#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
TAS1R1	80835	broad.mit.edu	37	1	6635143	6635143	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:6635143C>T	ENST00000333172.6	+	3	1144	c.951C>T	c.(949-951)cgC>cgT	p.R317R	TAS1R1_ENST00000328191.4_Silent_p.R317R|TAS1R1_ENST00000351136.3_Intron	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	317					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GGATCCAGCGCATTGGGATGG	0.642																																						uc001ant.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(949-951)CGC>CGT		sweet taste receptor T1r isoform b							34.0	39.0	37.0					1																	6635143		2203	4300	6503	SO:0001819	synonymous_variant	80835				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:6635143C>T		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.951C>T	1.37:g.6635143C>T			Somatic				TAS1R1_uc001anu.2_Intron|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_Silent_p.R317R	p.R317R	NM_138697	NP_619642	WXS	Illumina HiSeq	Unspecified	Q7RTX1	TS1R1_HUMAN		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)	3	951	+	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)	317			Extracellular (Potential).		B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	ENST00000333172.6	37	c.951C>T	CCDS81.1	.	.	.	.	.	.	.	.	.	.	C	0.203	-1.043282	0.01997	.	.	ENSG00000173662	ENST00000411823	.	.	.	5.4	4.43	0.53597	.	.	.	.	.	T	0.41903	0.1179	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.24870	-1.0148	4	.	.	.	.	12.2242	0.54451	0.0:0.79:0.1334:0.0767	.	.	.	.	V	243	.	.	A	+	2	0	TAS1R1	6557730	0.000000	0.05858	0.383000	0.26132	0.107000	0.19398	-0.517000	0.06275	2.497000	0.84241	0.655000	0.94253	GCA		0.642	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1			10	32	0	0	0	0	10	32				
VPS13D	55187	broad.mit.edu	37	1	12326995	12326995	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:12326995G>A	ENST00000358136.3	+	14	1782	c.1652G>A	c.(1651-1653)cGg>cAg	p.R551Q	VPS13D_ENST00000356315.4_Missense_Mutation_p.R551Q	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTTTCAGTCCGGTTGGGTGGA	0.388																																						uc001atv.2		NA																	0				ovary(4)|pancreas(1)	5						c.(1651-1653)CGG>CAG		vacuolar protein sorting 13D isoform 1							109.0	103.0	105.0					1																	12326995		2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12326995G>A	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.1652G>A	1.37:g.12326995G>A	ENSP00000350854:p.Arg551Gln		Somatic				VPS13D_uc001atw.2_Missense_Mutation_p.R551Q	p.R551Q	NM_015378	NP_056193	WXS	Illumina HiSeq	Unspecified	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	14	1793	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	551						Missense_Mutation	SNP	ENST00000358136.3	37	c.1652G>A	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672788	0.47781	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.44482	0.92;0.92	5.72	4.81	0.61882	.	0.272366	0.35466	N	0.003193	T	0.19604	0.0471	N	0.08118	0	0.80722	D	1	B;B	0.17852	0.024;0.005	B;B	0.06405	0.002;0.001	T	0.08249	-1.0731	10	0.15952	T	0.53	.	7.3871	0.26888	0.2545:0.0:0.7455:0.0	.	551;551	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	Q	551	ENSP00000348666:R551Q;ENSP00000350854:R551Q	ENSP00000348666:R551Q	R	+	2	0	VPS13D	12249582	1.000000	0.71417	0.908000	0.35775	0.966000	0.64601	5.134000	0.64770	1.422000	0.47177	0.655000	0.94253	CGG		0.388	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		16	35	0	0	0	0	16	35				
TMEM39B	55116	broad.mit.edu	37	1	32557499	32557499	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:32557499C>T	ENST00000336294.5	+	6	960	c.814C>T	c.(814-816)Cgc>Tgc	p.R272C	TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000373634.4_Missense_Mutation_p.R73C|TMEM39B_ENST00000427288.1_Missense_Mutation_p.R157C|TMEM39B_ENST00000456834.2_Missense_Mutation_p.P220L	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	272						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CAGCCTCATCCGCAGTGAGGT	0.597																																						uc010ogv.1		NA																	0					0						c.(814-816)CGC>TGC		transmembrane protein 39B							87.0	73.0	78.0					1																	32557499		2203	4300	6503	SO:0001583	missense	55116					integral to membrane		g.chr1:32557499C>T	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.814C>T	1.37:g.32557499C>T	ENSP00000338165:p.Arg272Cys		Somatic				TMEM39B_uc010ogt.1_RNA|TMEM39B_uc010ogu.1_Missense_Mutation_p.R145C|TMEM39B_uc001bue.3_Missense_Mutation_p.R273C|TMEM39B_uc001buf.3_Missense_Mutation_p.R73C|TMEM39B_uc010ogw.1_Missense_Mutation_p.R73C	p.R272C	NM_018056	NP_060526	WXS	Illumina HiSeq	Unspecified	Q9GZU3	TM39B_HUMAN			6	960	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)	272					B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Missense_Mutation	SNP	ENST00000336294.5	37	c.814C>T	CCDS351.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.321912|5.321912	0.95682|0.95682	.|.	.|.	ENSG00000121775|ENSG00000121775	ENST00000456834|ENST00000336294;ENST00000373634;ENST00000427288	.|.	.|.	.|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.098018	.|0.64402	.|D	.|0.000001	D|D	0.83760|0.83760	0.5324|0.5324	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.998	D|D	0.85001|0.85001	0.0900|0.0900	6|9	0.87932|0.87932	D|D	0|0	-22.8747|-22.8747	19.9499|19.9499	0.97195|0.97195	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|272;157;145	.|Q9GZU3;B4DTN8;Q9NW51	.|TM39B_HUMAN;.;.	L|C	220|272;73;157	.|.	ENSP00000390889:P192L|ENSP00000338165:R272C	P|R	+|+	2|1	0|0	TMEM39B|TMEM39B	32330086|32330086	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.374000|7.374000	0.79633|0.79633	2.806000|2.806000	0.96561|0.96561	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.597	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011489.2	NM_018056		5	49	0	0	0	0	5	49				
ELAVL4	1996	broad.mit.edu	37	1	50666696	50666696	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:50666696G>A	ENST00000371823.4	+	7	1213	c.989G>A	c.(988-990)cGt>cAt	p.R330H	ELAVL4_ENST00000371824.1_Missense_Mutation_p.R316H|ELAVL4_ENST00000371827.1_Missense_Mutation_p.R316H|ELAVL4_ENST00000371819.1_Missense_Mutation_p.R321H|ELAVL4_ENST00000371821.1_Missense_Mutation_p.R335H|ELAVL4_ENST00000448907.2_Missense_Mutation_p.R319H|ELAVL4_ENST00000357083.4_Missense_Mutation_p.R333H	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	330	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						AAGGTGATTCGTGACTTCAAC	0.542																																						uc001csb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(988-990)CGT>CAT		ELAV-like 4 isoform 1							128.0	114.0	119.0					1																	50666696		2203	4300	6503	SO:0001583	missense	1996				mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding	g.chr1:50666696G>A	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.989G>A	1.37:g.50666696G>A	ENSP00000360888:p.Arg330His		Somatic				ELAVL4_uc001cry.3_Missense_Mutation_p.R319H|ELAVL4_uc001crz.3_Missense_Mutation_p.R316H|ELAVL4_uc001csa.3_Missense_Mutation_p.R333H|ELAVL4_uc001csc.3_Missense_Mutation_p.R316H|ELAVL4_uc010omz.1_Missense_Mutation_p.R321H	p.R330H	NM_021952	NP_068771	WXS	Illumina HiSeq	Unspecified	P26378	ELAV4_HUMAN			7	1257	+			330			RRM 3.		B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Missense_Mutation	SNP	ENST00000371823.4	37	c.989G>A	CCDS553.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368347	0.61513	.	.	ENSG00000162374	ENST00000448907;ENST00000371827;ENST00000357083;ENST00000371824;ENST00000371823;ENST00000371821;ENST00000371819	T;T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21;3.21	6.07	5.16	0.70880	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.25269	0.0614	L	0.52759	1.655	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.77557	0.99;0.967;0.981;0.967;0.982;0.99	T	0.00970	-1.1496	10	0.72032	D	0.01	.	17.501	0.87732	0.0:0.124:0.876:0.0	.	321;316;330;333;316;319	B1APY9;P26378-2;P26378;P26378-3;P26378-4;B7Z4G7	.;.;ELAV4_HUMAN;.;.;.	H	319;316;333;316;330;335;321	ENSP00000399939:R319H;ENSP00000360892:R316H;ENSP00000349594:R333H;ENSP00000360889:R316H;ENSP00000360888:R330H;ENSP00000360886:R335H;ENSP00000360884:R321H	ENSP00000349594:R333H	R	+	2	0	ELAVL4	50439283	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	7.592000	0.82676	1.555000	0.49500	0.655000	0.94253	CGT		0.542	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952		10	68	0	0	0	0	10	68				
C1orf177	163747	broad.mit.edu	37	1	55282673	55282673	+	Silent	SNP	T	T	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:55282673T>A	ENST00000371273.3	+	9	1077	c.1062T>A	c.(1060-1062)ggT>ggA	p.G354G	C1orf177_ENST00000358193.3_Silent_p.G354G	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	354										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						ACCCAGTAGGTGTGGGCCGCT	0.572																																						uc001cyb.3		NA																	0					0						c.(1060-1062)GGT>GGA		hypothetical protein LOC163747 isoform 2							100.0	79.0	86.0					1																	55282673		2203	4300	6503	SO:0001819	synonymous_variant	163747							g.chr1:55282673T>A	AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.1062T>A	1.37:g.55282673T>A			Somatic				C1orf177_uc001cya.3_Silent_p.G354G	p.G354G	NM_001110533	NP_001104003	WXS	Illumina HiSeq	Unspecified	Q3ZCV2	CA177_HUMAN			9	1116	+			354					B7WPL2|Q8N7Y9	Silent	SNP	ENST00000371273.3	37	c.1062T>A	CCDS44153.1																																																																																				0.572	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027674.1	NM_152607		6	40	0	0	0	0	6	40				
C8A	731	broad.mit.edu	37	1	57351627	57351627	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:57351627A>T	ENST00000361249.3	+	7	979	c.883A>T	c.(883-885)Aag>Tag	p.K295*		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	295	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						AATCTTCACAAAGGTGCAGAC	0.368																																						uc001cyo.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(883-885)AAG>TAG		complement component 8, alpha polypeptide							71.0	67.0	69.0					1																	57351627		2203	4300	6503	SO:0001587	stop_gained	731				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex		g.chr1:57351627A>T	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.883A>T	1.37:g.57351627A>T	ENSP00000354458:p.Lys295*		Somatic					p.K295*	NM_000562	NP_000553	WXS	Illumina HiSeq	Unspecified	P07357	CO8A_HUMAN			7	1015	+			295			MACPF.		A2RUI4|A2RUI5|Q13668|Q9H130	Nonsense_Mutation	SNP	ENST00000361249.3	37	c.883A>T	CCDS606.1	.	.	.	.	.	.	.	.	.	.	A	39	7.323547	0.98210	.	.	ENSG00000157131	ENST00000361249	.	.	.	5.95	5.95	0.96441	.	0.082792	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-36.679	16.4101	0.83708	1.0:0.0:0.0:0.0	.	.	.	.	X	295	.	ENSP00000354458:K295X	K	+	1	0	C8A	57124215	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.600000	0.67599	2.280000	0.76307	0.460000	0.39030	AAG		0.368	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562		20	29	0	0	0	0	20	29				
DAB1	1600	broad.mit.edu	37	1	57611078	57611078	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:57611078A>G	ENST00000371231.1	-	2	126	c.92T>C	c.(91-93)tTg>tCg	p.L31S	DAB1_ENST00000439789.2_Missense_Mutation_p.L31S|DAB1_ENST00000371236.2_Missense_Mutation_p.L31S|DAB1_ENST00000371234.4_Missense_Mutation_p.L31S|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371230.1_Missense_Mutation_p.L31S|DAB1_ENST00000414851.2_Missense_Mutation_p.L31S|DAB1_ENST00000420954.2_Missense_Mutation_p.L31S			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	31					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CCTCTTTATCAAAGTGGCTTC	0.443																																						uc001cys.1		NA																	0				skin(2)|ovary(1)	3						c.(91-93)TTG>TCG		disabled homolog 1							115.0	105.0	109.0					1																	57611078		2203	4300	6503	SO:0001583	missense	1600				cell differentiation|nervous system development			g.chr1:57611078A>G	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.92T>C	1.37:g.57611078A>G	ENSP00000360275:p.Leu31Ser		Somatic				DAB1_uc001cyt.1_Missense_Mutation_p.L31S|DAB1_uc001cyq.1_Missense_Mutation_p.L31S|DAB1_uc001cyr.1_Missense_Mutation_p.L31S|DAB1_uc009vzw.1_Missense_Mutation_p.L31S|DAB1_uc009vzx.1_Missense_Mutation_p.L31S	p.L31S	NM_021080	NP_066566	WXS	Illumina HiSeq	Unspecified	O75553	DAB1_HUMAN			5	766	-			31					A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37	c.92T>C		.	.	.	.	.	.	.	.	.	.	A	24.0	4.484977	0.84854	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231;ENST00000371232;ENST00000332102;ENST00000371230	T;T;T;T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;1.71;-0.04;0.77;-0.04;-0.04	5.73	5.73	0.89815	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.77718	0.4172	M	0.72118	2.19	0.27928	N	0.938001	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.99;1.0	D;D;D;D;D	0.97110	1.0;0.996;0.998;0.988;0.999	T	0.72250	-0.4348	10	0.33940	T	0.23	-15.7393	16.0267	0.80550	1.0:0.0:0.0:0.0	.	31;31;31;31;31	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	S	31	ENSP00000360280:L31S;ENSP00000360278:L31S;ENSP00000395296:L31S;ENSP00000387581:L31S;ENSP00000409328:L31S;ENSP00000360275:L31S;ENSP00000360276:L31S;ENSP00000329120:L31S;ENSP00000360274:L31S	ENSP00000329120:L31S	L	-	2	0	DAB1	57383666	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.335000	0.96500	2.170000	0.68504	0.533000	0.62120	TTG		0.443	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		5	47	0	0	0	0	5	47				
COL24A1	255631	broad.mit.edu	37	1	86529426	86529426	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:86529426G>C	ENST00000370571.2	-	8	2090	c.1724C>G	c.(1723-1725)cCt>cGt	p.P575R	COL24A1_ENST00000436319.1_Missense_Mutation_p.P575R	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	575	Collagen-like 2.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TGGGAGTCCAGGATGTCCTTT	0.383																																						uc001dlj.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1723-1725)CCT>CGT		collagen, type XXIV, alpha 1 precursor							136.0	129.0	131.0					1																	86529426		1830	4090	5920	SO:0001583	missense	255631				cell adhesion	collagen	extracellular matrix structural constituent	g.chr1:86529426G>C	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1724C>G	1.37:g.86529426G>C	ENSP00000359603:p.Pro575Arg		Somatic				COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.P575R	p.P575R	NM_152890	NP_690850	WXS	Illumina HiSeq	Unspecified	Q17RW2	COOA1_HUMAN		all cancers(265;0.0627)|Epithelial(280;0.0689)	8	1766	-			575			Collagen-like 2.		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	c.1724C>G	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	G	8.847	0.943576	0.18281	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.96685	-4.09;-3.71	5.52	3.6	0.41247	.	0.219003	0.23226	N	0.050519	D	0.94515	0.8234	M	0.63169	1.94	0.35218	D	0.775764	B;P	0.46859	0.367;0.885	B;P	0.53760	0.114;0.734	D	0.93184	0.6577	10	0.56958	D	0.05	.	7.2786	0.26297	0.1457:0.0:0.7176:0.1367	.	575;575	F8WDM8;Q17RW2	.;COOA1_HUMAN	R	575	ENSP00000359603:P575R;ENSP00000392531:P575R	ENSP00000359603:P575R	P	-	2	0	COL24A1	86302014	1.000000	0.71417	0.963000	0.40424	0.961000	0.63080	1.818000	0.39012	0.762000	0.33152	0.467000	0.42956	CCT		0.383	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890		20	103	0	0	0	0	20	103				
COL11A1	1301	broad.mit.edu	37	1	103491099	103491099	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:103491099C>T	ENST00000370096.3	-	7	1280	c.968G>A	c.(967-969)aGg>aAg	p.R323K	COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000358392.2_Missense_Mutation_p.R335K|COL11A1_ENST00000353414.4_Missense_Mutation_p.R284K	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	323	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGAAACATGCCTAGGAGCTTC	0.328																																						uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(967-969)AGG>AAG		alpha 1 type XI collagen isoform A							139.0	132.0	134.0					1																	103491099		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103491099C>T	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.968G>A	1.37:g.103491099C>T	ENSP00000359114:p.Arg323Lys		Somatic				COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.R335K|COL11A1_uc001dun.2_Missense_Mutation_p.R284K|COL11A1_uc009weh.2_Intron	p.R323K	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	7	1286	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	323			Nonhelical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.968G>A	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	4.122	0.020788	0.08006	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000427239	D;T;D;T	0.87334	-2.24;-0.56;-2.23;-0.48	5.23	4.3	0.51218	.	0.328915	0.33553	N	0.004790	T	0.66906	0.2837	L	0.55103	1.725	0.09310	N	1	B;B;B	0.19200	0.034;0.034;0.02	B;B;B	0.19946	0.027;0.027;0.012	T	0.53878	-0.8376	10	0.06494	T	0.89	.	10.7335	0.46111	0.1262:0.6188:0.255:0.0	.	284;335;323	P12107-3;P12107-2;P12107	.;.;COBA1_HUMAN	K	323;335;284;335	ENSP00000359114:R323K;ENSP00000351163:R335K;ENSP00000302551:R284K;ENSP00000408640:R335K	ENSP00000302551:R284K	R	-	2	0	COL11A1	103263687	0.000000	0.05858	0.658000	0.29665	0.921000	0.55340	0.374000	0.20501	1.296000	0.44742	0.637000	0.83480	AGG		0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		6	47	0	0	0	0	6	47				
AMY2B	280	broad.mit.edu	37	1	104115869	104115869	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:104115869A>G	ENST00000361355.4	+	5	1116	c.500A>G	c.(499-501)aAt>aGt	p.N167S	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	167					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GAGAACTACAATGATGCTACT	0.358																																						uc001duq.2		NA																	0					0						c.(499-501)AAT>AGT		amylase, pancreatic, alpha-2B precursor							200.0	213.0	209.0					1																	104115869		2203	4300	6503	SO:0001583	missense	280				carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding	g.chr1:104115869A>G	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.500A>G	1.37:g.104115869A>G	ENSP00000354610:p.Asn167Ser		Somatic				AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.N167S|AMY2B_uc001dus.1_5'Flank	p.N167S	NM_020978	NP_066188	WXS	Illumina HiSeq	Unspecified	P19961	AMY2B_HUMAN		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)	5	1116	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	167					B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	ENST00000361355.4	37	c.500A>G	CCDS782.1	.	.	.	.	.	.	.	.	.	.	A	8.205	0.799017	0.16397	.	.	ENSG00000240038	ENST00000361355	D	0.98164	-4.76	4.58	0.795	0.18643	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	1.396940	0.03849	N	0.272012	D	0.92681	0.7674	L	0.42632	1.34	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.86513	0.1811	10	0.56958	D	0.05	.	6.2255	0.20706	0.6037:0.1265:0.2698:0.0	.	167	P19961	AMY2B_HUMAN	S	167	ENSP00000354610:N167S	ENSP00000354610:N167S	N	+	2	0	AMY2B	103917392	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.827000	0.27421	0.150000	0.19136	0.524000	0.50904	AAT		0.358	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030318.1	NM_020978		43	352	0	0	0	0	43	352				
HSD3B2	3284	broad.mit.edu	37	1	119962178	119962178	+	Missense_Mutation	SNP	G	G	A	rs6211	byFrequency	TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:119962178G>A	ENST00000543831.1	+	3	529	c.280G>A	c.(280-282)Gag>Aag	p.E94K	HSD3B2_ENST00000369416.3_Missense_Mutation_p.E94K|HSD3B2_ENST00000471656.1_3'UTR	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	94			E -> Q (in dbSNP:rs6211). {ECO:0000269|PubMed:17974005}.	HRE -> RRQ (in Ref. 8; AAD14329). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	CACTCACAGAGAGTCCATCAT	0.463																																						uc001ehs.2		NA																	0				ovary(2)	2						c.(280-282)GAG>AAG		3 beta-hydroxysteroid dehydrogenase 2	NADH(DB00157)|Trilostane(DB01108)						107.0	88.0	94.0					1																	119962178		2203	4300	6503	SO:0001583	missense	3284				androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity	g.chr1:119962178G>A	BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.280G>A	1.37:g.119962178G>A	ENSP00000445122:p.Glu94Lys		Somatic				HSD3B2_uc001eht.2_Missense_Mutation_p.E94K|HSD3B2_uc001ehu.2_Missense_Mutation_p.E94K	p.E94K	NM_000198	NP_000189	WXS	Illumina HiSeq	Unspecified	P26439	3BHS2_HUMAN		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	2	1053	+	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)	94	HRE -> RRQ (in Ref. 8; AAD14329).				A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	ENST00000543831.1	37	c.280G>A	CCDS902.1	.	.	.	.	.	.	.	.	.	.	-	14.33	2.501897	0.44455	.	.	ENSG00000203859	ENST00000543831;ENST00000433745;ENST00000369416	D;D;D	0.84944	-1.92;-1.92;-1.92	3.93	1.84	0.25277	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.582830	0.19069	N	0.123552	T	0.66645	0.2810	L	0.55481	1.735	0.09310	N	1	B;B	0.27068	0.123;0.167	B;B	0.30572	0.026;0.117	T	0.57382	-0.7821	9	.	.	.	-22.4798	8.6403	0.33972	0.0975:0.5656:0.337:0.0	.	94;94	P26439-2;P26439	.;3BHS2_HUMAN	K	94	ENSP00000445122:E94K;ENSP00000388292:E94K;ENSP00000358424:E94K	.	E	+	1	0	HSD3B2	119763701	0.891000	0.30450	0.003000	0.11579	0.559000	0.35586	1.803000	0.38863	0.182000	0.20032	0.298000	0.19748	GAG		0.463	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034994.1	NM_000198		6	56	0	0	0	0	6	56				
PIAS3	10401	broad.mit.edu	37	1	145581554	145581554	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:145581554A>G	ENST00000393045.2	+	9	1225	c.1135A>G	c.(1135-1137)Atc>Gtc	p.I379V	PIAS3_ENST00000369298.1_Missense_Mutation_p.I344V	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	379					positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGAATCTCTTATCATTGATGG	0.403																																						uc001eoc.1		NA																	0				ovary(1)	1						c.(1135-1137)ATC>GTC		protein inhibitor of activated STAT, 3							160.0	146.0	151.0					1																	145581554		2203	4300	6503	SO:0001583	missense	10401				positive regulation of protein sumoylation|protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	enzyme binding|nucleic acid binding|protein C-terminus binding|zinc ion binding	g.chr1:145581554A>G	AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.1135A>G	1.37:g.145581554A>G	ENSP00000376765:p.Ile379Val		Somatic				NBPF10_uc001emp.3_Intron|PIAS3_uc001eod.1_Missense_Mutation_p.I48V	p.I379V	NM_006099	NP_006090	WXS	Illumina HiSeq	Unspecified	Q9Y6X2	PIAS3_HUMAN			9	1226	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		379			SP-RING-type.		Q9UFI3	Missense_Mutation	SNP	ENST00000393045.2	37	c.1135A>G	CCDS920.2	.	.	.	.	.	.	.	.	.	.	a	11.03	1.519334	0.27211	.	.	ENSG00000131788	ENST00000393045;ENST00000369298	T;T	0.34275	1.37;1.42	5.86	4.54	0.55810	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, MIZ-type (1);	0.095580	0.43579	D	0.000560	T	0.09423	0.0232	N	0.13003	0.285	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10660	-1.0620	10	0.22109	T	0.4	-16.6739	10.2086	0.43128	0.9099:0.0:0.0901:0.0	.	379	Q9Y6X2	PIAS3_HUMAN	V	379;344	ENSP00000376765:I379V;ENSP00000358304:I344V	ENSP00000358304:I344V	I	+	1	0	PIAS3	144292911	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.170000	0.71920	2.234000	0.73211	0.529000	0.55759	ATC		0.403	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099		14	89	0	0	0	0	14	89				
THEM5	284486	broad.mit.edu	37	1	151824868	151824868	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:151824868G>A	ENST00000368817.5	-	2	322	c.191C>T	c.(190-192)tCg>tTg	p.S64L	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	64					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGCATGTCCGAACACCAGCT	0.493																																						uc009wnd.2		NA																	0				ovary(1)|skin(1)	2						c.(190-192)TCG>TTG		thioesterase superfamily member 5							134.0	131.0	132.0					1																	151824868		2203	4300	6503	SO:0001583	missense	284486						hydrolase activity	g.chr1:151824868G>A	AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.191C>T	1.37:g.151824868G>A	ENSP00000357807:p.Ser64Leu		Somatic					p.S64L	NM_182578	NP_872384	WXS	Illumina HiSeq	Unspecified	Q8N1Q8	THEM5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.181)		2	323	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		64					Q5T1C3	Missense_Mutation	SNP	ENST00000368817.5	37	c.191C>T	CCDS1005.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.53|13.53	2.263351|2.263351	0.39995|0.39995	.|.	.|.	ENSG00000196407|ENSG00000196407	ENST00000453881|ENST00000368817	.|T	.|0.23147	.|1.92	5.28|5.28	4.36|4.36	0.52297|0.52297	.|.	.|0.265445	.|0.37136	.|N	.|0.002230	T|T	0.06962|0.06962	0.0177|0.0177	L|L	0.36672|0.36672	1.1|1.1	0.25996|0.25996	N|N	0.982181|0.982181	.|P	.|0.40398	.|0.716	.|B	.|0.24269	.|0.052	T|T	0.05370|0.05370	-1.0889|-1.0889	5|10	.|0.62326	.|D	.|0.03	-9.5925|-9.5925	12.9606|12.9606	0.58455|0.58455	0.0854:0.0:0.9146:0.0|0.0854:0.0:0.9146:0.0	.|.	.|64	.|Q8N1Q8	.|THEM5_HUMAN	W|L	11|64	.|ENSP00000357807:S64L	.|ENSP00000357807:S64L	R|S	-|-	1|2	2|0	THEM5|THEM5	150091492|150091492	0.993000|0.993000	0.37304|0.37304	0.937000|0.937000	0.37676|0.37676	0.252000|0.252000	0.25951|0.25951	2.216000|2.216000	0.42871|0.42871	0.626000|0.626000	0.30322|0.30322	-0.797000|-0.797000	0.03246|0.03246	CGG|TCG		0.493	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036678.2	NM_182578		20	117	0	0	0	0	20	117				
RPTN	126638	broad.mit.edu	37	1	152128610	152128610	+	Missense_Mutation	SNP	G	G	A	rs527782408	byFrequency	TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:152128610G>A	ENST00000316073.3	-	3	1029	c.965C>T	c.(964-966)aCg>aTg	p.T322M		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	322	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TTGTCTGTCCGTCTGACTGTA	0.498													g|||	2	0.000399361	0.0	0.0	5008	,	,		23885	0.0		0.0	False		,,,				2504	0.002					uc001ezs.1		NA																	0					0						c.(964-966)ACG>ATG		repetin							737.0	643.0	672.0					1																	152128610		1568	3582	5150	SO:0001583	missense	126638					proteinaceous extracellular matrix	calcium ion binding	g.chr1:152128610G>A	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.965C>T	1.37:g.152128610G>A	ENSP00000317895:p.Thr322Met		Somatic					p.T322M	NM_001122965	NP_001116437	WXS	Illumina HiSeq	Unspecified	Q6XPR3	RPTN_HUMAN			3	1030	-			322			Gln-rich.		B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	c.965C>T	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	g	10.99	1.508094	0.27036	.	.	ENSG00000215853	ENST00000316073	T	0.14022	2.54	4.56	-0.989	0.10242	.	2.572970	0.02997	U	0.147594	T	0.02533	0.0077	L	0.39514	1.22	0.09310	N	1	P	0.45428	0.858	B	0.27170	0.077	T	0.38045	-0.9679	10	0.46703	T	0.11	.	4.9317	0.13921	0.331:0.0:0.5328:0.1362	.	322	Q6XPR3	RPTN_HUMAN	M	322	ENSP00000317895:T322M	ENSP00000317895:T322M	T	-	2	0	RPTN	150395234	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.050000	0.14120	-0.550000	0.06183	-2.458000	0.00206	ACG		0.498	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312		13	854	0	0	0	0	13	854				
FCRL6	343413	broad.mit.edu	37	1	159785428	159785428	+	Missense_Mutation	SNP	G	G	A	rs146779081	byFrequency	TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:159785428G>A	ENST00000368106.3	+	10	1283	c.1282G>A	c.(1282-1284)Gac>Aac	p.D428N	FCRL6_ENST00000321935.6_3'UTR|FCRL6_ENST00000339348.5_3'UTR	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	428						external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					ACCCCTTAGCGACTGTGAGGA	0.547																																						uc001fud.3		NA																	0				ovary(2)|skin(1)	3						c.(1282-1284)GAC>AAC		Fc receptor-like 6 precursor		G	ASN/ASP	0,4406		0,0,2203	87.0	87.0	87.0		1282	-3.2	0.0	1	dbSNP_134	87	2,8598	2.2+/-6.3	0,2,4298	yes	missense	FCRL6	NM_001004310.2	23	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	428/435	159785428	2,13004	2203	4300	6503	SO:0001583	missense	343413					integral to membrane		g.chr1:159785428G>A	AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.1282G>A	1.37:g.159785428G>A	ENSP00000357086:p.Asp428Asn		Somatic				FCRL6_uc001fuc.2_3'UTR|FCRL6_uc009wsz.1_3'UTR|FCRL6_uc009wta.2_3'UTR	p.D428N	NM_001004310	NP_001004310	WXS	Illumina HiSeq	Unspecified	Q6DN72	FCRL6_HUMAN			10	1324	+	all_hematologic(112;0.0597)		428			Cytoplasmic (Potential).		A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	ENST00000368106.3	37	c.1282G>A	CCDS30912.1	.	.	.	.	.	.	.	.	.	.	G	9.023	0.985353	0.18889	0.0	2.33E-4	ENSG00000181036	ENST00000368106	T	0.01279	5.06	3.87	-3.21	0.05140	.	.	.	.	.	T	0.00241	0.0007	N	0.14661	0.345	0.09310	N	1	B	0.19331	0.035	B	0.13407	0.009	T	0.42310	-0.9459	9	0.18710	T	0.47	.	0.7582	0.01002	0.1863:0.2898:0.2462:0.2777	.	428	Q6DN72	FCRL6_HUMAN	N	428	ENSP00000357086:D428N	ENSP00000357086:D428N	D	+	1	0	FCRL6	158052052	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.606000	0.05654	-0.652000	0.05408	0.491000	0.48974	GAC		0.547	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276853.1	NM_001004310		10	46	0	0	0	0	10	46				
EPRS	2058	broad.mit.edu	37	1	220153465	220153465	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:220153465T>C	ENST00000366923.3	-	26	3942	c.3673A>G	c.(3673-3675)Ata>Gta	p.I1225V		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1225	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	AATGCTTCTATTGTAGTTGTA	0.408																																						uc001hly.1		NA																	0				ovary(1)|skin(1)	2						c.(3673-3675)ATA>GTA		glutamyl-prolyl tRNA synthetase	L-Glutamic Acid(DB00142)|L-Proline(DB00172)						259.0	238.0	245.0					1																	220153465		2203	4300	6503	SO:0001583	missense	2058				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding	g.chr1:220153465T>C	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3673A>G	1.37:g.220153465T>C	ENSP00000355890:p.Ile1225Val		Somatic					p.I1225V	NM_004446	NP_004437	WXS	Illumina HiSeq	Unspecified	P07814	SYEP_HUMAN		GBM - Glioblastoma multiforme(131;0.0735)	26	3943	-			1225			Prolyl-tRNA synthetase.		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	c.3673A>G	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	T	0.118	-1.129067	0.01756	.	.	ENSG00000136628	ENST00000366923	T	0.32272	1.46	5.96	-8.44	0.00950	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.496807	0.23477	N	0.047753	T	0.05640	0.0148	N	0.01761	-0.735	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.23226	-1.0194	10	0.02654	T	1	-3.2795	4.1451	0.10212	0.0794:0.346:0.1561:0.4184	.	1225	P07814	SYEP_HUMAN	V	1225	ENSP00000355890:I1225V	ENSP00000355890:I1225V	I	-	1	0	EPRS	218220088	0.000000	0.05858	0.000000	0.03702	0.564000	0.35744	-0.073000	0.11468	-2.321000	0.00641	-3.072000	0.00067	ATA		0.408	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446		11	118	0	0	0	0	11	118				
PARP1	142	broad.mit.edu	37	1	226552719	226552719	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:226552719G>A	ENST00000366794.5	-	19	2785	c.2642C>T	c.(2641-2643)cCg>cTg	p.P881L	PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	881	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CGCTTCAGGCGGGGCTATCCG	0.567								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														uc001hqd.3		NA																	0				lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10						c.(2641-2643)CCG>CTG	Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA	poly (ADP-ribose) polymerase family, member 1							56.0	59.0	58.0					1																	226552719		2203	4300	6503	SO:0001583	missense	142				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding	g.chr1:226552719G>A	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2642C>T	1.37:g.226552719G>A	ENSP00000355759:p.Pro881Leu		Somatic					p.P881L	NM_001618	NP_001609	WXS	Illumina HiSeq	Unspecified	P09874	PARP1_HUMAN		GBM - Glioblastoma multiforme(131;0.0531)	19	2813	-	Breast(184;0.133)		881			PARP catalytic.		B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	37	c.2642C>T	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	G	33	5.228568	0.95173	.	.	ENSG00000143799	ENST00000366794	T	0.13420	2.59	5.84	5.84	0.93424	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.092852	0.85682	D	0.000000	T	0.50497	0.1619	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.60616	-0.7228	10	0.87932	D	0	.	20.1379	0.98040	0.0:0.0:1.0:0.0	.	881	P09874	PARP1_HUMAN	L	881	ENSP00000355759:P881L	ENSP00000355759:P881L	P	-	2	0	PARP1	224619342	1.000000	0.71417	0.962000	0.40283	0.801000	0.45260	9.837000	0.99465	2.779000	0.95612	0.655000	0.94253	CCG		0.567	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618		4	90	0	0	0	0	4	90				
SNAP47	116841	broad.mit.edu	37	1	227935683	227935683	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:227935683C>T	ENST00000366759.4	+	2	795	c.381C>T	c.(379-381)tcC>tcT	p.S127S	SNAP47_ENST00000315781.5_Silent_p.S127S|SNAP47_ENST00000366760.1_Intron|SNAP47-AS1_ENST00000413347.2_RNA	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	127					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GGTTCAGCTCCCTGCGGCCAA	0.547																																						uc001hrf.2		NA																	0				ovary(1)	1						c.(379-381)TCC>TCT		synaptosomal-associated protein, 47kDa							95.0	91.0	92.0					1																	227935683		2203	4300	6503	SO:0001819	synonymous_variant	116841					endomembrane system|membrane|perinuclear region of cytoplasm		g.chr1:227935683C>T	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.381C>T	1.37:g.227935683C>T			Somatic				SNAP47_uc001hqz.2_Silent_p.S82S|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_Silent_p.S127S|SNAP47_uc001hre.2_Intron|SNAP47_uc001hrg.1_Silent_p.S82S	p.S127S	NM_053052	NP_444280	WXS	Illumina HiSeq	Unspecified	Q5SQN1	SNP47_HUMAN			2	795	+			127					B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Silent	SNP	ENST00000366759.4	37	c.381C>T	CCDS1562.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.240733	0.22711	.	.	ENSG00000143740	ENST00000426344	.	.	.	4.35	2.4	0.29515	.	.	.	.	.	T	0.54255	0.1847	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44190	-0.9344	4	.	.	.	-7.24	6.2465	0.20820	0.1919:0.7064:0.0:0.1016	.	.	.	.	S	119	.	.	P	+	1	0	SNAP47	226002306	0.925000	0.31364	0.996000	0.52242	0.940000	0.58332	0.042000	0.13949	0.431000	0.26258	0.591000	0.81541	CCT		0.547	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052		8	90	0	0	0	0	8	90				
GNPAT	8443	broad.mit.edu	37	1	231396372	231396372	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:231396372C>A	ENST00000366647.4	+	3	550	c.381C>A	c.(379-381)agC>agA	p.S127R	GNPAT_ENST00000366646.3_Missense_Mutation_p.S66R	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	127					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TCACCCTGAGCAAAGTATTTA	0.363																																						uc001hup.3		NA																	0				ovary(3)|breast(1)	4						c.(379-381)AGC>AGA		glyceronephosphate O-acyltransferase							199.0	208.0	205.0					1																	231396372		2203	4300	6503	SO:0001583	missense	8443				ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity	g.chr1:231396372C>A	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.381C>A	1.37:g.231396372C>A	ENSP00000355607:p.Ser127Arg		Somatic				GNPAT_uc009xfo.1_Missense_Mutation_p.S18R|GNPAT_uc009xfp.2_Missense_Mutation_p.S66R	p.S127R	NM_014236	NP_055051	WXS	Illumina HiSeq	Unspecified	O15228	GNPAT_HUMAN			3	587	+	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)	127					B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	ENST00000366647.4	37	c.381C>A	CCDS1592.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551102	0.27739	.	.	ENSG00000116906	ENST00000436239;ENST00000366647;ENST00000366646;ENST00000416000	D;D;D;T	0.92545	-3.06;-3.06;-3.06;-0.09	5.6	1.05	0.20165	.	0.000000	0.85682	D	0.000000	D	0.86585	0.5968	L	0.54323	1.7	0.58432	D	0.999999	P;B	0.34462	0.454;0.112	B;B	0.31547	0.132;0.05	T	0.79864	-0.1623	10	0.41790	T	0.15	-17.488	7.2212	0.25988	0.0:0.6021:0.1192:0.2786	.	66;127	B4DNM9;O15228	.;GNPAT_HUMAN	R	66;127;66;127	ENSP00000402811:S66R;ENSP00000355607:S127R;ENSP00000355606:S66R;ENSP00000411640:S127R	ENSP00000355606:S66R	S	+	3	2	GNPAT	229462995	1.000000	0.71417	0.993000	0.49108	0.424000	0.31475	1.624000	0.37018	0.320000	0.23234	0.462000	0.41574	AGC		0.363	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1			29	233	1	0	2.85e-18	5.15e-18	29	233				
RYR2	6262	broad.mit.edu	37	1	237659856	237659856	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:237659856G>A	ENST00000366574.2	+	20	2324	c.2007G>A	c.(2005-2007)caG>caA	p.Q669Q	RYR2_ENST00000542537.1_Silent_p.Q653Q|RYR2_ENST00000360064.6_Silent_p.Q667Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	669	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTTCTGCTCAGTATAAGAAAT	0.448																																						uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(2005-2007)CAG>CAA		cardiac muscle ryanodine receptor							78.0	81.0	80.0					1																	237659856		1893	4108	6001	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237659856G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2007G>A	1.37:g.237659856G>A			Somatic					p.Q669Q	NM_001035	NP_001026	WXS	Illumina HiSeq	Unspecified	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		20	2127	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	669			Cytoplasmic (By similarity).|B30.2/SPRY 1.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.2007G>A	CCDS55691.1																																																																																				0.448	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		13	59	0	0	0	0	13	59				
AKT3	10000	broad.mit.edu	37	1	243708856	243708856	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:243708856T>C	ENST00000366539.1	-	12	1407	c.1207A>G	c.(1207-1209)Agt>Ggt	p.S403G	RP11-269F20.1_ENST00000439849.1_RNA|AKT3_ENST00000366540.1_Missense_Mutation_p.S403G|AKT3_ENST00000263826.5_Missense_Mutation_p.S403G|AKT3_ENST00000336199.5_Missense_Mutation_p.S403G			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	403	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			GAGAAGAAACTGTGTCTCATA	0.328																																						uc001iab.1		NA																	0				stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(1207-1209)AGT>GGT		AKT3 kinase isoform 1							112.0	109.0	110.0					1																	243708856		2203	4298	6501	SO:0001583	missense	10000				signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:243708856T>C	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.1207A>G	1.37:g.243708856T>C	ENSP00000355497:p.Ser403Gly		Somatic				AKT3_uc001hzz.1_Missense_Mutation_p.S403G	p.S403G	NM_005465	NP_005456	WXS	Illumina HiSeq	Unspecified	Q9Y243	AKT3_HUMAN	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)		11	1288	-	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	403			Protein kinase.		Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	ENST00000366539.1	37	c.1207A>G	CCDS31077.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087142	0.55968	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	L	0.45422	1.42	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.004;0.005	T	0.12293	-1.0553	10	0.39692	T	0.17	.	12.1554	0.54074	0.0:0.0:0.1426:0.8574	.	403;403	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	G	403	ENSP00000336943:S403G;ENSP00000355498:S403G;ENSP00000355497:S403G;ENSP00000263826:S403G	ENSP00000263826:S403G	S	-	1	0	AKT3	241775479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.193000	0.72075	2.244000	0.73946	0.528000	0.53228	AGT		0.328	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690		8	54	0	0	0	0	8	54				
OR2L3	391192	broad.mit.edu	37	1	248223987	248223987	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:248223987G>T	ENST00000359959.3	+	1	4	c.4G>T	c.(4-6)Gaa>Taa	p.E2*	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ATGCCCCATGGAAAATTACAA	0.408																																						uc001idx.1		NA																	0					0						c.(4-6)GAA>TAA		olfactory receptor, family 2, subfamily L,							157.0	156.0	157.0					1																	248223987		2203	4299	6502	SO:0001587	stop_gained	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248223987G>T	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.4G>T	1.37:g.248223987G>T	ENSP00000353044:p.Glu2*		Somatic				OR2L13_uc001ids.2_Intron	p.E2*	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	4	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		2			Extracellular (Potential).		B9EH44	Nonsense_Mutation	SNP	ENST00000359959.3	37	c.4G>T	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	16.35	3.099108	0.56183	.	.	ENSG00000198128	ENST00000359959	.	.	.	2.05	-0.123	0.13527	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	1.666	0.02802	0.3069:0.0:0.3861:0.307	.	.	.	.	X	2	.	ENSP00000353044:E2X	E	+	1	0	OR2L3	246290610	0.134000	0.22483	0.011000	0.14972	0.139000	0.21198	0.850000	0.27737	0.150000	0.19136	0.462000	0.41574	GAA		0.408	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		30	119	1	0	5.77e-19	1.05e-18	30	119				
OR2L3	391192	broad.mit.edu	37	1	248224181	248224181	+	Silent	SNP	C	C	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:248224181C>G	ENST00000359959.3	+	1	198	c.198C>G	c.(196-198)tcC>tcG	p.S66S	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GTCAGCTCTCCCTCATTGACC	0.423																																						uc001idx.1		NA																	0					0						c.(196-198)TCC>TCG		olfactory receptor, family 2, subfamily L,							319.0	299.0	306.0					1																	248224181		2203	4297	6500	SO:0001819	synonymous_variant	391192				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248224181C>G	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.198C>G	1.37:g.248224181C>G			Somatic				OR2L13_uc001ids.2_Intron	p.S66S	NM_001004687	NP_001004687	WXS	Illumina HiSeq	Unspecified	Q8NG85	OR2L3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)		1	198	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		66			Helical; Name=2; (Potential).		B9EH44	Silent	SNP	ENST00000359959.3	37	c.198C>G	CCDS31104.1																																																																																				0.423	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687		39	326	0	0	0	0	39	326				
ADARB2	105	broad.mit.edu	37	10	1405839	1405839	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr10:1405839G>T	ENST00000381312.1	-	3	786	c.461C>A	c.(460-462)cCg>cAg	p.P154Q	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	154	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CGCGAAGACCGGGGCATGCAC	0.692																																						uc009xhq.2		NA																	0				large_intestine(2)|central_nervous_system(1)	3						c.(460-462)CCG>CAG		adenosine deaminase, RNA-specific, B2							33.0	29.0	31.0					10																	1405839		2203	4299	6502	SO:0001583	missense	105				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding	g.chr10:1405839G>T	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.461C>A	10.37:g.1405839G>T	ENSP00000370713:p.Pro154Gln		Somatic					p.P154Q	NM_018702	NP_061172	WXS	Illumina HiSeq	Unspecified	Q9NS39	RED2_HUMAN		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)	3	835	-		all_epithelial(10;0.059)|Colorectal(49;0.0815)	154			DRBM 1.		B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	37	c.461C>A	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	g	29.2	4.985066	0.93044	.	.	ENSG00000185736	ENST00000381312	T	0.78246	-1.16	5.27	5.27	0.74061	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.050026	0.85682	D	0.000000	D	0.86343	0.5910	L	0.54965	1.715	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87494	0.2429	10	0.87932	D	0	-23.8728	18.9207	0.92523	0.0:0.0:1.0:0.0	.	154	Q9NS39	RED2_HUMAN	Q	154	ENSP00000370713:P154Q	ENSP00000370713:P154Q	P	-	2	0	ADARB2	1395839	1.000000	0.71417	0.984000	0.44739	0.970000	0.65996	9.724000	0.98775	2.463000	0.83235	0.651000	0.88453	CCG		0.692	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702		3	28	1	0	0.00024832	0.000390122	3	28				
ACBD5	91452	broad.mit.edu	37	10	27493384	27493384	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr10:27493384T>C	ENST00000375888.1	-	12	1641	c.1577A>G	c.(1576-1578)tAt>tGt	p.Y526C	ACBD5_ENST00000375897.3_Missense_Mutation_p.Y340C|ACBD5_ENST00000375901.1_Missense_Mutation_p.Y408C|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375905.4_Missense_Mutation_p.Y482C|ACBD5_ENST00000396271.3_Missense_Mutation_p.Y517C			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	526					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CCTTCTTTGATAGTATAAATA	0.413																																						uc010qdp.1		NA																	0					0						c.(1549-1551)TAT>TGT		acyl-Coenzyme A binding domain containing 5							88.0	82.0	84.0					10																	27493384		2203	4300	6503	SO:0001583	missense	91452				transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding	g.chr10:27493384T>C	AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1577A>G	10.37:g.27493384T>C	ENSP00000365049:p.Tyr526Cys		Somatic				ACBD5_uc010qdm.1_Missense_Mutation_p.Y515C|ACBD5_uc010qdn.1_Missense_Mutation_p.Y408C|ACBD5_uc010qdo.1_Missense_Mutation_p.Y340C|ACBD5_uc001ito.2_Missense_Mutation_p.Y482C|ACBD5_uc001itp.2_Missense_Mutation_p.Y408C|ACBD5_uc001itq.2_Missense_Mutation_p.Y408C|ACBD5_uc001itr.1_Missense_Mutation_p.Y306C	p.Y517C	NM_145698	NP_663736	WXS	Illumina HiSeq	Unspecified	Q5T8D3	ACBD5_HUMAN			12	1741	-			526			Helical; (Potential).		B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	ENST00000375888.1	37	c.1550A>G		.	.	.	.	.	.	.	.	.	.	T	17.37	3.372360	0.61624	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	T;T;T;T;T	0.31769	2.5;2.25;1.49;1.48;2.5	5.58	5.58	0.84498	.	0.269111	0.36444	N	0.002600	T	0.52289	0.1725	M	0.73962	2.25	0.32197	N	0.578331	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;P;P	0.70487	0.969;0.965;0.907;0.907	T	0.65043	-0.6264	10	0.54805	T	0.06	-16.7292	10.3947	0.44194	0.2678:0.0:0.0:0.7322	.	517;340;515;526	Q5T8D3-3;B7Z2A7;B7Z2R7;Q5T8D3	.;.;.;ACBD5_HUMAN	C	523;517;482;408;340;526	ENSP00000379568:Y517C;ENSP00000365070:Y482C;ENSP00000365066:Y408C;ENSP00000365062:Y340C;ENSP00000365049:Y526C	ENSP00000365049:Y526C	Y	-	2	0	ACBD5	27533390	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.770000	0.62309	2.139000	0.66308	0.383000	0.25322	TAT		0.413	ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1	NM_145698		6	32	0	0	0	0	6	32				
ASAH2	56624	broad.mit.edu	37	10	52005019	52005019	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr10:52005019C>T	ENST00000395526.4	-	2	322	c.323G>A	c.(322-324)cGa>cAa	p.R108Q	ASAH2_ENST00000447815.1_Missense_Mutation_p.R108Q|ASAH2_ENST00000329428.6_Missense_Mutation_p.R89Q	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	108					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						GCAGTCAGCTCGTCCAACACC	0.448																																						uc001jjd.2		NA																	0					0						c.(322-324)CGA>CAA		N-acylsphingosine amidohydrolase 2 isoform a							185.0	192.0	190.0					10																	52005019		2203	4300	6503	SO:0001583	missense	56624				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity	g.chr10:52005019C>T	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.323G>A	10.37:g.52005019C>T	ENSP00000378897:p.Arg108Gln		Somatic				ASAH2_uc009xos.2_Missense_Mutation_p.R108Q	p.R108Q	NM_019893	NP_063946	WXS	Illumina HiSeq	Unspecified	Q9NR71	ASAH2_HUMAN			2	323	-			108			Lumenal (Potential).		Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	37	c.323G>A	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	C	31	5.085506	0.94100	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.42900	0.96;0.96;0.96	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	T	0.67268	0.2875	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.987	T	0.65861	-0.6065	10	0.33141	T	0.24	.	17.2595	0.87066	0.0:1.0:0.0:0.0	.	108;108	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	Q	108;108;89	ENSP00000378897:R108Q;ENSP00000388206:R108Q;ENSP00000329886:R89Q	ENSP00000329886:R89Q	R	-	2	0	ASAH2	51675025	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.897000	0.75671	2.649000	0.89929	0.655000	0.94253	CGA		0.448	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893		34	210	0	0	0	0	34	210				
UNC5B	219699	broad.mit.edu	37	10	73057778	73057778	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr10:73057778A>G	ENST00000335350.6	+	16	3019	c.2603A>G	c.(2602-2604)aAc>aGc	p.N868S	UNC5B_ENST00000373192.4_Missense_Mutation_p.N857S	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	868	Death.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						AAGATATGCAACAGCCTAGAT	0.572																																						uc001jro.2		NA																	0				ovary(2)|lung(1)	3						c.(2602-2604)AAC>AGC		unc-5 homolog B precursor							127.0	93.0	105.0					10																	73057778		2203	4300	6503	SO:0001583	missense	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73057778A>G	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.2603A>G	10.37:g.73057778A>G	ENSP00000334329:p.Asn868Ser		Somatic				UNC5B_uc001jrp.2_Missense_Mutation_p.N857S|UNC5B_uc001jrq.1_5'Flank	p.N868S	NM_170744	NP_734465	WXS	Illumina HiSeq	Unspecified	Q8IZJ1	UNC5B_HUMAN			16	3048	+			868			Cytoplasmic (Potential).|Death.		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	c.2603A>G	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	A	4.398	0.073601	0.08485	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	D;D	0.84873	-1.91;-1.91	5.73	3.36	0.38483	Death (2);DEATH-like (2);	0.231175	0.45361	N	0.000375	T	0.57562	0.2062	N	0.00926	-1.1	0.29948	N	0.820486	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.51395	-0.8711	10	0.06494	T	0.89	-35.6255	10.5979	0.45349	0.8814:0.0:0.1186:0.0	.	857;868	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	S	868;857	ENSP00000334329:N868S;ENSP00000362288:N857S	ENSP00000334329:N868S	N	+	2	0	UNC5B	72727784	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.448000	0.35112	0.432000	0.26286	0.533000	0.62120	AAC		0.572	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		8	55	0	0	0	0	8	55				
MKI67	4288	broad.mit.edu	37	10	129913914	129913914	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr10:129913914T>G	ENST00000368654.3	-	7	1133	c.758A>C	c.(757-759)cAa>cCa	p.Q253P	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	253					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATTTTCTTTTTGTGATTTTAC	0.373																																						uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(757-759)CAA>CCA		antigen identified by monoclonal antibody Ki-67							74.0	73.0	73.0					10																	129913914		2203	4300	6503	SO:0001583	missense	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129913914T>G	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.758A>C	10.37:g.129913914T>G	ENSP00000357643:p.Gln253Pro		Somatic				MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	p.Q253P	NM_002417	NP_002408	WXS	Illumina HiSeq	Unspecified	P46013	KI67_HUMAN			7	953	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	253					Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	c.758A>C	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.990978	0.54041	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.24723	1.84	3.55	-0.383	0.12477	.	1.218520	0.06013	N	0.649790	T	0.15609	0.0376	N	0.19112	0.55	0.09310	N	1	B	0.24963	0.115	B	0.22152	0.038	T	0.33445	-0.9868	10	0.87932	D	0	.	3.9396	0.09321	0.0:0.2254:0.1823:0.5923	.	253	P46013	KI67_HUMAN	P	253	ENSP00000357643:Q253P	ENSP00000357643:Q253P	Q	-	2	0	MKI67	129803904	0.000000	0.05858	0.001000	0.08648	0.668000	0.39293	-0.408000	0.07169	-0.070000	0.12908	0.533000	0.62120	CAA		0.373	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		4	55	0	0	0	0	4	55				
MGMT	4255	broad.mit.edu	37	10	131565165	131565165	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr10:131565165G>T	ENST00000306010.7	+	5	653	c.621G>T	c.(619-621)ttG>ttT	p.L207F	RP11-109A6.3_ENST00000428273.1_lincRNA	NM_002412.3	NP_002403.2	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	176					cellular response to ionizing radiation (GO:0071479)|cellular response to organic cyclic compound (GO:0071407)|cellular response to oxidative stress (GO:0034599)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA ligation (GO:0006266)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to toxic substance (GO:0009636)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methylated-DNA-[protein]-cysteine S-methyltransferase activity (GO:0003908)|methyltransferase activity (GO:0008168)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	10		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	L-Cysteine(DB00151)	GCCACCGGTTGGGGAAGCCAG	0.662								Direct reversal of damage																														uc001lkh.2		NA																	0				ovary(1)|breast(1)	2						c.(619-621)TTG>TTT	Direct_reversal_of_damage	O-6-methylguanine-DNA methyltransferase							30.0	33.0	32.0					10																	131565165		2203	4300	6503	SO:0001583	missense	4255							g.chr10:131565165G>T	M29971	CCDS7660.2	10q26	2005-10-06			ENSG00000170430	ENSG00000170430			7059	protein-coding gene	gene with protein product		156569					Standard	NM_002412		Approved		uc001lkh.2	P16455	OTTHUMG00000019261	ENST00000306010.7:c.621G>T	10.37:g.131565165G>T	ENSP00000302111:p.Leu207Phe		Somatic					p.L207F	NM_002412	NP_002403	WXS	Illumina HiSeq	Unspecified	P16455	MGMT_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;0.00291)	5	647	+		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)	176					Q5VY78	Missense_Mutation	SNP	ENST00000306010.7	37	c.621G>T	CCDS7660.2	.	.	.	.	.	.	.	.	.	.	G	10.94	1.491550	0.26774	.	.	ENSG00000170430	ENST00000306010	T	0.06218	3.33	3.85	-7.69	0.01263	.	1.058320	0.07546	N	0.914685	T	0.02929	0.0087	N	0.19112	0.55	0.09310	N	1	B	0.16396	0.017	B	0.15052	0.012	T	0.43877	-0.9364	10	0.23302	T	0.38	.	2.9865	0.05970	0.3844:0.1851:0.3383:0.0921	.	207	B4DEE8	.	F	207	ENSP00000302111:L207F	ENSP00000302111:L207F	L	+	3	2	MGMT	131455155	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-2.516000	0.00954	-1.640000	0.01525	-0.471000	0.05019	TTG		0.662	MGMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051009.3	NM_002412		8	25	1	0	1.07e-07	1.8e-07	8	25				
LRRC56	115399	broad.mit.edu	37	11	554064	554064	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:554064C>A	ENST00000270115.7	+	14	1917	c.1417C>A	c.(1417-1419)Cag>Aag	p.Q473K		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	473										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACAGACCTGCAGTCCAGGGG	0.701																																						uc010qvz.1		NA																	0				skin(1)	1						c.(1417-1419)CAG>AAG		leucine rich repeat containing 56							54.0	59.0	57.0					11																	554064		2203	4299	6502	SO:0001583	missense	115399							g.chr11:554064C>A		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1417C>A	11.37:g.554064C>A	ENSP00000270115:p.Gln473Lys		Somatic					p.Q473K	NM_198075	NP_932341	WXS	Illumina HiSeq	Unspecified	Q8IYG6	LRC56_HUMAN		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	14	1922	+		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	473					Q8N3Q4	Missense_Mutation	SNP	ENST00000270115.7	37	c.1417C>A	CCDS7700.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.687655	0.00738	.	.	ENSG00000161328	ENST00000270115	T	0.08634	3.07	3.19	1.3	0.21679	.	1.808570	0.03619	N	0.236118	T	0.05318	0.0141	N	0.24115	0.695	0.09310	N	1	B	0.22003	0.063	B	0.17098	0.017	T	0.33240	-0.9876	10	0.02654	T	1	-14.2101	5.0091	0.14302	0.0:0.7215:0.0:0.2785	.	473	Q8IYG6	LRC56_HUMAN	K	473	ENSP00000270115:Q473K	ENSP00000270115:Q473K	Q	+	1	0	LRRC56	544064	0.000000	0.05858	0.005000	0.12908	0.054000	0.15201	0.387000	0.20718	0.382000	0.24878	0.491000	0.48974	CAG		0.701	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254969.1	NM_198075		17	96	1	0	9.17e-09	1.55e-08	17	96				
OR51V1	283111	broad.mit.edu	37	11	5221490	5221490	+	Missense_Mutation	SNP	A	A	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:5221490A>C	ENST00000321255.1	-	1	440	c.441T>G	c.(439-441)aaT>aaG	p.N147K		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	147					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAATTCTGGAATTAGTCAGGA	0.398																																						uc010qyz.1		NA																	0				skin(1)	1						c.(439-441)AAT>AAG		olfactory receptor, family 51, subfamily V,							53.0	57.0	55.0					11																	5221490		2200	4298	6498	SO:0001583	missense	283111				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5221490A>C	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.441T>G	11.37:g.5221490A>C	ENSP00000321729:p.Asn147Lys		Somatic					p.N147K	NM_001004760	NP_001004760	WXS	Illumina HiSeq	Unspecified	Q9H2C8	O51V1_HUMAN		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	441	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	147			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000321255.1	37	c.441T>G	CCDS31375.1	.	.	.	.	.	.	.	.	.	.	A	9.586	1.124899	0.20959	.	.	ENSG00000176742	ENST00000321255	T	0.69806	-0.43	5.27	0.13	0.14746	GPCR, rhodopsin-like superfamily (1);	0.613131	0.14579	N	0.311009	T	0.60919	0.2306	L	0.50847	1.595	0.09310	N	1	P	0.41848	0.763	P	0.46208	0.507	T	0.52426	-0.8577	10	0.49607	T	0.09	.	5.5103	0.16876	0.6395:0.1353:0.2252:0.0	.	147	Q9H2C8	O51V1_HUMAN	K	147	ENSP00000321729:N147K	ENSP00000321729:N147K	N	-	3	2	OR51V1	5178066	0.000000	0.05858	0.018000	0.16275	0.044000	0.14063	-1.584000	0.02114	0.137000	0.18759	-0.250000	0.11733	AAT		0.398	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142965.1	NM_001004760		6	47	0	0	0	0	6	47				
ANO3	63982	broad.mit.edu	37	11	26529781	26529781	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:26529781G>A	ENST00000256737.3	+	5	1415	c.563G>A	c.(562-564)aGa>aAa	p.R188K	ANO3_ENST00000531568.1_Missense_Mutation_p.R42K|ANO3_ENST00000531646.1_Missense_Mutation_p.R188K|ANO3_ENST00000525139.1_Missense_Mutation_p.R172K|ANO3_ENST00000537978.1_Missense_Mutation_p.R172K	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	188					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						AAGAACCTCAGAGCAGAAGGC	0.318																																						uc001mqt.3		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(562-564)AGA>AAA		transmembrane protein 16C							70.0	74.0	72.0					11																	26529781		2203	4300	6503	SO:0001583	missense	63982					chloride channel complex	chloride channel activity	g.chr11:26529781G>A	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.563G>A	11.37:g.26529781G>A	ENSP00000256737:p.Arg188Lys		Somatic				ANO3_uc010rdr.1_Missense_Mutation_p.R172K|ANO3_uc010rds.1_Missense_Mutation_p.R42K|ANO3_uc010rdt.1_Missense_Mutation_p.R42K	p.R188K	NM_031418	NP_113606	WXS	Illumina HiSeq	Unspecified	Q9BYT9	ANO3_HUMAN			5	708	+			188			Cytoplasmic (Potential).		B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	c.563G>A	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	G	35	5.575677	0.96553	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531646;ENST00000538001;ENST00000531568	T;T;T;T;T	0.66638	-0.04;-0.04;-0.04;-0.04;-0.22	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.71600	0.3359	L	0.33753	1.03	0.58432	D	0.999999	D;D	0.63046	0.989;0.992	D;D	0.77004	0.928;0.989	T	0.62450	-0.6852	10	0.06625	T	0.88	.	18.6915	0.91585	0.0:0.0:1.0:0.0	.	105;188	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	K	172;172;188;188;105;42	ENSP00000440737:R172K;ENSP00000432576:R172K;ENSP00000256737:R188K;ENSP00000435275:R188K;ENSP00000432394:R42K	ENSP00000256737:R188K	R	+	2	0	ANO3	26486357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.951000	0.93025	2.782000	0.95742	0.585000	0.79938	AGA		0.318	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418		7	43	0	0	0	0	7	43				
OR5M11	219487	broad.mit.edu	37	11	56310671	56310671	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:56310671C>T	ENST00000528616.2	-	1	86	c.63G>A	c.(61-63)ccG>ccA	p.P21P		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						ACTGGAGTTCCGGGCAATCTG	0.458																																						uc010rjl.1		NA																	0					0						c.(61-63)CCG>CCA		olfactory receptor, family 5, subfamily M,							91.0	90.0	90.0					11																	56310671		1985	4180	6165	SO:0001819	synonymous_variant	219487				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56310671C>T	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.63G>A	11.37:g.56310671C>T			Somatic					p.P21P	NM_001005245	NP_001005245	WXS	Illumina HiSeq	Unspecified	Q96RB7	OR5MB_HUMAN			1	63	-			21			Extracellular (Potential).		B2RNL5|B2RNL7	Silent	SNP	ENST00000528616.2	37	c.63G>A	CCDS53629.1																																																																																				0.458	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245		10	110	0	0	0	0	10	110				
TNKS1BP1	85456	broad.mit.edu	37	11	57085295	57085295	+	Silent	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:57085295A>G	ENST00000532437.1	-	3	1106	c.795T>C	c.(793-795)gcT>gcC	p.A265A	TNKS1BP1_ENST00000358252.3_Silent_p.A265A			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	265	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				AACTCACATCAGCAGGTAGCT	0.512																																						uc001njr.2		NA																	0				skin(1)	1						c.(793-795)GCT>GCC		tankyrase 1-binding protein 1							65.0	62.0	63.0					11																	57085295		2201	4296	6497	SO:0001819	synonymous_variant	85456				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding	g.chr11:57085295A>G	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.795T>C	11.37:g.57085295A>G			Somatic				TNKS1BP1_uc001njs.2_Silent_p.A265A|TNKS1BP1_uc009ymd.1_5'UTR	p.A265A	NM_033396	NP_203754	WXS	Illumina HiSeq	Unspecified	Q9C0C2	TB182_HUMAN			3	1107	-		all_epithelial(135;0.21)	265			Pro-rich.|Acidic.		A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	37	c.795T>C	CCDS7951.1																																																																																				0.512	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396		8	23	0	0	0	0	8	23				
CTNND1	1500	broad.mit.edu	37	11	57582974	57582974	+	Splice_Site	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:57582974T>C	ENST00000399050.4	+	19	3344		c.e19+2		CTNND1_ENST00000532844.1_Splice_Site|CTNND1_ENST00000526357.1_Splice_Site|CTNND1_ENST00000358694.6_Splice_Site|CTNND1_ENST00000531014.1_Splice_Site|CTNND1_ENST00000528232.1_Splice_Site|CTNND1_ENST00000415361.2_Splice_Site|CTNND1_ENST00000532245.1_Splice_Site|CTNND1_ENST00000534579.1_Splice_Site|CTNND1_ENST00000532649.1_Splice_Site|CTNND1_ENST00000529986.1_Splice_Site|CTNND1_ENST00000360682.6_Splice_Site|CTNND1_ENST00000529919.1_Splice_Site|CTNND1_ENST00000526938.1_Splice_Site|CTNND1_ENST00000532463.1_Splice_Site|CTNND1_ENST00000361332.4_Splice_Site|CTNND1_ENST00000361391.6_Splice_Site|CTNND1_ENST00000428599.2_Splice_Site|CTNND1_ENST00000528621.1_Splice_Site|CTNND1_ENST00000524630.1_Splice_Site|CTNND1_ENST00000426142.2_Splice_Site|CTNND1_ENST00000399039.4_Splice_Site|CTNND1_ENST00000527467.1_Splice_Site|CTNND1_ENST00000530748.1_Splice_Site|CTNND1_ENST00000529873.1_Splice_Site|CTNND1_ENST00000533667.1_Splice_Site|CTNND1_ENST00000526772.1_Splice_Site|CTNND1_ENST00000530094.1_Splice_Site|CTNND1_ENST00000529526.1_Splice_Site|CTNND1_ENST00000361796.4_Splice_Site|CTNND1_ENST00000525902.1_Splice_Site|CTNND1_ENST00000532787.1_Splice_Site	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1						adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				CCCTTGATGGTAAATTCTCTT	0.413																																						uc001nmc.3		NA																	0				breast(4)|ovary(1)|kidney(1)	6						c.e19+2		catenin, delta 1 isoform 1ABC							54.0	56.0	55.0					11																	57582974		1852	4095	5947	SO:0001630	splice_region_variant	1500				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding	g.chr11:57582974T>C	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2808+2T>C	11.37:g.57582974T>C			Somatic				CTNND1_uc001nlh.1_Splice_Site_p.M936_splice|CTNND1_uc001nlu.3_Splice_Site_p.M829_splice|CTNND1_uc001nlt.3_Splice_Site_p.M829_splice|CTNND1_uc001nls.3_Splice_Site_p.M808_splice|CTNND1_uc001nlw.3_Splice_Site_p.M829_splice|CTNND1_uc001nmf.3_Splice_Site_p.M936_splice|CTNND1_uc001nmd.3_Splice_Site_p.M882_splice|CTNND1_uc001nlk.3_Splice_Site_p.M882_splice|CTNND1_uc001nme.3_Splice_Site_p.M930_splice|CTNND1_uc001nll.3_Splice_Site_p.M876_splice|CTNND1_uc001nmg.3_Splice_Site_p.M876_splice|CTNND1_uc001nlj.3_Splice_Site_p.M876_splice|CTNND1_uc001nlr.3_Splice_Site_p.M876_splice|CTNND1_uc001nlp.3_Splice_Site_p.M855_splice|CTNND1_uc001nlx.3_Splice_Site_p.M613_splice|CTNND1_uc001nlz.3_Splice_Site_p.M613_splice|CTNND1_uc009ymn.2_Splice_Site_p.M607_splice|CTNND1_uc001nlm.3_Splice_Site_p.M930_splice|CTNND1_uc001nly.3_Splice_Site_p.M607_splice|CTNND1_uc001nmb.3_Splice_Site_p.M607_splice|CTNND1_uc001nma.3_Splice_Site_p.M586_splice|CTNND1_uc001nmi.3_Splice_Site_p.M835_splice|CTNND1_uc001nmh.3_Splice_Site_p.M930_splice|CTNND1_uc001nlq.3_Splice_Site_p.M835_splice|CTNND1_uc001nln.3_Splice_Site_p.M930_splice|CTNND1_uc001nli.3_Splice_Site_p.M909_splice|CTNND1_uc001nlo.3_Splice_Site_p.M829_splice|CTNND1_uc001nlv.3_Splice_Site_p.M829_splice	p.M936_splice	NM_001085458	NP_001078927	WXS	Illumina HiSeq	Unspecified	O60716	CTND1_HUMAN			19	3379	+		all_epithelial(135;0.155)						A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Splice_Site	SNP	ENST00000399050.4	37	c.2808_splice	CCDS44604.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.174856	0.78564	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8736	0.70478	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTNND1	57339550	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.896000	0.63222	2.333000	0.79357	0.533000	0.62120	.		0.413	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	Intron	3	20	0	0	0	0	3	20				
NUMA1	4926	broad.mit.edu	37	11	71729904	71729904	+	Missense_Mutation	SNP	T	T	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:71729904T>A	ENST00000393695.3	-	10	1038	c.707A>T	c.(706-708)gAg>gTg	p.E236V	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Missense_Mutation_p.E236V|NUMA1_ENST00000351960.6_Missense_Mutation_p.E236V	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CTCAGCTAGCTCCAGCTCCAG	0.562			T	RARA	APL																																	uc001orl.1		NA		Dom	yes		11	11q13	4926	T	nuclear mitotic apparatus protein 1			L	RARA		APL		0				ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						c.(706-708)GAG>GTG		nuclear mitotic apparatus protein 1							114.0	106.0	109.0					11																	71729904		2200	4293	6493	SO:0001583	missense	4926				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity	g.chr11:71729904T>A	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.707A>T	11.37:g.71729904T>A	ENSP00000377298:p.Glu236Val		Somatic				NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Missense_Mutation_p.E236V|NUMA1_uc001orm.1_Missense_Mutation_p.E236V|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Missense_Mutation_p.E236V|NUMA1_uc001oro.1_Missense_Mutation_p.E236V|NUMA1_uc009ysy.1_Missense_Mutation_p.E236V|NUMA1_uc001orp.2_Missense_Mutation_p.E236V|NUMA1_uc001orq.2_Missense_Mutation_p.E236V	p.E236V	NM_006185	NP_006176	WXS	Illumina HiSeq	Unspecified	Q14980	NUMA1_HUMAN			10	879	-			236			Potential.			Missense_Mutation	SNP	ENST00000393695.3	37	c.707A>T	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.666348	0.88251	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000542977;ENST00000537217	T;T;T;T;T	0.71817	0.41;1.07;1.05;-0.19;-0.6	5.98	4.86	0.63082	.	0.064389	0.64402	D	0.000006	T	0.75744	0.3891	L	0.34521	1.04	0.31744	N	0.635394	D;D;D;D;D;D	0.89917	1.0;0.996;0.996;0.989;1.0;0.999	D;D;D;P;D;D	0.91635	0.999;0.925;0.925;0.893;0.996;0.93	T	0.78919	-0.2014	10	0.72032	D	0.01	.	11.5362	0.50639	0.0:0.0701:0.0:0.9299	.	236;236;236;236;236;236	F5H6Y5;F5H4J1;A8K394;Q14980-2;Q14980;Q9BTE9	.;.;.;.;NUMA1_HUMAN;.	V	236	ENSP00000260051:E236V;ENSP00000351851:E236V;ENSP00000377298:E236V;ENSP00000444880:E236V;ENSP00000442936:E236V	ENSP00000260051:E236V	E	-	2	0	NUMA1	71407552	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.655000	0.67981	1.097000	0.41459	0.533000	0.62120	GAG		0.562	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			22	110	0	0	0	0	22	110				
RELT	84957	broad.mit.edu	37	11	73106507	73106507	+	Missense_Mutation	SNP	C	C	T	rs139368769		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:73106507C>T	ENST00000064780.2	+	11	1525	c.1264C>T	c.(1264-1266)Cgg>Tgg	p.R422W	RP11-809N8.2_ENST00000544674.1_RNA|RELT_ENST00000393580.2_Missense_Mutation_p.R422W	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor	422						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						ctatgtggtccggctaagtga	0.647													.|||	1	0.000199681	0.0	0.0	5008	,	,		18528	0.0		0.0	False		,,,				2504	0.001					uc001otv.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1264-1266)CGG>TGG		RELT tumor necrosis factor receptor precursor		C	TRP/ARG,TRP/ARG	0,4400		0,0,2200	98.0	91.0	94.0		1264,1264	3.1	1.0	11	dbSNP_134	94	10,8576	7.7+/-29.5	0,10,4283	yes	missense,missense	RELT	NM_032871.3,NM_152222.1	101,101	0,10,6483	TT,TC,CC		0.1165,0.0,0.077	probably-damaging,probably-damaging	422/431,422/431	73106507	10,12976	2200	4293	6493	SO:0001583	missense	84957					cytoplasm|integral to membrane|plasma membrane	binding|receptor activity	g.chr11:73106507C>T	AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.1264C>T	11.37:g.73106507C>T	ENSP00000064780:p.Arg422Trp		Somatic				RELT_uc001otw.2_Missense_Mutation_p.R422W|RELT_uc001otx.2_RNA	p.R422W	NM_152222	NP_689408	WXS	Illumina HiSeq	Unspecified	Q969Z4	TR19L_HUMAN			11	1429	+			422			Cytoplasmic (Potential).		Q86V34|Q96JU1|Q9BUX7	Missense_Mutation	SNP	ENST00000064780.2	37	c.1264C>T	CCDS8222.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414418	0.62511	0.0	0.001165	ENSG00000054967	ENST00000064780;ENST00000393580;ENST00000438119	T;T	0.79033	-1.23;-1.23	4.05	3.14	0.36123	.	0.195514	0.24530	N	0.037738	T	0.74215	0.3687	L	0.27053	0.805	0.34285	D	0.68259	D	0.76494	0.999	P	0.57620	0.824	T	0.80185	-0.1487	10	0.87932	D	0	-17.4921	7.752	0.28903	0.0:0.8871:0.0:0.1129	.	422	Q969Z4	TR19L_HUMAN	W	422;422;290	ENSP00000064780:R422W;ENSP00000377207:R422W	ENSP00000064780:R422W	R	+	1	2	RELT	72784155	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	0.436000	0.21526	1.299000	0.44798	0.563000	0.77884	CGG		0.647	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397380.2	NM_032871		17	82	0	0	0	0	17	82				
PIWIL4	143689	broad.mit.edu	37	11	94341767	94341767	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:94341767G>A	ENST00000299001.6	+	15	2069	c.1858G>A	c.(1858-1860)Gtc>Atc	p.V620I	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	620	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCTGATGGTGGTCGGTATTGA	0.388																																						uc001pfa.2		NA																	0				skin(1)	1						c.(1858-1860)GTC>ATC		piwi-like 4							208.0	189.0	195.0					11																	94341767		2201	4298	6499	SO:0001583	missense	143689				cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding	g.chr11:94341767G>A	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1858G>A	11.37:g.94341767G>A	ENSP00000299001:p.Val620Ile		Somatic				PIWIL4_uc010rue.1_Intron|PIWIL4_uc009ywk.1_RNA	p.V620I	NM_152431	NP_689644	WXS	Illumina HiSeq	Unspecified	Q7Z3Z4	PIWL4_HUMAN			15	2069	+		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)	620			Piwi.		B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	c.1858G>A	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024903	0.75390	.	.	ENSG00000134627	ENST00000299001	T	0.26810	1.71	5.73	5.73	0.89815	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.64402	D	0.000011	T	0.23210	0.0561	N	0.26092	0.79	0.80722	D	1	P	0.40638	0.725	B	0.42319	0.383	T	0.01287	-1.1395	10	0.25106	T	0.35	-30.7949	17.1771	0.86844	0.0:0.0:1.0:0.0	.	620	Q7Z3Z4	PIWL4_HUMAN	I	620	ENSP00000299001:V620I	ENSP00000299001:V620I	V	+	1	0	PIWIL4	93981415	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.930000	0.56522	2.868000	0.98415	0.555000	0.69702	GTC		0.388	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431		33	102	0	0	0	0	33	102				
OR6X1	390260	broad.mit.edu	37	11	123624803	123624803	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:123624803G>T	ENST00000327930.2	-	1	450	c.424C>A	c.(424-426)Ctg>Atg	p.L142M		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTCAGGGCCAGCTGCAGGCAG	0.507																																						uc010rzy.1		NA																	0				ovary(2)|skin(1)	3						c.(424-426)CTG>ATG		olfactory receptor, family 6, subfamily X,							103.0	104.0	104.0					11																	123624803		2202	4299	6501	SO:0001583	missense	390260				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123624803G>T	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.424C>A	11.37:g.123624803G>T	ENSP00000333724:p.Leu142Met		Somatic					p.L142M	NM_001005188	NP_001005188	WXS	Illumina HiSeq	Unspecified	Q8NH79	OR6X1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)	1	424	-		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	142			Helical; Name=4; (Potential).		B9EGW9|Q6IFA0	Missense_Mutation	SNP	ENST00000327930.2	37	c.424C>A	CCDS31695.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022696	0.54683	.	.	ENSG00000221931	ENST00000327930	T	0.40476	1.03	4.69	3.78	0.43462	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.42899	0.1223	N	0.12746	0.255	0.31573	N	0.656135	D	0.89917	1.0	D	0.81914	0.995	T	0.47983	-0.9074	9	0.59425	D	0.04	-3.8458	8.6184	0.33847	0.1041:0.0:0.8959:0.0	.	142	Q8NH79	OR6X1_HUMAN	M	142	ENSP00000333724:L142M	ENSP00000333724:L142M	L	-	1	2	OR6X1	123130013	0.192000	0.23301	0.298000	0.25002	0.971000	0.66376	0.469000	0.22067	1.215000	0.43411	0.650000	0.86243	CTG		0.507	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188		12	74	1	0	6.82e-15	1.2e-14	12	74				
ANO2	57101	broad.mit.edu	37	12	5685021	5685021	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:5685021T>C	ENST00000356134.5	-	25	2674	c.2603A>G	c.(2602-2604)gAc>gGc	p.D868G	ANO2_ENST00000327087.8_Missense_Mutation_p.D867G|ANO2_ENST00000546188.1_Missense_Mutation_p.D868G	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	872					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						AACCTCCTGGTCAAACTGTGA	0.493																																						uc001qnm.2		NA																	0				ovary(4)|large_intestine(2)|central_nervous_system(1)	7						c.(2599-2601)GAC>GGC		anoctamin 2							63.0	64.0	64.0					12																	5685021		1940	4138	6078	SO:0001583	missense	57101					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity	g.chr12:5685021T>C	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2603A>G	12.37:g.5685021T>C	ENSP00000348453:p.Asp868Gly		Somatic					p.D867G	NM_020373	NP_065106	WXS	Illumina HiSeq	Unspecified	Q9NQ90	ANO2_HUMAN			24	2672	-			872			Extracellular (Potential).		C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37	c.2600A>G		.	.	.	.	.	.	.	.	.	.	T	3.201	-0.163640	0.06502	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.64438	-0.1;-0.1;-0.1	5.28	5.28	0.74379	.	0.515257	0.21587	N	0.072146	T	0.23688	0.0573	N	0.00873	-1.125	0.30691	N	0.751277	B	0.02656	0.0	B	0.04013	0.001	T	0.33599	-0.9862	10	0.02654	T	1	.	6.2859	0.21033	0.0:0.0808:0.2873:0.6318	.	867	Q9NQ90-3	.	G	867;868;868;872	ENSP00000314048:D867G;ENSP00000348453:D868G;ENSP00000440981:D868G	ENSP00000314048:D867G	D	-	2	0	ANO2	5555282	0.999000	0.42202	1.000000	0.80357	0.989000	0.77384	0.773000	0.26661	2.119000	0.64992	0.528000	0.53228	GAC		0.493	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373		5	40	0	0	0	0	5	40				
ATN1	1822	broad.mit.edu	37	12	7048173	7048173	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:7048173C>A	ENST00000356654.4	+	7	3284	c.3047C>A	c.(3046-3048)tCc>tAc	p.S1016Y	ATN1_ENST00000396684.2_Missense_Mutation_p.S1016Y	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	1016					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CCTGACATGTCCTATGCTGAG	0.667																																						uc001qrw.1		NA																	0				ovary(2)|breast(2)|pancreas(1)|skin(1)	6						c.(3046-3048)TCC>TAC		atrophin-1							47.0	52.0	50.0					12																	7048173		2202	4299	6501	SO:0001583	missense	1822				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding	g.chr12:7048173C>A	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.3047C>A	12.37:g.7048173C>A	ENSP00000349076:p.Ser1016Tyr		Somatic				ATN1_uc001qrx.1_Missense_Mutation_p.S1016Y	p.S1016Y	NM_001007026	NP_001007027	WXS	Illumina HiSeq	Unspecified	P54259	ATN1_HUMAN			7	3284	+			1016					Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	c.3047C>A	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.794064	0.50102	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.53423	0.62;0.62;0.62	4.82	4.82	0.62117	.	0.512077	0.14585	U	0.310639	T	0.67487	0.2898	L	0.60455	1.87	0.43947	D	0.996618	D	0.71674	0.998	D	0.78314	0.991	T	0.68637	-0.5356	10	0.87932	D	0	.	18.5267	0.90975	0.0:1.0:0.0:0.0	.	1016	P54259	ATN1_HUMAN	Y	1016;1016;1016;601	ENSP00000349076:S1016Y;ENSP00000379915:S1016Y;ENSP00000441744:S1016Y	ENSP00000229279:S601Y	S	+	2	0	ATN1	6918434	0.583000	0.26757	0.965000	0.40720	0.489000	0.33432	1.036000	0.30228	2.684000	0.91462	0.650000	0.86243	TCC		0.667	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940		23	78	1	0	7.93e-12	1.37e-11	23	78				
CD69	969	broad.mit.edu	37	12	9907188	9907188	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:9907188G>T	ENST00000228434.3	-	4	566	c.486C>A	c.(484-486)aaC>aaA	p.N162K	CD69_ENST00000536709.1_Missense_Mutation_p.N162K	NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	162	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						CTTACCAGTTGTTAAATTCTT	0.413																																						uc001qwk.2		NA																	0					0						c.(484-486)AAC>AAA		CD69 molecule							182.0	187.0	185.0					12																	9907188		2203	4300	6503	SO:0001583	missense	969					integral to plasma membrane	sugar binding|transmembrane receptor activity	g.chr12:9907188G>T	Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.486C>A	12.37:g.9907188G>T	ENSP00000228434:p.Asn162Lys		Somatic				CD69_uc010sgu.1_Missense_Mutation_p.N162K|CD69_uc010sgv.1_3'UTR	p.N162K	NM_001781	NP_001772	WXS	Illumina HiSeq	Unspecified	Q07108	CD69_HUMAN			4	567	-			162			C-type lectin.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000228434.3	37	c.486C>A	CCDS8604.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459582	0.63401	.	.	ENSG00000110848	ENST00000228434;ENST00000536709	T;T	0.18174	2.23;2.23	5.4	1.31	0.21738	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.528279	0.20501	N	0.091098	T	0.16854	0.0405	L	0.53249	1.67	0.23899	N	0.996521	P	0.41524	0.753	B	0.43251	0.413	T	0.07809	-1.0753	9	.	.	.	-8.8134	6.4211	0.21744	0.4076:0.0:0.5924:0.0	.	162	Q07108	CD69_HUMAN	K	162	ENSP00000228434:N162K;ENSP00000442597:N162K	.	N	-	3	2	CD69	9798455	0.001000	0.12720	0.443000	0.26883	0.990000	0.78478	0.228000	0.17814	0.416000	0.25844	0.655000	0.94253	AAC		0.413	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399876.1			38	123	1	0	9.81e-26	1.8e-25	38	123				
CAPRIN2	65981	broad.mit.edu	37	12	30877333	30877333	+	Missense_Mutation	SNP	G	G	T	rs200738608		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:30877333G>T	ENST00000395805.2	-	10	2505	c.1958C>A	c.(1957-1959)cCg>cAg	p.P653Q	CAPRIN2_ENST00000417045.1_Missense_Mutation_p.P653Q|CAPRIN2_ENST00000298892.5_Missense_Mutation_p.P653Q|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.P653Q|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.P320Q	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AGCTGAAGGCGGTTGTGACGT	0.388																																						uc001rji.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1957-1959)CCG>CAG		C1q domain containing 1 isoform 1							138.0	127.0	130.0					12																	30877333		2203	4300	6503	SO:0001583	missense	65981				negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding	g.chr12:30877333G>T	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.1958C>A	12.37:g.30877333G>T	ENSP00000379150:p.Pro653Gln		Somatic				CAPRIN2_uc001rjf.1_Missense_Mutation_p.P450Q|CAPRIN2_uc001rjg.1_Missense_Mutation_p.P320Q|CAPRIN2_uc001rjh.1_Missense_Mutation_p.P653Q|CAPRIN2_uc001rjj.1_Missense_Mutation_p.P320Q|CAPRIN2_uc001rjk.3_Missense_Mutation_p.P653Q|CAPRIN2_uc001rjl.3_Missense_Mutation_p.P653Q|CAPRIN2_uc001rjm.1_Missense_Mutation_p.P320Q	p.P653Q	NM_001002259	NP_001002259	WXS	Illumina HiSeq	Unspecified	Q6IMN6	CAPR2_HUMAN			10	2709	-	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)		653						Missense_Mutation	SNP	ENST00000395805.2	37	c.1958C>A	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122771	0.56613	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000308433;ENST00000417045;ENST00000438006;ENST00000537108	T;T;T;T;T;T;T	0.73681	1.02;-0.77;2.74;1.02;1.02;1.02;1.02	5.42	3.26	0.37387	.	0.585034	0.17125	N	0.186074	T	0.76535	0.4001	L	0.36672	1.1	0.30718	N	0.748564	D;D;D;P;B;P	0.67145	0.99;0.996;0.996;0.915;0.041;0.915	P;P;P;P;B;P	0.61132	0.884;0.806;0.77;0.632;0.066;0.632	T	0.75502	-0.3295	10	0.72032	D	0.01	-4.8345	11.3702	0.49696	0.1675:0.0:0.8325:0.0	.	379;653;653;653;653;653	E9PAU5;Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;.;CAPR2_HUMAN;.;.	Q	399;653;653;653;320;653;379;572	ENSP00000415407:P399Q;ENSP00000298892:P653Q;ENSP00000379150:P653Q;ENSP00000251071:P653Q;ENSP00000309785:P320Q;ENSP00000391479:P653Q;ENSP00000438010:P572Q	ENSP00000251071:P653Q	P	-	2	0	CAPRIN2	30768600	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.837000	0.39201	1.287000	0.44583	0.655000	0.94253	CCG		0.388	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925		4	26	1	0	0.000602214	0.000936068	4	26				
ADAMTS20	80070	broad.mit.edu	37	12	43822059	43822059	+	Silent	SNP	G	G	A	rs375296101		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:43822059G>A	ENST00000389420.3	-	26	3929	c.3930C>T	c.(3928-3930)acC>acT	p.T1310T	ADAMTS20_ENST00000553158.1_Silent_p.T1310T|ADAMTS20_ENST00000395541.2_Silent_p.T428T	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1310	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CCCATGGTCCGGTTCTCCACT	0.358																																						uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(3928-3930)ACC>ACT		a disintegrin-like and metalloprotease with							98.0	99.0	98.0					12																	43822059		2203	4300	6503	SO:0001819	synonymous_variant	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43822059G>A	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3930C>T	12.37:g.43822059G>A			Somatic				ADAMTS20_uc001rno.1_Silent_p.T428T|ADAMTS20_uc001rnp.1_Silent_p.T464T	p.T1310T	NM_025003	NP_079279	WXS	Illumina HiSeq	Unspecified	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	26	3930	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	1310			TSP type-1 9.		A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	c.3930C>T	CCDS31778.2																																																																																				0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		10	92	0	0	0	0	10	92				
ITGB7	3695	broad.mit.edu	37	12	53590515	53590515	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:53590515G>A	ENST00000267082.5	-	6	895	c.664C>T	c.(664-666)Cgc>Tgc	p.R222C	ITGB7_ENST00000422257.3_Missense_Mutation_p.R222C|ITGB7_ENST00000550743.2_Missense_Mutation_p.R222C|ITGB7_ENST00000338737.4_Missense_Mutation_p.R222C	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	222	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GACTGGCAGCGCTCCAGCCGG	0.617																																						uc009zmv.2		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						c.(664-666)CGC>TGC		integrin, beta 7 precursor							46.0	43.0	44.0					12																	53590515		2203	4300	6503	SO:0001583	missense	3695				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity	g.chr12:53590515G>A		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.664C>T	12.37:g.53590515G>A	ENSP00000267082:p.Arg222Cys		Somatic				ITGB7_uc001scc.2_Missense_Mutation_p.R222C|ITGB7_uc010snz.1_RNA|ITGB7_uc010soa.1_3'UTR	p.R222C	NM_000889	NP_000880	WXS	Illumina HiSeq	Unspecified	P26010	ITB7_HUMAN			5	735	-			222			VWFA.|Extracellular (Potential).		Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	c.664C>T	CCDS8849.1	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711141	0.68730	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737;ENST00000542497	D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1	5.05	3.08	0.35506	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.727821	0.11364	N	0.571582	D	0.90559	0.7041	M	0.61703	1.905	0.42803	D	0.993935	P	0.50710	0.938	B	0.42112	0.376	D	0.89074	0.3471	10	0.59425	D	0.04	.	12.3694	0.55246	0.0:0.0:0.5576:0.4424	.	222	P26010	ITB7_HUMAN	C	222	ENSP00000408741:R222C;ENSP00000267082:R222C;ENSP00000345501:R222C;ENSP00000437375:R222C	ENSP00000267082:R222C	R	-	1	0	ITGB7	51876782	0.782000	0.28689	1.000000	0.80357	0.972000	0.66771	0.902000	0.28459	1.255000	0.44051	0.555000	0.69702	CGC		0.617	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2			8	15	0	0	0	0	8	15				
ESYT1	23344	broad.mit.edu	37	12	56528126	56528126	+	Splice_Site	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:56528126G>A	ENST00000394048.5	+	15	1810	c.1546G>A	c.(1546-1548)Gct>Act	p.A516T	ESYT1_ENST00000267113.4_Splice_Site_p.A526T|ESYT1_ENST00000541590.1_Splice_Site_p.A526T	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	516	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						ACATCTCCAGGCTGTCTACAG	0.502																																						uc001sjq.2		NA																	0		p.A516G(1)		ovary(4)|skin(1)	5						c.(1546-1548)GCT>ACT		extended synaptotagmin-like protein 1							192.0	175.0	181.0					12																	56528126		2203	4300	6503	SO:0001630	splice_region_variant	23344					integral to membrane		g.chr12:56528126G>A	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.1546-1G>A	12.37:g.56528126G>A			Somatic				ESYT1_uc001sjr.2_Missense_Mutation_p.A526T	p.A516T	NM_015292	NP_056107	WXS	Illumina HiSeq	Unspecified	Q9BSJ8	ESYT1_HUMAN			15	1596	+			516			C2 2.		A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	c.1546G>A	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	G	6.481	0.456871	0.12283	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.66280	-0.2;-0.2;-0.2	5.28	3.47	0.39725	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.156711	0.56097	N	0.000021	T	0.23846	0.0577	N	0.00566	-1.37	0.38142	D	0.938493	B;P	0.35192	0.191;0.489	B;B	0.31869	0.032;0.137	T	0.14868	-1.0457	9	.	.	.	-9.6798	9.5017	0.39022	0.1677:0.0:0.8323:0.0	.	526;516	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	T	516;470;526;526	ENSP00000377612:A516T;ENSP00000267113:A526T;ENSP00000445952:A526T	.	A	+	1	0	ESYT1	54814393	0.998000	0.40836	0.999000	0.59377	0.942000	0.58702	1.038000	0.30254	0.736000	0.32559	-0.140000	0.14226	GCT		0.502	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	Missense_Mutation	35	104	0	0	0	0	35	104				
LRP1	4035	broad.mit.edu	37	12	57604546	57604546	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:57604546G>A	ENST00000243077.3	+	83	13266	c.12800G>A	c.(12799-12801)tGc>tAc	p.C4267Y		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4267	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGCCCCAAATGCACCCAGCAG	0.667																																						uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(12799-12801)TGC>TAC		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						65.0	67.0	66.0					12																	57604546		2203	4300	6503	SO:0001583	missense	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57604546G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12800G>A	12.37:g.57604546G>A	ENSP00000243077:p.Cys4267Tyr		Somatic					p.C4267Y	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	83	13266	+			4267			EGF-like 18.|Extracellular (Potential).		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	c.12800G>A	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767043	0.69878	.	.	ENSG00000123384	ENST00000243077	D	0.99834	-7.04	4.45	4.45	0.53987	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99908	0.9956	H	0.99197	4.465	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.95988	0.8983	10	0.87932	D	0	.	16.3851	0.83502	0.0:0.0:1.0:0.0	.	4267	Q07954	LRP1_HUMAN	Y	4267	ENSP00000243077:C4267Y	ENSP00000243077:C4267Y	C	+	2	0	LRP1	55890813	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.502000	0.84385	0.462000	0.41574	TGC		0.667	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		14	90	0	0	0	0	14	90				
TMBIM4	51643	broad.mit.edu	37	12	66531827	66531827	+	Silent	SNP	G	G	A	rs554625377		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:66531827G>A	ENST00000358230.3	-	7	750	c.630C>T	c.(628-630)taC>taT	p.Y210Y	TMBIM4_ENST00000544599.1_Silent_p.Y33Y|TMBIM4_ENST00000542724.1_Silent_p.Y179Y|TMBIM4_ENST00000398033.4_3'UTR|TMBIM4_ENST00000539652.1_3'UTR|TMBIM4_ENST00000286424.7_Silent_p.Y257Y|TMBIM4_ENST00000556010.1_3'UTR	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	210					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		CAGCTAATACGTACTCTTCAG	0.413													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15532	0.0		0.0	False		,,,				2504	0.0					uc001stc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(628-630)TAC>TAT		transmembrane BAX inhibitor motif containing 4							128.0	126.0	126.0					12																	66531827		1948	4151	6099	SO:0001819	synonymous_variant	51643					integral to membrane	protein binding	g.chr12:66531827G>A	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.630C>T	12.37:g.66531827G>A			Somatic				LLPH_uc010ssx.1_RNA|TMBIM4_uc001std.2_Silent_p.Y179Y|TMBIM4_uc009zqr.2_Silent_p.Y257Y|TMBIM4_uc001ste.2_RNA|TMBIM4_uc001stf.2_3'UTR|TMBIM4_uc009zqs.2_3'UTR	p.Y210Y	NM_016056	NP_057140	WXS	Illumina HiSeq	Unspecified	Q9HC24	TMBI4_HUMAN		GBM - Glioblastoma multiforme(28;0.0745)	7	706	-			210			Helical; (Potential).		Q542Z6|Q9UHY5|Q9Y3C2	Silent	SNP	ENST00000358230.3	37	c.630C>T	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	G	1.127	-0.653548	0.03480	.	.	ENSG00000155957	ENST00000539043	.	.	.	5.73	-2.15	0.07102	.	.	.	.	.	T	0.65698	0.2716	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63708	-0.6576	4	.	.	.	-14.6476	14.7595	0.69596	0.3524:0.0:0.6476:0.0	.	.	.	.	M	210	.	.	T	-	2	0	TMBIM4	64818094	0.999000	0.42202	0.299000	0.25016	0.225000	0.24961	0.427000	0.21379	-0.547000	0.06207	-0.793000	0.03317	ACG		0.413	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056		25	47	0	0	0	0	25	47				
CFAP54	144535	broad.mit.edu	37	12	97043804	97043804	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:97043804T>C	ENST00000524981.4	+	35	4849	c.4826T>C	c.(4825-4827)gTa>gCa	p.V1609A				Q96N23	CL055_HUMAN		0																	AATTTGTGTGTAATGGATCAT	0.363																																						uc001tet.1		NA																	0				skin(6)|ovary(1)	7						c.(100-102)GTA>GCA		hypothetical protein LOC374467							117.0	121.0	120.0					12																	97043804		2203	4300	6503	SO:0001583	missense	374467							g.chr12:97043804T>C																												ENST00000524981.4:c.4826T>C	12.37:g.97043804T>C	ENSP00000431759:p.Val1609Ala		Somatic					p.V34A	NM_198520	NP_940922	WXS	Illumina HiSeq	Unspecified	Q6ZTY8	CL063_HUMAN			2	179	+			34						Missense_Mutation	SNP	ENST00000524981.4	37	c.101T>C		.	.	.	.	.	.	.	.	.	.	T	11.40	1.627036	0.28978	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	4.68	3.52	0.40303	.	1.866620	0.03133	N	0.165515	T	0.20333	0.0489	N	0.03608	-0.345	0.09310	N	1	B	0.18863	0.031	B	0.16289	0.015	T	0.20638	-1.0269	9	0.30078	T	0.28	-0.0056	8.0341	0.30482	0.0:0.0942:0.0:0.9058	.	34	Q6ZTY8	CL063_HUMAN	A	1609;34	.	ENSP00000345466:V34A	V	+	2	0	C12orf63	95567935	0.032000	0.19561	0.001000	0.08648	0.021000	0.10359	3.535000	0.53575	0.649000	0.30751	0.533000	0.62120	GTA		0.363	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000395046.4			10	52	0	0	0	0	10	52				
ACAD10	80724	broad.mit.edu	37	12	112150407	112150407	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:112150407C>T	ENST00000313698.4	+	6	951	c.796C>T	c.(796-798)Ccg>Tcg	p.P266S	ACAD10_ENST00000455480.2_Missense_Mutation_p.P297S|ACAD10_ENST00000392636.2_5'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.P266S|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	266						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GATGGAAATTCCGAAAGATTC	0.453																																						uc001tsq.2		NA																	0				ovary(2)	2						c.(796-798)CCG>TCG		acyl-Coenzyme A dehydrogenase family, member 10							160.0	174.0	169.0					12																	112150407		2203	4300	6503	SO:0001583	missense	80724						acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups	g.chr12:112150407C>T	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.796C>T	12.37:g.112150407C>T	ENSP00000325137:p.Pro266Ser		Somatic				ACAD10_uc001tso.3_Missense_Mutation_p.P266S|ACAD10_uc001tsp.2_Missense_Mutation_p.P266S|ACAD10_uc009zvx.2_Missense_Mutation_p.P297S|ACAD10_uc001tsr.2_Missense_Mutation_p.P4S|ACAD10_uc001tss.1_5'Flank	p.P266S	NM_025247	NP_079523	WXS	Illumina HiSeq	Unspecified	Q6JQN1	ACD10_HUMAN			6	996	+			266					G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	c.796C>T	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892176	0.33442	.	.	ENSG00000111271	ENST00000413681;ENST00000549590;ENST00000455480;ENST00000507135;ENST00000313698;ENST00000552706;ENST00000507683	T;T;T	0.26223	1.75;1.75;1.75	5.03	3.19	0.36642	.	0.383881	0.27433	N	0.019385	T	0.34395	0.0896	L	0.54323	1.7	0.80722	D	1	B;B;B;D;P	0.58620	0.447;0.317;0.307;0.983;0.717	B;B;B;P;B	0.54026	0.046;0.124;0.06;0.74;0.352	T	0.02444	-1.1158	10	0.37606	T	0.19	.	10.8158	0.46575	0.0:0.8428:0.0:0.1572	.	297;4;266;266;266	G3XAJ0;F8W0Q4;Q6JQN1;Q6JQN1-2;Q6JQN1-4	.;.;ACD10_HUMAN;.;.	S	266;266;297;266;266;4;4	ENSP00000446959:P266S;ENSP00000389813:P297S;ENSP00000325137:P266S	ENSP00000325137:P266S	P	+	1	0	ACAD10	110634790	1.000000	0.71417	0.113000	0.21522	0.295000	0.27426	1.699000	0.37804	0.520000	0.28426	0.591000	0.81541	CCG		0.453	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		30	197	0	0	0	0	30	197				
VSIG10	54621	broad.mit.edu	37	12	118517157	118517157	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:118517157G>T	ENST00000359236.5	-	4	1195	c.919C>A	c.(919-921)Cag>Aag	p.Q307K	VSIG10_ENST00000536905.1_5'Flank	NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	307	Ig-like C2-type 3.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						TCACTGATCTGCACCATGCAG	0.517																																						uc001tws.2		NA																	0					0						c.(919-921)CAG>AAG		V-set and immunoglobulin domain containing 10							70.0	78.0	75.0					12																	118517157		2124	4230	6354	SO:0001583	missense	54621					integral to membrane		g.chr12:118517157G>T		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.919C>A	12.37:g.118517157G>T	ENSP00000352172:p.Gln307Lys		Somatic					p.Q307K	NM_019086	NP_061959	WXS	Illumina HiSeq	Unspecified	Q8N0Z9	VSI10_HUMAN			4	1253	-			307			Ig-like C2-type 3.|Extracellular (Potential).		Q9NWQ7	Missense_Mutation	SNP	ENST00000359236.5	37	c.919C>A	CCDS44992.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.278764	0.23307	.	.	ENSG00000176834	ENST00000359236	T	0.15256	2.44	5.84	4.95	0.65309	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.174243	0.27891	N	0.017424	T	0.15782	0.0380	L	0.47716	1.5	0.25866	N	0.983761	B	0.26935	0.164	B	0.23574	0.047	T	0.12863	-1.0531	10	0.41790	T	0.15	-23.3648	10.2022	0.43092	0.0:0.1574:0.6985:0.1441	.	307	Q8N0Z9	VSI10_HUMAN	K	307	ENSP00000352172:Q307K	ENSP00000352172:Q307K	Q	-	1	0	VSIG10	117001540	0.998000	0.40836	0.974000	0.42286	0.754000	0.42855	2.957000	0.49137	1.457000	0.47850	0.650000	0.86243	CAG		0.517	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086		6	64	1	0	2.01e-06	3.33e-06	6	64				
DHX37	57647	broad.mit.edu	37	12	125470690	125470690	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:125470690C>T	ENST00000308736.2	-	2	326	c.228G>A	c.(226-228)gaG>gaA	p.E76E		NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	76							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCACTTTCTTCTCCTTCTTGG	0.512																																						uc001ugy.2		NA																	0				skin(1)	1						c.(226-228)GAG>GAA		DEAH (Asp-Glu-Ala-His) box polypeptide 37							193.0	188.0	190.0					12																	125470690		2203	4300	6503	SO:0001819	synonymous_variant	57647						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding	g.chr12:125470690C>T	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.228G>A	12.37:g.125470690C>T			Somatic					p.E76E	NM_032656	NP_116045	WXS	Illumina HiSeq	Unspecified	Q8IY37	DHX37_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)	2	327	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		76					Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	37	c.228G>A	CCDS9261.1																																																																																				0.512	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656		77	114	0	0	0	0	77	114				
CDK8	1024	broad.mit.edu	37	13	26971342	26971342	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:26971342G>A	ENST00000381527.3	+	9	1416	c.913G>A	c.(913-915)Gat>Aat	p.D305N	CDK8_ENST00000536792.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	305	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		AGTTAAACCAGATAGTAAAGC	0.318																																						uc001uqr.1		NA																	0				lung(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(913-915)GAT>AAT		cyclin-dependent kinase 8							99.0	97.0	98.0					13																	26971342		2203	4300	6503	SO:0001583	missense	1024				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr13:26971342G>A	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.913G>A	13.37:g.26971342G>A	ENSP00000370938:p.Asp305Asn		Somatic				CDK8_uc001uqs.1_Missense_Mutation_p.D305N|CDK8_uc001uqt.1_Missense_Mutation_p.D132N	p.D305N	NM_001260	NP_001251	WXS	Illumina HiSeq	Unspecified	P49336	CDK8_HUMAN		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)	9	939	+	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)	305			Protein kinase.		Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	c.913G>A	CCDS9317.1	.	.	.	.	.	.	.	.	.	.	G	31	5.073559	0.94000	.	.	ENSG00000132964	ENST00000381527	T	0.44083	0.93	5.76	5.76	0.90799	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	L	0.35341	1.055	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.66979	0.944;0.948	T	0.54248	-0.8322	10	0.54805	T	0.06	-15.1899	19.943	0.97172	0.0:0.0:1.0:0.0	.	305;305	P49336-2;P49336	.;CDK8_HUMAN	N	305	ENSP00000370938:D305N	ENSP00000370938:D305N	D	+	1	0	CDK8	25869342	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.444000	0.97578	2.716000	0.92895	0.655000	0.94253	GAT		0.318	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1			10	32	0	0	0	0	10	32				
DGKH	160851	broad.mit.edu	37	13	42803280	42803280	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:42803280G>A	ENST00000337343.4	+	30	3640	c.3619G>A	c.(3619-3621)Gga>Aga	p.G1207R	DGKH_ENST00000261491.5_Missense_Mutation_p.G1163E|DGKH_ENST00000379274.2_Missense_Mutation_p.G1087R|DGKH_ENST00000540693.1_Missense_Mutation_p.G1163E|DGKH_ENST00000536612.1_Missense_Mutation_p.G1071R|DGKH_ENST00000538674.1_Missense_Mutation_p.G918E|DGKH_ENST00000498255.2_3'UTR	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	1207	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		AATTCTCCAGGGAATTAAAGA	0.373																																						uc001uyl.1		NA																	0				ovary(2)	2						c.(3619-3621)GGA>AGA		diacylglycerol kinase, eta isoform 2							88.0	89.0	89.0					13																	42803280		2203	4300	6503	SO:0001583	missense	160851				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chr13:42803280G>A	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.3619G>A	13.37:g.42803280G>A	ENSP00000337572:p.Gly1207Arg		Somatic				DGKH_uc010tfh.1_Missense_Mutation_p.G1163E|DGKH_uc001uym.1_Missense_Mutation_p.G1163E|DGKH_uc010tfi.1_Missense_Mutation_p.G918E|DGKH_uc010tfj.1_Missense_Mutation_p.G1062R|DGKH_uc001uyn.1_RNA|DGKH_uc001uyo.1_Missense_Mutation_p.G1078R|DGKH_uc001uyp.2_RNA	p.G1207R	NM_178009	NP_821077	WXS	Illumina HiSeq	Unspecified	Q86XP1	DGKH_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)	30	3640	+		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)	1207			SAM.		A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	c.3619G>A	CCDS9381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.3|27.3	4.819864|4.819864	0.90873|0.90873	.|.	.|.	ENSG00000102780|ENSG00000102780	ENST00000540693;ENST00000261491;ENST00000538674|ENST00000337343;ENST00000379274;ENST00000536612	T;T;T|D;D;D	0.81247|0.84944	-1.47;-1.47;1.75|-1.92;-1.92;-1.92	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.91851|0.91851	0.7421|0.7421	L|L	0.61387|0.61387	1.9|1.9	0.44780|0.44780	D|D	0.997785|0.997785	D;D|D;D	0.89917|0.89917	1.0;1.0|0.999;1.0	D;D|D;D	0.97110|0.81914	1.0;1.0|0.984;0.995	D|D	0.91694|0.91694	0.5368|0.5368	10|10	0.87932|0.87932	D|D	0|0	.|.	20.3539|20.3539	0.98825|0.98825	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	918;1163|1087;1207	F5GYP2;Q86XP1-2|Q86XP1-3;Q86XP1	.;.|.;DGKH_HUMAN	E|R	1163;1163;918|1207;1087;1071	ENSP00000440823:G1163E;ENSP00000261491:G1163E;ENSP00000441308:G918E|ENSP00000337572:G1207R;ENSP00000368576:G1087R;ENSP00000445114:G1071R	ENSP00000261491:G1163E|ENSP00000337572:G1207R	G|G	+|+	2|1	0|0	DGKH|DGKH	41701280|41701280	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	8.421000|8.421000	0.90259|0.90259	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GGG|GGA		0.373	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009		14	82	0	0	0	0	14	82				
CLN5	1203	broad.mit.edu	37	13	77566263	77566263	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:77566263C>T	ENST00000377453.3	+	1	1469	c.177C>T	c.(175-177)ggC>ggT	p.G59G	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	10					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		CGGCACAGGGCGCCGAGATgc	0.746																																						uc001vkc.2		NA																	0				ovary(1)	1						c.(175-177)GGC>GGT		ceroid-lipofuscinosis, neuronal 5							10.0	13.0	12.0					13																	77566263		2158	4220	6378	SO:0001819	synonymous_variant	1203				brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding	g.chr13:77566263C>T		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.177C>T	13.37:g.77566263C>T			Somatic					p.G59G	NM_006493	NP_006484	WXS	Illumina HiSeq	Unspecified	O75503	CLN5_HUMAN		GBM - Glioblastoma multiforme(99;0.0503)	1	205	+		Acute lymphoblastic leukemia(28;0.205)	10					B3KQK7	Silent	SNP	ENST00000377453.3	37	c.177C>T	CCDS9456.1																																																																																				0.746	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493		7	23	0	0	0	0	7	23				
EDNRB	1910	broad.mit.edu	37	13	78477688	78477688	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:78477688T>C	ENST00000334286.5	-	2	774	c.538A>G	c.(538-540)Ata>Gta	p.I180V	EDNRB_ENST00000377211.4_Missense_Mutation_p.I270V|EDNRB_ENST00000446573.1_Missense_Mutation_p.I180V	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	180					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GCTTTCTGTATGAAAGGCACC	0.443																																						uc001vko.2		NA																	0					0						c.(538-540)ATA>GTA		endothelin receptor type B isoform 1 precursor	Bosentan(DB00559)						80.0	74.0	76.0					13																	78477688		2203	4300	6503	SO:0001583	missense	1910				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding	g.chr13:78477688T>C	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.538A>G	13.37:g.78477688T>C	ENSP00000335311:p.Ile180Val		Somatic				EDNRB_uc001vkq.1_Missense_Mutation_p.I180V|uc001vkn.1_Intron|EDNRB_uc010aez.1_Missense_Mutation_p.I180V|EDNRB_uc001vkp.1_Missense_Mutation_p.I263V	p.I180V	NM_001122659	NP_001116131	WXS	Illumina HiSeq	Unspecified	P24530	EDNRB_HUMAN		GBM - Glioblastoma multiforme(99;0.0933)	2	796	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)	180			Helical; Name=3; (Potential).		A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	c.538A>G	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	T	13.68	2.310802	0.40895	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.37058	1.22;1.22;1.22	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.119241	0.64402	D	0.000012	T	0.25975	0.0633	N	0.21508	0.67	0.44048	D	0.996788	B;B;B	0.26483	0.15;0.038;0.035	B;B;B	0.26864	0.06;0.023;0.074	T	0.07443	-1.0772	10	0.49607	T	0.09	-18.2696	10.9997	0.47598	0.1391:0.0:0.0:0.8609	.	180;270;180	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	V	270;180;180	ENSP00000366416:I270V;ENSP00000403401:I180V;ENSP00000335311:I180V	ENSP00000335311:I180V	I	-	1	0	EDNRB	77375689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.345000	0.44018	2.122000	0.65172	0.528000	0.53228	ATA		0.443	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1			33	53	0	0	0	0	33	53				
SLITRK1	114798	broad.mit.edu	37	13	84453689	84453689	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:84453689G>A	ENST00000377084.2	-	1	2839	c.1954C>T	c.(1954-1956)Cga>Tga	p.R652*		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	652					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TTGGCATCTCGTCTCTTGGAC	0.572																																						uc001vlk.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(1954-1956)CGA>TGA		slit and trk like 1 protein precursor							84.0	71.0	76.0					13																	84453689		2203	4300	6503	SO:0001587	stop_gained	114798					integral to membrane		g.chr13:84453689G>A	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1954C>T	13.37:g.84453689G>A	ENSP00000366288:p.Arg652*		Somatic					p.R652*	NM_052910	NP_443142	WXS	Illumina HiSeq	Unspecified	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	2840	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	652			Cytoplasmic (Potential).		Q5U5I6|Q96SF9	Nonsense_Mutation	SNP	ENST00000377084.2	37	c.1954C>T	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	46	12.118372	0.99637	.	.	ENSG00000178235	ENST00000377084	.	.	.	4.98	3.82	0.43975	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-10.8504	11.139	0.48392	0.0:0.0:0.1629:0.8371	.	.	.	.	X	652	.	ENSP00000366288:R652X	R	-	1	2	SLITRK1	83351690	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.379000	0.44318	1.042000	0.40150	-0.262000	0.10625	CGA		0.572	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		13	47	0	0	0	0	13	47				
ERCC5	2073	broad.mit.edu	37	13	103518238	103518238	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:103518238C>T	ENST00000355739.4	+	9	3599	c.2176C>T	c.(2176-2178)Cat>Tat	p.H726Y	BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.P1151L|ERCC5_ENST00000375954.1_5'UTR	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	726					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AGATTCGCTCCATGAATGGCA	0.483			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													uc001vpw.2		NA	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""			E		skin basal cell|skin squamous cell|melanoma			0				ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						c.(2176-2178)CAT>TAT	Direct_reversal_of_damage|NER	XPG-complementing protein							77.0	73.0	74.0					13																	103518238		2203	4300	6503	SO:0001583	missense	2073	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding	g.chr13:103518238C>T	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2176C>T	13.37:g.103518238C>T	ENSP00000347978:p.His726Tyr		Somatic				ERCC5_uc001vpu.1_Missense_Mutation_p.H1180Y|ERCC5_uc010tjb.1_Missense_Mutation_p.H726Y|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.H558Y	p.H726Y	NM_000123	NP_000114	WXS	Illumina HiSeq	Unspecified	P28715	ERCC5_HUMAN			9	2619	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		726					A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	c.2176C>T	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341584	0.41498	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955	T	0.04654	3.58	5.49	-2.98	0.05513	.	0.680257	0.15341	N	0.267498	T	0.02888	0.0086	L	0.36672	1.1	0.38288	D	0.942639	P;P;P	0.47302	0.75;0.893;0.673	B;B;B	0.34180	0.129;0.177;0.091	T	0.52946	-0.8507	10	0.45353	T	0.12	-10.6561	6.9439	0.24508	0.4801:0.2142:0.3057:0.0	.	726;726;1151	B4DSI5;P28715;Q59FZ7	.;ERCC5_HUMAN;.	Y	1151;726;558	ENSP00000347978:H726Y	ENSP00000347978:H726Y	H	+	1	0	ERCC5	102316239	0.003000	0.15002	0.017000	0.16124	0.132000	0.20833	-0.066000	0.11598	-0.394000	0.07727	-0.457000	0.05445	CAT		0.483	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			9	48	0	0	0	0	9	48				
FAM155A	728215	broad.mit.edu	37	13	108518140	108518140	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr13:108518140G>T	ENST00000375915.2	-	1	943	c.805C>A	c.(805-807)Cag>Aag	p.Q269K		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	269						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						TCATAGTCCTGGTAAGCCTCG	0.522																																						uc001vql.2		NA																	0				skin(1)	1						c.(805-807)CAG>AAG		family with sequence similarity 155, member A							139.0	123.0	128.0					13																	108518140		2203	4300	6503	SO:0001583	missense	728215					integral to membrane	binding	g.chr13:108518140G>T	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.805C>A	13.37:g.108518140G>T	ENSP00000365080:p.Gln269Lys		Somatic					p.Q269K	NM_001080396	NP_001073865	WXS	Illumina HiSeq	Unspecified	B1AL88	F155A_HUMAN			1	1321	-			269					B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	c.805C>A	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703167	0.48412	.	.	ENSG00000204442	ENST00000375915	T	0.12255	2.7	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	L	0.38838	1.175	0.51012	D	0.9999	D	0.71674	0.998	D	0.78314	0.991	T	0.00295	-1.1839	10	0.33141	T	0.24	.	19.2604	0.93966	0.0:0.0:1.0:0.0	.	269	B1AL88	F155A_HUMAN	K	269	ENSP00000365080:Q269K	ENSP00000365080:Q269K	Q	-	1	0	FAM155A	107316141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.439000	0.97543	2.793000	0.96121	0.563000	0.77884	CAG		0.522	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396		22	119	1	0	2.52e-20	4.59e-20	22	119				
CMA1	1215	broad.mit.edu	37	14	24974805	24974805	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr14:24974805G>A	ENST00000250378.3	-	5	690	c.661C>T	c.(661-663)Cgg>Tgg	p.R221W	RP11-80A15.1_ENST00000555109.1_Intron|CMA1_ENST00000206446.4_Missense_Mutation_p.R110W	NM_001836.3	NP_001827.1	P23946	CMA1_HUMAN	chymase 1, mast cell	221	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|cellular response to glucose stimulus (GO:0071333)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|interleukin-1 beta biosynthetic process (GO:0050720)|midbrain development (GO:0030901)|peptide metabolic process (GO:0006518)|positive regulation of angiogenesis (GO:0045766)|regulation of inflammatory response (GO:0050727)	extracellular region (GO:0005576)|intracellular (GO:0005622)	peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			kidney(1)|lung(8)|pancreas(1)|prostate(1)	11				GBM - Glioblastoma multiforme(265;0.0271)		GCATCCGACCGTCCATAGGAT	0.592																																						uc001wpp.1		NA																	0					0						c.(661-663)CGG>TGG		chymase 1, mast cell preproprotein							77.0	76.0	76.0					14																	24974805		2203	4300	6503	SO:0001583	missense	1215				interleukin-1 beta biosynthetic process|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr14:24974805G>A		CCDS9630.1	14q12	2012-08-30			ENSG00000092009	ENSG00000092009	3.4.21.39		2097	protein-coding gene	gene with protein product		118938				8468056	Standard	NM_001836		Approved		uc001wpp.1	P23946	OTTHUMG00000140181	ENST00000250378.3:c.661C>T	14.37:g.24974805G>A	ENSP00000250378:p.Arg221Trp		Somatic				CMA1_uc010alx.1_Missense_Mutation_p.R110W	p.R221W	NM_001836	NP_001827	WXS	Illumina HiSeq	Unspecified	P23946	CMA1_HUMAN		GBM - Glioblastoma multiforme(265;0.0271)	5	691	-			221			Peptidase S1.		B5BUM8|Q16018|Q3SY36|Q3SY37|Q9UDH5	Missense_Mutation	SNP	ENST00000250378.3	37	c.661C>T	CCDS9630.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378488	0.42207	.	.	ENSG00000092009	ENST00000250378;ENST00000206446	D;D	0.89123	-2.47;-2.47	5.38	1.02	0.19986	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.700130	0.01047	N	0.004417	D	0.90448	0.7009	L	0.39467	1.215	0.09310	N	1	D	0.76494	0.999	P	0.54431	0.752	T	0.78239	-0.2281	10	0.46703	T	0.11	.	12.6318	0.56661	0.0:0.0:0.4459:0.5541	.	221	P23946	CMA1_HUMAN	W	221;110	ENSP00000250378:R221W;ENSP00000206446:R110W	ENSP00000206446:R110W	R	-	1	2	CMA1	24044645	0.001000	0.12720	0.000000	0.03702	0.395000	0.30598	-0.140000	0.10342	0.000000	0.14550	0.655000	0.94253	CGG		0.592	CMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276535.2			9	62	0	0	0	0	9	62				
KCNH5	27133	broad.mit.edu	37	14	63269189	63269189	+	Silent	SNP	G	G	T	rs114074278	byFrequency	TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr14:63269189G>T	ENST00000322893.7	-	9	1948	c.1680C>A	c.(1678-1680)cgC>cgA	p.R560R	KCNH5_ENST00000394968.1_Silent_p.R502R|KCNH5_ENST00000420622.2_Silent_p.R560R	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	560					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CCGCCAAGGCGCGCAGACACC	0.507													g|||	5	0.000998403	0.0	0.0014	5008	,	,		19344	0.0		0.004	False		,,,				2504	0.0					uc001xfx.2		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(1678-1680)CGC>CGA		potassium voltage-gated channel, subfamily H,		A	,,	2,4404	4.2+/-10.8	0,2,2201	83.0	78.0	80.0		1680,1680,1506	-8.1	0.2	14	dbSNP_132	80	27,8573	19.2+/-60.6	0,27,4273	no	coding-synonymous,coding-synonymous,coding-synonymous	KCNH5	NM_139318.3,NM_172375.1,NM_172376.1	,,	0,29,6474	TT,TG,GG		0.314,0.0454,0.223	,,	560/989,560/612,502/625	63269189	29,12977	2203	4300	6503	SO:0001819	synonymous_variant	27133				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity	g.chr14:63269189G>T	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1680C>A	14.37:g.63269189G>T			Somatic				KCNH5_uc001xfy.2_Silent_p.R560R|KCNH5_uc001xfz.1_Silent_p.R502R	p.R560R	NM_139318	NP_647479	WXS	Illumina HiSeq	Unspecified	Q8NCM2	KCNH5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)	9	1731	-			560			cNMP.|Cytoplasmic (Potential).		C9JP98	Silent	SNP	ENST00000322893.7	37	c.1680C>A	CCDS9756.1																																																																																				0.507	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		11	89	1	0	1.59e-06	2.64e-06	11	89				
SYNE2	23224	broad.mit.edu	37	14	64496701	64496701	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr14:64496701T>C	ENST00000344113.4	+	44	7015	c.6803T>C	c.(6802-6804)tTc>tCc	p.F2268S	SYNE2_ENST00000358025.3_Missense_Mutation_p.F2268S|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.F2268S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2268					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTGGACAATTTCTCCAAGGAA	0.408																																						uc001xgm.2		NA																	0				ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(6802-6804)TTC>TCC		spectrin repeat containing, nuclear envelope 2							77.0	74.0	75.0					14																	64496701		1827	4081	5908	SO:0001583	missense	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64496701T>C	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6803T>C	14.37:g.64496701T>C	ENSP00000341781:p.Phe2268Ser		Somatic				SYNE2_uc001xgl.2_Missense_Mutation_p.F2268S	p.F2268S	NM_015180	NP_055995	WXS	Illumina HiSeq	Unspecified	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	44	7033	+			2268			Cytoplasmic (Potential).		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	c.6803T>C	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880359	0.33162	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.34072	1.38;1.38;1.38	5.24	5.24	0.73138	.	0.930568	0.08958	N	0.869067	T	0.29190	0.0726	N	0.19112	0.55	0.80722	D	1	B;P	0.37015	0.442;0.578	B;B	0.38056	0.135;0.264	T	0.03493	-1.1031	10	0.39692	T	0.17	.	12.8217	0.57696	0.0:0.0:0.0:1.0	.	2268;2268	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	S	2268	ENSP00000350719:F2268S;ENSP00000341781:F2268S;ENSP00000452570:F2268S	ENSP00000261678:F2268S	F	+	2	0	SYNE2	63566454	0.007000	0.16637	0.005000	0.12908	0.406000	0.30931	1.489000	0.35562	2.108000	0.64289	0.533000	0.62120	TTC		0.408	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		3	35	0	0	0	0	3	35				
TLN2	83660	broad.mit.edu	37	15	62939593	62939593	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr15:62939593C>G	ENST00000561311.1	+	3	314	c.84C>G	c.(82-84)taC>taG	p.Y28*	RP11-625H11.1_ENST00000560347.1_5'Flank|RP11-625H11.1_ENST00000558940.1_5'Flank|TLN2_ENST00000306829.6_Nonsense_Mutation_p.Y28*			Q9Y4G6	TLN2_HUMAN	talin 2	28					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CAGCTGTGTACGATGCGTGTC	0.488																																						uc002alb.3		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(82-84)TAC>TAG		talin 2							218.0	192.0	200.0					15																	62939593		2203	4300	6503	SO:0001587	stop_gained	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:62939593C>G	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.84C>G	15.37:g.62939593C>G	ENSP00000453508:p.Tyr28*		Somatic				MGC15885_uc010uib.1_5'Flank|MGC15885_uc002ala.3_5'Flank	p.Y28*	NM_015059	NP_055874	WXS	Illumina HiSeq	Unspecified	Q9Y4G6	TLN2_HUMAN			1	84	+			28					A6NLB8	Nonsense_Mutation	SNP	ENST00000561311.1	37	c.84C>G	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088195	0.76642	.	.	ENSG00000171914	ENST00000306829	.	.	.	5.5	-11.0	0.00169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8689	19.355	0.94408	0.0:0.3366:0.0:0.6634	.	.	.	.	X	28	.	ENSP00000303476:Y28X	Y	+	3	2	TLN2	60726885	0.000000	0.05858	0.026000	0.17262	0.079000	0.17450	-2.041000	0.01415	-2.719000	0.00389	-1.170000	0.01741	TAC		0.488	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			19	119	0	0	0	0	19	119				
CAPN15	6650	broad.mit.edu	37	16	596993	596993	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:596993G>A	ENST00000219611.2	+	4	518	c.155G>A	c.(154-156)cGc>cAc	p.R52H	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	52					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CCCTGCGCCCGCTGCACCTTC	0.692																																						uc002chi.2		NA																	0				ovary(1)|breast(1)	2						c.(154-156)CGC>CAC		small optic lobes							27.0	27.0	27.0					16																	596993		2186	4284	6470	SO:0001583	missense	6650				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:596993G>A	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.155G>A	16.37:g.596993G>A	ENSP00000219611:p.Arg52His		Somatic				SOLH_uc002chh.1_Missense_Mutation_p.R52H	p.R52H	NM_005632	NP_005623	WXS	Illumina HiSeq	Unspecified	O75808	CAN15_HUMAN			4	518	+		Hepatocellular(780;0.00335)	52			RanBP2-type 2.		B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	c.155G>A	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	24.4	4.530399	0.85706	.	.	ENSG00000103326	ENST00000219611;ENST00000397687	T	0.41065	1.01	5.1	5.1	0.69264	Zinc finger, RanBP2-type (2);	0.787215	0.11240	N	0.584709	T	0.55657	0.1934	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.37220	-0.9715	10	0.18276	T	0.48	.	17.0758	0.86586	0.0:0.0:1.0:0.0	.	52	O75808	CAN15_HUMAN	H	52	ENSP00000219611:R52H	ENSP00000219611:R52H	R	+	2	0	SOLH	536994	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.269000	0.95684	2.359000	0.80004	0.556000	0.70494	CGC		0.692	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632		5	40	0	0	0	0	5	40				
ATP6V0C	527	broad.mit.edu	37	16	2569563	2569563	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:2569563C>T	ENST00000330398.4	+	3	519	c.285C>T	c.(283-285)gcC>gcT	p.A95A	AMDHD2_ENST00000413459.3_5'Flank|AMDHD2_ENST00000302956.4_5'Flank|ATP6V0C_ENST00000565223.1_Silent_p.A52A|ATP6V0C_ENST00000564973.1_Silent_p.A52A|ATP6C_ENST00000569317.1_Intron|ATP6V0C_ENST00000568562.1_3'UTR|RP11-20I23.1_ENST00000564543.1_3'UTR|AMDHD2_ENST00000293971.6_5'Flank	NM_001198569.1|NM_001694.3	NP_001185498.1|NP_001685.1	P27449	VATL_HUMAN	ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c	95					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|lung(1)|ovary(1)	3		Ovarian(90;0.17)				AGCTGGGCGCCGGCCTGAGCG	0.701																																						uc002cqn.2		NA																	0				ovary(1)	1						c.(283-285)GCC>GCT		ATPase, H+ transporting, lysosomal, V0 subunit							13.0	14.0	14.0					16																	2569563		2191	4274	6465	SO:0001819	synonymous_variant	527				ATP hydrolysis coupled proton transport|ATP synthesis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|interspecies interaction between organisms|transferrin transport	endosome membrane|integral to membrane|proton-transporting ATP synthase complex, coupling factor F(o)|proton-transporting V-type ATPase, V0 domain|vacuolar membrane	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism|ubiquitin protein ligase binding	g.chr16:2569563C>T	M62762	CCDS10470.1	16p13.3	2010-04-21	2002-08-29	2002-05-10	ENSG00000185883	ENSG00000185883	3.6.3.14	"""ATPases / V-type"""	855	protein-coding gene	gene with protein product		108745	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16kD"""	ATPL, ATP6C, ATP6L		1709739, 8250920	Standard	NM_001694		Approved	VATL, Vma3	uc021tav.1	P27449	OTTHUMG00000128865	ENST00000330398.4:c.285C>T	16.37:g.2569563C>T			Somatic				TBC1D24_uc002cqm.2_3'UTR|ATP6V0C_uc002cqo.2_Silent_p.A52A|AMDHD2_uc002cqp.2_5'Flank|AMDHD2_uc002cqq.2_5'Flank|AMDHD2_uc010uwc.1_5'Flank|AMDHD2_uc010uwd.1_5'Flank	p.A95A	NM_001694	NP_001685	WXS	Illumina HiSeq	Unspecified	P27449	VATL_HUMAN			3	437	+		Ovarian(90;0.17)	95			Helical; (Potential).		Q6FH26	Silent	SNP	ENST00000330398.4	37	c.285C>T	CCDS10470.1																																																																																				0.701	ATP6V0C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250810.1	NM_001694		19	39	0	0	0	0	19	39				
TXNDC11	51061	broad.mit.edu	37	16	11792153	11792153	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:11792153G>A	ENST00000356957.3	-	8	1123	c.1016C>T	c.(1015-1017)aCa>aTa	p.T339I	TXNDC11_ENST00000283033.5_Missense_Mutation_p.T312I			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	339					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GTTCTCAGCTGTGTAGTTCAG	0.552																																						uc010buu.1		NA																	0					0						c.(1015-1017)ACA>ATA		thioredoxin domain containing 11							83.0	84.0	84.0					16																	11792153		2197	4300	6497	SO:0001583	missense	51061				cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane		g.chr16:11792153G>A	BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1016C>T	16.37:g.11792153G>A	ENSP00000349439:p.Thr339Ile		Somatic				TXNDC11_uc002dbg.1_Missense_Mutation_p.T312I	p.T339I	NM_015914	NP_056998	WXS	Illumina HiSeq	Unspecified	Q6PKC3	TXD11_HUMAN			8	1078	-			339					O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	ENST00000356957.3	37	c.1016C>T		.	.	.	.	.	.	.	.	.	.	G	29.0	4.964802	0.92791	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.34667	1.35;1.35	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.59142	0.2172	L	0.58810	1.83	0.58432	D	0.999998	D;D	0.89917	0.997;1.0	D;D	0.91635	0.922;0.999	T	0.55263	-0.8168	10	0.51188	T	0.08	-21.0895	19.2073	0.93736	0.0:0.0:1.0:0.0	.	339;312	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	I	339;312	ENSP00000349439:T339I;ENSP00000283033:T312I	ENSP00000283033:T312I	T	-	2	0	TXNDC11	11699654	1.000000	0.71417	0.975000	0.42487	0.877000	0.50540	8.831000	0.92068	2.780000	0.95670	0.655000	0.94253	ACA		0.552	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000437057.1	NM_015914		12	34	0	0	0	0	12	34				
PDXDC1	23042	broad.mit.edu	37	16	15127244	15127244	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:15127244G>A	ENST00000396410.4	+	19	1897	c.1800G>A	c.(1798-1800)gaG>gaA	p.E600E	PDXDC1_ENST00000569715.1_Silent_p.E573E|PDXDC1_ENST00000563679.1_Silent_p.E618E|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000325823.7_Silent_p.E585E|PDXDC1_ENST00000447912.2_Silent_p.E509E|PDXDC1_ENST00000450288.2_Silent_p.E572E	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	600					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGAGATAGAGGAGAACTCGA	0.567																																						uc002dda.3		NA																	0				skin(1)	1						c.(1798-1800)GAG>GAA		pyridoxal-dependent decarboxylase domain	Pyridoxal Phosphate(DB00114)						123.0	115.0	118.0					16																	15127244		2197	4300	6497	SO:0001819	synonymous_variant	23042				carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding	g.chr16:15127244G>A	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1800G>A	16.37:g.15127244G>A			Somatic				PDXDC1_uc010uzl.1_Silent_p.E585E|PDXDC1_uc010uzm.1_Silent_p.E509E|PDXDC1_uc002ddb.3_Silent_p.E573E|PDXDC1_uc010uzn.1_Silent_p.E572E|PDXDC1_uc002ddc.2_Intron	p.E600E	NM_015027	NP_055842	WXS	Illumina HiSeq	Unspecified	Q6P996	PDXD1_HUMAN			19	2024	+			600					B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	c.1800G>A	CCDS32393.1																																																																																				0.567	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027		33	101	0	0	0	0	33	101				
ACSM2A	123876	broad.mit.edu	37	16	20486734	20486734	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:20486734C>T	ENST00000573854.1	+	7	1059	c.945C>T	c.(943-945)taC>taT	p.Y315Y	ACSM2A_ENST00000219054.6_Silent_p.Y315Y|ACSM2A_ENST00000575690.1_Silent_p.Y315Y|ACSM2A_ENST00000396104.2_Silent_p.Y315Y|ACSM2A_ENST00000417235.2_Silent_p.Y236Y|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000536134.1_Silent_p.Y87Y	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	315					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						CCATTGTTTACCGGATGTTGC	0.512																																						uc010bwe.2		NA																	0				skin(2)|breast(1)	3						c.(943-945)TAC>TAT		acyl-CoA synthetase medium-chain family member							176.0	145.0	156.0					16																	20486734		2203	4298	6501	SO:0001819	synonymous_variant	123876				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding	g.chr16:20486734C>T	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.945C>T	16.37:g.20486734C>T			Somatic				ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Silent_p.Y236Y|ACSM2A_uc002dhf.3_Silent_p.Y315Y|ACSM2A_uc002dhg.3_Silent_p.Y315Y|ACSM2A_uc010vay.1_Silent_p.Y236Y|ACSM2A_uc002dhh.3_5'Flank	p.Y315Y	NM_001010845	NP_001010845	WXS	Illumina HiSeq	Unspecified	Q08AH3	ACS2A_HUMAN			8	1184	+			315					B3KTT9|O75202	Silent	SNP	ENST00000573854.1	37	c.945C>T	CCDS32401.1																																																																																				0.512	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845		26	104	0	0	0	0	26	104				
GTF3C1	2975	broad.mit.edu	37	16	27549582	27549582	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:27549582A>T	ENST00000356183.4	-	3	542	c.527T>A	c.(526-528)tTc>tAc	p.F176Y	GTF3C1_ENST00000561623.1_Missense_Mutation_p.F176Y	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	176					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCAGTAGGAGAAGTCGGGCAG	0.602																																						uc002dov.1		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(526-528)TTC>TAC		general transcription factor IIIC, polypeptide							71.0	69.0	69.0					16																	27549582		2197	4300	6497	SO:0001583	missense	2975					transcription factor TFIIIC complex	DNA binding|protein binding	g.chr16:27549582A>T	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.527T>A	16.37:g.27549582A>T	ENSP00000348510:p.Phe176Tyr		Somatic				GTF3C1_uc002dou.2_Missense_Mutation_p.F176Y	p.F176Y	NM_001520	NP_001511	WXS	Illumina HiSeq	Unspecified	Q12789	TF3C1_HUMAN			3	567	-			176					B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	c.527T>A	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760265	0.69763	.	.	ENSG00000077235	ENST00000356183	T	0.23950	1.88	5.73	5.73	0.89815	.	0.443413	0.26719	N	0.022844	T	0.33381	0.0861	L	0.29908	0.895	0.26173	N	0.979836	D;D	0.89917	1.0;0.997	D;D	0.70016	0.967;0.917	T	0.16276	-1.0408	10	0.12103	T	0.63	-2.0031	11.9184	0.52778	0.8548:0.1452:0.0:0.0	.	176;176	Q12789;Q12789-3	TF3C1_HUMAN;.	Y	176	ENSP00000348510:F176Y	ENSP00000348510:F176Y	F	-	2	0	GTF3C1	27457083	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	4.364000	0.59479	2.308000	0.77769	0.533000	0.62120	TTC		0.602	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		16	93	0	0	0	0	16	93				
DOC2A	8448	broad.mit.edu	37	16	30018259	30018259	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:30018259G>A	ENST00000350119.4	-	8	915	c.725C>T	c.(724-726)gCg>gTg	p.A242V	DOC2A_ENST00000564944.1_Missense_Mutation_p.A242V|DOC2A_ENST00000564979.1_Missense_Mutation_p.A242V	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	242	Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						CCCCTGCTCCGCCTGCTCCAA	0.682																																						uc002dvm.2		NA																	0				ovary(2)	2						c.(724-726)GCG>GTG		double C2-like domains, alpha							23.0	25.0	24.0					16																	30018259		2197	4294	6491	SO:0001583	missense	8448				nervous system development|regulation of calcium ion-dependent exocytosis	cell junction|lysosome|synaptic vesicle membrane|synaptosome	calcium-dependent phospholipid binding|protein binding|transporter activity	g.chr16:30018259G>A	D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.725C>T	16.37:g.30018259G>A	ENSP00000340017:p.Ala242Val		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|DOC2A_uc002dvl.2_Missense_Mutation_p.A240V|DOC2A_uc002dvn.2_Missense_Mutation_p.A242V|DOC2A_uc010vef.1_RNA|DOC2A_uc002dvo.2_Missense_Mutation_p.A242V|DOC2A_uc002dvp.2_Missense_Mutation_p.A242V|DOC2A_uc002dvq.2_Missense_Mutation_p.A242V	p.A242V	NM_003586	NP_003577	WXS	Illumina HiSeq	Unspecified	Q14183	DOC2A_HUMAN			8	825	-			242			Interaction with UNC13D.		B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	ENST00000350119.4	37	c.725C>T	CCDS10666.1	.	.	.	.	.	.	.	.	.	.	g	0.070	-1.203871	0.01581	.	.	ENSG00000149927	ENST00000350119	T	0.62364	0.03	5.14	-0.309	0.12769	.	0.366899	0.23153	N	0.051329	T	0.37919	0.1021	N	0.14661	0.345	0.22354	N	0.999176	B	0.11235	0.004	B	0.04013	0.001	T	0.16012	-1.0417	10	0.28530	T	0.3	.	8.1798	0.31305	0.4203:0.0:0.5797:0.0	.	242	Q14183	DOC2A_HUMAN	V	242	ENSP00000340017:A242V	ENSP00000340017:A242V	A	-	2	0	DOC2A	29925760	0.066000	0.20996	0.036000	0.18154	0.015000	0.08874	0.633000	0.24598	-0.178000	0.10672	-0.320000	0.08662	GCG		0.682	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255148.2	NM_003586		8	22	0	0	0	0	8	22				
SETD1A	9739	broad.mit.edu	37	16	30995053	30995053	+	Missense_Mutation	SNP	A	A	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:30995053A>C	ENST00000262519.8	+	18	5596	c.4910A>C	c.(4909-4911)aAg>aCg	p.K1637T	HSD3B7_ENST00000262520.6_5'Flank|HSD3B7_ENST00000297679.5_5'Flank|HSD3B7_ENST00000353250.5_5'Flank	NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1637	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GATGCCACCAAGTGTGGCAAC	0.652																																						uc002ead.1		NA																	0				ovary(2)|skin(1)	3						c.(4909-4911)AAG>ACG		SET domain containing 1A							83.0	68.0	73.0					16																	30995053		2197	4300	6497	SO:0001583	missense	9739				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding	g.chr16:30995053A>C	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4910A>C	16.37:g.30995053A>C	ENSP00000262519:p.Lys1637Thr		Somatic				HSD3B7_uc002eaf.2_5'Flank|HSD3B7_uc010cac.2_5'Flank|HSD3B7_uc002eag.2_5'Flank|HSD3B7_uc002eah.2_5'Flank	p.K1637T	NM_014712	NP_055527	WXS	Illumina HiSeq	Unspecified	O15047	SET1A_HUMAN			18	5596	+			1637			SET.		A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	c.4910A>C	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	A	14.63	2.592367	0.46214	.	.	ENSG00000099381	ENST00000262519	T	0.80653	-1.4	4.76	4.76	0.60689	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.87842	0.6279	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88887	0.3343	10	0.66056	D	0.02	.	13.3863	0.60797	1.0:0.0:0.0:0.0	.	1637	O15047	SET1A_HUMAN	T	1637	ENSP00000262519:K1637T	ENSP00000262519:K1637T	K	+	2	0	SETD1A	30902554	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.312000	0.78968	2.005000	0.58758	0.455000	0.32223	AAG		0.652	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712		10	37	0	0	0	0	10	37				
N4BP1	9683	broad.mit.edu	37	16	48580115	48580115	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:48580115G>T	ENST00000262384.3	-	6	2512	c.2276C>A	c.(2275-2277)cCt>cAt	p.P759H	N4BP1_ENST00000565423.1_Intron	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	759					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				TCTTCCCAGAGGATCATCGGG	0.458																																						uc002efp.2		NA																	0					0						c.(2275-2277)CCT>CAT		Nedd4 binding protein 1							114.0	110.0	111.0					16																	48580115		1941	4134	6075	SO:0001583	missense	9683				negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body		g.chr16:48580115G>T	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2276C>A	16.37:g.48580115G>T	ENSP00000262384:p.Pro759His		Somatic					p.P759H	NM_153029	NP_694574	WXS	Illumina HiSeq	Unspecified	O75113	N4BP1_HUMAN			6	2513	-		all_cancers(37;0.179)|all_lung(18;0.11)	759					A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	c.2276C>A	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	G	32	5.191331	0.94923	.	.	ENSG00000102921	ENST00000262384	T	0.48522	0.81	5.87	5.87	0.94306	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.78091	0.4229	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82442	-0.0455	10	0.87932	D	0	-25.5173	20.2181	0.98305	0.0:0.0:1.0:0.0	.	759	O75113	N4BP1_HUMAN	H	759	ENSP00000262384:P759H	ENSP00000262384:P759H	P	-	2	0	N4BP1	47137616	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.356000	0.79445	2.785000	0.95823	0.655000	0.94253	CCT		0.458	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664		20	75	1	0	2.89e-11	4.95e-11	20	75				
SETD6	79918	broad.mit.edu	37	16	58552440	58552440	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr16:58552440C>T	ENST00000219315.4	+	7	1159	c.1109C>T	c.(1108-1110)aCa>aTa	p.T370I	SETD6_ENST00000394266.4_Missense_Mutation_p.T301I|SETD6_ENST00000310682.2_Missense_Mutation_p.T346I			Q8TBK2	SETD6_HUMAN	SET domain containing 6	370					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						CTGACCACCACACTAAAGGTA	0.443																																						uc002ens.2		NA																	0				ovary(1)	1						c.(1108-1110)ACA>ATA		SET domain containing 6 isoform a							89.0	83.0	85.0					16																	58552440		2198	4300	6498	SO:0001583	missense	79918				negative regulation of NF-kappaB transcription factor activity|peptidyl-lysine monomethylation|regulation of inflammatory response	nucleus	NF-kappaB binding|protein-lysine N-methyltransferase activity	g.chr16:58552440C>T	AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.1109C>T	16.37:g.58552440C>T	ENSP00000219315:p.Thr370Ile		Somatic				SETD6_uc002enr.2_Missense_Mutation_p.T346I|SETD6_uc010cdm.2_RNA	p.T370I	NM_001160305	NP_001153777	WXS	Illumina HiSeq	Unspecified	Q8TBK2	SETD6_HUMAN			7	1168	+			370					A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	37	c.1109C>T	CCDS54013.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898735	0.52227	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315;ENST00000447443	T;T;T;T	0.21734	2.34;2.34;2.34;1.99	5.6	5.6	0.85130	Rubisco LS methyltransferase, substrate-binding domain (2);	0.176769	0.50627	D	0.000107	T	0.28067	0.0692	L	0.55103	1.725	0.49582	D	0.9998	P;P	0.41214	0.728;0.742	P;B	0.46026	0.501;0.338	T	0.00981	-1.1492	10	0.27082	T	0.32	-14.5856	14.2326	0.65903	0.0:0.851:0.149:0.0	.	370;346	Q8TBK2;Q8TBK2-2	SETD6_HUMAN;.	I	346;301;370;132	ENSP00000310082:T346I;ENSP00000377809:T301I;ENSP00000219315:T370I;ENSP00000396437:T132I	ENSP00000219315:T370I	T	+	2	0	SETD6	57109941	0.996000	0.38824	0.987000	0.45799	0.603000	0.37013	5.400000	0.66320	2.624000	0.88883	0.561000	0.74099	ACA		0.443	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	NM_024860		8	55	0	0	0	0	8	55				
CNTROB	116840	broad.mit.edu	37	17	7847811	7847811	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:7847811C>T	ENST00000563694.1	+	12	2514	c.1589C>T	c.(1588-1590)gCg>gTg	p.A530V	CNTROB_ENST00000380255.3_Intron|CNTROB_ENST00000565740.1_Missense_Mutation_p.A530V|CNTROB_ENST00000380262.3_Missense_Mutation_p.A530V	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	530	Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				CGGGAGCAAGCGCGAGTGTGC	0.567																																						uc002gjq.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(1588-1590)GCG>GTG		centrobin, centrosomal BRCA2 interacting protein							37.0	39.0	39.0					17																	7847811		2203	4300	6503	SO:0001583	missense	116840				centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding	g.chr17:7847811C>T	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.1589C>T	17.37:g.7847811C>T	ENSP00000456335:p.Ala530Val		Somatic				CNTROB_uc002gjp.2_Missense_Mutation_p.A530V|CNTROB_uc002gjr.2_Missense_Mutation_p.A432V|CNTROB_uc010vum.1_3'UTR	p.A530V	NM_053051	NP_444279	WXS	Illumina HiSeq	Unspecified	Q8N137	CNTRB_HUMAN			13	2508	+		Prostate(122;0.173)	530			Potential.|Required for centrosome localization.		A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	37	c.1589C>T	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339801	0.60963	.	.	ENSG00000170037	ENST00000380262	T	0.46451	0.87	4.56	4.56	0.56223	.	0.000000	0.52532	D	0.000064	T	0.43722	0.1260	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.63488	0.915;0.885;0.915	T	0.32613	-0.9900	10	0.48119	T	0.1	-12.6443	10.3272	0.43801	0.3057:0.6943:0.0:0.0	.	530;530;530	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	V	530	ENSP00000369614:A530V	ENSP00000369614:A530V	A	+	2	0	CNTROB	7788536	0.857000	0.29778	0.819000	0.32651	0.622000	0.37654	1.690000	0.37711	2.530000	0.85305	0.561000	0.74099	GCG		0.567	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051		5	30	0	0	0	0	5	30				
ASIC2	40	broad.mit.edu	37	17	32483155	32483155	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:32483155C>T	ENST00000359872.6	-	1	1158	c.397G>A	c.(397-399)Gtg>Atg	p.V133M		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	133					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GCCTCCAGCACGGAGGGGTCA	0.612																																						uc002hhu.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(397-399)GTG>ATG		amiloride-sensitive cation channel 1, neuronal	Amiloride(DB00594)						84.0	93.0	90.0					17																	32483155		2136	4252	6388	SO:0001583	missense	40				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding	g.chr17:32483155C>T	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.397G>A	17.37:g.32483155C>T	ENSP00000352934:p.Val133Met		Somatic					p.V133M	NM_001094	NP_001085	WXS	Illumina HiSeq	Unspecified	Q16515	ACCN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	1	671	-		Breast(31;0.042)|Ovarian(249;0.202)	133			Extracellular (By similarity).		E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	c.397G>A	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	C	8.298	0.819160	0.16607	.	.	ENSG00000108684	ENST00000359872	T	0.63744	-0.06	4.96	4.96	0.65561	.	.	.	.	.	T	0.60090	0.2242	L	0.59912	1.85	0.35233	D	0.777119	P	0.42039	0.769	B	0.40199	0.322	T	0.69617	-0.5097	9	0.33940	T	0.23	.	15.7471	0.77955	0.0:1.0:0.0:0.0	.	133	Q16515	ACCN1_HUMAN	M	133	ENSP00000352934:V133M	ENSP00000352934:V133M	V	-	1	0	ACCN1	29507268	1.000000	0.71417	0.000000	0.03702	0.059000	0.15707	5.927000	0.70080	2.559000	0.86315	0.655000	0.94253	GTG		0.612	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094		14	97	0	0	0	0	14	97				
IFI35	3430	broad.mit.edu	37	17	41168533	41168533	+	IGR	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:41168533T>C	ENST00000415816.2	+	0	1241				VAT1_ENST00000420567.3_Missense_Mutation_p.N163D|VAT1_ENST00000355653.3_Missense_Mutation_p.N297D|VAT1_ENST00000587173.1_Missense_Mutation_p.N229D	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35						cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		GCCATCAGGTTCCGTTTGGGG	0.612																																						uc002icm.1		NA																	0					0						c.(889-891)AAC>GAC		vesicle amine transport protein 1							44.0	40.0	41.0					17																	41168533		2203	4300	6503	SO:0001628	intergenic_variant	10493					cytoplasm|integral to membrane	oxidoreductase activity|zinc ion binding	g.chr17:41168533T>C	BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720		17.37:g.41168533T>C			Somatic				VAT1_uc010cyw.1_Missense_Mutation_p.N163D|VAT1_uc010whk.1_Missense_Mutation_p.N229D	p.N297D	NM_006373	NP_006364	WXS	Illumina HiSeq	Unspecified	Q99536	VAT1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.156)	5	1009	-		Breast(137;0.000717)	297					C9JGX1|Q92984|Q99537|Q9BV98	Missense_Mutation	SNP	ENST00000415816.2	37	c.889A>G		.	.	.	.	.	.	.	.	.	.	T	26.6	4.755534	0.89843	.	.	ENSG00000108828	ENST00000355653;ENST00000542468;ENST00000420567	T;T	0.11821	3.51;2.74	5.6	5.6	0.85130	Alcohol dehydrogenase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.36054	0.0953	M	0.76574	2.34	0.80722	D	1	D;D	0.67145	0.992;0.996	D;D	0.67231	0.912;0.95	T	0.05852	-1.0860	10	0.32370	T	0.25	-17.4446	15.7715	0.78173	0.0:0.0:0.0:1.0	.	229;297	B4DPX4;Q99536	.;VAT1_HUMAN	D	297;204;163	ENSP00000347872:N297D;ENSP00000408553:N163D	ENSP00000347872:N297D	N	-	1	0	VAT1	38422059	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.008000	0.88588	2.132000	0.65825	0.459000	0.35465	AAC		0.612	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000395851.1	NM_005533		3	25	0	0	0	0	3	25				
NSF	4905	broad.mit.edu	37	17	44770322	44770322	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:44770322C>T	ENST00000398238.4	+	10	1106	c.999C>T	c.(997-999)atC>atT	p.I333I	NSF_ENST00000225282.8_Silent_p.I239I|NSF_ENST00000575068.1_Silent_p.I328I	NM_006178.3	NP_006169.2	P46459	NSF_HUMAN	N-ethylmaleimide-sensitive factor	333					exocytosis (GO:0006887)|plasma membrane fusion (GO:0045026)|positive regulation of receptor recycling (GO:0001921)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|syntaxin-1 binding (GO:0017075)			kidney(2)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		TTGATGCCATCTGCAAGCAGA	0.418																																					Ovarian(25;472 742 1472 36813 50223)	uc002iku.2		NA																	0				ovary(1)	1						c.(997-999)ATC>ATT		vesicle-fusing ATPase							28.0	25.0	26.0					17																	44770322		1830	4053	5883	SO:0001819	synonymous_variant	4905				protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding	g.chr17:44770322C>T		CCDS42354.1	17q21	2010-04-21			ENSG00000073969	ENSG00000073969		"""ATPases / AAA-type"""	8016	protein-coding gene	gene with protein product	"""N-ethylmaleimide-sensitive factor-like protein"""	601633				1315316, 8875895	Standard	NM_006178		Approved	SKD2	uc002iku.3	P46459	OTTHUMG00000134315	ENST00000398238.4:c.999C>T	17.37:g.44770322C>T			Somatic				NSF_uc010wke.1_Silent_p.I239I|NSF_uc010wkf.1_Silent_p.I239I|NSF_uc010wkg.1_Silent_p.I328I	p.I333I	NM_006178	NP_006169	WXS	Illumina HiSeq	Unspecified	P46459	NSF_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)	10	1103	+		Melanoma(429;0.203)	333					A8K2D9|B4DFA2|Q8N6D7|Q9UKZ2	Silent	SNP	ENST00000398238.4	37	c.999C>T	CCDS42354.1																																																																																				0.418	NSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259348.2	NM_006178		4	28	0	0	0	0	4	28				
COL1A1	1277	broad.mit.edu	37	17	48263006	48263006	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:48263006G>A	ENST00000225964.5	-	51	4370	c.4252C>T	c.(4252-4254)Cac>Tac	p.H1418Y		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1418	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GCTCCGGTGTGACTCTGGGGT	0.617			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															uc002iqm.2		NA		Dom	yes		17	17q21.31-q22	1277	T	"""collagen, type I, alpha 1"""	yes	Osteogenesis imperfecta	M	PDGFB|USP6		dermatofibrosarcoma protuberans|aneurysmal bone cyst 	COL1A1/PDGFB(372)	0				soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382						c.(4252-4254)CAC>TAC		alpha 1 type I collagen preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						70.0	61.0	64.0					17																	48263006		2203	4300	6503	SO:0001583	missense	1277				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding	g.chr17:48263006G>A	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.4252C>T	17.37:g.48263006G>A	ENSP00000225964:p.His1418Tyr		Somatic					p.H1418Y	NM_000088	NP_000079	WXS	Illumina HiSeq	Unspecified	P02452	CO1A1_HUMAN			51	4378	-			1418			Fibrillar collagen NC1.		O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	37	c.4252C>T	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805070	0.50315	.	.	ENSG00000108821	ENST00000225964	T	0.73469	-0.75	4.49	4.49	0.54785	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.88945	0.6575	M	0.92970	3.365	0.80722	D	1	D	0.62365	0.991	D	0.76575	0.988	D	0.91256	0.5033	10	0.56958	D	0.05	.	16.098	0.81144	0.0:0.0:1.0:0.0	.	1418	P02452	CO1A1_HUMAN	Y	1418	ENSP00000225964:H1418Y	ENSP00000225964:H1418Y	H	-	1	0	COL1A1	45618005	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.720000	0.84759	2.333000	0.79357	0.313000	0.20887	CAC		0.617	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2			8	40	0	0	0	0	8	40				
RPS6KB1	6198	broad.mit.edu	37	17	58009058	58009058	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:58009058G>A	ENST00000225577.4	+	7	684	c.663G>A	c.(661-663)ccG>ccA	p.P221P	RPS6KB1_ENST00000393021.3_Silent_p.P168P|RPS6KB1_ENST00000406116.3_Silent_p.P221P|RPS6KB1_ENST00000443572.2_Silent_p.P198P	NM_001272042.1|NM_001272044.1|NM_001272060.1|NM_003161.2	NP_001258971.1|NP_001258973.1|NP_001258989.1|NP_003152.1	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 1	221	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				aging (GO:0007568)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell development (GO:0007281)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue growth (GO:0048633)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of glucose import (GO:0046324)|response to drug (GO:0042493)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to leucine (GO:0043201)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|response to tumor necrosis factor (GO:0034612)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			ACCTGAAGCCGGAGAATATCA	0.388																																						uc002ixy.2		NA																	0				large_intestine(1)	1						c.(661-663)CCG>CCA		ribosomal protein S6 kinase, 70kDa, polypeptide							62.0	59.0	60.0					17																	58009058		2203	4300	6503	SO:0001819	synonymous_variant	6198				apoptosis|G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|negative regulation of apoptosis|phosphatidylinositol-mediated signaling|positive regulation of mitotic cell cycle|positive regulation of translational initiation|TOR signaling cascade	cell junction|cytoplasm|cytosol|mitochondrial outer membrane|nucleus|nucleus|synapse|synaptosome	ATP binding|protein binding|protein kinase activity	g.chr17:58009058G>A	M60724	CCDS11621.1, CCDS62271.1, CCDS62272.1, CCDS62273.1	17q23.1	2011-04-05	2002-08-29		ENSG00000108443	ENSG00000108443			10436	protein-coding gene	gene with protein product		608938	"""ribosomal protein S6 kinase, 70kD, polypeptide 1"""	STK14A		1922062	Standard	NM_003161		Approved	S6K1, p70(S6K)-alpha, PS6K	uc002ixy.4	P23443	OTTHUMG00000150642	ENST00000225577.4:c.663G>A	17.37:g.58009058G>A			Somatic				RPS6KB1_uc010ddj.1_Silent_p.P221P|RPS6KB1_uc010wom.1_Silent_p.P168P|RPS6KB1_uc010won.1_Silent_p.P198P|RPS6KB1_uc010woo.1_Silent_p.P156P	p.P221P	NM_003161	NP_003152	WXS	Illumina HiSeq	Unspecified	P23443	KS6B1_HUMAN	Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)		7	766	+	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		221			Protein kinase.		B2R779|B4DLT4|B4DTG1|E7ESB8|F6UYM1|Q7Z721	Silent	SNP	ENST00000225577.4	37	c.663G>A	CCDS11621.1																																																																																				0.388	RPS6KB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319324.1	NM_003161		7	38	0	0	0	0	7	38				
SMURF2	64750	broad.mit.edu	37	17	62589665	62589665	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:62589665G>A	ENST00000262435.9	-	4	414	c.227C>T	c.(226-228)aCg>aTg	p.T76M	SMURF2_ENST00000578200.1_Intron	NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	76	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			TACACTGATCGTAACTGAATC	0.393																																						uc002jep.1		NA																	0				skin(3)|lung(1)	4						c.(226-228)ACG>ATG		SMAD specific E3 ubiquitin protein ligase 2							86.0	78.0	81.0					17																	62589665		2203	4300	6503	SO:0001583	missense	64750				BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity	g.chr17:62589665G>A	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.227C>T	17.37:g.62589665G>A	ENSP00000262435:p.Thr76Met		Somatic				SMURF2_uc002jeq.1_Translation_Start_Site|SMURF2_uc002jer.1_Translation_Start_Site	p.T76M	NM_022739	NP_073576	WXS	Illumina HiSeq	Unspecified	Q9HAU4	SMUF2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;9.88e-12)		4	615	-	Breast(5;1.32e-14)		76			C2.		Q52LL1|Q9H260	Missense_Mutation	SNP	ENST00000262435.9	37	c.227C>T	CCDS32707.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845786	0.51164	.	.	ENSG00000108854	ENST00000262435	T	0.69926	-0.44	5.82	5.82	0.92795	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.84183	0.5416	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.85154	0.0988	10	0.66056	D	0.02	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	76	Q9HAU4	SMUF2_HUMAN	M	76	ENSP00000262435:T76M	ENSP00000262435:T76M	T	-	2	0	SMURF2	60020127	1.000000	0.71417	0.931000	0.37212	0.994000	0.84299	9.779000	0.99018	2.752000	0.94435	0.655000	0.94253	ACG		0.393	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445227.1	NM_022739		6	64	0	0	0	0	6	64				
ARSG	22901	broad.mit.edu	37	17	66381312	66381312	+	Splice_Site	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:66381312A>T	ENST00000448504.2	+	9	1886	c.1090A>T	c.(1090-1092)Agc>Tgc	p.S364C	ARSG_ENST00000452479.2_Splice_Site_p.S200C|ARSG_ENST00000582154.1_3'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	364					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGCCTTGTTAAGGTATGAGAC	0.562																																						uc002jhc.2		NA																	0				ovary(1)	1						c.(1090-1092)AGC>TGC		Arylsulfatase G precursor							70.0	66.0	67.0					17																	66381312		2203	4300	6503	SO:0001630	splice_region_variant	22901				sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding	g.chr17:66381312A>T	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.1091+1A>T	17.37:g.66381312A>T			Somatic				ARSG_uc002jhb.1_Missense_Mutation_p.S200C	p.S364C	NM_014960	NP_055775	WXS	Illumina HiSeq	Unspecified	Q96EG1	ARSG_HUMAN	BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)		9	1886	+			364					Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	c.1090A>T	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.613282	0.87359	.	.	ENSG00000141337	ENST00000452479;ENST00000448504	.	.	.	5.38	5.38	0.77491	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.77785	0.4182	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80233	-0.1467	9	0.66056	D	0.02	.	14.3697	0.66830	1.0:0.0:0.0:0.0	.	364	Q96EG1	ARSG_HUMAN	C	364;263	.	ENSP00000407193:S263C	S	+	1	0	ARSG	63892907	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.919000	0.75793	2.034000	0.60081	0.379000	0.24179	AGC		0.562	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	Missense_Mutation	24	49	0	0	0	0	24	49				
SYT4	6860	broad.mit.edu	37	18	40854093	40854093	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr18:40854093G>T	ENST00000255224.3	-	2	669	c.301C>A	c.(301-303)Ctc>Atc	p.L101I	SYT4_ENST00000590752.1_Missense_Mutation_p.L83I|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	101					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						TTGCCATTGAGATCTCTCTTT	0.398																																					NSCLC(85;81 1419 2855 22820 35912)	uc002law.2		NA																	0				skin(5)	5						c.(301-303)CTC>ATC		synaptotagmin IV							149.0	147.0	148.0					18																	40854093		2203	4300	6503	SO:0001583	missense	6860					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr18:40854093G>T	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.301C>A	18.37:g.40854093G>T	ENSP00000255224:p.Leu101Ile		Somatic				SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.L83I|SYT4_uc010dnh.2_Intron	p.L101I	NM_020783	NP_065834	WXS	Illumina HiSeq	Unspecified	Q9H2B2	SYT4_HUMAN			2	670	-			101			Cytoplasmic (Potential).		B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	c.301C>A	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262146	0.80358	.	.	ENSG00000132872	ENST00000255224	T	0.39056	1.1	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	D;D	0.72625	0.978;0.978	T	0.54977	-0.8212	10	0.34782	T	0.22	.	13.7319	0.62792	0.0702:0.0:0.9298:0.0	.	83;101	B4DEU3;Q9H2B2	.;SYT4_HUMAN	I	101	ENSP00000255224:L101I	ENSP00000255224:L101I	L	-	1	0	SYT4	39108091	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.163000	0.64948	2.937000	0.99478	0.650000	0.86243	CTC		0.398	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783		12	90	1	0	1.36e-13	2.38e-13	12	90				
ST8SIA5	29906	broad.mit.edu	37	18	44260231	44260231	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr18:44260231C>T	ENST00000315087.7	-	7	1565	c.905G>A	c.(904-906)gGc>gAc	p.G302D	ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.G271D|ST8SIA5_ENST00000538168.1_Missense_Mutation_p.G338D	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	302					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						CAGAATGAGGCCGGTGCTGAT	0.622																																						uc002lcj.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(904-906)GGC>GAC		ST8 alpha-N-acetyl-neuraminide							89.0	87.0	87.0					18																	44260231		2203	4300	6503	SO:0001583	missense	29906				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane		g.chr18:44260231C>T	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.905G>A	18.37:g.44260231C>T	ENSP00000321343:p.Gly302Asp		Somatic				ST8SIA5_uc002lci.1_Missense_Mutation_p.G149D|ST8SIA5_uc010xcy.1_Missense_Mutation_p.G338D|ST8SIA5_uc010xcz.1_Missense_Mutation_p.G271D	p.G302D	NM_013305	NP_037437	WXS	Illumina HiSeq	Unspecified	O15466	SIA8E_HUMAN			7	1473	-			302			Lumenal (Potential).		B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	37	c.905G>A	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	C	33	5.200743	0.94997	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.76839	-1.05;-1.05;-1.05	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.92143	0.7509	H	0.95780	3.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94097	0.7358	10	0.87932	D	0	-7.6235	19.4172	0.94706	0.0:1.0:0.0:0.0	.	271;338;302	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	D	302;338;271	ENSP00000321343:G302D;ENSP00000445492:G338D;ENSP00000443683:G271D	ENSP00000321343:G302D	G	-	2	0	ST8SIA5	42514229	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.786000	0.85741	2.584000	0.87258	0.561000	0.74099	GGC		0.622	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305		15	75	0	0	0	0	15	75				
CDH7	1005	broad.mit.edu	37	18	63511243	63511243	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr18:63511243G>A	ENST00000397968.2	+	7	1603	c.1177G>A	c.(1177-1179)Ggg>Agg	p.G393R	CDH7_ENST00000323011.3_Missense_Mutation_p.G393R|CDH7_ENST00000536984.2_Missense_Mutation_p.G393R	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	393	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TACCCAGGTTGGGAATATCAT	0.448																																						uc002ljz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(1177-1179)GGG>AGG		cadherin 7, type 2 preproprotein							161.0	138.0	146.0					18																	63511243		2203	4300	6503	SO:0001583	missense	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63511243G>A	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1177G>A	18.37:g.63511243G>A	ENSP00000381058:p.Gly393Arg		Somatic				CDH7_uc002lka.2_Missense_Mutation_p.G393R|CDH7_uc002lkb.2_Missense_Mutation_p.G393R	p.G393R	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			7	1502	+		Esophageal squamous(42;0.129)	393			Extracellular (Potential).|Cadherin 4.		Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	c.1177G>A	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610528	0.66558	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.69806	-0.43;-0.43;-0.43	4.75	4.75	0.60458	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.87783	0.6264	H	0.96048	3.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	D	0.91792	0.5444	10	0.72032	D	0.01	.	17.9193	0.88961	0.0:0.0:1.0:0.0	.	393;393	F5H5X9;Q9ULB5	.;CADH7_HUMAN	R	393	ENSP00000319166:G393R;ENSP00000443030:G393R;ENSP00000381058:G393R	ENSP00000319166:G393R	G	+	1	0	CDH7	61662223	1.000000	0.71417	0.964000	0.40570	0.259000	0.26198	9.012000	0.93624	2.436000	0.82500	0.655000	0.94253	GGG		0.448	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		41	75	0	0	0	0	41	75				
TSHZ1	10194	broad.mit.edu	37	18	72999914	72999914	+	Missense_Mutation	SNP	T	T	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr18:72999914T>A	ENST00000580243.1	+	2	2900	c.2552T>A	c.(2551-2553)cTg>cAg	p.L851Q	TSHZ1_ENST00000322038.5_Missense_Mutation_p.L806Q			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	851					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ACAGGCCGCCTGACGCCCAAG	0.602																																						uc002lly.2		NA																	0					0						c.(2416-2418)CTG>CAG		teashirt family zinc finger 1							68.0	62.0	64.0					18																	72999914		2203	4300	6503	SO:0001583	missense	10194					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:72999914T>A	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2552T>A	18.37:g.72999914T>A	ENSP00000464391:p.Leu851Gln		Somatic					p.L806Q	NM_005786	NP_005777	WXS	Illumina HiSeq	Unspecified	Q6ZSZ6	TSH1_HUMAN		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)	2	2980	+		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)	851					O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	37	c.2417T>A		.	.	.	.	.	.	.	.	.	.	T	6.171	0.399791	0.11696	.	.	ENSG00000179981	ENST00000322038	T	0.12361	2.69	4.96	4.96	0.65561	.	0.080798	0.51477	D	0.000085	T	0.29423	0.0733	M	0.70595	2.14	0.41537	D	0.98849	D	0.71674	0.998	P	0.60345	0.873	T	0.01111	-1.1448	10	0.28530	T	0.3	-23.7354	10.2191	0.43186	0.1481:0.0:0.0:0.8518	.	851	Q6ZSZ6	TSH1_HUMAN	Q	806	ENSP00000323584:L806Q	ENSP00000323584:L806Q	L	+	2	0	TSHZ1	71128902	1.000000	0.71417	0.982000	0.44146	0.678000	0.39670	7.655000	0.83696	-0.081000	0.12662	0.561000	0.74099	CTG		0.602	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786		9	79	0	0	0	0	9	79				
SALL3	27164	broad.mit.edu	37	18	76757094	76757094	+	Missense_Mutation	SNP	G	G	A	rs562185028	byFrequency	TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr18:76757094G>A	ENST00000537592.2	+	3	3675	c.3675G>A	c.(3673-3675)atG>atA	p.M1225I	SALL3_ENST00000536229.3_Missense_Mutation_p.M1020I|SALL3_ENST00000575389.2_Missense_Mutation_p.M1153I	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1225					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGCTCGCCATGAAGAACAACG	0.602																																						uc002lmt.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(3673-3675)ATG>ATA		sal-like 3							111.0	102.0	105.0					18																	76757094		2203	4300	6503	SO:0001583	missense	27164				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:76757094G>A	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3675G>A	18.37:g.76757094G>A	ENSP00000441823:p.Met1225Ile		Somatic				SALL3_uc010dra.2_Missense_Mutation_p.M760I	p.M1225I	NM_171999	NP_741996	WXS	Illumina HiSeq	Unspecified	Q9BXA9	SALL3_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)	3	3675	+		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)	1225					Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	c.3675G>A	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853591	0.51270	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.51071	0.72	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000001	T	0.73418	0.3584	M	0.86651	2.83	0.80722	D	1	P;D	0.63880	0.951;0.993	P;D	0.70227	0.553;0.968	T	0.77686	-0.2495	10	0.54805	T	0.06	-52.3722	18.7722	0.91896	0.0:0.0:1.0:0.0	.	885;1225	F5GXY4;Q9BXA9	.;SALL3_HUMAN	I	1225;1153;885	ENSP00000441823:M1225I	ENSP00000299466:M1225I	M	+	3	0	SALL3	74858082	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.904000	0.87408	2.423000	0.82170	0.561000	0.74099	ATG		0.602	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999		35	166	0	0	0	0	35	166				
C3	718	broad.mit.edu	37	19	6714452	6714452	+	Silent	SNP	C	C	T	rs370998019		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:6714452C>T	ENST00000245907.6	-	5	602	c.510G>A	c.(508-510)ccG>ccA	p.P170P		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	170					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	GGATGCCTTCCGGGTTCTGTG	0.562													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19645	0.0		0.0	False		,,,				2504	0.0					uc002mfm.2		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(508-510)CCG>CCA		complement component 3 precursor				1,4405	2.1+/-5.4	0,1,2202	59.0	50.0	53.0		510	-9.9	0.0	19		53	0,8598		0,0,4299	no	coding-synonymous	C3	NM_000064.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		170/1664	6714452	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6714452C>T	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.510G>A	19.37:g.6714452C>T			Somatic					p.P170P	NM_000064	NP_000055	WXS	Illumina HiSeq	Unspecified	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	5	572	-			170					A7E236	Silent	SNP	ENST00000245907.6	37	c.510G>A	CCDS32883.1																																																																																				0.562	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064		5	43	0	0	0	0	5	43				
PDE4A	5141	broad.mit.edu	37	19	10570295	10570295	+	Missense_Mutation	SNP	C	C	T	rs201196140		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:10570295C>T	ENST00000352831.6	+	10	1335	c.1225C>T	c.(1225-1227)Cgc>Tgc	p.R409C	PDE4A_ENST00000380702.2_Missense_Mutation_p.R387C|PDE4A_ENST00000344979.3_Missense_Mutation_p.R170C|PDE4A_ENST00000592685.1_Missense_Mutation_p.R387C|PDE4A_ENST00000440014.2_Missense_Mutation_p.R348C|PDE4A_ENST00000293683.5_Missense_Mutation_p.R383C	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	409	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	GAAGAAATTCCGCATCCCTGT	0.637																																						uc002moj.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1225-1227)CGC>TGC		phosphodiesterase 4A isoform 1	Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)						62.0	55.0	57.0					19																	10570295		2203	4300	6503	SO:0001583	missense	5141				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding	g.chr19:10570295C>T		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1225C>T	19.37:g.10570295C>T	ENSP00000270474:p.Arg409Cys		Somatic				PDE4A_uc002mok.2_Missense_Mutation_p.R383C|PDE4A_uc002mol.2_Missense_Mutation_p.R348C|PDE4A_uc002mom.2_Missense_Mutation_p.R170C|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_Missense_Mutation_p.R75C	p.R409C	NM_001111307	NP_001104777	WXS	Illumina HiSeq	Unspecified	P27815	PDE4A_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		10	1333	+			409			Catalytic.		O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	c.1225C>T	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407363	0.42715	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	4.28	3.18	0.36537	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.477651	0.19080	N	0.123273	T	0.72350	0.3449	L	0.40543	1.245	0.40974	D	0.984725	B;D;D;B;B	0.71674	0.059;0.998;0.998;0.115;0.045	B;P;P;B;B	0.60173	0.012;0.87;0.766;0.03;0.009	T	0.73889	-0.3840	10	0.59425	D	0.04	.	9.6507	0.39895	0.3415:0.6585:0.0:0.0	.	75;170;348;383;409	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	C	387;409;383;348;170;75	ENSP00000370078:R387C;ENSP00000270474:R409C;ENSP00000293683:R383C;ENSP00000394754:R348C;ENSP00000341007:R170C	ENSP00000293683:R383C	R	+	1	0	PDE4A	10431295	0.008000	0.16893	1.000000	0.80357	0.995000	0.86356	0.197000	0.17197	2.224000	0.72417	0.561000	0.74099	CGC		0.637	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1			6	39	0	0	0	0	6	39				
SMARCA4	6597	broad.mit.edu	37	19	11101902	11101902	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:11101902G>A	ENST00000429416.3	+	9	1603	c.1322G>A	c.(1321-1323)cGc>cAc	p.R441H	SMARCA4_ENST00000344626.4_Missense_Mutation_p.R441H|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R441H|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R441H|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R441H|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R441H|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R441H|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R441H|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R441H	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	441					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GCCTACAAGCGCAGCAAGCGC	0.632			"""F, N, Mis"""		NSCLC																																	uc002mqf.3		NA		Rec	yes		19	19p13.2	6597	F|N|Mis	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""			E			NSCLC		1	Unknown(1)	p.?(1)	lung(1)	lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67						c.(1321-1323)CGC>CAC		SWI/SNF-related matrix-associated							49.0	47.0	47.0					19																	11101902		2203	4300	6503	SO:0001583	missense	6597	Rhabdoid_Predisposition_syndrome			chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	g.chr19:11101902G>A	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1322G>A	19.37:g.11101902G>A	ENSP00000395654:p.Arg441His		Somatic				SMARCA4_uc010dxp.2_Missense_Mutation_p.R441H|SMARCA4_uc010dxo.2_Missense_Mutation_p.R441H|SMARCA4_uc002mqg.1_Missense_Mutation_p.R441H|SMARCA4_uc010dxq.2_Missense_Mutation_p.R441H|SMARCA4_uc010dxr.2_Missense_Mutation_p.R441H|SMARCA4_uc002mqj.3_Missense_Mutation_p.R441H|SMARCA4_uc010dxs.2_Missense_Mutation_p.R441H|SMARCA4_uc002mqe.2_Missense_Mutation_p.R441H	p.R441H	NM_003072	NP_003063	WXS	Illumina HiSeq	Unspecified	P51532	SMCA4_HUMAN			8	1606	+		all_lung(6;0.0512)|Lung NSC(9;0.0568)	441					B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	c.1322G>A	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	34	5.332097	0.95733	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.71160	0.3307	M	0.90145	3.09	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.79784	0.993;0.993;0.993;0.993;0.985;0.993;0.993	T	0.77940	-0.2399	10	0.87932	D	0	-36.1843	17.2802	0.87126	0.0:0.0:1.0:0.0	.	441;441;441;441;441;441;441	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	H	441	ENSP00000395654:R441H;ENSP00000350720:R441H;ENSP00000343896:R441H;ENSP00000445036:R441H;ENSP00000392837:R441H;ENSP00000397783:R441H;ENSP00000414727:R441H	ENSP00000343896:R441H	R	+	2	0	SMARCA4	10962902	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.565000	0.98154	2.696000	0.92011	0.655000	0.94253	CGC		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		4	38	0	0	0	0	4	38				
ZNF625	90589	broad.mit.edu	37	19	12256889	12256889	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:12256889C>T	ENST00000355738.1	-	4	493	c.144G>A	c.(142-144)agG>agA	p.R48R	ZNF625_ENST00000439556.2_Silent_p.R114R|CTC-359D24.3_ENST00000472362.1_RNA|ZNF625_ENST00000455799.1_3'UTR|ZNF625_ENST00000542938.1_Silent_p.R48R|ZNF625-ZNF20_ENST00000430024.1_Intron			Q96I27	ZN625_HUMAN	zinc finger protein 625	48					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						CTCTGTGGTGCCTATTAAGGG	0.443																																						uc002mth.2		NA																	0					0						c.(142-144)AGG>AGA		zinc finger protein 625							90.0	83.0	85.0					19																	12256889		2203	4300	6503	SO:0001819	synonymous_variant	90589				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12256889C>T	BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.144G>A	19.37:g.12256889C>T			Somatic				ZNF20_uc002mtg.1_Intron|ZNF625_uc010dyn.1_RNA|ZNF625_uc010dyo.1_Silent_p.R82R	p.R48R	NM_145233	NP_660276	WXS	Illumina HiSeq	Unspecified	Q96I27	ZN625_HUMAN			4	494	-			48			C2H2-type 1; degenerate.		A4FU45|I3L0E9	Silent	SNP	ENST00000355738.1	37	c.144G>A																																																																																					0.443	ZNF625-201	KNOWN	basic	protein_coding	protein_coding		NM_145233		17	56	0	0	0	0	17	56				
ZNF99	7652	broad.mit.edu	37	19	22940808	22940808	+	Missense_Mutation	SNP	T	T	C	rs202061112		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:22940808T>C	ENST00000596209.1	-	4	1993	c.1903A>G	c.(1903-1905)Acc>Gcc	p.T635A	ZNF99_ENST00000397104.3_Missense_Mutation_p.T544A	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTTCTAAGGGTTGAGGACTGG	0.373																																						uc010xrh.1		NA																	0				ovary(1)|skin(1)	2						c.(1630-1632)ACC>GCC		zinc finger protein 99							37.0	39.0	38.0					19																	22940808		1987	4183	6170	SO:0001583	missense	7652							g.chr19:22940808T>C	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1903A>G	19.37:g.22940808T>C	ENSP00000472969:p.Thr635Ala		Somatic					p.T544A	NM_001080409	NP_001073878	WXS	Illumina HiSeq	Unspecified					5	1630	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)						M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	c.1630A>G	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	t	0.010	-1.756059	0.00663	.	.	ENSG00000213973	ENST00000397104	T	0.00976	5.48	1.16	-2.32	0.06745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00524	0.0017	N	0.05510	-0.035	0.09310	N	1	B	0.28998	0.23	B	0.29862	0.108	T	0.43360	-0.9396	9	0.10111	T	0.7	.	3.4678	0.07555	0.0:0.3281:0.2093:0.4626	.	544	A8MXY4	ZNF99_HUMAN	A	544	ENSP00000380293:T544A	ENSP00000380293:T544A	T	-	1	0	ZNF99	22732648	0.000000	0.05858	0.001000	0.08648	0.719000	0.41307	-6.339000	0.00070	-1.208000	0.02634	0.163000	0.16589	ACC		0.373	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124		12	61	0	0	0	0	12	61				
ACTN4	81	broad.mit.edu	37	19	39191741	39191741	+	Missense_Mutation	SNP	T	T	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:39191741T>A	ENST00000252699.2	+	3	453	c.377T>A	c.(376-378)cTg>cAg	p.L126Q	ACTN4_ENST00000390009.3_Intron|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	126	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGCGTCAAGCTGGTCTCCATC	0.557																																					Colon(168;199 1940 10254 46213 46384)	uc002oja.1		NA																	0					0						c.(376-378)CTG>CAG		actinin, alpha 4							72.0	67.0	69.0					19																	39191741		2203	4300	6503	SO:0001583	missense	81				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity	g.chr19:39191741T>A	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.377T>A	19.37:g.39191741T>A	ENSP00000252699:p.Leu126Gln		Somatic				ACTN4_uc010egc.1_Missense_Mutation_p.L126Q	p.L126Q	NM_004924	NP_004915	WXS	Illumina HiSeq	Unspecified	O43707	ACTN4_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		3	436	+	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		126			Actin-binding.|CH 1.		A4K467|D6PXK4|O76048	Missense_Mutation	SNP	ENST00000252699.2	37	c.377T>A	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.626208	0.87560	.	.	ENSG00000130402	ENST00000252699;ENST00000445727	D	0.97575	-4.44	4.35	4.35	0.52113	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.000000	0.56097	D	0.000021	D	0.98943	0.9641	H	0.97214	3.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.988	D	0.99133	1.0853	10	0.87932	D	0	.	12.9372	0.58322	0.0:0.0:0.0:1.0	.	126;126	E7EV83;O43707	.;ACTN4_HUMAN	Q	126	ENSP00000252699:L126Q	ENSP00000252699:L126Q	L	+	2	0	ACTN4	43883581	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.735000	0.84939	1.964000	0.57103	0.459000	0.35465	CTG		0.557	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1			21	51	0	0	0	0	21	51				
CEACAM3	1084	broad.mit.edu	37	19	42314017	42314017	+	Missense_Mutation	SNP	G	G	A	rs200503121		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:42314017G>A	ENST00000357396.3	+	4	798	c.557G>A	c.(556-558)cGt>cAt	p.R186H	CEACAM3_ENST00000344550.4_Intron|CEACAM3_ENST00000221999.4_Intron	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	186						integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						AGCATCCAGCGTGACCTCAAG	0.592																																						uc002orn.1		NA																	0				skin(1)	1						c.(556-558)CGT>CAT		carcinoembryonic antigen-related cell adhesion		G	HIS/ARG	0,4406		0,0,2203	183.0	203.0	196.0		557	-4.0	0.0	19		196	4,8596	3.7+/-12.6	0,4,4296	yes	missense	CEACAM3	NM_001815.2	29	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	186/253	42314017	4,13002	2203	4300	6503	SO:0001583	missense	1084					integral to membrane		g.chr19:42314017G>A	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.557G>A	19.37:g.42314017G>A	ENSP00000349971:p.Arg186His		Somatic				CEACAM3_uc010eia.1_Intron|CEACAM3_uc002oro.1_RNA	p.R186H	NM_001815	NP_001806	WXS	Illumina HiSeq	Unspecified	P40198	CEAM3_HUMAN			4	633	+			186			Cytoplasmic (Potential).		G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	37	c.557G>A	CCDS12586.2	.	.	.	.	.	.	.	.	.	.	G	1.406	-0.576811	0.03854	0.0	4.65E-4	ENSG00000170956	ENST00000357396	T	0.01438	4.89	2.0	-4.0	0.04057	.	.	.	.	.	T	0.00784	0.0026	N	0.05177	-0.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46062	-0.9218	9	0.45353	T	0.12	.	5.0705	0.14604	0.2339:0.3513:0.4149:0.0	.	186	P40198	CEAM3_HUMAN	H	186	ENSP00000349971:R186H	ENSP00000349971:R186H	R	+	2	0	CEACAM3	47005857	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-2.503000	0.00965	-1.921000	0.01068	-1.478000	0.00992	CGT		0.592	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2	NM_001815		36	295	0	0	0	0	36	295				
IRF2BP1	26145	broad.mit.edu	37	19	46388533	46388533	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:46388533A>T	ENST00000302165.3	-	1	843	c.500T>A	c.(499-501)cTg>cAg	p.L167Q		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		TGCAGCTGCCAGCAGCCCAGG	0.682																																						uc002pds.1		NA																	0					0						c.(499-501)CTG>CAG		interferon regulatory factor 2 binding protein							22.0	25.0	24.0					19																	46388533		2187	4270	6457	SO:0001583	missense	26145				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr19:46388533A>T	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.500T>A	19.37:g.46388533A>T	ENSP00000307265:p.Leu167Gln		Somatic					p.L167Q	NM_015649	NP_056464	WXS	Illumina HiSeq	Unspecified	Q8IU81	I2BP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)	1	844	-		all_neural(266;0.113)|Ovarian(192;0.127)	167					Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Missense_Mutation	SNP	ENST00000302165.3	37	c.500T>A	CCDS12678.1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.125909	0.37533	.	.	ENSG00000170604	ENST00000302165	T	0.46451	0.87	4.59	4.59	0.56863	.	0.280839	0.23291	U	0.049797	T	0.28267	0.0698	L	0.39898	1.24	0.40169	D	0.977156	B	0.30281	0.275	B	0.18263	0.021	T	0.13845	-1.0494	10	0.35671	T	0.21	.	6.7517	0.23491	0.8966:0.0:0.1034:0.0	.	167	Q8IU81	I2BP1_HUMAN	Q	167	ENSP00000307265:L167Q	ENSP00000307265:L167Q	L	-	2	0	IRF2BP1	51080373	0.987000	0.35691	1.000000	0.80357	0.955000	0.61496	2.265000	0.43311	1.918000	0.55548	0.379000	0.24179	CTG		0.682	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649		9	61	0	0	0	0	9	61				
TSKS	60385	broad.mit.edu	37	19	50250010	50250010	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:50250010G>A	ENST00000246801.3	-	6	791	c.709C>T	c.(709-711)Cga>Tga	p.R237*	TSKS_ENST00000358830.3_Nonsense_Mutation_p.R37*	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	237					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		tcctgccgtcgcggcgtctca	0.677																																						uc002ppm.2		NA																	0				large_intestine(1)|skin(1)	2						c.(709-711)CGA>TGA		testis-specific kinase substrate							17.0	16.0	17.0					19																	50250010		2186	4263	6449	SO:0001587	stop_gained	60385						protein binding	g.chr19:50250010G>A	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.709C>T	19.37:g.50250010G>A	ENSP00000246801:p.Arg237*		Somatic					p.R237*	NM_021733	NP_068379	WXS	Illumina HiSeq	Unspecified	Q9UJT2	TSKS_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)	6	720	-		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)	237					Q8WXJ0	Nonsense_Mutation	SNP	ENST00000246801.3	37	c.709C>T	CCDS12780.1	.	.	.	.	.	.	.	.	.	.	-	32	5.142036	0.94560	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	.	.	.	4.78	1.13	0.20643	.	0.000000	0.42964	D	0.000627	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.0456	10.5632	0.45156	0.0:0.0:0.4723:0.5277	.	.	.	.	X	237;37	.	ENSP00000246801:R237X	R	-	1	2	TSKS	54941822	0.699000	0.27786	0.436000	0.26797	0.580000	0.36256	1.064000	0.30579	0.556000	0.29098	0.591000	0.81541	CGA		0.677	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733		6	34	0	0	0	0	6	34				
MYADM	91663	broad.mit.edu	37	19	54377153	54377153	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:54377153T>C	ENST00000391769.2	+	3	650	c.370T>C	c.(370-372)Tat>Cat	p.Y124H	MYADM_ENST00000391770.4_Missense_Mutation_p.Y124H|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391768.2_Missense_Mutation_p.Y124H|MYADM_ENST00000391771.1_Missense_Mutation_p.Y124H|MYADM_ENST00000336967.3_Missense_Mutation_p.Y124H	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	124	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CCCCACCACCTATGTCCAGTT	0.647																																						uc002qcl.2		NA																	0				ovary(1)	1						c.(370-372)TAT>CAT		myeloid-associated differentiation marker							97.0	94.0	95.0					19																	54377153		2203	4300	6503	SO:0001583	missense	91663					integral to membrane		g.chr19:54377153T>C	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.370T>C	19.37:g.54377153T>C	ENSP00000375649:p.Tyr124His		Somatic				MYADM_uc002qcm.2_Missense_Mutation_p.Y124H|MYADM_uc002qcn.2_Missense_Mutation_p.Y124H|MYADM_uc002qco.2_Missense_Mutation_p.Y124H|MYADM_uc002qcp.2_Missense_Mutation_p.Y124H	p.Y124H	NM_001020820	NP_001018656	WXS	Illumina HiSeq	Unspecified	Q96S97	MYADM_HUMAN		GBM - Glioblastoma multiforme(134;0.0488)	3	518	+	Ovarian(34;0.19)		124			MARVEL 1.		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	c.370T>C	CCDS12866.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.767419	0.49574	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000391769;ENST00000391768;ENST00000414489	T;T;T;T;T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79;1.79;1.79;1.79;1.79	4.21	4.21	0.49690	Marvel (1);MARVEL-like domain (1);	0.075082	0.53938	D	0.000041	T	0.47210	0.1433	M	0.75615	2.305	0.37250	D	0.906501	D	0.71674	0.998	D	0.66979	0.948	T	0.56541	-0.7962	10	0.52906	T	0.07	-3.0331	11.5664	0.50807	0.0:0.0:0.0:1.0	.	124	Q96S97	MYADM_HUMAN	H	124	ENSP00000398269:Y124H;ENSP00000337222:Y124H;ENSP00000375650:Y124H;ENSP00000399722:Y124H;ENSP00000416919:Y124H;ENSP00000375651:Y124H;ENSP00000375649:Y124H;ENSP00000375648:Y124H;ENSP00000404958:Y124H	ENSP00000337222:Y124H	Y	+	1	0	MYADM	59068965	1.000000	0.71417	0.997000	0.53966	0.322000	0.28314	5.001000	0.63946	1.691000	0.51100	0.260000	0.18958	TAT		0.647	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373		20	129	0	0	0	0	20	129				
NLRP2	55655	broad.mit.edu	37	19	55481573	55481573	+	Missense_Mutation	SNP	G	G	C	rs374722220		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:55481573G>C	ENST00000543010.1	+	2	333	c.190G>C	c.(190-192)Gac>Cac	p.D64H	NLRP2_ENST00000448584.2_Missense_Mutation_p.D64H|NLRP2_ENST00000427260.2_Intron|NLRP2_ENST00000537859.1_Missense_Mutation_p.D64H|NLRP2_ENST00000263437.6_Missense_Mutation_p.D64H|NLRP2_ENST00000538819.1_Missense_Mutation_p.D64H|NLRP2_ENST00000339757.7_Missense_Mutation_p.D64H|NLRP2_ENST00000391721.4_Missense_Mutation_p.D64H	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	64	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CACCCATTGTGACAGCTACTG	0.532																																						uc002qij.2		NA																	0				ovary(1)|skin(1)	2						c.(190-192)GAC>CAC		NLR family, pyrin domain containing 2							95.0	86.0	89.0					19																	55481573		2203	4300	6503	SO:0001583	missense	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55481573G>C	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.190G>C	19.37:g.55481573G>C	ENSP00000445135:p.Asp64His		Somatic				NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Missense_Mutation_p.D64H|NLRP2_uc010eso.2_Missense_Mutation_p.D64H|NLRP2_uc010esp.2_Missense_Mutation_p.D64H	p.D64H	NM_017852	NP_060322	WXS	Illumina HiSeq	Unspecified	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	2	276	+			64			DAPIN.		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	37	c.190G>C	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	G	1.131	-0.652342	0.03480	.	.	ENSG00000022556	ENST00000433772;ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	1.88	-0.452	0.12205	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.19725	0.0474	N	0.02011	-0.69	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.001;0.003;0.002;0.003	T	0.19451	-1.0305	9	0.45353	T	0.12	.	7.6407	0.28292	0.0:0.4652:0.5348:0.0	.	64;64;64;64	Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;NALP2_HUMAN	H	64	ENSP00000443519:D64H;ENSP00000445135:D64H;ENSP00000375601:D64H;ENSP00000344074:D64H;ENSP00000409370:D64H;ENSP00000440601:D64H;ENSP00000441133:D64H;ENSP00000263437:D64H	ENSP00000263437:D64H	D	+	1	0	NLRP2	60173385	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.148000	0.16224	-0.021000	0.14009	-0.362000	0.07510	GAC		0.532	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		15	74	0	0	0	0	15	74				
NLRP2	55655	broad.mit.edu	37	19	55494909	55494909	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:55494909G>T	ENST00000543010.1	+	6	1986	c.1843G>T	c.(1843-1845)Gag>Tag	p.E615*	NLRP2_ENST00000448584.2_Nonsense_Mutation_p.E615*|NLRP2_ENST00000427260.2_Nonsense_Mutation_p.E592*|NLRP2_ENST00000537859.1_Nonsense_Mutation_p.E593*|NLRP2_ENST00000263437.6_Nonsense_Mutation_p.E612*|NLRP2_ENST00000538819.1_Nonsense_Mutation_p.E591*|NLRP2_ENST00000339757.7_Nonsense_Mutation_p.E593*|NLRP2_ENST00000391721.4_Nonsense_Mutation_p.E591*	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	615					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GTCTCAGGAGGAGGAGCTGGT	0.507																																						uc002qij.2		NA																	0				ovary(1)|skin(1)	2						c.(1843-1845)GAG>TAG		NLR family, pyrin domain containing 2							102.0	83.0	89.0					19																	55494909		2203	4300	6503	SO:0001587	stop_gained	55655				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding	g.chr19:55494909G>T	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1843G>T	19.37:g.55494909G>T	ENSP00000445135:p.Glu615*		Somatic				NLRP2_uc010yfp.1_Nonsense_Mutation_p.E592*|NLRP2_uc010esn.2_Nonsense_Mutation_p.E591*|NLRP2_uc010eso.2_Nonsense_Mutation_p.E612*|NLRP2_uc010esp.2_Nonsense_Mutation_p.E593*	p.E615*	NM_017852	NP_060322	WXS	Illumina HiSeq	Unspecified	Q9NX02	NALP2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)	6	1929	+			615					B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Nonsense_Mutation	SNP	ENST00000543010.1	37	c.1843G>T	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	G	35	5.553580	0.96501	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	.	.	.	1.94	0.858	0.19030	.	0.512339	0.14562	N	0.312028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	6.3121	0.21171	0.0:0.3134:0.6866:0.0	.	.	.	.	X	615;591;593;615;593;592;591;612	.	ENSP00000263437:E612X	E	+	1	0	NLRP2	60186721	0.000000	0.05858	0.015000	0.15790	0.006000	0.05464	0.704000	0.25661	0.379000	0.24794	-0.304000	0.09214	GAG		0.507	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852		12	30	1	0	5.51e-06	9.02e-06	12	30				
SBK2	646643	broad.mit.edu	37	19	56047567	56047567	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:56047567A>T	ENST00000413299.1	-	2	132	c.95T>A	c.(94-96)cTc>cAc	p.L32H	SBK2_ENST00000344158.3_Missense_Mutation_p.L32H	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	32							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9						GCCCTGCTGGAGCTCCTCTAA	0.667																																						uc010ygc.1		NA																	0					0						c.(94-96)CTC>CAC		SH3-binding domain kinase family, member 2							26.0	30.0	29.0					19																	56047567		2120	4237	6357	SO:0001583	missense	646643						ATP binding|protein serine/threonine kinase activity	g.chr19:56047567A>T		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550			34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""				Standard	NM_001101401		Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.95T>A	19.37:g.56047567A>T	ENSP00000389015:p.Leu32His		Somatic					p.L32H	NM_001101401	NP_001094871	WXS	Illumina HiSeq	Unspecified	P0C263	SBK2_HUMAN			1	95	-			32						Missense_Mutation	SNP	ENST00000413299.1	37	c.95T>A	CCDS42631.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.923655	0.33908	.	.	ENSG00000187550	ENST00000413299;ENST00000344158	T;T	0.71579	-0.58;-0.58	4.13	4.13	0.48395	.	0.830436	0.09432	U	0.802912	T	0.72252	0.3437	N	0.19112	0.55	0.36551	D	0.871855	D	0.89917	1.0	D	0.71184	0.972	T	0.68481	-0.5397	10	0.38643	T	0.18	-14.0935	9.8255	0.40910	1.0:0.0:0.0:0.0	.	32	P0C263	SBK2_HUMAN	H	32	ENSP00000389015:L32H;ENSP00000345044:L32H	ENSP00000345044:L32H	L	-	2	0	SBK2	60739379	0.383000	0.25156	0.996000	0.52242	0.012000	0.07955	-0.389000	0.07342	1.646000	0.50622	0.260000	0.18958	CTC		0.667	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1	NM_001101401		4	38	0	0	0	0	4	38				
ZNF581	51545	broad.mit.edu	37	19	56156365	56156365	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:56156365G>A	ENST00000587252.1	+	2	701	c.428G>A	c.(427-429)cGg>cAg	p.R143Q	ZNF581_ENST00000270451.5_Missense_Mutation_p.R143Q|ZNF581_ENST00000588537.1_Missense_Mutation_p.R143Q			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GGTGGTGGGCGGCCCCACGGC	0.667																																						uc002qln.2		NA																	0					0						c.(427-429)CGG>CAG		zinc finger protein 581							42.0	46.0	45.0					19																	56156365		2197	4297	6494	SO:0001583	missense	51545				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:56156365G>A	AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.428G>A	19.37:g.56156365G>A	ENSP00000466047:p.Arg143Gln		Somatic				ZNF581_uc002qlq.2_Missense_Mutation_p.R143Q|CCDC106_uc002qlr.2_5'Flank	p.R143Q	NM_016535	NP_057619	WXS	Illumina HiSeq	Unspecified	Q9P0T4	ZN581_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)	2	1144	+		Ovarian(87;0.133)	143					B2RDM6	Missense_Mutation	SNP	ENST00000587252.1	37	c.428G>A	CCDS12932.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882017	0.72294	.	.	ENSG00000171425	ENST00000270451	T	0.16457	2.34	3.28	0.834	0.18880	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33206	0.0855	M	0.83692	2.655	0.80722	D	1	D	0.76494	0.999	P	0.61533	0.89	T	0.10941	-1.0608	9	0.87932	D	0	.	3.4256	0.07409	0.334:0.2022:0.4638:0.0	.	143	Q9P0T4	ZN581_HUMAN	Q	143	ENSP00000270451:R143Q	ENSP00000270451:R143Q	R	+	2	0	ZNF581	60848177	0.644000	0.27277	0.050000	0.19076	0.958000	0.62258	1.156000	0.31712	0.174000	0.19809	0.407000	0.27541	CGG		0.667	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453430.1	NM_016535		21	104	0	0	0	0	21	104				
NLRP4	147945	broad.mit.edu	37	19	56369225	56369225	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:56369225C>T	ENST00000301295.6	+	3	888	c.466C>T	c.(466-468)Cca>Tca	p.P156S	NLRP4_ENST00000587891.1_Missense_Mutation_p.P81S|NLRP4_ENST00000346986.5_Missense_Mutation_p.P156S	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	156	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CATTCAAGGACCACAAGGAAT	0.473																																						uc002qmd.3		NA																	0				ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(466-468)CCA>TCA		NLR family, pyrin domain containing 4							135.0	121.0	125.0					19																	56369225		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56369225C>T	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.466C>T	19.37:g.56369225C>T	ENSP00000301295:p.Pro156Ser		Somatic				NLRP4_uc002qmf.2_Missense_Mutation_p.P81S|NLRP4_uc010etf.2_5'UTR	p.P156S	NM_134444	NP_604393	WXS	Illumina HiSeq	Unspecified	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	3	888	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	156			NACHT.|ATP (Potential).		Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.466C>T	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	0.332	-0.955710	0.02267	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.82433	-1.61;-1.61	4.09	-8.18	0.01053	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.64886	0.2639	L	0.33093	0.98	0.09310	N	1	B;B	0.16396	0.017;0.009	B;B	0.13407	0.008;0.009	T	0.40156	-0.9578	9	0.08837	T	0.75	.	5.7472	0.18126	0.2271:0.0915:0.5132:0.1683	.	81;156	Q96MN2-3;Q96MN2	.;NALP4_HUMAN	S	156	ENSP00000301295:P156S;ENSP00000344787:P156S	ENSP00000301295:P156S	P	+	1	0	NLRP4	61061037	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.448000	0.06820	-4.930000	0.00027	-0.929000	0.02709	CCA		0.473	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		18	151	0	0	0	0	18	151				
MYT1L	23040	broad.mit.edu	37	2	1921066	1921066	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:1921066C>A	ENST00000399161.2	-	11	2276	c.1529G>T	c.(1528-1530)gGg>gTg	p.G510V	MYT1L_ENST00000428368.2_Missense_Mutation_p.G508V	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	510					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCCATCACACCCGGGGGTTGG	0.507																																						uc002qxe.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(1528-1530)GGG>GTG		myelin transcription factor 1-like							192.0	199.0	197.0					2																	1921066		1939	4162	6101	SO:0001583	missense	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1921066C>A	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1529G>T	2.37:g.1921066C>A	ENSP00000382114:p.Gly510Val		Somatic				MYT1L_uc002qxd.2_Missense_Mutation_p.G508V|MYT1L_uc010ewl.1_RNA	p.G510V	NM_015025	NP_055840	WXS	Illumina HiSeq	Unspecified	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	11	2356	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	510			C2HC-type 2.		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37	c.1529G>T		.	.	.	.	.	.	.	.	.	.	C	32	5.113308	0.94339	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.62232	0.19;0.04	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.84079	0.5393	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86607	0.1870	10	0.87932	D	0	-49.4582	19.8984	0.96975	0.0:1.0:0.0:0.0	.	510;508	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	V	510;456;508	ENSP00000382114:G510V;ENSP00000396103:G508V	ENSP00000295067:G456V	G	-	2	0	MYT1L	1900073	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.755000	0.85180	2.713000	0.92767	0.655000	0.94253	GGG		0.507	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		54	104	1	0	1.86e-20	3.4e-20	54	104				
APOB	338	broad.mit.edu	37	2	21239357	21239357	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:21239357T>C	ENST00000233242.1	-	21	3413	c.3286A>G	c.(3286-3288)Att>Gtt	p.I1096V		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1096					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGTTCTGAATGTCCAGGGTG	0.478																																						uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(3286-3288)ATT>GTT		apolipoprotein B precursor	Atorvastatin(DB01076)						107.0	101.0	103.0					2																	21239357		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21239357T>C	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3286A>G	2.37:g.21239357T>C	ENSP00000233242:p.Ile1096Val		Somatic					p.I1096V	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			21	3414	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1096					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.3286A>G	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	9.815	1.184223	0.21870	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00695	5.83	4.88	-2.44	0.06502	.	0.566590	0.16785	N	0.199640	T	0.00524	0.0017	N	0.24115	0.695	0.80722	D	1	B	0.14438	0.01	B	0.14023	0.01	T	0.54957	-0.8215	10	0.16896	T	0.51	.	5.4641	0.16634	0.5148:0.1354:0.0:0.3498	.	1096	P04114	APOB_HUMAN	V	1096	ENSP00000233242:I1096V	ENSP00000233242:I1096V	I	-	1	0	APOB	21092862	0.002000	0.14202	0.995000	0.50966	0.966000	0.64601	-1.564000	0.02152	-0.294000	0.08973	0.459000	0.35465	ATT		0.478	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			6	46	0	0	0	0	6	46				
ATAD2B	54454	broad.mit.edu	37	2	24011485	24011485	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:24011485C>A	ENST00000238789.5	-	20	3016	c.2673G>T	c.(2671-2673)gaG>gaT	p.E891D	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	891						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATACAAGACCTCTTCATACT	0.313																																						uc002rek.3		NA																	0				central_nervous_system(1)	1						c.(2671-2673)GAG>GAT		ATPase family, AAA domain containing 2B							82.0	74.0	76.0					2																	24011485		1809	4066	5875	SO:0001583	missense	54454						ATP binding|nucleoside-triphosphatase activity	g.chr2:24011485C>A	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2673G>T	2.37:g.24011485C>A	ENSP00000238789:p.Glu891Asp		Somatic				ATAD2B_uc010yki.1_RNA|ATAD2B_uc002rei.3_Missense_Mutation_p.E136D|ATAD2B_uc002rej.3_Missense_Mutation_p.E59D	p.E891D	NM_017552	NP_060022	WXS	Illumina HiSeq	Unspecified	Q9ULI0	ATD2B_HUMAN			20	2967	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		891					B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	c.2673G>T	CCDS46227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.39|16.39	3.110956|3.110956	0.56398|0.56398	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000238789;ENST00000546030|ENST00000381024	D|.	0.95069|.	-3.6|.	5.52|5.52	2.38|2.38	0.29361|0.29361	.|.	1.841720|.	0.02364|.	N|.	0.077141|.	T|T	0.57213|0.57213	0.2038|0.2038	L|L	0.52206|0.52206	1.635|1.635	0.58432|0.58432	D|D	0.99999|0.99999	P;D|.	0.76494|.	0.931;0.999|.	P;D|.	0.77557|.	0.659;0.99|.	T|T	0.51084|0.51084	-0.8750|-0.8750	10|5	0.48119|.	T|.	0.1|.	.|.	9.4521|9.4521	0.38731|0.38731	0.0:0.7442:0.0:0.2558|0.0:0.7442:0.0:0.2558	.|.	891;891|.	Q9ULI0;Q9ULI0-2|.	ATD2B_HUMAN;.|.	D|M	891;59|172	ENSP00000238789:E891D|.	ENSP00000238789:E891D|.	E|R	-|-	3|2	2|0	ATAD2B|ATAD2B	23864989|23864989	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	0.291000|0.291000	0.18994|0.18994	0.621000|0.621000	0.30232|0.30232	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.313	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552		13	22	1	0	0.00136819	0.00211547	13	22				
DQX1	165545	broad.mit.edu	37	2	74745638	74745638	+	Missense_Mutation	SNP	C	C	T	rs201394061		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:74745638C>T	ENST00000404568.3	-	12	2308	c.2089G>A	c.(2089-2091)Gat>Aat	p.D697N	DQX1_ENST00000393951.2_Missense_Mutation_p.D697N	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	697						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						GCTGTAGAATCTGCCATTCCT	0.532													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21838	0.0		0.0	False		,,,				2504	0.0					uc010yrw.1		NA																	0				ovary(2)	2						c.(2089-2091)GAT>AAT		DEAQ box polypeptide 1 (RNA-dependent ATPase)							156.0	138.0	144.0					2																	74745638		2203	4300	6503	SO:0001583	missense	165545					nucleus	ATP binding|helicase activity|nucleic acid binding	g.chr2:74745638C>T	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.2089G>A	2.37:g.74745638C>T	ENSP00000384621:p.Asp697Asn		Somatic				DQX1_uc002smc.2_Missense_Mutation_p.D258N	p.D697N	NM_133637	NP_598376	WXS	Illumina HiSeq	Unspecified	Q8TE96	DQX1_HUMAN			12	2254	-			697					Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	37	c.2089G>A	CCDS1949.2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.16	1.558172	0.27827	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.02863	4.13;4.13	4.91	4.91	0.64330	.	1.245160	0.05705	N	0.594921	T	0.03783	0.0107	L	0.44542	1.39	0.09310	N	1	B	0.23650	0.089	B	0.16289	0.015	T	0.53578	-0.8419	10	0.02654	T	1	.	13.5806	0.61901	0.0:1.0:0.0:0.0	.	697	Q8TE96	DQX1_HUMAN	N	697	ENSP00000377523:D697N;ENSP00000384621:D697N	ENSP00000377523:D697N	D	-	1	0	DQX1	74599146	0.151000	0.22747	0.823000	0.32752	0.782000	0.44232	2.549000	0.45803	2.253000	0.74438	0.563000	0.77884	GAT		0.532	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637		9	51	0	0	0	0	9	51				
GYPC	2995	broad.mit.edu	37	2	127451474	127451474	+	Silent	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:127451474C>A	ENST00000259254.4	+	3	472	c.141C>A	c.(139-141)ggC>ggA	p.G47G	GYPC_ENST00000356887.7_Silent_p.G26G|GYPC_ENST00000409836.3_Silent_p.G28G|GYPC_ENST00000464053.1_3'UTR	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	47						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		GGCCGGATGGCAGAATGGAGA	0.562																																					Melanoma(110;806 1600 6704 9981 33404)	uc002tnq.2		NA																	0				central_nervous_system(1)	1						c.(139-141)GGC>GGA		glycophorin C isoform 1							156.0	132.0	140.0					2																	127451474		2203	4300	6503	SO:0001819	synonymous_variant	2995					cortical cytoskeleton|integral to plasma membrane	protein binding	g.chr2:127451474C>A		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.141C>A	2.37:g.127451474C>A			Somatic				GYPC_uc002tnr.2_Silent_p.G28G|GYPC_uc010flv.2_RNA	p.G47G	NM_002101	NP_002092	WXS	Illumina HiSeq	Unspecified	P04921	GLPC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.075)	3	297	+	Colorectal(110;0.0533)		47			Extracellular.		B2R522|Q53SV9|Q92642	Silent	SNP	ENST00000259254.4	37	c.141C>A	CCDS2136.1																																																																																				0.562	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101		9	84	1	0	0.000274275	0.000428601	9	84				
FMNL2	114793	broad.mit.edu	37	2	153504404	153504404	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:153504404C>T	ENST00000288670.9	+	26	3631	c.3264C>T	c.(3262-3264)gcC>gcT	p.A1088A	FMNL2_ENST00000475377.2_3'UTR	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	0					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						TTAATGGTGCCGAAATAACAA	0.478																																						uc002tye.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(3262-3264)GCC>GCT		formin-like 2							139.0	144.0	142.0					2																	153504404		2043	4189	6232	SO:0001819	synonymous_variant	114793				actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding	g.chr2:153504404C>T	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.3264C>T	2.37:g.153504404C>T			Somatic				FMNL2_uc010fob.2_3'UTR|FMNL2_uc002tyf.2_3'UTR	p.A1088A	NM_052905	NP_443137	WXS	Illumina HiSeq	Unspecified	Q96PY5	FMNL2_HUMAN			26	3631	+			Error:Variant_position_missing_in_Q96PY5_after_alignment					B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	c.3264C>T	CCDS46429.1																																																																																				0.478	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905		20	169	0	0	0	0	20	169				
KLHL23	151230	broad.mit.edu	37	2	170592711	170592711	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:170592711G>T	ENST00000392647.2	+	2	1431	c.1187G>T	c.(1186-1188)tGg>tTg	p.W396L	KLHL23_ENST00000272797.4_Missense_Mutation_p.W396L|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	396										breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						AAAGAGAAATGGATTCCTATT	0.408																																						uc002ufh.1		NA																	0					0						c.(1186-1188)TGG>TTG		kelch-like 23							94.0	101.0	99.0					2																	170592711		2203	4300	6503	SO:0001583	missense	151230							g.chr2:170592711G>T	BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.1187G>T	2.37:g.170592711G>T	ENSP00000376419:p.Trp396Leu		Somatic				KLHL23_uc002ufi.1_Missense_Mutation_p.W396L	p.W396L	NM_144711	NP_653312	WXS	Illumina HiSeq	Unspecified	Q8NBE8	KLH23_HUMAN			4	1525	+			396			Kelch 3.		Q8N9B9|Q96FT8	Missense_Mutation	SNP	ENST00000392647.2	37	c.1187G>T	CCDS2236.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019149	0.75275	.	.	ENSG00000213160	ENST00000272797;ENST00000392647;ENST00000437875	D;D;D	0.96940	-4.18;-4.18;-4.18	5.49	5.49	0.81192	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.98998	0.9658	H	0.98178	4.165	0.31499	N	0.665009	D	0.89917	1.0	D	0.97110	1.0	D	0.99253	1.0888	9	0.87932	D	0	.	19.3833	0.94546	0.0:0.0:1.0:0.0	.	396	Q8NBE8	KLH23_HUMAN	L	396;396;217	ENSP00000272797:W396L;ENSP00000376419:W396L;ENSP00000394732:W217L	ENSP00000272797:W396L	W	+	2	0	KLHL23	170300957	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.835000	0.99442	2.567000	0.86603	0.650000	0.86243	TGG		0.408	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255271.2	NM_144711		12	104	1	0	7.04e-09	1.19e-08	12	104				
DNAJC10	54431	broad.mit.edu	37	2	183627484	183627484	+	Silent	SNP	A	A	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:183627484A>C	ENST00000264065.7	+	22	2636	c.2221A>C	c.(2221-2223)Agg>Cgg	p.R741R		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	741	Thioredoxin 4. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AGCTGGGATCAGGGCCTATCC	0.408																																					Pancreas(56;860 1183 25669 35822 48585)	uc002uow.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4						c.(2221-2223)AGG>CGG		DnaJ (Hsp40) homolog, subfamily C, member 10							112.0	110.0	111.0					2																	183627484		2203	4300	6503	SO:0001819	synonymous_variant	54431				apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding	g.chr2:183627484A>C		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.2221A>C	2.37:g.183627484A>C			Somatic				DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Silent_p.R695R|DNAJC10_uc010fro.1_RNA	p.R741R	NM_018981	NP_061854	WXS	Illumina HiSeq	Unspecified	Q8IXB1	DJC10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		22	2636	+			741			Thioredoxin 4.		Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	37	c.2221A>C	CCDS33345.1																																																																																				0.408	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981		4	49	0	0	0	0	4	49				
ALS2	57679	broad.mit.edu	37	2	202593826	202593826	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:202593826C>T	ENST00000264276.6	-	14	3033	c.2661G>A	c.(2659-2661)aaG>aaA	p.K887K	ALS2_ENST00000457679.2_Silent_p.K199K	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	887					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						ATTCTGCTTCCTTCCTTTTCC	0.453																																						uc002uyo.2		NA																	0				skin(5)|lung(1)|breast(1)	7						c.(2659-2661)AAG>AAA		alsin isoform 1							135.0	127.0	130.0					2																	202593826		1858	4102	5960	SO:0001819	synonymous_variant	57679				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity	g.chr2:202593826C>T	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2661G>A	2.37:g.202593826C>T			Somatic				ALS2_uc002uyp.3_Silent_p.K887K|ALS2_uc010ftl.2_RNA	p.K887K	NM_020919	NP_065970	WXS	Illumina HiSeq	Unspecified	Q96Q42	ALS2_HUMAN			14	3017	-			887					Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	c.2661G>A	CCDS42800.1																																																																																				0.453	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919		129	78	0	0	0	0	129	78				
CPS1	1373	broad.mit.edu	37	2	211502448	211502448	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:211502448C>G	ENST00000233072.5	+	22	2906	c.2710C>G	c.(2710-2712)Ctg>Gtg	p.L904V	CPS1_ENST00000430249.2_Missense_Mutation_p.L910V|CPS1_ENST00000451903.2_Missense_Mutation_p.L453V|CPS1_ENST00000497121.1_3'UTR	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	904					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AGAAGAAACCCTGAAAAGGGC	0.398																																						uc002vee.3		NA																	0				ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.(2710-2712)CTG>GTG		carbamoyl-phosphate synthetase 1 isoform b							71.0	80.0	77.0					2																	211502448		2203	4300	6503	SO:0001583	missense	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211502448C>G	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2710C>G	2.37:g.211502448C>G	ENSP00000233072:p.Leu904Val		Somatic				CPS1_uc010fur.2_Missense_Mutation_p.L910V|CPS1_uc010fus.2_Missense_Mutation_p.L453V	p.L904V	NM_001875	NP_001866	WXS	Illumina HiSeq	Unspecified	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	22	2842	+			904					B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	c.2710C>G	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484875	0.44147	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98649	-5.05;-5.05;-5.05	5.47	3.67	0.42095	Carbamoyl-phosphate synthetase, large subunit, oligomerisation (3);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	M	0.87328	2.875	0.46774	D	0.999193	D;D	0.58620	0.983;0.983	P;P	0.54238	0.746;0.746	D	0.98287	1.0511	10	0.59425	D	0.04	1.4979	12.1517	0.54053	0.0:0.8604:0.0:0.1396	.	914;904	Q59HF8;P31327	.;CPSM_HUMAN	V	910;912;904;453	ENSP00000402608:L910V;ENSP00000233072:L904V;ENSP00000406136:L453V	ENSP00000233072:L904V	L	+	1	2	CPS1	211210693	0.312000	0.24545	0.971000	0.41717	0.256000	0.26092	0.734000	0.26101	0.773000	0.33404	0.650000	0.86243	CTG		0.398	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			7	39	0	0	0	0	7	39				
CHRND	1144	broad.mit.edu	37	2	233398936	233398936	+	Missense_Mutation	SNP	C	C	T	rs140455307		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:233398936C>T	ENST00000258385.3	+	11	1287	c.1255C>T	c.(1255-1257)Cgg>Tgg	p.R419W	CHRND_ENST00000543200.1_Missense_Mutation_p.R404W|CHRND_ENST00000457943.2_Missense_Mutation_p.R225W	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	419					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GTCTGTAGGCCGGCCCCCAGC	0.607																																						uc002vsw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1255-1257)CGG>TGG		nicotinic acetylcholine receptor delta			TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	42.0	46.0	45.0		1255	1.2	1.0	2	dbSNP_134	45	2,8598	2.2+/-6.3	0,2,4298	no	missense	CHRND	NM_000751.1	101	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	possibly-damaging	419/518	233398936	3,13003	2203	4300	6503	SO:0001583	missense	1144				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	g.chr2:233398936C>T	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1255C>T	2.37:g.233398936C>T	ENSP00000258385:p.Arg419Trp		Somatic				CHRND_uc010zmg.1_Missense_Mutation_p.R404W|CHRND_uc010fyc.2_Missense_Mutation_p.R292W|CHRND_uc010zmh.1_Missense_Mutation_p.R225W	p.R419W	NM_000751	NP_000742	WXS	Illumina HiSeq	Unspecified	Q07001	ACHD_HUMAN		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	11	1259	+		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)	419			Cytoplasmic (Potential).		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	37	c.1255C>T	CCDS2494.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062172	0.36373	2.27E-4	2.33E-4	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	D;D;D	0.84730	-1.89;-1.89;-1.89	5.43	1.19	0.21007	Neurotransmitter-gated ion-channel transmembrane domain (2);	229.314000	0.01670	U	0.025544	D	0.88702	0.6508	L	0.57536	1.79	0.09310	N	1	D;P;P;P	0.60160	0.987;0.748;0.748;0.748	P;P;P;P	0.55055	0.767;0.456;0.456;0.456	T	0.71974	-0.4430	10	0.59425	D	0.04	.	8.4401	0.32810	0.506:0.4176:0.0:0.0763	.	225;404;419;419	B4E3W4;B4DT92;A8K661;Q07001	.;.;.;ACHD_HUMAN	W	404;419;225	ENSP00000438380:R404W;ENSP00000258385:R419W;ENSP00000391055:R225W	ENSP00000258385:R419W	R	+	1	2	CHRND	233107180	0.003000	0.15002	0.957000	0.39632	0.194000	0.23727	0.525000	0.22956	0.216000	0.20781	0.457000	0.33378	CGG		0.607	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2			12	71	0	0	0	0	12	71				
GIGYF2	26058	broad.mit.edu	37	2	233680442	233680442	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:233680442G>T	ENST00000409547.1	+	21	2514	c.2203G>T	c.(2203-2205)Gca>Tca	p.A735S	GIGYF2_ENST00000409451.3_Missense_Mutation_p.A756S|GIGYF2_ENST00000452341.2_Missense_Mutation_p.A566S|GIGYF2_ENST00000373566.3_Missense_Mutation_p.A757S|GIGYF2_ENST00000409196.3_Missense_Mutation_p.A729S|GIGYF2_ENST00000409480.1_Missense_Mutation_p.A757S|GIGYF2_ENST00000373563.4_Missense_Mutation_p.A735S	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	735	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GGCCAAAGCTGCAAAGGTCTG	0.478																																						uc002vti.3		NA																	0				ovary(4)|central_nervous_system(3)	7						c.(2203-2205)GCA>TCA		GRB10 interacting GYF protein 2 isoform b							126.0	108.0	114.0					2																	233680442		2203	4300	6503	SO:0001583	missense	26058				cell death		protein binding	g.chr2:233680442G>T	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2203G>T	2.37:g.233680442G>T	ENSP00000386537:p.Ala735Ser		Somatic				GIGYF2_uc010zmj.1_Missense_Mutation_p.A735S|GIGYF2_uc002vtg.2_Missense_Mutation_p.A729S|GIGYF2_uc002vtj.3_Missense_Mutation_p.A756S|GIGYF2_uc002vtk.3_Missense_Mutation_p.A735S|GIGYF2_uc002vth.3_Missense_Mutation_p.A729S|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Missense_Mutation_p.A566S|GIGYF2_uc002vtq.3_Missense_Mutation_p.A68S	p.A735S	NM_015575	NP_056390	WXS	Illumina HiSeq	Unspecified	Q6Y7W6	PERQ2_HUMAN		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)	21	2540	+		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)	735			Gln-rich.		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	c.2203G>T	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277826	0.80692	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.9;-0.99;-0.99;-0.99;-0.99	5.29	5.29	0.74685	.	0.125717	0.53938	D	0.000052	D	0.84388	0.5461	M	0.66939	2.045	0.53005	D	0.999961	D;D;D;D	0.76494	0.999;0.982;0.98;0.994	D;P;P;D	0.83275	0.996;0.816;0.629;0.97	T	0.80360	-0.1415	10	0.18276	T	0.48	-14.56	18.9247	0.92540	0.0:0.0:1.0:0.0	.	566;756;735;729	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	S	757;678;735;757;735;735;678;729;756;729;566	ENSP00000362667:A757S;ENSP00000362664:A735S;ENSP00000386765:A757S;ENSP00000386537:A735S;ENSP00000404195:A678S;ENSP00000387070:A729S;ENSP00000387170:A756S;ENSP00000410297:A729S;ENSP00000411505:A566S	ENSP00000362664:A735S	A	+	1	0	GIGYF2	233388686	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.264000	0.78432	2.467000	0.83353	0.650000	0.86243	GCA		0.478	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146		3	29	1	0	0.004672	0.0070744	3	29				
HDAC4	9759	broad.mit.edu	37	2	240085518	240085518	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr2:240085518C>T	ENST00000345617.3	-	6	1383	c.592G>A	c.(592-594)Gac>Aac	p.D198N	AC017028.1_ENST00000396489.1_5'Flank|HDAC4_ENST00000541256.1_Missense_Mutation_p.D167N	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	198	Interaction with MEF2A.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TAGCGAGGGTCGCTGGAAATG	0.562																																						uc002vyk.3		NA																	0				breast(3)|skin(2)|ovary(1)	6						c.(592-594)GAC>AAC		histone deacetylase 4							127.0	128.0	128.0					2																	240085518		2203	4300	6503	SO:0001583	missense	9759				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding	g.chr2:240085518C>T	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.592G>A	2.37:g.240085518C>T	ENSP00000264606:p.Asp198Asn		Somatic				HDAC4_uc010fyz.1_Missense_Mutation_p.D193N|HDAC4_uc010zoa.1_Missense_Mutation_p.D193N|HDAC4_uc010fza.2_Missense_Mutation_p.D198N|HDAC4_uc010fyy.2_Missense_Mutation_p.D150N|HDAC4_uc010znz.1_Missense_Mutation_p.D81N	p.D198N	NM_006037	NP_006028	WXS	Illumina HiSeq	Unspecified	P56524	HDAC4_HUMAN		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)	6	1384	-		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)	198			Interaction with MEF2A.		Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	c.592G>A	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955712	0.53293	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000541256;ENST00000393621	T;T	0.42131	0.98;0.98	4.31	4.31	0.51392	.	0.055536	0.64402	D	0.000002	T	0.52354	0.1729	L	0.31294	0.92	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;P;D	0.87578	0.99;0.971;0.995;0.998;0.791;0.946	T	0.50701	-0.8797	9	.	.	.	.	17.1787	0.86849	0.0:1.0:0.0:0.0	.	193;81;167;167;166;198	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	N	198;81;167;81	ENSP00000264606:D198N;ENSP00000443057:D167N	.	D	-	1	0	HDAC4	239750455	1.000000	0.71417	0.536000	0.28039	0.318000	0.28184	5.353000	0.66034	2.124000	0.65301	0.655000	0.94253	GAC		0.562	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037		22	78	0	0	0	0	22	78				
SNRPB2	6629	broad.mit.edu	37	20	16721614	16721614	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr20:16721614G>A	ENST00000246071.6	+	7	858	c.642G>A	c.(640-642)ccG>ccA	p.P214P	SNRPB2_ENST00000377943.5_Silent_p.P214P	NM_003092.4	NP_003083.1	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B	214	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	nucleotide binding (GO:0000166)|snRNA binding (GO:0017069)			large_intestine(2)|lung(2)|urinary_tract(1)	5						AGATCACACCGTCCCATGCTA	0.413																																						uc002wph.1		NA																	0				large_intestine(1)	1						c.(640-642)CCG>CCA		small nuclear ribonucleoprotein polypeptide B''							94.0	86.0	89.0					20																	16721614		2203	4300	6503	SO:0001819	synonymous_variant	6629					catalytic step 2 spliceosome|nucleoplasm|U2 snRNP	nucleotide binding|protein binding|RNA binding	g.chr20:16721614G>A		CCDS13123.1	20p12.1	2013-02-12	2010-07-07		ENSG00000125870	ENSG00000125870		"""RNA binding motif (RRM) containing"""	11155	protein-coding gene	gene with protein product		603520	"""small nuclear ribonucleoprotein polypeptide B2"", ""small nuclear ribonucleoprotein polypeptide B''"""			2951739	Standard	NM_198220		Approved	Msl1	uc002wpi.2	P08579	OTTHUMG00000031933	ENST00000246071.6:c.642G>A	20.37:g.16721614G>A			Somatic				SNRPB2_uc002wpi.1_Silent_p.P214P	p.P214P	NM_003092	NP_003083	WXS	Illumina HiSeq	Unspecified	P08579	RU2B_HUMAN			7	858	+			214			RRM 2.		B2R7J3|D3DW21|Q9UJD4	Silent	SNP	ENST00000246071.6	37	c.642G>A	CCDS13123.1																																																																																				0.413	SNRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078110.1	NM_003092		8	63	0	0	0	0	8	63				
CHD6	84181	broad.mit.edu	37	20	40162087	40162087	+	Silent	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr20:40162087A>G	ENST00000373233.3	-	3	333	c.156T>C	c.(154-156)gcT>gcC	p.A52A	CHD6_ENST00000373222.3_Silent_p.A87A|CHD6_ENST00000309279.7_Silent_p.A52A	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	52	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GACAGTGACTAGCAACATCTT	0.448																																						uc002xka.1		NA																	0				ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14						c.(154-156)GCT>GCC		chromodomain helicase DNA binding protein 6							94.0	88.0	90.0					20																	40162087		2203	4300	6503	SO:0001819	synonymous_variant	84181				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding	g.chr20:40162087A>G	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.156T>C	20.37:g.40162087A>G			Somatic				CHD6_uc002xkd.2_Silent_p.A30A|CHD6_uc002xkc.2_Silent_p.A87A	p.A52A	NM_032221	NP_115597	WXS	Illumina HiSeq	Unspecified	Q8TD26	CHD6_HUMAN			3	334	-		Myeloproliferative disorder(115;0.00425)	52					Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	c.156T>C	CCDS13317.1																																																																																				0.448	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			53	91	0	0	0	0	53	91				
BMP7	655	broad.mit.edu	37	20	55803477	55803477	+	Splice_Site	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr20:55803477A>G	ENST00000395863.3	-	2	924	c.419T>C	c.(418-420)gTg>gCg	p.V140A	BMP7_ENST00000450594.2_Splice_Site_p.V140A|BMP7_ENST00000395864.3_Splice_Site_p.V140A	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	140					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GTCATGTTCCACTGGAAGAGG	0.512																																						uc010gip.1		NA																	0				skin(1)	1						c.(418-420)GTG>GCG		bone morphogenetic protein 7 precursor							128.0	124.0	125.0					20																	55803477		2203	4300	6503	SO:0001630	splice_region_variant	655				BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity	g.chr20:55803477A>G		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.419-1T>C	20.37:g.55803477A>G			Somatic				BMP7_uc010giq.1_Missense_Mutation_p.V140A|BMP7_uc002xyc.2_Missense_Mutation_p.V140A	p.V140A	NM_001719	NP_001710	WXS	Illumina HiSeq	Unspecified	P18075	BMP7_HUMAN	BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)		2	948	-	all_lung(29;0.0133)|Melanoma(10;0.242)		140					Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	c.419T>C	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	A	18.10	3.549462	0.65311	.	.	ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594	T;T;T	0.64618	-0.11;-0.11;-0.11	5.33	5.33	0.75918	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79281	0.4419	M	0.87900	2.915	0.58432	D	0.999995	D;B;D	0.69078	0.997;0.123;0.997	D;B;D	0.79108	0.992;0.411;0.955	T	0.78298	-0.2258	10	0.10111	T	0.7	.	15.5961	0.76583	1.0:0.0:0.0:0.0	.	140;140;140	B1AKZ9;P18075;B1AL00	.;BMP7_HUMAN;.	A	140	ENSP00000379204:V140A;ENSP00000379205:V140A;ENSP00000398687:V140A	ENSP00000379204:V140A	V	-	2	0	BMP7	55236884	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	5.564000	0.67359	2.137000	0.66172	0.533000	0.62120	GTG		0.512	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		Missense_Mutation	3	114	0	0	0	0	3	114				
LAMA5	3911	broad.mit.edu	37	20	60888727	60888727	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr20:60888727C>T	ENST00000252999.3	-	63	8702	c.8636G>A	c.(8635-8637)gGg>gAg	p.G2879E		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2879	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGGGTACCCCCCGACGTAGAA	0.677																																						uc002ycq.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(8635-8637)GGG>GAG		laminin alpha 5 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						66.0	58.0	61.0					20																	60888727		2203	4295	6498	SO:0001583	missense	3911				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding	g.chr20:60888727C>T	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.8636G>A	20.37:g.60888727C>T	ENSP00000252999:p.Gly2879Glu		Somatic					p.G2879E	NM_005560	NP_005551	WXS	Illumina HiSeq	Unspecified	O15230	LAMA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		63	8703	-	Breast(26;1.57e-08)		2879			Laminin G-like 1.		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	c.8636G>A	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	c	23.1	4.371468	0.82573	.	.	ENSG00000130702	ENST00000252999	D	0.82167	-1.58	4.2	4.2	0.49525	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	U	0.000000	D	0.92176	0.7519	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94013	0.7286	10	0.87932	D	0	.	16.1239	0.81380	0.0:1.0:0.0:0.0	.	2879	O15230	LAMA5_HUMAN	E	2879	ENSP00000252999:G2879E	ENSP00000252999:G2879E	G	-	2	0	LAMA5	60322122	1.000000	0.71417	0.941000	0.38009	0.532000	0.34746	4.994000	0.63901	1.890000	0.54733	0.457000	0.33378	GGG		0.677	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560		18	76	0	0	0	0	18	76				
POTEH	23784	broad.mit.edu	37	22	16267041	16267042	+	Missense_Mutation	DNP	GG	GG	AT	rs530488686		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr22:16267041_16267042GG>AT	ENST00000343518.6	-	9	1458_1459	c.1407_1408CC>AT	c.(1405-1410)aaCCtg>aaATtg	p.N469K		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	469										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CCGTTAGTCAGGTTTTCTGGGA	0.401																																						uc010gqp.2		NA																	0				skin(1)	1						c.(1405-1410)AACCTG>AAATTG		ANKRD26-like family C, member 3																																				SO:0001583	missense	23784							g.chr22:16267041_16267042GG>AT	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1407_1408delinsAT	22.37:g.16267041_16267042delinsAT	ENSP00000340610:p.Asn469Lys		Somatic				POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Missense_Mutation_p.N188K|POTEH_uc002zlj.1_Missense_Mutation_p.N304K	p.N469K	NM_001136213	NP_001129685	WXS	Illumina HiSeq	Unspecified	Q6S545	POTEH_HUMAN			9	1459_1460	-			469					A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	DNP	ENST00000343518.6	37	c.1407_1408CC>AT	CCDS46658.1																																																																																				0.401	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213		25	573	0	0	0	0	25	573				
CELSR1	9620	broad.mit.edu	37	22	46859980	46859980	+	Silent	SNP	G	G	A	rs148297929	byFrequency	TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr22:46859980G>A	ENST00000262738.3	-	2	3806	c.3807C>T	c.(3805-3807)ggC>ggT	p.G1269G	CELSR1_ENST00000395964.1_Silent_p.G1269G	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1269					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGCCGCGGACGCCGCCAGGCA	0.632													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17053	0.0		0.0	False		,,,				2504	0.0					uc003bhw.1		NA																	0				lung(4)|breast(4)|pancreas(2)|skin(1)	11						c.(3805-3807)GGC>GGT		cadherin EGF LAG seven-pass G-type receptor 1		G		8,4398	14.3+/-33.2	0,8,2195	67.0	68.0	68.0		3807	2.5	0.7	22	dbSNP_134	68	0,8600		0,0,4300	no	coding-synonymous	CELSR1	NM_014246.1		0,8,6495	AA,AG,GG		0.0,0.1816,0.0615		1269/3015	46859980	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	9620				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity	g.chr22:46859980G>A	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.3807C>T	22.37:g.46859980G>A			Somatic					p.G1269G	NM_014246	NP_055061	WXS	Illumina HiSeq	Unspecified	Q9NYQ6	CELR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	2	3807	-		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)	1269			Extracellular (Potential).		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	c.3807C>T	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	6.625	0.483744	0.12581	0.001816	0.0	ENSG00000075275	ENST00000454637	.	.	.	4.85	2.54	0.30619	.	.	.	.	.	T	0.45256	0.1333	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	T	0.42599	-0.9442	4	.	.	.	.	2.8953	0.05689	0.1566:0.1455:0.5484:0.1494	.	.	.	.	V	644	.	.	A	-	2	0	CELSR1	45238644	0.184000	0.23200	0.705000	0.30386	0.764000	0.43329	0.165000	0.16564	2.239000	0.73571	0.655000	0.94253	GCG		0.632	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246		6	48	0	0	0	0	6	48				
RAF1	5894	broad.mit.edu	37	3	12653459	12653459	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:12653459C>T	ENST00000251849.4	-	3	749	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	RAF1_ENST00000542177.1_Intron|RAF1_ENST00000534997.1_5'Flank|RAF1_ENST00000442415.2_Missense_Mutation_p.E104K	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	104	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCTTTGTGTTCGTGGAGAAGT	0.428			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																													uc003bxf.3		NA		Dom	yes		3	3p25	5894	T	v-raf-1 murine leukemia viral oncogene homolog 1			M	SRGAP3		pilocytic astrocytoma	ESRP1/RAF1(4)|SRGAP3/RAF1(4)	0				central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14						c.(310-312)GAA>AAA		v-raf-1 murine leukemia viral oncogene homolog	Sorafenib(DB00398)						163.0	160.0	161.0					3																	12653459		2203	4300	6503	SO:0001583	missense	5894	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chr3:12653459C>T	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.310G>A	3.37:g.12653459C>T	ENSP00000251849:p.Glu104Lys		Somatic				RAF1_uc011aut.1_5'Flank|RAF1_uc011auu.1_Intron	p.E104K	NM_002880	NP_002871	WXS	Illumina HiSeq	Unspecified	P04049	RAF1_HUMAN			3	725	-			104			RBD.		B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	c.310G>A	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.985179	0.53934	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427	T;T;T	0.74106	-0.8;-0.81;-0.8	5.77	5.77	0.91146	Raf-like Ras-binding (3);	0.095474	0.64402	D	0.000001	T	0.57666	0.2069	N	0.14661	0.345	0.80722	D	1	B	0.32829	0.386	B	0.25884	0.064	T	0.56872	-0.7907	10	0.13108	T	0.6	.	19.9922	0.97370	0.0:1.0:0.0:0.0	.	104	P04049	RAF1_HUMAN	K	104;104;16	ENSP00000251849:E104K;ENSP00000401888:E104K;ENSP00000398591:E16K	ENSP00000251849:E104K	E	-	1	0	RAF1	12628459	1.000000	0.71417	0.880000	0.34516	0.805000	0.45488	7.394000	0.79862	2.740000	0.93945	0.557000	0.71058	GAA		0.428	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880		49	87	0	0	0	0	49	87				
ELP6	54859	broad.mit.edu	37	3	47552662	47552662	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:47552662G>T	ENST00000296149.4	-	2	279	c.109C>A	c.(109-111)Cac>Aac	p.H37N	ELP6_ENST00000439305.1_5'UTR|ELP6_ENST00000446787.1_5'UTR|ELP6_ENST00000460502.1_5'Flank	NM_001031703.2	NP_001026873.2	Q0PNE2	ELP6_HUMAN	elongator acetyltransferase complex subunit 6	37					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Elongator holoenzyme complex (GO:0033588)											GAGAGAAAGTGGTGTACAAGG	0.403																																						uc003crk.2		NA																	0					0						c.(109-111)CAC>AAC		transmembrane protein 103							106.0	100.0	102.0					3																	47552662		1880	4109	5989	SO:0001583	missense	54859							g.chr3:47552662G>T	AK000218	CCDS43082.1	3p21.31	2012-08-14	2012-08-08	2012-08-08	ENSG00000163832	ENSG00000163832		"""Elongator acetyltransferase complex subunits"""	25976	protein-coding gene	gene with protein product		615020	"""transmembrane protein 103"", ""chromosome 3 open reading frame 75"""	TMEM103, C3orf75		22854966	Standard	XM_005265241		Approved	FLJ20211	uc003crk.3	Q0PNE2	OTTHUMG00000133521	ENST00000296149.4:c.109C>A	3.37:g.47552662G>T	ENSP00000296149:p.His37Asn		Somatic				C3orf75_uc003crj.2_5'UTR|C3orf75_uc011bba.1_Silent_p.T11T|C3orf75_uc003crl.1_Missense_Mutation_p.H37N	p.H37N	NM_001031703	NP_001026873	WXS	Illumina HiSeq	Unspecified	Q0PNE2	CC075_HUMAN			2	228	-			37					Q9BW57|Q9NXJ3	Missense_Mutation	SNP	ENST00000296149.4	37	c.109C>A	CCDS43082.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.588234	0.86851	.	.	ENSG00000163832	ENST00000296149;ENST00000450051	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.79656	0.4483	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.79533	-0.1764	9	0.44086	T	0.13	-24.6241	15.3053	0.73987	0.0:0.0:1.0:0.0	.	37;37	C9JAS1;Q0PNE2	.;CC075_HUMAN	N	37	.	ENSP00000296149:H37N	H	-	1	0	C3orf75	47527666	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.071000	0.76770	2.692000	0.91855	0.650000	0.86243	CAC		0.403	ELP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257493.1	NM_017713		8	51	1	0	9.7e-10	1.65e-09	8	51				
ATRIP	84126	broad.mit.edu	37	3	48491541	48491541	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:48491541G>T	ENST00000320211.3	+	2	459	c.346G>T	c.(346-348)Gta>Tta	p.V116L	ATRIP_ENST00000346691.4_Missense_Mutation_p.V116L|ATRIP_ENST00000357105.6_5'UTR|ATRIP_ENST00000412052.1_Missense_Mutation_p.V23L	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	116					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGAATTAGAGGTACTTCAGGC	0.333								Other conserved DNA damage response genes																														uc003ctf.1		NA																	0				ovary(1)	1						c.(346-348)GTA>TTA	Other_conserved_DNA_damage_response_genes	ATR interacting protein isoform 1							83.0	90.0	88.0					3																	48491541		2203	4298	6501	SO:0001583	missense	84126				DNA damage checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding|protein serine/threonine kinase activity	g.chr3:48491541G>T	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.346G>T	3.37:g.48491541G>T	ENSP00000323099:p.Val116Leu		Somatic				ATRIP_uc011bbj.1_5'UTR|ATRIP_uc003ctg.1_Missense_Mutation_p.V116L	p.V116L	NM_130384	NP_569055	WXS	Illumina HiSeq	Unspecified	Q8WXE1	ATRIP_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	2	378	+			116			Potential.		A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	37	c.346G>T	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986034	0.35036	.	.	ENSG00000164053	ENST00000421175;ENST00000320211;ENST00000346691;ENST00000412052	T;T;T;T	0.77489	-1.1;1.53;1.53;1.52	5.51	-2.4	0.06583	.	1.023550	0.07743	N	0.947318	T	0.68256	0.2981	L	0.49350	1.555	0.43994	D	0.996696	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.55679	-0.8103	10	0.56958	D	0.05	-0.3582	5.7328	0.18049	0.1973:0.0:0.3847:0.418	.	116;116	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	L	23;116;116;23	ENSP00000406664:V23L;ENSP00000323099:V116L;ENSP00000302338:V116L;ENSP00000400930:V23L	ENSP00000323099:V116L	V	+	1	0	ATRIP	48466545	0.925000	0.31364	0.646000	0.29493	0.967000	0.64934	0.191000	0.17076	-0.420000	0.07427	0.655000	0.94253	GTA		0.333	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384		31	53	1	0	1.89e-17	3.39e-17	31	53				
RNF123	63891	broad.mit.edu	37	3	49744294	49744294	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:49744294G>A	ENST00000327697.6	+	26	2603	c.2459G>A	c.(2458-2460)cGc>cAc	p.R820H	RNF123_ENST00000432042.1_Missense_Mutation_p.R674H	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	820					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CACCTGAGCCGCCGTCTTGCC	0.567																																						uc003cxh.2		NA																	0				kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7						c.(2458-2460)CGC>CAC		ring finger protein 123							151.0	125.0	134.0					3																	49744294		2203	4300	6503	SO:0001583	missense	63891					cytoplasm	ligase activity|protein binding|zinc ion binding	g.chr3:49744294G>A	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.2459G>A	3.37:g.49744294G>A	ENSP00000328287:p.Arg820His		Somatic				RNF123_uc010hky.1_Missense_Mutation_p.R482H|RNF123_uc003cxi.2_RNA	p.R820H	NM_022064	NP_071347	WXS	Illumina HiSeq	Unspecified	Q5XPI4	RN123_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)	26	2545	+			820					A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	c.2459G>A	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644720	0.87859	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	D;D	0.94897	-2.95;-3.55	5.3	5.3	0.74995	.	0.162806	0.41294	D	0.000912	D	0.95332	0.8485	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	D	0.96022	0.9010	10	0.87932	D	0	-22.7933	16.0911	0.81090	0.0:0.0:1.0:0.0	.	674;820	C9J266;Q5XPI4	.;RN123_HUMAN	H	820;820;674	ENSP00000328287:R820H;ENSP00000392443:R674H	ENSP00000328287:R820H	R	+	2	0	RNF123	49719298	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	8.678000	0.91211	2.460000	0.83146	0.491000	0.48974	CGC		0.567	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064		12	45	0	0	0	0	12	45				
CBLB	868	broad.mit.edu	37	3	105421037	105421037	+	Silent	SNP	T	T	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:105421037T>A	ENST00000264122.4	-	12	2181	c.1860A>T	c.(1858-1860)acA>acT	p.T620T	CBLB_ENST00000394027.3_Silent_p.T642T|CBLB_ENST00000403724.1_Silent_p.T620T|CBLB_ENST00000405772.1_Silent_p.T620T	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	620	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TTGAACTCGCTGTGATTCCAG	0.517			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	uc003dwc.2		NA		Rec	yes		3	3q13.11	868	Mis S	Cas-Br-M (murine) ecotropic retroviral transforming sequence b			L			AML		0				lung(4)|ovary(3)|breast(1)|skin(1)	9						c.(1858-1860)ACA>ACT		Cas-Br-M (murine) ecotropic retroviral							129.0	127.0	128.0					3																	105421037		2203	4300	6503	SO:0001819	synonymous_variant	868				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding	g.chr3:105421037T>A	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1860A>T	3.37:g.105421037T>A			Somatic				CBLB_uc011bhi.1_Silent_p.T642T|CBLB_uc003dwd.1_Silent_p.T620T|CBLB_uc003dwe.1_Silent_p.T620T	p.T620T	NM_170662	NP_733762	WXS	Illumina HiSeq	Unspecified	Q13191	CBLB_HUMAN			12	2182	-			620			Pro-rich.		A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Silent	SNP	ENST00000264122.4	37	c.1860A>T	CCDS2948.1																																																																																				0.517	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662		20	100	0	0	0	0	20	100				
CCDC54	84692	broad.mit.edu	37	3	107096565	107096565	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:107096565G>C	ENST00000261058.1	+	1	378	c.131G>C	c.(130-132)gGa>gCa	p.G44A		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	44										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						GATTCAACTGGATATCCCACT	0.398																																						uc003dwi.1		NA																	0					0						c.(130-132)GGA>GCA		coiled-coil domain containing 54							145.0	144.0	144.0					3																	107096565		2203	4300	6503	SO:0001583	missense	84692							g.chr3:107096565G>C	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.131G>C	3.37:g.107096565G>C	ENSP00000261058:p.Gly44Ala		Somatic					p.G44A	NM_032600	NP_115989	WXS	Illumina HiSeq	Unspecified	Q8NEL0	CCD54_HUMAN			1	378	+			44					Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	c.131G>C	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	G	1.398	-0.579047	0.03854	.	.	ENSG00000138483	ENST00000261058	T	0.42900	0.96	5.17	2.24	0.28232	.	1.499290	0.04582	N	0.395135	T	0.21962	0.0529	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.22765	-1.0207	10	0.11485	T	0.65	1.1018	5.2219	0.15373	0.181:0.0:0.658:0.161	.	44	Q8NEL0	CCD54_HUMAN	A	44	ENSP00000261058:G44A	ENSP00000261058:G44A	G	+	2	0	CCDC54	108579255	0.003000	0.15002	0.000000	0.03702	0.018000	0.09664	1.293000	0.33353	0.513000	0.28278	0.460000	0.39030	GGA		0.398	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600		16	94	0	0	0	0	16	94				
LRRC58	116064	broad.mit.edu	37	3	120053967	120053967	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:120053967G>A	ENST00000295628.3	-	3	744	c.649C>T	c.(649-651)Cta>Tta	p.L217L		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	217										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		TGAAGACTTAGGGAACGAAGT	0.348																																						uc003edr.2		NA																	0					0						c.(649-651)CTA>TTA		leucine rich repeat containing 58							88.0	82.0	84.0					3																	120053967		1871	4109	5980	SO:0001819	synonymous_variant	116064							g.chr3:120053967G>A	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.649C>T	3.37:g.120053967G>A			Somatic					p.L217L	NM_001099678	NP_001093148	WXS	Illumina HiSeq	Unspecified	Q96CX6	LRC58_HUMAN		GBM - Glioblastoma multiforme(114;0.147)	3	745	-			217			LRR 8.			Silent	SNP	ENST00000295628.3	37	c.649C>T	CCDS46892.1																																																																																				0.348	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296		4	53	0	0	0	0	4	53				
UROC1	131669	broad.mit.edu	37	3	126220060	126220060	+	Splice_Site	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:126220060C>T	ENST00000290868.2	-	10	1019		c.e10+1		UROC1_ENST00000383579.3_Splice_Site	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1						cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		CCCCCACTCACCAAAGAGCCA	0.562																																						uc003eiz.1		NA																	0				ovary(1)	1						c.e10+1		urocanase domain containing 1 isoform 1							227.0	219.0	222.0					3																	126220060		2203	4300	6503	SO:0001630	splice_region_variant	131669				histidine catabolic process	cytosol	urocanate hydratase activity	g.chr3:126220060C>T	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.965+1G>A	3.37:g.126220060C>T			Somatic				UROC1_uc010hsi.1_Splice_Site_p.W382_splice	p.W322_splice	NM_144639	NP_653240	WXS	Illumina HiSeq	Unspecified	Q96N76	HUTU_HUMAN		GBM - Glioblastoma multiforme(114;0.17)	10	997	-								E9PE13|Q14C64|Q68CJ7	Splice_Site	SNP	ENST00000290868.2	37	c.965_splice	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	c	15.93	2.978786	0.53720	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6633	0.77206	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UROC1	127702750	1.000000	0.71417	1.000000	0.80357	0.478000	0.33099	7.085000	0.76875	2.300000	0.77407	0.486000	0.48141	.		0.562	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	Intron	29	282	0	0	0	0	29	282				
ASTE1	28990	broad.mit.edu	37	3	130742943	130742943	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:130742943C>A	ENST00000264992.3	-	3	1649	c.1208G>T	c.(1207-1209)aGt>aTt	p.S403I	NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000511262.1_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.S403I|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000429253.2_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	403					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTCCACTTCACTGAAAGCTAG	0.428																																						uc003env.1		NA																	0					0						c.(1207-1209)AGT>ATT		asteroid homolog 1							114.0	116.0	116.0					3																	130742943		2203	4300	6503	SO:0001583	missense	28990				DNA repair		nuclease activity	g.chr3:130742943C>A	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1208G>T	3.37:g.130742943C>A	ENSP00000264992:p.Ser403Ile		Somatic				NEK11_uc003enx.2_5'Flank|NEK11_uc003eny.2_5'Flank|NEK11_uc003eoa.2_5'Flank|NEK11_uc003enz.2_5'Flank|NEK11_uc010htn.2_5'Flank|NEK11_uc011blk.1_5'Flank|NEK11_uc011bll.1_5'Flank|NEK11_uc003enw.1_5'Flank|NEK11_uc011blm.1_5'Flank|ASTE1_uc010htm.1_Missense_Mutation_p.S403I|ASTE1_uc011blj.1_RNA	p.S403I	NM_014065	NP_054784	WXS	Illumina HiSeq	Unspecified	Q2TB18	ASTE1_HUMAN			3	1650	-			403					B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	c.1208G>T	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	C	7.219	0.596991	0.13875	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	.	.	.	5.64	2.84	0.33178	.	0.377356	0.36519	N	0.002550	T	0.32763	0.0840	L	0.57536	1.79	0.09310	N	0.999995	B;B	0.27625	0.183;0.112	B;B	0.22386	0.039;0.039	T	0.20306	-1.0279	9	0.38643	T	0.18	-4.3517	5.0348	0.14428	0.1336:0.5761:0.0:0.2903	.	403;403	D6RG30;Q2TB18	.;ASTE1_HUMAN	I	403;403;366	.	ENSP00000264992:S403I	S	-	2	0	ASTE1	132225633	0.232000	0.23762	0.677000	0.29947	0.294000	0.27393	0.556000	0.23438	0.727000	0.32360	-0.291000	0.09656	AGT		0.428	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065		48	106	1	0	6.77e-33	1.24e-32	48	106				
SLC35G2	80723	broad.mit.edu	37	3	136574278	136574278	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:136574278G>A	ENST00000446465.2	+	2	1604	c.976G>A	c.(976-978)Gtc>Atc	p.V326I	RP11-85F14.5_ENST00000474250.1_RNA|RP11-85F14.5_ENST00000470236.1_RNA|RP11-85F14.5_ENST00000461864.1_RNA|SLC35G2_ENST00000393079.3_Missense_Mutation_p.V326I	NM_025246.2	NP_079522.2			solute carrier family 35, member G2																		TGCTATATGTGTCTGTTCTAC	0.393																																						uc003erf.3		NA																	0				ovary(1)	1						c.(976-978)GTC>ATC		transmembrane protein 22							275.0	268.0	270.0					3																	136574278		2203	4300	6503	SO:0001583	missense	80723					Golgi apparatus|integral to membrane		g.chr3:136574278G>A	BC022557	CCDS3091.1	3q22.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000168917	ENSG00000168917		"""Solute carriers"""	28480	protein-coding gene	gene with protein product			"""transmembrane protein 22"""	TMEM22		11230166	Standard	NM_001097600		Approved	MGC3295, DKFZp564K2464	uc003erf.4	Q8TBE7	OTTHUMG00000159787	ENST00000446465.2:c.976G>A	3.37:g.136574278G>A	ENSP00000400839:p.Val326Ile		Somatic				TMEM22_uc003erg.3_Missense_Mutation_p.V326I|TMEM22_uc010hub.2_Missense_Mutation_p.V326I	p.V326I	NM_001097600	NP_001091069	WXS	Illumina HiSeq	Unspecified	Q8TBE7	TMM22_HUMAN			2	1190	+			326			DUF6 2.|Helical; (Potential).			Missense_Mutation	SNP	ENST00000446465.2	37	c.976G>A	CCDS3091.1	.	.	.	.	.	.	.	.	.	.	G	0.141	-1.102261	0.01828	.	.	ENSG00000168917	ENST00000446465;ENST00000393079	T;T	0.50277	0.75;0.75	5.93	-7.02	0.01589	Drug/metabolite transporter (1);	0.770733	0.12245	N	0.486153	T	0.14874	0.0359	N	0.04880	-0.145	0.19775	N	0.999951	B	0.02656	0.0	B	0.04013	0.001	T	0.33317	-0.9873	10	0.06365	T	0.9	-3.3782	4.5935	0.12319	0.5355:0.2181:0.1609:0.0854	.	326	Q8TBE7	TMM22_HUMAN	I	326	ENSP00000400839:V326I;ENSP00000376794:V326I	ENSP00000376794:V326I	V	+	1	0	TMEM22	138056968	0.033000	0.19621	0.064000	0.19789	0.997000	0.91878	0.300000	0.19156	-0.987000	0.03494	0.591000	0.81541	GTC		0.393	SLC35G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357317.1	NM_025246		75	189	0	0	0	0	75	189				
TM4SF4	7104	broad.mit.edu	37	3	149216509	149216509	+	Splice_Site	SNP	G	G	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:149216509G>C	ENST00000305354.4	+	4	1306	c.402G>C	c.(400-402)ggG>ggC	p.G134G		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	134					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)		p.G134G(1)		large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TCACCAACAGGGATTATCTCA	0.448																																						uc003exd.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(400-402)GGG>GGC		transmembrane 4 superfamily member 4							70.0	70.0	70.0					3																	149216509		1896	4117	6013	SO:0001630	splice_region_variant	7104					integral to membrane		g.chr3:149216509G>C		CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.402-1G>C	3.37:g.149216509G>C			Somatic					p.G134G	NM_004617	NP_004608	WXS	Illumina HiSeq	Unspecified	P48230	T4S4_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)		4	633	+			134			Extracellular (Potential).		B2RDA4	Silent	SNP	ENST00000305354.4	37	c.402G>C	CCDS46932.1																																																																																				0.448	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1		Silent	4	35	0	0	0	0	4	35				
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		1582	Substitution - Missense(1582)	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(3139-3141)CAT>CGT		phosphoinositide-3-kinase, catalytic, alpha							99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178952085A>G		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.H1047R	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		21	3297	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		1047		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).	PI3K/PI4K.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.3140A>G	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			6	43	0	0	0	0	6	43				
FAM131A	131408	broad.mit.edu	37	3	184059698	184059698	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:184059698G>A	ENST00000310585.4	+	1	1441	c.77G>A	c.(76-78)gGg>gAg	p.G26E	EIF2B5_ENST00000444495.1_Intron|FAM131A_ENST00000418281.1_Intron|FAM131A_ENST00000340957.5_Intron|FAM131A_ENST00000450976.1_Intron|FAM131A_ENST00000453072.1_Intron|FAM131A_ENST00000383847.2_Intron			Q6UXB0	F131A_HUMAN	family with sequence similarity 131, member A	26						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(9)|skin(1)	14	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TACATGCTGGGGTCTCCCCTT	0.547																																						uc003fog.2		NA																	0				breast(1)	1						c.(76-78)GGG>GAG		hypothetical protein LOC131408 precursor							249.0	226.0	234.0					3																	184059698		2203	4300	6503	SO:0001583	missense	131408					extracellular region		g.chr3:184059698G>A	BC026221	CCDS3262.1, CCDS3262.2, CCDS54689.1	3q27.1	2007-03-20	2007-03-20	2007-03-20	ENSG00000175182	ENSG00000175182			28308	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 40"""	C3orf40		12975309	Standard	NM_144635		Approved	MGC21688	uc003foe.3	Q6UXB0	OTTHUMG00000156206	ENST00000310585.4:c.77G>A	3.37:g.184059698G>A	ENSP00000310135:p.Gly26Glu		Somatic				FAM131A_uc003fob.1_Intron|FAM131A_uc003foc.2_Intron|FAM131A_uc003foe.2_Intron	p.G26E	NM_144635	NP_653236	WXS	Illumina HiSeq	Unspecified	Q6UXB0	F131A_HUMAN	Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		1	1441	+	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		26					D3DNT6|G5E9B1|Q8TA84	Missense_Mutation	SNP	ENST00000310585.4	37	c.77G>A		.	.	.	.	.	.	.	.	.	.	g	11.02	1.516308	0.27123	.	.	ENSG00000175182	ENST00000310585	T	0.21031	2.03	4.36	2.47	0.30058	.	3.928610	0.00481	N	0.000128	T	0.17492	0.0420	.	.	.	0.09310	N	1	B	0.19583	0.037	B	0.18561	0.022	T	0.26916	-1.0089	9	0.87932	D	0	.	3.0491	0.06164	0.0983:0.1808:0.534:0.187	.	26	Q6UXB0	F131A_HUMAN	E	26	ENSP00000310135:G26E	ENSP00000310135:G26E	G	+	2	0	FAM131A	185542392	0.002000	0.14202	0.046000	0.18839	0.027000	0.11550	0.461000	0.21940	0.523000	0.28482	0.655000	0.94253	GGG		0.547	FAM131A-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000343462.1	NM_144635		67	127	0	0	0	0	67	127				
MB21D2	151963	broad.mit.edu	37	3	192516720	192516720	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr3:192516720G>C	ENST00000392452.2	-	2	1251	c.931C>G	c.(931-933)Cag>Gag	p.Q311E		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	311							protein complex binding (GO:0032403)	p.Q309E(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						TTGCAGGCCTGATAGGCCTGC	0.557																																						uc011bsp.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(931-933)CAG>GAG		hypothetical protein LOC151963							34.0	35.0	34.0					3																	192516720		2203	4300	6503	SO:0001583	missense	151963							g.chr3:192516720G>C	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.931C>G	3.37:g.192516720G>C	ENSP00000376246:p.Gln311Glu		Somatic					p.Q311E	NM_178496	NP_848591	WXS	Illumina HiSeq	Unspecified	Q8IYB1	M21D2_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)	2	1252	-	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		311					Q86VD8	Missense_Mutation	SNP	ENST00000392452.2	37	c.931C>G	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453077	0.43531	.	.	ENSG00000180611	ENST00000392452	T	0.07800	3.16	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.10252	0.0251	L	0.51422	1.61	0.80722	D	1	P	0.46784	0.884	B	0.42959	0.403	T	0.07102	-1.0790	10	0.05351	T	0.99	.	18.2403	0.89966	0.0:0.0:1.0:0.0	.	311	Q8IYB1	M21D2_HUMAN	E	311	ENSP00000376246:Q311E	ENSP00000376246:Q311E	Q	-	1	0	MB21D2	193999414	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.869000	0.99810	2.542000	0.85734	0.655000	0.94253	CAG		0.557	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496		9	40	0	0	0	0	9	40				
WHSC1	7468	broad.mit.edu	37	4	1955057	1955057	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:1955057A>T	ENST00000382895.3	+	14	2575	c.2144A>T	c.(2143-2145)cAc>cTc	p.H715L	WHSC1_ENST00000382888.3_Missense_Mutation_p.H63L|WHSC1_ENST00000508803.1_Missense_Mutation_p.H715L|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382892.2_Missense_Mutation_p.H715L|WHSC1_ENST00000382891.5_Missense_Mutation_p.H715L	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	715					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TTAGGGATTCACTCATGTTTC	0.403			T	IGH@	MM																																	uc003gdz.3		NA		Dom	yes		4	4p16.3	7468	T	Wolf-Hirschhorn syndrome candidate 1(MMSET)			L	IGH@		MM		0				ovary(3)|lung(3)|skin(2)|pancreas(1)	9						c.(2143-2145)CAC>CTC		Wolf-Hirschhorn syndrome candidate 1 protein							103.0	102.0	102.0					4																	1955057		2203	4300	6503	SO:0001583	missense	7468				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding	g.chr4:1955057A>T	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2144A>T	4.37:g.1955057A>T	ENSP00000372351:p.His715Leu		Somatic				WHSC1_uc003geb.3_Missense_Mutation_p.H715L|WHSC1_uc003gec.3_Missense_Mutation_p.H715L|WHSC1_uc003ged.3_Missense_Mutation_p.H715L|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_5'UTR|WHSC1_uc011bvh.1_5'UTR|WHSC1_uc010icf.2_Missense_Mutation_p.H63L	p.H715L	NM_001042424	NP_001035889	WXS	Illumina HiSeq	Unspecified	O96028	NSD2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)	12	2320	+		all_epithelial(65;1.34e-05)	715			PHD-type 2.		A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	c.2144A>T	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.505181	0.85282	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.98633	-5.04;-5.04;-5.04;-5.04;-5.04	5.73	5.73	0.89815	.	0.000000	0.56097	D	0.000026	D	0.98896	0.9626	M	0.91090	3.175	0.80722	D	1	D;D	0.57899	0.975;0.981	P;P	0.55161	0.77;0.599	D	0.99364	1.0918	10	0.72032	D	0.01	.	10.3741	0.44071	0.9271:0.0:0.0729:0.0	.	63;715	A2A2T2;O96028	.;NSD2_HUMAN	L	715;715;715;715;63	ENSP00000423972:H715L;ENSP00000372347:H715L;ENSP00000372348:H715L;ENSP00000372351:H715L;ENSP00000372344:H63L	ENSP00000372344:H63L	H	+	2	0	WHSC1	1924855	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.180000	0.71981	2.186000	0.69663	0.533000	0.62120	CAC		0.403	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		10	87	0	0	0	0	10	87				
SCFD2	152579	broad.mit.edu	37	4	53751945	53751945	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:53751945T>C	ENST00000401642.3	-	8	2064	c.1931A>G	c.(1930-1932)gAt>gGt	p.D644G	SCFD2_ENST00000388940.4_Missense_Mutation_p.D599G	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	644					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGCCACAAGATCTTTGACCAT	0.532																																						uc003gzu.2		NA																	0				ovary(2)|pancreas(1)	3						c.(1930-1932)GAT>GGT		sec1 family domain containing 2							116.0	105.0	108.0					4																	53751945		2203	4300	6503	SO:0001583	missense	152579				protein transport|vesicle docking involved in exocytosis			g.chr4:53751945T>C	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1931A>G	4.37:g.53751945T>C	ENSP00000384182:p.Asp644Gly		Somatic				SCFD2_uc010igm.2_Missense_Mutation_p.D599G	p.D644G	NM_152540	NP_689753	WXS	Illumina HiSeq	Unspecified	Q8WU76	SCFD2_HUMAN	GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)		8	2065	-			644					Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	c.1931A>G	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.946137	0.53079	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.77620	-1.11;-1.11	5.07	5.07	0.68467	.	0.068114	0.56097	D	0.000026	D	0.84520	0.5490	L	0.50333	1.59	0.44843	D	0.997852	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.86055	0.1528	10	0.72032	D	0.01	.	14.0065	0.64468	0.0:0.0:0.0:1.0	.	599;644	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	G	644;599	ENSP00000384182:D644G;ENSP00000373592:D599G	ENSP00000373592:D599G	D	-	2	0	SCFD2	53446702	1.000000	0.71417	1.000000	0.80357	0.438000	0.31896	5.558000	0.67319	1.922000	0.55676	0.459000	0.35465	GAT		0.532	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		10	87	0	0	0	0	10	87				
UGT2B4	7363	broad.mit.edu	37	4	70359477	70359477	+	Missense_Mutation	SNP	G	G	T	rs373959839		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:70359477G>T	ENST00000305107.6	-	2	850	c.804C>A	c.(802-804)caC>caA	p.H268Q	UGT2B4_ENST00000381096.3_Missense_Mutation_p.H132Q|UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000512583.1_Missense_Mutation_p.H268Q	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	268					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GTAAGAGTGGGTGAGGAAATT	0.423																																						uc003hek.3		NA																	0				skin(2)	2						c.(802-804)CAC>CAA		UDP glucuronosyltransferase 2B4 precursor							120.0	127.0	125.0					4																	70359477		2195	4300	6495	SO:0001583	missense	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70359477G>T	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.804C>A	4.37:g.70359477G>T	ENSP00000305221:p.His268Gln		Somatic				UGT2B4_uc011cap.1_Missense_Mutation_p.H132Q|UGT2B4_uc003hel.3_Missense_Mutation_p.H268Q	p.H268Q	NM_021139	NP_066962	WXS	Illumina HiSeq	Unspecified	P06133	UD2B4_HUMAN			2	851	-			268					A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	c.804C>A	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	G	0.682	-0.797978	0.02862	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000381096	T;T;T	0.59638	0.25;0.25;0.25	1.96	-2.08	0.07254	.	0.146541	0.46758	U	0.000271	T	0.46718	0.1407	L	0.28192	0.835	0.24819	N	0.992596	B;B;P	0.34699	0.013;0.058;0.464	B;B;P	0.45794	0.043;0.038;0.493	T	0.49322	-0.8952	10	0.54805	T	0.06	.	7.3782	0.26841	0.5047:0.0:0.4953:0.0	.	132;268;268	A6NCP7;G5E9X8;P06133	.;.;UD2B4_HUMAN	Q	268;268;132	ENSP00000421290:H268Q;ENSP00000305221:H268Q;ENSP00000370486:H132Q	ENSP00000305221:H268Q	H	-	3	2	UGT2B4	70394066	0.000000	0.05858	0.010000	0.14722	0.007000	0.05969	-2.178000	0.01260	-0.764000	0.04651	-1.801000	0.00618	CAC		0.423	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		40	88	1	0	4.33e-17	7.75e-17	40	88				
SLC4A4	8671	broad.mit.edu	37	4	72423471	72423471	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:72423471C>T	ENST00000264485.5	+	22	2923	c.2806C>T	c.(2806-2808)Cag>Tag	p.Q936*	SLC4A4_ENST00000351898.6_Nonsense_Mutation_p.Q852*|SLC4A4_ENST00000340595.3_Nonsense_Mutation_p.Q892*|SLC4A4_ENST00000425175.1_Nonsense_Mutation_p.Q936*	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	936					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TCTGAAGCATCAGCCTGACTT	0.507																																						uc003hfy.2		NA																	0				ovary(3)|kidney(1)|skin(1)	5						c.(2806-2808)CAG>TAG		solute carrier family 4, sodium bicarbonate							149.0	121.0	131.0					4																	72423471		2203	4300	6503	SO:0001587	stop_gained	8671					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity	g.chr4:72423471C>T	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2806C>T	4.37:g.72423471C>T	ENSP00000264485:p.Gln936*		Somatic				SLC4A4_uc010iic.2_Nonsense_Mutation_p.Q936*|SLC4A4_uc010iib.2_Nonsense_Mutation_p.Q852*|SLC4A4_uc003hfz.2_Nonsense_Mutation_p.Q936*|SLC4A4_uc003hgc.3_Nonsense_Mutation_p.Q892*|SLC4A4_uc010iid.2_Nonsense_Mutation_p.Q140*	p.Q936*	NM_001098484	NP_001091954	WXS	Illumina HiSeq	Unspecified	Q9Y6R1	S4A4_HUMAN	Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		22	2923	+			936			Cytoplasmic (Potential).		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Nonsense_Mutation	SNP	ENST00000264485.5	37	c.2806C>T	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	C	42	9.820568	0.99272	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000340595	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	.	.	.	X	936;936;852;892	.	ENSP00000264485:Q936X	Q	+	1	0	SLC4A4	72642335	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.826000	0.97356	0.563000	0.77884	CAG		0.507	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759		15	41	0	0	0	0	15	41				
NPFFR2	10886	broad.mit.edu	37	4	73012719	73012719	+	Missense_Mutation	SNP	T	T	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:73012719T>G	ENST00000308744.6	+	4	857	c.759T>G	c.(757-759)ttT>ttG	p.F253L	NPFFR2_ENST00000395999.1_Missense_Mutation_p.F154L|NPFFR2_ENST00000358749.3_Missense_Mutation_p.F151L|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000344413.5_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	253					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TCTACCCTTTTAAACCAAAGC	0.388																																						uc003hgg.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(757-759)TTT>TTG		neuropeptide FF receptor 2 isoform 1							202.0	203.0	203.0					4																	73012719		2203	4300	6503	SO:0001583	missense	10886				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity	g.chr4:73012719T>G	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.759T>G	4.37:g.73012719T>G	ENSP00000307822:p.Phe253Leu		Somatic				NPFFR2_uc010iig.1_Missense_Mutation_p.F35L|NPFFR2_uc003hgi.2_Missense_Mutation_p.F154L|NPFFR2_uc003hgh.2_Missense_Mutation_p.F151L|NPFFR2_uc003hgj.2_RNA	p.F253L	NM_004885	NP_004876	WXS	Illumina HiSeq	Unspecified	Q9Y5X5	NPFF2_HUMAN	Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)		4	857	+			253			Cytoplasmic (Potential).		Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	c.759T>G	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	T	3.777	-0.046531	0.07407	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.26373	1.74;1.74;1.74	5.81	2.15	0.27550	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000019	T	0.12987	0.0315	N	0.12920	0.275	0.58432	D	0.999997	B;B	0.26512	0.151;0.085	B;B	0.33960	0.091;0.173	T	0.09862	-1.0655	10	0.06757	T	0.87	.	8.307	0.32049	0.0:0.289:0.0:0.711	.	154;253	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	L	253;154;151	ENSP00000307822:F253L;ENSP00000379321:F154L;ENSP00000351599:F151L	ENSP00000307822:F253L	F	+	3	2	NPFFR2	73231583	1.000000	0.71417	1.000000	0.80357	0.123000	0.20343	1.657000	0.37366	0.476000	0.27440	-0.911000	0.02809	TTT		0.388	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885		13	169	0	0	0	0	13	169				
FAM175A	84142	broad.mit.edu	37	4	84384670	84384670	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:84384670C>A	ENST00000321945.7	-	8	881	c.773G>T	c.(772-774)aGa>aTa	p.R258I	MRPS18C_ENST00000509571.1_Intron|FAM175A_ENST00000506553.1_Missense_Mutation_p.R209I	NM_139076.2	NP_620775.2	Q6UWZ7	F175A_HUMAN	family with sequence similarity 175, member A	258					chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	13						CTGTGCTCCTCTCCTTTTCTC	0.333																																						uc003hou.2		NA																	0				kidney(1)	1						c.(772-774)AGA>ATA		coiled-coil domain containing 98							160.0	145.0	150.0					4																	84384670		2203	4299	6502	SO:0001583	missense	84142				chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding	g.chr4:84384670C>A	AK023676	CCDS3605.2	4q21.23	2008-10-31	2008-07-02	2008-07-02	ENSG00000163322	ENSG00000163322			25829	protein-coding gene	gene with protein product	"""Abraxas protein"""	611143	"""coiled-coil domain containing 98"""	CCDC98		12975309, 17525340	Standard	NM_139076		Approved	FLJ13614, ABRA1	uc003hou.2	Q6UWZ7	OTTHUMG00000130429	ENST00000321945.7:c.773G>T	4.37:g.84384670C>A	ENSP00000369857:p.Arg258Ile		Somatic				MRPS18C_uc011ccu.1_Intron|FAM175A_uc003hot.2_Missense_Mutation_p.R86I|FAM175A_uc003hov.2_Missense_Mutation_p.R149I	p.R258I	NM_139076	NP_620775	WXS	Illumina HiSeq	Unspecified	Q6UWZ7	F175A_HUMAN			8	838	-			258			Potential.		A5JJ07|Q9H8I1|Q9H9N4	Missense_Mutation	SNP	ENST00000321945.7	37	c.773G>T	CCDS3605.2	.	.	.	.	.	.	.	.	.	.	C	9.956	1.221406	0.22457	.	.	ENSG00000163322	ENST00000321945;ENST00000506553	T;T	0.53857	0.61;0.6	5.99	2.29	0.28610	.	0.148640	0.64402	D	0.000015	T	0.35393	0.0930	N	0.19112	0.55	0.35165	D	0.771036	P	0.41569	0.755	B	0.39258	0.295	T	0.47018	-0.9149	10	0.87932	D	0	-15.8783	9.7037	0.40203	0.0:0.1783:0.0:0.8217	.	258	Q6UWZ7	F175A_HUMAN	I	258;209	ENSP00000369857:R258I;ENSP00000426763:R209I	ENSP00000369857:R258I	R	-	2	0	FAM175A	84603694	1.000000	0.71417	0.907000	0.35723	0.004000	0.04260	0.795000	0.26972	0.181000	0.19994	-1.029000	0.02412	AGA		0.333	FAM175A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252818.1	NM_139076		10	66	1	0	7.48e-07	1.25e-06	10	66				
MAPK10	5602	broad.mit.edu	37	4	86988972	86988972	+	Missense_Mutation	SNP	G	G	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:86988972G>C	ENST00000359221.3	-	10	1465	c.939C>G	c.(937-939)ttC>ttG	p.F313L	MAPK10_ENST00000395166.1_Missense_Mutation_p.F275L|MAPK10_ENST00000395160.3_Missense_Mutation_p.F168L|MAPK10_ENST00000395161.2_Missense_Mutation_p.F313L|MAPK10_ENST00000395157.3_Missense_Mutation_p.F168L|MAPK10_ENST00000361569.2_Missense_Mutation_p.F313L|MAPK10_ENST00000395169.3_Missense_Mutation_p.F275L|MAPK10_ENST00000449047.2_Missense_Mutation_p.F168L			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	313	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GGGAATCTGGGAAGAGTTTGG	0.488																																						uc003hpq.2		NA																	0				stomach(1)|breast(1)|central_nervous_system(1)	3						c.(937-939)TTC>TTG		mitogen-activated protein kinase 10 isoform 2							146.0	131.0	136.0					4																	86988972		2203	4300	6503	SO:0001583	missense	5602				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding	g.chr4:86988972G>C	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.939C>G	4.37:g.86988972G>C	ENSP00000352157:p.Phe313Leu		Somatic				MAPK10_uc010ikg.2_Missense_Mutation_p.F275L|MAPK10_uc003hpr.2_Missense_Mutation_p.F275L|MAPK10_uc003hps.2_Missense_Mutation_p.F313L|MAPK10_uc003hpt.2_Missense_Mutation_p.F313L|MAPK10_uc003hpu.2_Missense_Mutation_p.F313L|MAPK10_uc003hpv.2_Missense_Mutation_p.F168L|MAPK10_uc003hpn.2_Missense_Mutation_p.F61L|MAPK10_uc003hpo.2_Missense_Mutation_p.F168L|MAPK10_uc011ccw.1_Missense_Mutation_p.F199L|MAPK10_uc003hpp.2_Missense_Mutation_p.F168L	p.F313L	NM_138982	NP_620448	WXS	Illumina HiSeq	Unspecified	P53779	MK10_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.002)	9	1006	-		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)	313			Protein kinase.		A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	c.939C>G	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.97|18.97	3.736394|3.736394	0.69189|0.69189	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	T;T;T;T;T;T;T;T|.	0.81415|.	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49|.	5.28|5.28	1.55|1.55	0.23275|0.23275	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50326|0.50326	0.1609|0.1609	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	B;P;P;P;P|.	0.44659|.	0.242;0.84;0.807;0.807;0.514|.	B;P;P;P;P|.	0.50754|.	0.423;0.649;0.517;0.517;0.519|.	T|T	0.28713|0.28713	-1.0035|-1.0035	10|5	0.59425|.	D|.	0.04|.	-17.1611|-17.1611	8.8374|8.8374	0.35119|0.35119	0.7011:0.0:0.2989:0.0|0.7011:0.0:0.2989:0.0	.|.	199;168;275;313;313|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	L|A	275;313;168;313;275;168;168;313|226	ENSP00000378598:F275L;ENSP00000352157:F313L;ENSP00000378586:F168L;ENSP00000355297:F313L;ENSP00000378595:F275L;ENSP00000378589:F168L;ENSP00000414469:F168L;ENSP00000378590:F313L|.	ENSP00000352157:F313L|.	F|P	-|-	3|1	2|0	MAPK10|MAPK10	87207996|87207996	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	0.611000|0.611000	0.24268|0.24268	0.091000|0.091000	0.17302|0.17302	-0.302000|-0.302000	0.09304|0.09304	TTC|CCC		0.488	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2			10	27	0	0	0	0	10	27				
HERC6	55008	broad.mit.edu	37	4	89318075	89318075	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:89318075C>A	ENST00000264346.7	+	7	1019	c.960C>A	c.(958-960)agC>agA	p.S320R	HERC6_ENST00000273960.3_Intron|HERC6_ENST00000380265.5_Missense_Mutation_p.S320R	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	320					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GTGACACAAGCAAGCCAACTC	0.453																																						uc011cdi.1		NA																	0				lung(3)|ovary(1)|kidney(1)	5						c.(958-960)AGC>AGA		hect domain and RLD 6 isoform 1							175.0	168.0	170.0					4																	89318075		1981	4179	6160	SO:0001583	missense	55008				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity	g.chr4:89318075C>A	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.960C>A	4.37:g.89318075C>A	ENSP00000264346:p.Ser320Arg		Somatic				HERC6_uc003hrp.1_Intron|HERC6_uc011cdj.1_Missense_Mutation_p.S320R|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_Intron	p.S320R	NM_017912	NP_060382	WXS	Illumina HiSeq	Unspecified	Q8IVU3	HERC6_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000222)	7	1143	+		Hepatocellular(203;0.114)	320					B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	ENST00000264346.7	37	c.960C>A	CCDS47098.1	.	.	.	.	.	.	.	.	.	.	C	10.10	1.257500	0.22965	.	.	ENSG00000138642	ENST00000380265;ENST00000511939;ENST00000264346	T;T	0.80214	-1.35;-1.35	4.79	3.94	0.45596	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.343196	0.28420	N	0.015404	T	0.69602	0.3129	M	0.62723	1.935	0.80722	D	1	B;B	0.34103	0.043;0.437	B;B	0.28553	0.018;0.091	T	0.62742	-0.6790	10	0.15066	T	0.55	.	5.4697	0.16662	0.0:0.7496:0.0:0.2504	.	320;320	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	R	320	ENSP00000369617:S320R;ENSP00000264346:S320R	ENSP00000264346:S320R	S	+	3	2	HERC6	89537098	0.159000	0.22864	0.979000	0.43373	0.049000	0.14656	0.522000	0.22909	2.636000	0.89361	0.579000	0.79373	AGC		0.453	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2			7	141	1	0	0.00307968	0.00471199	7	141				
ADH4	127	broad.mit.edu	37	4	100062731	100062731	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:100062731C>T	ENST00000265512.7	-	3	297	c.223G>A	c.(223-225)Gtg>Atg	p.V75M	RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000505590.1_Missense_Mutation_p.V94M|ADH4_ENST00000504581.1_5'Flank|ADH4_ENST00000508393.1_Missense_Mutation_p.V94M|ADH4_ENST00000423445.1_Missense_Mutation_p.V94M	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	75					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		ATACTTTCCACAATACCTGCA	0.403																																						uc003hun.2		NA																	0				skin(2)	2						c.(223-225)GTG>ATG		class II alcohol dehydrogenase, pi subunit	NADH(DB00157)						96.0	85.0	89.0					4																	100062731		2203	4300	6503	SO:0001583	missense	127				alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding	g.chr4:100062731C>T	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.223G>A	4.37:g.100062731C>T	ENSP00000265512:p.Val75Met		Somatic				uc003hum.1_Intron|ADH4_uc011ced.1_Missense_Mutation_p.V94M	p.V75M	NM_000670	NP_000661	WXS	Illumina HiSeq	Unspecified	P08319	ADH4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	3	299	-			75					A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	37	c.223G>A	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857593	0.71834	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590;ENST00000512499;ENST00000504125	T;T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65;2.65	4.44	3.6	0.41247	GroES-like (1);Alcohol dehydrogenase GroES-like (1);Alcohol dehydrogenase, zinc-type, conserved site (1);	0.000000	0.64402	D	0.000008	T	0.55768	0.1941	H	0.99668	4.69	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.71300	-0.4634	10	0.87932	D	0	-0.9898	10.5223	0.44927	0.0:0.8385:0.0:0.1615	.	94;75	P08319-2;P08319	.;ADH4_HUMAN	M	94;75;94;94;94;75	ENSP00000424630:V94M;ENSP00000265512:V75M;ENSP00000397939:V94M;ENSP00000425416:V94M;ENSP00000423571:V94M;ENSP00000427525:V75M	ENSP00000265512:V75M	V	-	1	0	ADH4	100281754	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	3.607000	0.54102	1.089000	0.41292	0.655000	0.94253	GTG		0.403	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670		5	24	0	0	0	0	5	24				
ADH1A	124	broad.mit.edu	37	4	100205642	100205642	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:100205642T>C	ENST00000209668.2	-	5	594	c.481A>G	c.(481-483)Att>Gtt	p.I161V	ADH1A_ENST00000511656.1_5'Flank|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	161					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	GCTGCATCAATTTTGGCTACT	0.493																																						uc003hur.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(481-483)ATT>GTT		class I alcohol dehydrogenase, alpha subunit	Fomepizole(DB01213)|NADH(DB00157)						97.0	93.0	94.0					4																	100205642		2203	4300	6503	SO:0001583	missense	124				ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding	g.chr4:100205642T>C	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.481A>G	4.37:g.100205642T>C	ENSP00000209668:p.Ile161Val		Somatic				uc003hum.1_Intron|ADH1A_uc011ceg.1_Missense_Mutation_p.I161V|ADH1A_uc010ilf.1_5'UTR	p.I161V	NM_000667	NP_000658	WXS	Illumina HiSeq	Unspecified	P07327	ADH1A_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	5	552	-			161					A8K3E3|Q17R68	Missense_Mutation	SNP	ENST00000209668.2	37	c.481A>G	CCDS3648.1	.	.	.	.	.	.	.	.	.	.	T	2.274	-0.366377	0.05069	.	.	ENSG00000187758	ENST00000209668	T	0.03580	3.88	2.59	1.19	0.21007	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.02342	0.0072	N	0.16708	0.43	0.41061	D	0.985378	B	0.31413	0.322	B	0.33799	0.17	T	0.56177	-0.8022	10	0.14252	T	0.57	-19.013	8.8009	0.34907	0.0:0.0:0.1883:0.8117	.	161	P07327	ADH1A_HUMAN	V	161	ENSP00000209668:I161V	ENSP00000209668:I161V	I	-	1	0	ADH1A	100424665	0.996000	0.38824	0.913000	0.36048	0.159000	0.22180	2.109000	0.41863	1.174000	0.42811	0.377000	0.23210	ATT		0.493	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667		9	43	0	0	0	0	9	43				
LEF1	51176	broad.mit.edu	37	4	109088757	109088757	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:109088757G>A	ENST00000265165.1	-	1	821	c.167C>T	c.(166-168)tCc>tTc	p.S56F	LEF1_ENST00000438313.2_Missense_Mutation_p.S56F|LEF1_ENST00000379951.2_Missense_Mutation_p.S56F|LEF1_ENST00000512172.1_5'Flank|LEF1_ENST00000510624.1_5'Flank|LEF1-AS1_ENST00000436413.1_RNA	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	56	CTNNB1-binding. {ECO:0000250}.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		GTTCACCAAGGAAGACTTGAT	0.577																																						uc003hyt.1		NA																	0				large_intestine(1)	1						c.(166-168)TCC>TTC		lymphoid enhancer-binding factor 1 isoform 1							163.0	150.0	154.0					4																	109088757		2203	4300	6503	SO:0001583	missense	51176				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding	g.chr4:109088757G>A		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.167C>T	4.37:g.109088757G>A	ENSP00000265165:p.Ser56Phe		Somatic				LEF1_uc011cfj.1_5'Flank|LEF1_uc011cfk.1_5'Flank|LEF1_uc003hyu.1_Missense_Mutation_p.S56F|LEF1_uc003hyv.1_Missense_Mutation_p.S56F|LEF1_uc010imb.1_RNA	p.S56F	NM_016269	NP_057353	WXS	Illumina HiSeq	Unspecified	Q9UJU2	LEF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000224)	1	822	-			56			CTNNB1-binding (By similarity).		B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	ENST00000265165.1	37	c.167C>T	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261010	0.59431	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313	D;D;D	0.99834	-6.96;-7.04;-6.99	4.91	4.06	0.47325	CTNNB1 binding, N-teminal (1);	0.000000	0.85682	D	0.000000	D	0.99753	0.9901	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	D;D;D	0.97110	0.989;1.0;1.0	D	0.96812	0.9597	10	0.87932	D	0	-22.8868	12.6049	0.56516	0.0803:0.0:0.9197:0.0	.	56;56;56	Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;LEF1_HUMAN	F	56	ENSP00000265165:S56F;ENSP00000369284:S56F;ENSP00000406176:S56F	ENSP00000265165:S56F	S	-	2	0	LEF1	109308206	1.000000	0.71417	0.559000	0.28332	0.175000	0.22909	7.021000	0.76425	2.253000	0.74438	0.591000	0.81541	TCC		0.577	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2			19	89	0	0	0	0	19	89				
COL25A1	84570	broad.mit.edu	37	4	110222987	110222987	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:110222987G>A	ENST00000399132.1	-	2	719	c.189C>T	c.(187-189)atC>atT	p.I63I	AC004051.2_ENST00000500526.1_lincRNA|COL25A1_ENST00000399126.1_Silent_p.I63I|COL25A1_ENST00000399127.1_Silent_p.I63I	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CGAGAGCGGCGATCCTCGCCT	0.607																																						uc003hze.1		NA																	0				ovary(2)	2						c.(187-189)ATC>ATT		collagen, type XXV, alpha 1 isoform 1							93.0	98.0	96.0					4																	110222987		1978	4152	6130	SO:0001819	synonymous_variant	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:110222987G>A	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.189C>T	4.37:g.110222987G>A			Somatic				COL25A1_uc003hzg.2_Silent_p.I63I|COL25A1_uc003hzh.1_Silent_p.I63I	p.I63I	NM_198721	NP_942014	WXS	Illumina HiSeq	Unspecified	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	2	720	-		Hepatocellular(203;0.217)	63			Extracellular (Potential).			Silent	SNP	ENST00000399132.1	37	c.189C>T	CCDS43258.1																																																																																				0.607	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		11	74	0	0	0	0	11	74				
DCHS2	54798	broad.mit.edu	37	4	155158157	155158157	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:155158157G>A	ENST00000357232.4	-	25	6281	c.6282C>T	c.(6280-6282)ttC>ttT	p.F2094F		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2094	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATTTGACTGTGAATTCAGGGG	0.418																																						uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(6280-6282)TTC>TTT		dachsous 2 isoform 1							145.0	143.0	144.0					4																	155158157		2203	4300	6503	SO:0001819	synonymous_variant	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155158157G>A	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6282C>T	4.37:g.155158157G>A			Somatic					p.F2094F	NM_017639	NP_060109	WXS	Illumina HiSeq	Unspecified	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	25	6282	-	all_hematologic(180;0.208)	Renal(120;0.0854)	2094			Cadherin 18.		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	c.6282C>T	CCDS3785.1																																																																																				0.418	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		17	90	0	0	0	0	17	90				
SEMA5A	9037	broad.mit.edu	37	5	9066574	9066574	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:9066574C>T	ENST00000382496.5	-	17	2923	c.2258G>A	c.(2257-2259)cGg>cAg	p.R753Q		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	753	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.R753L(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						AGAACAGTACCGCATTTCGAT	0.537																																						uc003jek.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2257-2259)CGG>CAG		semaphorin 5A precursor							179.0	171.0	174.0					5																	9066574		2203	4300	6503	SO:0001583	missense	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9066574C>T	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2258G>A	5.37:g.9066574C>T	ENSP00000371936:p.Arg753Gln		Somatic					p.R753Q	NM_003966	NP_003957	WXS	Illumina HiSeq	Unspecified	Q13591	SEM5A_HUMAN			17	2970	-			753			TSP type-1 4.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	c.2258G>A	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	36	5.682125	0.96774	.	.	ENSG00000112902	ENST00000382496	T	0.38077	1.16	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.61502	0.2352	M	0.71871	2.18	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62845	-0.6768	10	0.87932	D	0	.	17.5918	0.87999	0.0:1.0:0.0:0.0	.	753	Q13591	SEM5A_HUMAN	Q	753	ENSP00000371936:R753Q	ENSP00000371936:R753Q	R	-	2	0	SEMA5A	9119574	1.000000	0.71417	0.984000	0.44739	0.771000	0.43674	7.511000	0.81718	2.761000	0.94854	0.591000	0.81541	CGG		0.537	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			29	128	0	0	0	0	29	128				
CDH6	1004	broad.mit.edu	37	5	31323025	31323025	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:31323025C>T	ENST00000265071.2	+	12	2248	c.1983C>T	c.(1981-1983)gaC>gaT	p.D661D		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	661					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GTTACAACGACGAAGGTGGTG	0.493																																						uc003jhe.1		NA																	0				ovary(4)|skin(2)|large_intestine(1)	7						c.(1981-1983)GAC>GAT		cadherin 6, type 2 preproprotein							87.0	84.0	85.0					5																	31323025		2203	4300	6503	SO:0001819	synonymous_variant	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31323025C>T	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1983C>T	5.37:g.31323025C>T			Somatic					p.D661D	NM_004932	NP_004923	WXS	Illumina HiSeq	Unspecified	P55285	CADH6_HUMAN			12	2309	+			661			Cytoplasmic (Potential).		A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	c.1983C>T	CCDS3894.1																																																																																				0.493	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		12	66	0	0	0	0	12	66				
OSMR	9180	broad.mit.edu	37	5	38933399	38933399	+	Silent	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:38933399T>C	ENST00000274276.3	+	18	3195	c.2793T>C	c.(2791-2793)agT>agC	p.S931S		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	931					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					ACAAGGACAGTCTCCCAACAA	0.483																																						uc003jln.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(2791-2793)AGT>AGC		oncostatin M receptor precursor							102.0	106.0	105.0					5																	38933399		2203	4300	6503	SO:0001819	synonymous_variant	9180				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity	g.chr5:38933399T>C	U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.2793T>C	5.37:g.38933399T>C			Somatic				OSMR_uc011cpj.1_Silent_p.S135S	p.S931S	NM_003999	NP_003990	WXS	Illumina HiSeq	Unspecified	Q99650	OSMR_HUMAN			18	3160	+	all_lung(31;0.000365)		931			Cytoplasmic (Potential).		Q6P4E8|Q96QJ6	Silent	SNP	ENST00000274276.3	37	c.2793T>C	CCDS3928.1																																																																																				0.483	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999		19	171	0	0	0	0	19	171				
ANKRD55	79722	broad.mit.edu	37	5	55407004	55407004	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:55407004G>T	ENST00000341048.4	-	10	1722	c.1571C>A	c.(1570-1572)cCt>cAt	p.P524H	ANKRD55_ENST00000504958.2_Missense_Mutation_p.P481H|ANKRD55_ENST00000434982.2_Missense_Mutation_p.P236H|ANKRD55_ENST00000505970.2_5'Flank	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	524										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TTGGTGACCAGGCCGGACACT	0.463																																						uc003jqu.2		NA																	0				skin(1)	1						c.(1570-1572)CCT>CAT		ankyrin repeat domain 55 isoform 1							148.0	147.0	148.0					5																	55407004		2203	4300	6503	SO:0001583	missense	79722							g.chr5:55407004G>T	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.1571C>A	5.37:g.55407004G>T	ENSP00000342295:p.Pro524His		Somatic				ANKRD55_uc003jqt.2_Missense_Mutation_p.P236H	p.P524H	NM_024669	NP_078945	WXS	Illumina HiSeq	Unspecified	Q3KP44	ANR55_HUMAN			10	1723	-		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)	523					B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	c.1571C>A	CCDS34161.1	.	.	.	.	.	.	.	.	.	.	.	11.64	1.698150	0.30142	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000434982	T;T;T	0.39592	1.32;1.07;1.44	5.63	4.76	0.60689	.	0.236644	0.36002	N	0.002849	T	0.31575	0.0801	N	0.19112	0.55	0.09310	N	1	P;P	0.50710	0.856;0.938	B;B	0.43360	0.219;0.417	T	0.16958	-1.0385	10	0.62326	D	0.03	.	12.9252	0.58257	0.0751:0.0:0.9249:0.0	.	524;523	B3KVT8;Q3KP44	.;ANR55_HUMAN	H	524;524;481;236	ENSP00000342295:P524H;ENSP00000424230:P481H;ENSP00000429421:P236H	ENSP00000342295:P524H	P	-	2	0	ANKRD55	55442761	0.966000	0.33281	0.018000	0.16275	0.313000	0.28021	4.947000	0.63583	1.511000	0.48818	0.655000	0.94253	CCT		0.463	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669		22	168	1	0	2.22e-12	3.86e-12	22	168				
MCCC2	64087	broad.mit.edu	37	5	70898414	70898414	+	Silent	SNP	G	G	A	rs184731247		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:70898414G>A	ENST00000340941.6	+	5	594	c.465G>A	c.(463-465)cgG>cgA	p.R155R	MCCC2_ENST00000509358.2_Silent_p.R155R|MCCC2_ENST00000510895.2_3'UTR|MCCC2_ENST00000323375.8_Silent_p.R155R	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	155	Carboxyltransferase.		R -> Q (in MCC2D; mild form). {ECO:0000269|PubMed:11181649}.		biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AACAATTACGGGCCCAAGAAA	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		17198	0.0		0.001	False		,,,				2504	0.0					uc003kbs.3		NA																	0				ovary(1)	1						c.(463-465)CGG>CGA		methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	Biotin(DB00121)						89.0	86.0	87.0					5																	70898414		2203	4300	6503	SO:0001819	synonymous_variant	64087				leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity	g.chr5:70898414G>A	AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.465G>A	5.37:g.70898414G>A			Somatic				MCCC2_uc010iyv.1_Silent_p.R155R|MCCC2_uc003kbt.3_RNA|MCCC2_uc003kbu.1_Silent_p.R24R	p.R155R	NM_022132	NP_071415	WXS	Illumina HiSeq	Unspecified	Q9HCC0	MCCB_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	5	603	+		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)	155		R -> Q (in MCC2 deficiency; mild form).	Carboxyltransferase.		A6NIY9|Q96C27|Q9Y4L7	Silent	SNP	ENST00000340941.6	37	c.465G>A	CCDS34184.1																																																																																				0.418	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4			5	43	0	0	0	0	5	43				
MTX3	345778	broad.mit.edu	37	5	79282892	79282892	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:79282892G>T	ENST00000512528.1	-	7	640	c.620C>A	c.(619-621)gCa>gAa	p.A207E	MTX3_ENST00000509852.1_Missense_Mutation_p.A207E|MTX3_ENST00000512560.1_Missense_Mutation_p.A146E			Q5HYI7	MTX3_HUMAN	metaxin 3	207					protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(1)	7		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		GTAAAGAGGTGCAAGAAAACC	0.398																																						uc010jag.2		NA																	0					0						c.(619-621)GCA>GAA		metaxin 3							100.0	97.0	98.0					5																	79282892		1843	4104	5947	SO:0001583	missense	345778				protein targeting to mitochondrion	mitochondrial outer membrane		g.chr5:79282892G>T	BX538064	CCDS47239.1, CCDS47239.2, CCDS54872.1	5q14.1	2004-08-18				ENSG00000177034			24812	protein-coding gene	gene with protein product						15087125	Standard	NM_001010891		Approved		uc010jah.3	Q5HYI7		ENST00000512528.1:c.620C>A	5.37:g.79282892G>T	ENSP00000424798:p.Ala207Glu		Somatic				MTX3_uc010jah.2_Missense_Mutation_p.A207E|MTX3_uc003kge.3_Missense_Mutation_p.A146E|MTX3_uc003kgf.1_RNA	p.A207E	NM_001010891	NP_001010891	WXS	Illumina HiSeq	Unspecified	Q5HYI7	MTX3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)	7	647	-		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)	207					B4DL65|E9PB57|Q7Z380|Q8NB92	Missense_Mutation	SNP	ENST00000512528.1	37	c.620C>A		.	.	.	.	.	.	.	.	.	.	G	33	5.207417	0.95033	.	.	ENSG00000177034	ENST00000512560;ENST00000509852;ENST00000512528;ENST00000418095	T;T;T	0.48201	0.82;0.82;0.82	6.02	6.02	0.97574	Glutathione S-transferase, C-terminal-like (2);	.	.	.	.	T	0.75140	0.3809	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	0.992;1.0	P;D	0.80764	0.866;0.994	T	0.77242	-0.2660	9	0.66056	D	0.02	.	20.5269	0.99230	0.0:0.0:1.0:0.0	.	207;207	Q5HYI7-4;Q5HYI7	.;MTX3_HUMAN	E	146;207;207;207	ENSP00000423600:A146E;ENSP00000423302:A207E;ENSP00000424798:A207E	ENSP00000392181:A207E	A	-	2	0	MTX3	79318648	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.529000	0.98049	2.859000	0.98148	0.591000	0.81541	GCA		0.398	MTX3-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372567.1	XM_293971		17	44	1	0	2.35e-11	4.07e-11	17	44				
WNT8A	7478	broad.mit.edu	37	5	137426351	137426351	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:137426351G>A	ENST00000398754.1	+	6	650	c.645G>A	c.(643-645)gcG>gcA	p.A215A	WNT8A_ENST00000506684.1_Silent_p.A233A	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	215					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATGACCAGGCGCTGAAAATTG	0.587																																						uc003lcd.1		NA																	0				ovary(1)|lung(1)|breast(1)|skin(1)	4						c.(643-645)GCG>GCA		wingless-type MMTV integration site family,							49.0	50.0	50.0					5																	137426351		1934	4149	6083	SO:0001819	synonymous_variant	7478				brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity	g.chr5:137426351G>A	AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.645G>A	5.37:g.137426351G>A			Somatic				BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Silent_p.A233A|WNT8A_uc011cyk.1_Silent_p.A233A	p.A215A	NM_058244	NP_490645	WXS	Illumina HiSeq	Unspecified	Q9H1J5	WNT8A_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		6	650	+			215					Q96S51	Silent	SNP	ENST00000398754.1	37	c.645G>A	CCDS43368.1																																																																																				0.587	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280395.1	NM_058244		8	41	0	0	0	0	8	41				
PCDHA1	56147	broad.mit.edu	37	5	140165973	140165973	+	Missense_Mutation	SNP	A	A	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:140165973A>C	ENST00000504120.2	+	1	98	c.98A>C	c.(97-99)tAc>tCc	p.Y33S	PCDHA1_ENST00000378133.3_Missense_Mutation_p.Y33S|PCDHA1_ENST00000394633.3_Missense_Mutation_p.Y33S	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	33	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCTCCACTACTCGATCCCG	0.652																																						uc003lhb.2		NA																	0				skin(1)	1						c.(97-99)TAC>TCC		protocadherin alpha 1 isoform 1 precursor							45.0	54.0	51.0					5																	140165973		2203	4300	6503	SO:0001583	missense	56147				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140165973A>C	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.98A>C	5.37:g.140165973A>C	ENSP00000420840:p.Tyr33Ser		Somatic				PCDHA1_uc003lha.2_Missense_Mutation_p.Y33S|PCDHA1_uc003lgz.2_Missense_Mutation_p.Y33S	p.Y33S	NM_018900	NP_061723	WXS	Illumina HiSeq	Unspecified	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	98	+			33			Cadherin 1.|Extracellular (Potential).		O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	c.98A>C	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	a	16.27	3.075939	0.55646	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.58358	0.34;0.34;0.34	4.53	4.53	0.55603	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.39146	U	0.001451	D	0.84032	0.5383	H	0.99573	4.635	0.40203	D	0.977533	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.999	D	0.91224	0.5009	10	0.87932	D	0	.	14.1378	0.65297	1.0:0.0:0.0:0.0	.	33;33;33	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	S	33	ENSP00000420840:Y33S;ENSP00000378129:Y33S;ENSP00000367373:Y33S	ENSP00000367373:Y33S	Y	+	2	0	PCDHA1	140146157	1.000000	0.71417	0.996000	0.52242	0.242000	0.25591	5.002000	0.63952	1.821000	0.53095	0.528000	0.53228	TAC		0.652	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		12	80	0	0	0	0	12	80				
PCDHA6	56142	broad.mit.edu	37	5	140209865	140209865	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:140209865G>A	ENST00000529310.1	+	1	2303	c.2189G>A	c.(2188-2190)gGc>gAc	p.G730D	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	730					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCACCGAGGGCGCGTGCACG	0.682																																						uc003lho.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(2188-2190)GGC>GAC		protocadherin alpha 6 isoform 1 precursor							45.0	44.0	45.0					5																	140209865		2203	4298	6501	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140209865G>A	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2189G>A	5.37:g.140209865G>A	ENSP00000433378:p.Gly730Asp		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Missense_Mutation_p.G730D	p.G730D	NM_018909	NP_061732	WXS	Illumina HiSeq	Unspecified	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2216	+			730			Cytoplasmic (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.2189G>A	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	9.760	1.169863	0.21621	.	.	ENSG00000081842	ENST00000529310	T	0.15603	2.41	4.12	2.04	0.26737	.	0.224086	0.21506	U	0.073454	T	0.28665	0.0710	M	0.90145	3.09	0.80722	D	1	B;B	0.22909	0.077;0.011	B;B	0.25759	0.063;0.013	T	0.37596	-0.9699	10	0.72032	D	0.01	.	12.3394	0.55085	0.0:0.3227:0.6773:0.0	.	730;730	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	D	730	ENSP00000433378:G730D	ENSP00000433378:G730D	G	+	2	0	PCDHA6	140190049	0.020000	0.18652	0.987000	0.45799	0.173000	0.22820	1.266000	0.33039	1.021000	0.39600	0.306000	0.20318	GGC		0.682	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		31	55	0	0	0	0	31	55				
PCDHAC2	56134	broad.mit.edu	37	5	140346785	140346785	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:140346785C>G	ENST00000289269.5	+	1	966	c.434C>G	c.(433-435)tCa>tGa	p.S145*	PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	145	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGACAACTCACCGCGTTTC	0.632																																					Melanoma(190;638 2083 3390 11909 52360)	uc003lii.2		NA																	0				ovary(2)|skin(2)	4						c.(433-435)TCA>TGA		protocadherin alpha subfamily C, 2 isoform 1							37.0	40.0	39.0					5																	140346785		2203	4300	6503	SO:0001587	stop_gained	56134				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding	g.chr5:140346785C>G	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.434C>G	5.37:g.140346785C>G	ENSP00000289269:p.Ser145*		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_Intron|PCDHAC2_uc011dag.1_Nonsense_Mutation_p.S145*	p.S145*	NM_018899	NP_061722	WXS	Illumina HiSeq	Unspecified	Q9Y5I4	PCDC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	674	+			145			Cadherin 1.|Extracellular (Potential).		Q2M3V1|Q9Y5F4	Nonsense_Mutation	SNP	ENST00000289269.5	37	c.434C>G	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	C	42	9.742961	0.99252	.	.	ENSG00000243232	ENST00000289269	.	.	.	5.43	5.43	0.79202	.	0.000000	0.36854	N	0.002372	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.2427	0.93889	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000289269:S145X	S	+	2	0	PCDHAC2	140326969	0.484000	0.25964	0.998000	0.56505	0.997000	0.91878	3.262000	0.51538	2.555000	0.86185	0.555000	0.69702	TCA		0.632	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899		8	29	0	0	0	0	8	29				
PCDHB10	56126	broad.mit.edu	37	5	140572211	140572211	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:140572211G>T	ENST00000239446.4	+	1	270	c.86G>T	c.(85-87)gGg>gTg	p.G29V		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	29					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCAGGTTCTGGGTTTGGACGT	0.502																																						uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(85-87)GGG>GTG		protocadherin beta 10 precursor							91.0	103.0	99.0					5																	140572211		2203	4300	6503	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140572211G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.86G>T	5.37:g.140572211G>T	ENSP00000239446:p.Gly29Val		Somatic					p.G29V	NM_018930	NP_061753	WXS	Illumina HiSeq	Unspecified	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	260	+			29			Extracellular (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.86G>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460823	0.43736	.	.	ENSG00000120324	ENST00000239446	T	0.50548	0.74	3.35	-1.78	0.07957	.	.	.	.	.	T	0.35885	0.0947	L	0.42581	1.335	0.20764	N	0.999857	B	0.23540	0.087	B	0.33121	0.158	T	0.43196	-0.9406	9	0.48119	T	0.1	.	1.9746	0.03413	0.3289:0.1274:0.4146:0.1291	.	29	Q9UN67	PCDBA_HUMAN	V	29	ENSP00000239446:G29V	ENSP00000239446:G29V	G	+	2	0	PCDHB10	140552395	0.000000	0.05858	0.007000	0.13788	0.971000	0.66376	-3.983000	0.00320	-0.249000	0.09569	0.549000	0.68633	GGG		0.502	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		22	112	1	0	1.18e-14	2.07e-14	22	112				
ARSI	340075	broad.mit.edu	37	5	149676799	149676799	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr5:149676799C>T	ENST00000328668.7	-	2	2267	c.1688G>A	c.(1687-1689)aGg>aAg	p.R563K		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	563					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGACATTAGCCTGGTGTTGAG	0.532																																						uc003lrv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1687-1689)AGG>AAG		arylsulfatase family, member I precursor							108.0	103.0	104.0					5																	149676799		2203	4300	6503	SO:0001583	missense	340075					endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding	g.chr5:149676799C>T	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1688G>A	5.37:g.149676799C>T	ENSP00000333395:p.Arg563Lys		Somatic					p.R563K	NM_001012301	NP_001012301	WXS	Illumina HiSeq	Unspecified	Q5FYB1	ARSI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		2	2277	-			563					A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	c.1688G>A	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	C	9.099	1.003661	0.19121	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.97138	-4.26;-3.36	4.56	4.56	0.56223	.	0.173875	0.49916	D	0.000134	D	0.93996	0.8077	L	0.31664	0.95	0.38746	D	0.954003	B	0.14438	0.01	B	0.08055	0.003	D	0.91795	0.5447	10	0.40728	T	0.16	.	17.5297	0.87810	0.0:1.0:0.0:0.0	.	563	Q5FYB1	ARSI_HUMAN	K	563;420	ENSP00000333395:R563K;ENSP00000426879:R420K	ENSP00000333395:R563K	R	-	2	0	ARSI	149656992	1.000000	0.71417	0.998000	0.56505	0.178000	0.23041	3.859000	0.55987	2.356000	0.79943	0.643000	0.83706	AGG		0.532	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301		16	95	0	0	0	0	16	95				
HIST1H4F	8361	broad.mit.edu	37	6	26240858	26240858	+	Missense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:26240858G>T	ENST00000377745.2	+	1	298	c.205G>T	c.(205-207)Gac>Tac	p.D69Y		NM_003540.3	NP_003531.1	P62805	H4_HUMAN	histone cluster 1, H4f	69					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				TGTGATACGGGACGCCGTAAC	0.587																																						uc003nhe.1		NA																	0					0						c.(205-207)GAC>TAC		histone cluster 1, H4f							91.0	78.0	82.0					6																	26240858		2203	4300	6503	SO:0001583	missense	8361				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26240858G>T	M60749	CCDS4598.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198327			"""Histones / Replication-dependent"""	4783	protein-coding gene	gene with protein product		602824	"""H4 histone family, member C"", ""histone 1, H4f"""	H4FC		1916825, 9119399, 12408966	Standard	NM_003540		Approved	H4/c, H4	uc003nhe.1	P62805	OTTHUMG00000014443	ENST00000377745.2:c.205G>T	6.37:g.26240858G>T	ENSP00000366974:p.Asp69Tyr		Somatic					p.D69Y	NM_003540	NP_003531	WXS	Illumina HiSeq	Unspecified	P62805	H4_HUMAN			1	205	+		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)	69					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377745.2	37	c.205G>T	CCDS4598.1	.	.	.	.	.	.	.	.	.	.	.	16.12	3.032276	0.54790	.	.	ENSG00000198327	ENST00000377745	T	0.71341	-0.56	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.77791	0.4183	.	.	.	0.50313	D	0.99986	.	.	.	.	.	.	T	0.80768	-0.1235	7	0.66056	D	0.02	.	16.4132	0.83726	0.0:0.0:1.0:0.0	.	.	.	.	Y	69	ENSP00000366974:D69Y	ENSP00000366974:D69Y	D	+	1	0	HIST1H4F	26348837	1.000000	0.71417	0.867000	0.34043	0.001000	0.01503	9.222000	0.95196	2.430000	0.82344	0.563000	0.77884	GAC		0.587	HIST1H4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040106.1	NM_003540		31	27	1	0	5.46e-16	9.66e-16	31	27				
HIST1H3I	8354	broad.mit.edu	37	6	27840062	27840062	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:27840062G>A	ENST00000328488.2	-	1	37	c.32C>T	c.(31-33)tCc>tTc	p.S11F		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	11					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GCCGCCGGTGGACTTGCGAGC	0.587																																						uc003njy.2		NA																	0				ovary(1)	1						c.(31-33)TCC>TTC		histone cluster 1, H3i							22.0	25.0	24.0					6																	27840062		2184	4284	6468	SO:0001583	missense	8354				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:27840062G>A	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.32C>T	6.37:g.27840062G>A	ENSP00000329554:p.Ser11Phe		Somatic					p.S11F	NM_003533	NP_003524	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	38	-			11					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000328488.2	37	c.32C>T	CCDS4636.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.333845	0.24253	.	.	ENSG00000182572	ENST00000328488	T	0.47869	0.83	4.12	4.12	0.48240	.	.	.	.	.	T	0.58750	0.2144	.	.	.	0.45634	D	0.998566	.	.	.	.	.	.	T	0.64499	-0.6393	6	0.87932	D	0	.	16.6345	0.85043	0.0:0.0:1.0:0.0	.	.	.	.	F	11	ENSP00000329554:S11F	ENSP00000329554:S11F	S	-	2	0	HIST1H3I	27948041	1.000000	0.71417	0.999000	0.59377	0.152000	0.21847	9.193000	0.94954	2.580000	0.87095	0.650000	0.86243	TCC		0.587	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	NM_003533		5	36	0	0	0	0	5	36				
ITPR3	3710	broad.mit.edu	37	6	33653966	33653966	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:33653966G>A	ENST00000374316.5	+	43	6864	c.5804G>A	c.(5803-5805)gGc>gAc	p.G1935D	ITPR3_ENST00000605930.1_Missense_Mutation_p.G1935D			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1935					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GACAACGTGGGCCTCGTCATC	0.612																																						uc011drk.1		NA																	0				ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						c.(5803-5805)GGC>GAC		inositol 1,4,5-triphosphate receptor, type 3							61.0	52.0	55.0					6																	33653966		2203	4300	6503	SO:0001583	missense	3710				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	g.chr6:33653966G>A	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5804G>A	6.37:g.33653966G>A	ENSP00000363435:p.Gly1935Asp		Somatic				ITPR3_uc003oey.2_Missense_Mutation_p.G22D	p.G1935D	NM_002224	NP_002215	WXS	Illumina HiSeq	Unspecified	Q14573	ITPR3_HUMAN			42	6023	+			1935			Cytoplasmic (Potential).		Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	c.5804G>A	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329376	0.41197	.	.	ENSG00000096433	ENST00000374316	D	0.94650	-3.48	4.82	3.88	0.44766	RyR/IP3R Homology associated domain (1);	0.286211	0.34802	N	0.003680	T	0.80380	0.4612	N	0.03608	-0.345	0.33445	D	0.582866	B;B	0.27910	0.001;0.193	B;B	0.34536	0.006;0.185	T	0.77400	-0.2602	10	0.39692	T	0.17	-40.8205	12.0351	0.53420	0.0:0.3838:0.6162:0.0	.	1935;1605	Q14573;Q59ES2	ITPR3_HUMAN;.	D	1935	ENSP00000363435:G1935D	ENSP00000363435:G1935D	G	+	2	0	ITPR3	33761944	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.535000	0.53575	2.227000	0.72691	0.467000	0.42956	GGC		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		6	22	0	0	0	0	6	22				
DNAH8	1769	broad.mit.edu	37	6	38831662	38831662	+	Silent	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:38831662G>T	ENST00000359357.3	+	43	5927	c.5673G>T	c.(5671-5673)tcG>tcT	p.S1891S	DNAH8_ENST00000449981.2_Silent_p.S2108S|DNAH8_ENST00000441566.1_Silent_p.S1891S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1891	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S1891S(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTGCACAGTCGGGTTCCTGGG	0.358																																						uc003ooe.1		NA																	2	Substitution - coding silent(2)		kidney(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(5671-5673)TCG>TCT		dynein, axonemal, heavy polypeptide 8							85.0	84.0	84.0					6																	38831662		2203	4300	6503	SO:0001819	synonymous_variant	1769							g.chr6:38831662G>T	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5673G>T	6.37:g.38831662G>T			Somatic					p.S1891S	NM_001371	NP_001362	WXS	Illumina HiSeq	Unspecified					43	6273	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37	c.5673G>T																																																																																					0.358	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		10	51	1	0	0.00010058	0.000160599	10	51				
ZNF318	24149	broad.mit.edu	37	6	43304974	43304974	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:43304974C>T	ENST00000361428.2	-	10	6839	c.6762G>A	c.(6760-6762)atG>atA	p.M2254I	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	2254					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CCTGAGGGACCATATTGTCTT	0.463																																						uc003oux.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(6760-6762)ATG>ATA		zinc finger protein 318							116.0	104.0	108.0					6																	43304974		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43304974C>T	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.6762G>A	6.37:g.43304974C>T	ENSP00000354964:p.Met2254Ile		Somatic				ZNF318_uc003ouw.2_Intron	p.M2254I	NM_014345	NP_055160	WXS	Illumina HiSeq	Unspecified	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		10	6840	-			2254					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.6762G>A	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	0.358	-0.941143	0.02322	.	.	ENSG00000171467	ENST00000361428	T	0.09350	2.99	5.69	-0.159	0.13379	.	1.260430	0.05031	N	0.474650	T	0.01523	0.0049	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46289	-0.9202	10	0.16896	T	0.51	6.5298	6.2791	0.20997	0.1307:0.567:0.0:0.3023	.	2254	Q5VUA4	ZN318_HUMAN	I	2254	ENSP00000354964:M2254I	ENSP00000354964:M2254I	M	-	3	0	ZNF318	43412952	0.000000	0.05858	0.000000	0.03702	0.602000	0.36980	-0.377000	0.07456	0.019000	0.15079	0.655000	0.94253	ATG		0.463	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		15	30	0	0	0	0	15	30				
DST	667	broad.mit.edu	37	6	56495121	56495121	+	Silent	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:56495121G>T	ENST00000361203.3	-	27	3577	c.3570C>A	c.(3568-3570)ctC>ctA	p.L1190L	DST_ENST00000312431.6_Silent_p.L1190L|DST_ENST00000370788.2_Silent_p.L1190L|DST_ENST00000370754.5_Silent_p.L1368L|DST_ENST00000518935.1_Silent_p.L864L|DST_ENST00000370765.6_Silent_p.L864L|DST_ENST00000244364.6_Silent_p.L864L|DST_ENST00000370769.4_Silent_p.L1190L|DST_ENST00000446842.2_Silent_p.L864L|DST_ENST00000421834.2_Silent_p.L1190L			Q03001	DYST_HUMAN	dystonin	1190					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TAGTTTCATAGAGTTTTACGA	0.323																																						uc003pdf.2		NA																	0				ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(4102-4104)CTC>CTA		dystonin isoform 2							81.0	82.0	81.0					6																	56495121		2201	4298	6499	SO:0001819	synonymous_variant	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56495121G>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3570C>A	6.37:g.56495121G>T			Somatic				DST_uc003pcz.3_Silent_p.L1190L|DST_uc011dxj.1_Silent_p.L1219L|DST_uc011dxk.1_Silent_p.L1230L|DST_uc003pcy.3_Silent_p.L864L|DST_uc003pdb.2_Silent_p.L864L|DST_uc003pdc.3_Silent_p.L864L|DST_uc003pdd.3_Silent_p.L864L	p.L1368L	NM_001144769	NP_001138241	WXS	Illumina HiSeq	Unspecified	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		30	4132	-	Lung NSC(77;0.103)		1190					B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37	c.4104C>A																																																																																					0.323	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		14	73	1	0	0.000151284	0.000240251	14	73				
FUT9	10690	broad.mit.edu	37	6	96651372	96651372	+	Missense_Mutation	SNP	G	G	C	rs376403164		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:96651372G>C	ENST00000302103.5	+	3	667	c.341G>C	c.(340-342)aGt>aCt	p.S114T		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	114					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		CGAGACATCAGTTGGGATCTG	0.473																																					Melanoma(98;1369 1476 6592 22940 26587)	uc003pop.3		NA																	0				skin(4)|ovary(1)	5						c.(340-342)AGT>ACT		fucosyltransferase 9 (alpha (1,3)							120.0	106.0	111.0					6																	96651372		2203	4300	6503	SO:0001583	missense	10690				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	g.chr6:96651372G>C	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.341G>C	6.37:g.96651372G>C	ENSP00000302599:p.Ser114Thr		Somatic					p.S114T	NM_006581	NP_006572	WXS	Illumina HiSeq	Unspecified	Q9Y231	FUT9_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.08)	3	682	+		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)	114			Lumenal (Potential).		Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	37	c.341G>C	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.234838	0.22626	.	.	ENSG00000172461	ENST00000302103	T	0.25085	1.82	5.3	5.3	0.74995	.	0.234874	0.49305	D	0.000141	T	0.09247	0.0228	L	0.35487	1.065	0.31918	N	0.613794	B	0.15719	0.014	B	0.28553	0.091	T	0.13656	-1.0501	10	0.11485	T	0.65	-15.605	13.6879	0.62529	0.0771:0.0:0.9229:0.0	.	114	Q9Y231	FUT9_HUMAN	T	114	ENSP00000302599:S114T	ENSP00000302599:S114T	S	+	2	0	FUT9	96758093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.423000	0.52756	2.643000	0.89663	0.655000	0.94253	AGT		0.473	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581		6	54	0	0	0	0	6	54				
SIM1	6492	broad.mit.edu	37	6	100895160	100895160	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:100895160C>T	ENST00000369208.3	-	9	1764	c.982G>A	c.(982-984)Gtc>Atc	p.V328I	SIM1_ENST00000262901.4_Missense_Mutation_p.V328I			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	328	PAC.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		ACATAGTTGACGCTGACGATA	0.627																																						uc003pqj.3		NA																	0				ovary(4)	4						c.(982-984)GTC>ATC		single-minded homolog 1							139.0	106.0	117.0					6																	100895160		2203	4300	6503	SO:0001583	missense	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100895160C>T	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.982G>A	6.37:g.100895160C>T	ENSP00000358210:p.Val328Ile		Somatic				SIM1_uc010kcu.2_Missense_Mutation_p.V328I	p.V328I	NM_005068	NP_005059	WXS	Illumina HiSeq	Unspecified	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	8	1189	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	328			PAC.		Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	c.982G>A	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	C	36	5.702771	0.96812	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.15718	2.4;2.4	6.17	6.17	0.99709	PAS fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.40145	0.1105	M	0.75150	2.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.13255	-1.0516	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	328	P81133	SIM1_HUMAN	I	328	ENSP00000358210:V328I;ENSP00000262901:V328I	ENSP00000262901:V328I	V	-	1	0	SIM1	101001881	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.790000	0.85794	2.941000	0.99782	0.655000	0.94253	GTC		0.627	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		4	31	0	0	0	0	4	31				
TFB1M	51106	broad.mit.edu	37	6	155581464	155581464	+	Missense_Mutation	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr6:155581464T>C	ENST00000367166.4	-	6	792	c.737A>G	c.(736-738)gAa>gGa	p.E246G		NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		AACCACTTTTTCCACCAGCTT	0.438																																						uc003qqj.3		NA																	0				skin(1)	1						c.(736-738)GAA>GGA		transcription factor B1, mitochondrial							153.0	128.0	136.0					6																	155581464		2203	4300	6503	SO:0001583	missense	51106				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity	g.chr6:155581464T>C	AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.737A>G	6.37:g.155581464T>C	ENSP00000356134:p.Glu246Gly		Somatic				TFB1M_uc003qqk.2_Intron	p.E246G	NM_016020	NP_057104	WXS	Illumina HiSeq	Unspecified	Q8WVM0	TFB1M_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)	6	801	-		Ovarian(120;0.196)	246					Q05DR0|Q9Y384	Missense_Mutation	SNP	ENST00000367166.4	37	c.737A>G	CCDS5248.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204014	0.58234	.	.	ENSG00000029639	ENST00000367166	T	0.33865	1.39	5.55	4.38	0.52667	rRNA adenine dimethylase-like (1);	0.211200	0.48286	D	0.000200	T	0.50360	0.1611	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.55724	-0.8096	10	0.48119	T	0.1	-30.5653	12.7444	0.57273	0.0:0.0:0.1374:0.8626	.	246	Q8WVM0	TFB1M_HUMAN	G	246	ENSP00000356134:E246G	ENSP00000356134:E246G	E	-	2	0	TFB1M	155623156	1.000000	0.71417	0.620000	0.29132	0.160000	0.22226	7.698000	0.84413	0.918000	0.36919	-0.316000	0.08728	GAA		0.438	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042809.1			3	37	0	0	0	0	3	37				
RAC1	5879	broad.mit.edu	37	7	6441634	6441634	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:6441634G>A	ENST00000348035.4	+	5	637	c.424G>A	c.(424-426)Ggt>Agt	p.G142S	RAC1_ENST00000356142.4_Missense_Mutation_p.G161S|RAC1_ENST00000488373.1_3'UTR	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	142					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	CTATCCGCAGGGTCTAGCCAT	0.463																																						uc003spx.2		NA																	0				lung(2)	2						c.(424-426)GGT>AGT		ras-related C3 botulinum toxin substrate 1	Pravastatin(DB00175)|Simvastatin(DB00641)						188.0	154.0	165.0					7																	6441634		2203	4300	6503	SO:0001583	missense	5879				actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding	g.chr7:6441634G>A	AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.424G>A	7.37:g.6441634G>A	ENSP00000258737:p.Gly142Ser		Somatic				RAC1_uc003spw.2_Missense_Mutation_p.G161S	p.G142S	NM_006908	NP_008839	WXS	Illumina HiSeq	Unspecified	P63000	RAC1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	5	665	+		Ovarian(82;0.0776)	142					O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Missense_Mutation	SNP	ENST00000348035.4	37	c.424G>A	CCDS5348.1	.	.	.	.	.	.	.	.	.	.	.	36	5.744109	0.96873	.	.	ENSG00000136238	ENST00000348035;ENST00000356142	T;T	0.80214	-1.35;-1.35	5.89	5.89	0.94794	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93128	0.7812	H	0.94847	3.59	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.81914	0.989;0.995	D	0.94147	0.7402	10	0.87932	D	0	.	20.2437	0.98389	0.0:0.0:1.0:0.0	.	142;161	P63000;A4D2P0	RAC1_HUMAN;.	S	142;161	ENSP00000258737:G142S;ENSP00000348461:G161S	ENSP00000258737:G142S	G	+	1	0	RAC1	6408159	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	9.661000	0.98601	2.778000	0.95560	0.655000	0.94253	GGT		0.463	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242868.2	NM_018890		5	154	0	0	0	0	5	154				
THSD7A	221981	broad.mit.edu	37	7	11485699	11485699	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:11485699C>A	ENST00000423059.4	-	13	3304	c.3053G>T	c.(3052-3054)tGt>tTt	p.C1018F	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1018	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ATGGCTGTTACATCTAGATGT	0.423										HNSCC(18;0.044)																												uc003ssf.3		NA																	0				ovary(3)	3						c.(3052-3054)TGT>TTT		thrombospondin, type I, domain containing 7A							289.0	263.0	271.0					7																	11485699		1934	4151	6085	SO:0001583	missense	221981					integral to membrane		g.chr7:11485699C>A		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3053G>T	7.37:g.11485699C>A	ENSP00000406482:p.Cys1018Phe	HNSCC(18;0.044)	Somatic					p.C1018F	NM_015204	NP_056019	WXS	Illumina HiSeq	Unspecified	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	13	3305	-			1018			TSP type-1 10.|Extracellular (Potential).			Missense_Mutation	SNP	ENST00000423059.4	37	c.3053G>T	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.618882	0.87460	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.70516	-0.49	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.83317	0.5228	M	0.70595	2.14	0.80722	D	1	D	0.65815	0.995	D	0.63793	0.918	D	0.84583	0.0662	10	0.87932	D	0	.	19.6788	0.95950	0.0:1.0:0.0:0.0	.	1018	Q9UPZ6	THS7A_HUMAN	F	1018	ENSP00000406482:C1018F	ENSP00000262042:C1018F	C	-	2	0	THSD7A	11452224	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.487000	0.81328	2.653000	0.90120	0.650000	0.86243	TGT		0.423	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		89	168	1	0	3.1e-51	5.71e-51	89	168				
SEPT7	989	broad.mit.edu	37	7	35930338	35930338	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:35930338C>T	ENST00000435235.1	+	10	1206	c.774C>T	c.(772-774)agC>agT	p.S258S	SEPT7_ENST00000494488.2_Silent_p.S297S|SEPT7_ENST00000350320.6_Silent_p.S310S|SEPT7_ENST00000399034.2_Silent_p.S312S|SEPT7_ENST00000432293.2_Intron|SEPT7_ENST00000399035.3_Silent_p.S310S			Q16181	SEPT7_HUMAN	septin 7	311	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						ACTACAGAAGCAGAAAACTTG	0.333																																						uc010kxc.2		NA																	0					0						c.(931-933)AGC>AGT		cell division cycle 10 isoform 1							52.0	47.0	49.0					7																	35930338		1836	4092	5928	SO:0001819	synonymous_variant	989				cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity	g.chr7:35930338C>T	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.774C>T	7.37:g.35930338C>T			Somatic				SEPT7_uc011kat.1_Silent_p.S310S|SEPT7_uc011kau.1_Silent_p.S275S|SEPT7_uc011kav.1_Silent_p.S258S|SEPT7_uc003tey.2_Silent_p.S159S	p.S311S	NM_001788	NP_001779	WXS	Illumina HiSeq	Unspecified	Q16181	SEPT7_HUMAN			10	1126	+			311					Q52M76|Q6NX50	Silent	SNP	ENST00000435235.1	37	c.933C>T																																																																																					0.333	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788		4	34	0	0	0	0	4	34				
VPS41	27072	broad.mit.edu	37	7	38765891	38765891	+	Silent	SNP	A	A	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:38765891A>C	ENST00000310301.4	-	29	2574	c.2520T>G	c.(2518-2520)gcT>gcG	p.A840A	VPS41_ENST00000395969.2_Silent_p.A815A	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	840					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CACGGTTCTTAGCACTGCAGA	0.363																																						uc003tgy.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(2518-2520)GCT>GCG		vacuolar protein sorting 41 isoform 1							126.0	114.0	118.0					7																	38765891		2203	4300	6503	SO:0001819	synonymous_variant	27072				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding	g.chr7:38765891A>C	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.2520T>G	7.37:g.38765891A>C			Somatic				VPS41_uc003tgz.2_Silent_p.A815A|VPS41_uc010kxn.2_Silent_p.A751A|VPS41_uc003tgx.2_RNA	p.A840A	NM_014396	NP_055211	WXS	Illumina HiSeq	Unspecified	P49754	VPS41_HUMAN			29	2546	-			840					E9PF36|Q86TP8|Q99851|Q99852	Silent	SNP	ENST00000310301.4	37	c.2520T>G	CCDS5457.1																																																																																				0.363	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			17	24	0	0	0	0	17	24				
POM121L12	285877	broad.mit.edu	37	7	53104113	53104113	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:53104113A>T	ENST00000408890.4	+	1	765	c.749A>T	c.(748-750)gAt>gTt	p.D250V		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	250										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						TTTTGTGATGATGCTTGGCCT	0.627																																						uc003tpz.2		NA																	0					0						c.(748-750)GAT>GTT		POM121 membrane glycoprotein-like 12							50.0	59.0	56.0					7																	53104113		2012	4169	6181	SO:0001583	missense	285877							g.chr7:53104113A>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.749A>T	7.37:g.53104113A>T	ENSP00000386133:p.Asp250Val		Somatic					p.D250V	NM_182595	NP_872401	WXS	Illumina HiSeq	Unspecified	Q8N7R1	P1L12_HUMAN			1	765	+			250					Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	c.749A>T	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	A	9.195	1.026975	0.19512	.	.	ENSG00000221900	ENST00000408890	T	0.33216	1.42	1.82	0.581	0.17407	.	.	.	.	.	T	0.13884	0.0336	N	0.08118	0	0.09310	N	1	B	0.17268	0.021	B	0.14023	0.01	T	0.22556	-1.0213	9	0.66056	D	0.02	.	3.8781	0.09066	0.6729:0.0:0.0:0.3271	.	250	Q8N7R1	P1L12_HUMAN	V	250	ENSP00000386133:D250V	ENSP00000386133:D250V	D	+	2	0	POM121L12	53071607	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.844000	0.01679	0.157000	0.19338	0.459000	0.35465	GAT		0.627	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		19	97	0	0	0	0	19	97				
ZNF117	51351	broad.mit.edu	37	7	64438853	64438853	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:64438853A>T	ENST00000282869.6	-	4	2380	c.1096T>A	c.(1096-1098)Tgt>Agt	p.C366S		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	366					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				GCTTTGCCACATTCTCCACAT	0.398																																						uc003ttr.2		NA																	0				skin(1)	1						c.(1096-1098)TGT>AGT		zinc finger protein 117							90.0	95.0	94.0					7																	64438853		2143	4272	6415	SO:0001583	missense	51351					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:64438853A>T	M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.1096T>A	7.37:g.64438853A>T	ENSP00000282869:p.Cys366Ser		Somatic					p.C366S	NM_015852	NP_056936	WXS	Illumina HiSeq	Unspecified	Q03924	ZN117_HUMAN			4	2381	-		Lung NSC(55;0.0295)|all_lung(88;0.0691)	366			C2H2-type 10.		Q02313|Q7Z7Q7	Missense_Mutation	SNP	ENST00000282869.6	37	c.1096T>A	CCDS43593.1	.	.	.	.	.	.	.	.	.	.	.	15.34	2.803750	0.50315	.	.	ENSG00000152926	ENST00000282869	D	0.85861	-2.04	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92919	0.7747	H	0.95574	3.69	0.35006	D	0.756471	D	0.89917	1.0	D	0.87578	0.998	D	0.91797	0.5448	9	0.87932	D	0	.	5.9831	0.19419	1.0:0.0:0.0:0.0	.	366	Q03924	ZN117_HUMAN	S	366	ENSP00000282869:C366S	ENSP00000282869:C366S	C	-	1	0	ZNF117	64076288	1.000000	0.71417	0.025000	0.17156	0.021000	0.10359	6.330000	0.72925	0.436000	0.26393	0.260000	0.18958	TGT		0.398	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344863.3	NM_024498		11	65	0	0	0	0	11	65				
GRM3	2913	broad.mit.edu	37	7	86416016	86416016	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:86416016G>A	ENST00000361669.2	+	3	2007	c.908G>A	c.(907-909)tGg>tAg	p.W303*	GRM3_ENST00000536043.1_Nonsense_Mutation_p.W175*|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Nonsense_Mutation_p.W303*|GRM3_ENST00000394720.2_Nonsense_Mutation_p.W301*|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	303					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AGCGACGGCTGGGGCGCGCAG	0.687																																					GBM(52;969 1098 3139 52280)	uc003uid.2		NA																	0				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13						c.(907-909)TGG>TAG		glutamate receptor, metabotropic 3 precursor	Acamprosate(DB00659)|Nicotine(DB00184)						33.0	36.0	35.0					7																	86416016		2203	4299	6502	SO:0001587	stop_gained	2913				synaptic transmission	integral to plasma membrane		g.chr7:86416016G>A		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.908G>A	7.37:g.86416016G>A	ENSP00000355316:p.Trp303*		Somatic				GRM3_uc010lef.2_Nonsense_Mutation_p.W301*|GRM3_uc010leg.2_Nonsense_Mutation_p.W175*|GRM3_uc010leh.2_Intron	p.W303*	NM_000840	NP_000831	WXS	Illumina HiSeq	Unspecified	Q14832	GRM3_HUMAN			3	2007	+	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)		303			Extracellular (Potential).		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Nonsense_Mutation	SNP	ENST00000361669.2	37	c.908G>A	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	37	6.621264	0.97714	.	.	ENSG00000198822	ENST00000361669;ENST00000536043;ENST00000439827;ENST00000394720	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6475	0.95784	0.0:0.0:1.0:0.0	.	.	.	.	X	303;175;303;301	.	ENSP00000355316:W303X	W	+	2	0	GRM3	86253952	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.756000	0.98918	2.885000	0.99019	0.655000	0.94253	TGG		0.687	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			9	38	0	0	0	0	9	38				
GNG11	2791	broad.mit.edu	37	7	93555441	93555441	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:93555441A>T	ENST00000248564.5	+	2	574	c.135A>T	c.(133-135)gaA>gaT	p.E45D		NM_004126.3	NP_004117.1	P61952	GBG11_HUMAN	guanine nucleotide binding protein (G protein), gamma 11	45					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|kidney(1)|lung(2)|skin(1)	6	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			ACTATATTGAAGAACGTTCTG	0.348																																						uc003und.2		NA																	0				kidney(1)	1						c.(133-135)GAA>GAT		guanine nucleotide binding protein gamma 11							77.0	86.0	83.0					7																	93555441		2203	4299	6502	SO:0001583	missense	2791				cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway	heterotrimeric G-protein complex	GTPase activity|signal transducer activity	g.chr7:93555441A>T		CCDS5634.1	7q31-q32	2008-07-18			ENSG00000127920	ENSG00000127920			4403	protein-coding gene	gene with protein product	"""G protein gamma-11 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-11 subunit"""	604390				7665596	Standard	NM_004126		Approved	GNGT11	uc003und.3	P61952	OTTHUMG00000023411	ENST00000248564.5:c.135A>T	7.37:g.93555441A>T	ENSP00000248564:p.Glu45Asp		Somatic					p.E45D	NM_004126	NP_004117	WXS	Illumina HiSeq	Unspecified	P61952	GBG11_HUMAN	STAD - Stomach adenocarcinoma(171;0.000967)		2	569	+	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		45					P50152	Missense_Mutation	SNP	ENST00000248564.5	37	c.135A>T	CCDS5634.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645306	0.67358	.	.	ENSG00000127920	ENST00000248564	T	0.26373	1.74	4.25	3.1	0.35709	G-protein gamma domain (5);	0.162995	0.53938	D	0.000051	T	0.42381	0.1200	.	.	.	0.43852	D	0.996445	D	0.65815	0.995	D	0.66497	0.944	T	0.22312	-1.0220	9	0.46703	T	0.11	-17.7755	7.0025	0.24817	0.8137:0.0:0.1863:0.0	.	45	P61952	GBG11_HUMAN	D	45	ENSP00000248564:E45D	ENSP00000248564:E45D	E	+	3	2	GNG11	93393377	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.946000	0.49050	0.971000	0.38288	-0.371000	0.07208	GAA		0.348	GNG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254719.3	NM_004126		22	81	0	0	0	0	22	81				
EXOC4	60412	broad.mit.edu	37	7	133160110	133160110	+	Missense_Mutation	SNP	A	A	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:133160110A>T	ENST00000253861.4	+	8	1240	c.1211A>T	c.(1210-1212)aAa>aTa	p.K404I	EXOC4_ENST00000539845.1_Missense_Mutation_p.K303I|EXOC4_ENST00000393161.2_Missense_Mutation_p.K404I	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	404					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				TTGGATATGAAAAATACTCGT	0.363																																						uc003vrk.2		NA																	0				ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9						c.(1210-1212)AAA>ATA		SEC8 protein isoform a							103.0	107.0	105.0					7																	133160110		2203	4300	6503	SO:0001583	missense	60412				vesicle docking involved in exocytosis	exocyst	protein N-terminus binding	g.chr7:133160110A>T	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1211A>T	7.37:g.133160110A>T	ENSP00000253861:p.Lys404Ile		Somatic				EXOC4_uc011kpo.1_Missense_Mutation_p.K303I|EXOC4_uc003vri.2_Missense_Mutation_p.K404I|EXOC4_uc003vrj.2_Missense_Mutation_p.K404I	p.K404I	NM_021807	NP_068579	WXS	Illumina HiSeq	Unspecified	Q96A65	EXOC4_HUMAN			8	1246	+		Esophageal squamous(399;0.129)	404					E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	c.1211A>T	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.625766	0.87560	.	.	ENSG00000131558	ENST00000253861;ENST00000393161;ENST00000546185;ENST00000539845	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.63558	0.2521	L	0.51422	1.61	0.80722	D	1	D;P	0.61697	0.99;0.838	P;B	0.53649	0.731;0.364	T	0.63945	-0.6522	9	0.41790	T	0.15	.	14.9773	0.71283	1.0:0.0:0.0:0.0	.	404;404	Q96A65;Q8TAR2	EXOC4_HUMAN;.	I	404;404;23;303	.	ENSP00000253861:K404I	K	+	2	0	EXOC4	132810650	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.556000	0.90697	2.011000	0.59026	0.455000	0.32223	AAA		0.363	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		10	99	0	0	0	0	10	99				
KIAA1549	57670	broad.mit.edu	37	7	138583773	138583773	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:138583773G>A	ENST00000422774.1	-	9	3823	c.3775C>T	c.(3775-3777)Ctg>Ttg	p.L1259L	KIAA1549_ENST00000242365.4_Silent_p.L1209L|KIAA1549_ENST00000440172.1_Silent_p.L1259L			Q9HCM3	K1549_HUMAN	KIAA1549	1259						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TTGTTAATCAGGTCCGAAGAC	0.493			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	uc011kql.1		NA		Dom	yes		7	7q34	57670	O	KIAA1549			O	BRAF		pilocytic astrocytoma	KIAA1549/BRAF(229)	0				central_nervous_system(229)|pancreas(1)	230						c.(3775-3777)CTG>TTG		hypothetical protein LOC57670 isoform 1							195.0	188.0	190.0					7																	138583773		2061	4220	6281	SO:0001819	synonymous_variant	57670					integral to membrane		g.chr7:138583773G>A		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3775C>T	7.37:g.138583773G>A			Somatic				KIAA1549_uc011kqi.1_Silent_p.L43L|KIAA1549_uc003vuk.3_Silent_p.L1209L|KIAA1549_uc011kqj.1_Silent_p.L1259L|KIAA1549_uc011kqk.1_Silent_p.L43L	p.L1259L	NM_020910	NP_065961	WXS	Illumina HiSeq	Unspecified	Q9HCM3	K1549_HUMAN			9	3824	-			1259					B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	c.3775C>T	CCDS56513.1																																																																																				0.493	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			15	133	0	0	0	0	15	133				
TBXAS1	6916	broad.mit.edu	37	7	139715537	139715537	+	Missense_Mutation	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:139715537C>A	ENST00000336425.5	+	15	1630	c.1241C>A	c.(1240-1242)gCa>gAa	p.A414E	TBXAS1_ENST00000436047.2_Missense_Mutation_p.A415E|TBXAS1_ENST00000414508.2_Missense_Mutation_p.A415E|TBXAS1_ENST00000263552.6_Missense_Mutation_p.A415E|TBXAS1_ENST00000458722.1_Missense_Mutation_p.A460E|TBXAS1_ENST00000416849.2_Missense_Mutation_p.A461E|TBXAS1_ENST00000448866.1_Missense_Mutation_p.A414E|TBXAS1_ENST00000411653.1_Missense_Mutation_p.A414E|TBXAS1_ENST00000425687.1_Missense_Mutation_p.A347E|TBXAS1_ENST00000462275.1_3'UTR			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	414					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	ACACGGGAGGCAGCTCAGGAC	0.642																																						uc011kqv.1		NA																	0				ovary(2)|breast(1)	3						c.(1381-1383)GCA>GAA		thromboxane A synthase 1, platelet isoform							55.0	53.0	53.0					7																	139715537		2203	4300	6503	SO:0001583	missense	6916				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity	g.chr7:139715537C>A	L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.1241C>A	7.37:g.139715537C>A	ENSP00000338087:p.Ala414Glu		Somatic				TBXAS1_uc003vvh.2_Missense_Mutation_p.A415E|TBXAS1_uc010lne.2_Missense_Mutation_p.A347E|TBXAS1_uc011kqu.1_Missense_Mutation_p.A366E|TBXAS1_uc003vvi.2_Missense_Mutation_p.A415E|TBXAS1_uc003vvj.2_Missense_Mutation_p.A415E|TBXAS1_uc011kqw.1_Missense_Mutation_p.A395E	p.A461E	NM_001130966	NP_001124438	WXS	Illumina HiSeq	Unspecified	P24557	THAS_HUMAN			12	1546	+	Melanoma(164;0.0142)		414			Cytoplasmic (Potential).		B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	ENST00000336425.5	37	c.1382C>A		.	.	.	.	.	.	.	.	.	.	C	16.74	3.205786	0.58234	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	4.61	4.61	0.57282	.	0.289111	0.33959	N	0.004390	D	0.87140	0.6103	M	0.93016	3.37	0.80722	D	1	D;D;D;P;D;P;P	0.63046	0.963;0.979;0.958;0.954;0.992;0.924;0.924	P;P;P;P;D;P;P	0.72075	0.851;0.791;0.885;0.645;0.976;0.786;0.836	D	0.90553	0.4510	10	0.87932	D	0	.	15.2408	0.73468	0.0:1.0:0.0:0.0	.	395;461;366;347;415;415;414	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	E	347;415;414;461;415;415;414;460;414	ENSP00000388736:A347E;ENSP00000263552:A415E;ENSP00000338087:A414E;ENSP00000389414:A461E;ENSP00000392361:A415E;ENSP00000392702:A415E;ENSP00000402536:A414E;ENSP00000411274:A460E;ENSP00000411326:A414E	ENSP00000263552:A415E	A	+	2	0	TBXAS1	139362006	0.947000	0.32204	0.776000	0.31678	0.388000	0.30384	4.697000	0.61782	2.119000	0.64992	0.462000	0.41574	GCA		0.642	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1			8	80	1	0	0.000274275	0.000428601	8	80				
PARP12	64761	broad.mit.edu	37	7	139724438	139724438	+	Silent	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:139724438C>T	ENST00000263549.3	-	12	2901	c.2028G>A	c.(2026-2028)caG>caA	p.Q676Q		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	676	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					AGGTGGTGTACTGGATGACAT	0.572																																						uc003vvl.1		NA																	0				ovary(3)	3						c.(2026-2028)CAG>CAA		poly ADP-ribose polymerase 12							178.0	142.0	154.0					7																	139724438		2203	4300	6503	SO:0001819	synonymous_variant	64761					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding	g.chr7:139724438C>T	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.2028G>A	7.37:g.139724438C>T			Somatic				PARP12_uc003vvk.1_Silent_p.Q462Q|PARP12_uc010lnf.1_RNA	p.Q676Q	NM_022750	NP_073587	WXS	Illumina HiSeq	Unspecified	Q9H0J9	PAR12_HUMAN			12	2902	-	Melanoma(164;0.0142)		676			PARP catalytic.		Q9H610|Q9NP36|Q9NTI3	Silent	SNP	ENST00000263549.3	37	c.2028G>A	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	C	0.971	-0.700148	0.03279	.	.	ENSG00000059378	ENST00000541746	.	.	.	5.18	1.23	0.21249	.	.	.	.	.	T	0.57066	0.2028	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51356	-0.8716	5	0.49607	T	0.09	.	5.2991	0.15768	0.0:0.453:0.2674:0.2795	.	.	.	.	N	60	.	ENSP00000445106:S60N	S	-	2	0	PARP12	139370907	0.842000	0.29525	0.993000	0.49108	0.143000	0.21401	-0.031000	0.12287	-0.051000	0.13334	-0.951000	0.02657	AGT		0.572	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750		10	52	0	0	0	0	10	52				
TRPV5	56302	broad.mit.edu	37	7	142612693	142612693	+	Silent	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:142612693G>A	ENST00000265310.1	-	9	1516	c.1168C>T	c.(1168-1170)Ctg>Ttg	p.L390L		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	390					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					ATGCTCACCAGCTCCCCCACC	0.547																																						uc003wby.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(1168-1170)CTG>TTG		transient receptor potential cation channel,							121.0	96.0	104.0					7																	142612693		2203	4300	6503	SO:0001819	synonymous_variant	56302				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	g.chr7:142612693G>A	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1168C>T	7.37:g.142612693G>A			Somatic					p.L390L	NM_019841	NP_062815	WXS	Illumina HiSeq	Unspecified	Q9NQA5	TRPV5_HUMAN			9	1432	-	Melanoma(164;0.059)		390			Helical; (Potential).		A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	c.1168C>T	CCDS5875.1																																																																																				0.547	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841		5	40	0	0	0	0	5	40				
PAXIP1	22976	broad.mit.edu	37	7	154738231	154738231	+	Silent	SNP	T	T	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:154738231T>G	ENST00000404141.1	-	19	3278	c.3124A>C	c.(3124-3126)Aga>Cga	p.R1042R	PAXIP1_ENST00000397192.1_Silent_p.R1042R|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	1042	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CCTATGCCTCTGGCAAAATAT	0.413																																						uc003wlp.2		NA																	0				lung(2)|ovary(1)|breast(1)|pancreas(1)	5						c.(3124-3126)AGA>CGA		PAX interacting protein 1							76.0	74.0	75.0					7																	154738231		1914	4125	6039	SO:0001819	synonymous_variant	22976				DNA damage response, signal transduction by p53 class mediator|DNA recombination|DNA repair|histone H3-K4 methylation|positive regulation of histone acetylation|positive regulation of histone H3-K36 methylation|positive regulation of histone H3-K4 methylation|positive regulation of isotype switching|positive regulation of protein ubiquitination|positive regulation of transcription initiation from RNA polymerase II promoter|response to ionizing radiation|transcription, DNA-dependent	histone methyltransferase complex|nuclear matrix		g.chr7:154738231T>G	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.3124A>C	7.37:g.154738231T>G			Somatic				LOC100132707_uc011kvr.1_Intron|LOC100132707_uc003wlo.2_Intron|PAXIP1_uc003wlq.1_Silent_p.R1008R|PAXIP1_uc011kvs.1_Silent_p.R1006R	p.R1042R	NM_007349	NP_031375	WXS	Illumina HiSeq	Unspecified	Q6ZW49	PAXI1_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)	19	3167	-	all_neural(206;0.119)	all_hematologic(28;0.0592)	1042			Interaction with TP53BP1.|BRCT 6.		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	ENST00000404141.1	37	c.3124A>C	CCDS47753.1																																																																																				0.413	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349		3	46	0	0	0	0	3	46				
WRN	7486	broad.mit.edu	37	8	30977861	30977861	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr8:30977861G>T	ENST00000298139.5	+	21	2800	c.2551G>T	c.(2551-2553)Gag>Tag	p.E851*		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	851	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ATATTATCAGGAGATTGGTAG	0.393			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	uc003xio.3		NA	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Mis|N|F|S	Werner syndrome (RECQL2)			"""L, E, M, O"""		osteosarcoma|meningioma|others			0				ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7						c.(2551-2553)GAG>TAG	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner syndrome protein							148.0	141.0	144.0					8																	30977861		2203	4299	6502	SO:0001587	stop_gained	7486	Werner_syndrome	Familial Cancer Database	WS, Adult Progeria	base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding	g.chr8:30977861G>T		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2551G>T	8.37:g.30977861G>T	ENSP00000298139:p.Glu851*		Somatic				WRN_uc010lvk.2_Nonsense_Mutation_p.E318*	p.E851*	NM_000553	NP_000544	WXS	Illumina HiSeq	Unspecified	Q14191	WRN_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	21	3339	+		Breast(100;0.195)	851			Helicase C-terminal.		A1KYY9	Nonsense_Mutation	SNP	ENST00000298139.5	37	c.2551G>T	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	G	44	11.030547	0.99505	.	.	ENSG00000165392	ENST00000298139	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.7954	19.9192	0.97079	0.0:0.0:1.0:0.0	.	.	.	.	X	851	.	ENSP00000298139:E851X	E	+	1	0	WRN	31097403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.146000	0.89626	2.882000	0.98803	0.655000	0.94253	GAG		0.393	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			18	102	1	0	3.41e-10	5.83e-10	18	102				
PXDNL	137902	broad.mit.edu	37	8	52284568	52284569	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr8:52284568_52284569CC>AA	ENST00000356297.4	-	19	3865_3866	c.3765_3766GG>TT	c.(3763-3768)cgGGtg>cgTTtg	p.V1256L	PXDNL_ENST00000543296.1_Missense_Mutation_p.V1256L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1256					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCACAAAGCACCCGGCTCAGGG	0.49																																						uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(3763-3768)CGGGTG>CGTTTG		peroxidasin homolog-like precursor																																				SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52284568_52284569CC>AA		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3765_3766delinsAA	8.37:g.52284568_52284569delinsAA	ENSP00000348645:p.Val1256Leu		Somatic				PXDNL_uc003xqt.3_RNA	p.V1256L	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			19	3866_3867	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	1256					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	DNP	ENST00000356297.4	37	c.3765_3766GG>TT	CCDS47855.1																																																																																				0.490	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		18	17	0	0	0	0	18	17				
SLC26A7	115111	broad.mit.edu	37	8	92401664	92401664	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr8:92401664G>A	ENST00000276609.3	+	16	2013	c.1774G>A	c.(1774-1776)Gag>Aag	p.E592K	SLC26A7_ENST00000520249.1_3'UTR|SLC26A7_ENST00000523719.1_Missense_Mutation_p.E592K|SLC26A7_ENST00000309536.2_Missense_Mutation_p.E592K	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CATGCTTGTTGAGGTATTTAT	0.413																																						uc003yex.2		NA																	0				ovary(2)	2						c.(1774-1776)GAG>AAG		solute carrier family 26, member 7 isoform a							273.0	245.0	254.0					8																	92401664		2203	4300	6503	SO:0001583	missense	115111					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity	g.chr8:92401664G>A	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1774G>A	8.37:g.92401664G>A	ENSP00000276609:p.Glu592Lys		Somatic				SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.E592K|SLC26A7_uc003yfa.2_Missense_Mutation_p.E592K	p.E592K	NM_052832	NP_439897	WXS	Illumina HiSeq	Unspecified	Q8TE54	S26A7_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00802)		17	2052	+			592			STAS.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000276609.3	37	c.1774G>A	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603127	0.66445	.	.	ENSG00000147606	ENST00000523719;ENST00000276609;ENST00000309536	D;D;D	0.88896	-2.44;-2.44;-2.44	5.62	4.73	0.59995	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.082528	0.51477	D	0.000091	D	0.85873	0.5798	M	0.62723	1.935	0.34835	D	0.740113	P;P	0.38827	0.649;0.565	B;B	0.37550	0.164;0.253	D	0.87600	0.2496	10	0.27082	T	0.32	.	12.0837	0.53686	0.0:0.315:0.685:0.0	.	592;592	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	K	592	ENSP00000428849:E592K;ENSP00000276609:E592K;ENSP00000309504:E592K	ENSP00000276609:E592K	E	+	1	0	SLC26A7	92470840	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.874000	0.56101	2.650000	0.89964	0.563000	0.77884	GAG		0.413	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1			57	107	0	0	0	0	57	107				
CSMD3	114788	broad.mit.edu	37	8	113241018	113241018	+	Missense_Mutation	SNP	A	A	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr8:113241018A>G	ENST00000297405.5	-	70	11175	c.10931T>C	c.(10930-10932)tTt>tCt	p.F3644S	CSMD3_ENST00000343508.3_Missense_Mutation_p.F3604S|CSMD3_ENST00000455883.2_Missense_Mutation_p.F3475S|CSMD3_ENST00000352409.3_Missense_Mutation_p.F3574S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3644						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAATCCTGCAAATATAAGTGC	0.313										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(10930-10932)TTT>TCT		CUB and Sushi multiple domains 3 isoform 1							78.0	82.0	81.0					8																	113241018		2203	4296	6499	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113241018A>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10931T>C	8.37:g.113241018A>G	ENSP00000297405:p.Phe3644Ser	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.F2846S|CSMD3_uc003ynt.2_Missense_Mutation_p.F3604S|CSMD3_uc011lhx.1_Missense_Mutation_p.F3475S	p.F3644S	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			70	11090	-			3644			Helical; (Potential).		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.10931T>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	31	5.062387	0.93898	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.27402	1.98;1.97;2.01;1.67;1.99	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	L	0.54323	1.7	0.53688	D	0.999974	P;P;B	0.52061	0.95;0.811;0.004	P;B;B	0.53146	0.719;0.405;0.004	T	0.39099	-0.9630	10	0.72032	D	0.01	.	16.2119	0.82168	1.0:0.0:0.0:0.0	.	3475;3644;3604	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	3604;3644;2914;3475;3574	ENSP00000345799:F3604S;ENSP00000297405:F3644S;ENSP00000341558:F2914S;ENSP00000412263:F3475S;ENSP00000343124:F3574S	ENSP00000297405:F3644S	F	-	2	0	CSMD3	113310194	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.288000	0.76882	0.482000	0.46254	TTT		0.313	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		38	34	0	0	0	0	38	34				
AGO2	27161	broad.mit.edu	37	8	141570572	141570572	+	Missense_Mutation	SNP	C	C	T			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr8:141570572C>T	ENST00000220592.5	-	5	668	c.556G>A	c.(556-558)Gaa>Aaa	p.E186K	AGO2_ENST00000519980.1_Missense_Mutation_p.E186K	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	186					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GAGCAGCCTTCGGACGCGGTG	0.597																																						uc003yvn.2		NA																	0					0						c.(556-558)GAA>AAA		argonaute 2 isoform 1							61.0	64.0	63.0					8																	141570572		2203	4300	6503	SO:0001583	missense	27161				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity	g.chr8:141570572C>T	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.556G>A	8.37:g.141570572C>T	ENSP00000220592:p.Glu186Lys		Somatic				EIF2C2_uc010men.2_Missense_Mutation_p.E109K|EIF2C2_uc010meo.2_Missense_Mutation_p.E186K	p.E186K	NM_012154	NP_036286	WXS	Illumina HiSeq	Unspecified	Q9UKV8	AGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.158)		5	596	-	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	186					Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	c.556G>A	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383394	0.42207	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.10005	2.92;2.92	5.02	5.02	0.67125	Argonaute/Dicer protein, PAZ (1);Domain of unknown function DUF1785 (1);	0.048556	0.85682	D	0.000000	T	0.12689	0.0308	L	0.55990	1.75	0.80722	D	1	B;B	0.16802	0.019;0.004	B;B	0.21546	0.02;0.035	T	0.10613	-1.0622	10	0.06365	T	0.9	-17.4548	18.7056	0.91637	0.0:1.0:0.0:0.0	.	186;186	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	K	186	ENSP00000220592:E186K;ENSP00000430176:E186K	ENSP00000220592:E186K	E	-	1	0	EIF2C2	141639754	1.000000	0.71417	0.939000	0.37840	0.239000	0.25481	7.700000	0.84556	2.495000	0.84180	0.655000	0.94253	GAA		0.597	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4			46	78	0	0	0	0	46	78				
SLC46A2	57864	broad.mit.edu	37	9	115652267	115652267	+	Missense_Mutation	SNP	G	G	A	rs140881150		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr9:115652267G>A	ENST00000374228.4	-	1	926	c.695C>T	c.(694-696)tCg>tTg	p.S232L		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	232					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						TTTGGCCACCGACTCAGGGAC	0.607																																						uc004bgk.2		NA																	0				central_nervous_system(1)	1						c.(694-696)TCG>TTG		solute carrier family 46, member 2		G	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	57.0	50.0	53.0		695	4.4	0.0	9	dbSNP_134	53	0,8600		0,0,4300	no	missense	SLC46A2	NM_033051.3	145	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	232/476	115652267	1,13005	2203	4300	6503	SO:0001583	missense	57864					integral to membrane|plasma membrane	symporter activity	g.chr9:115652267G>A	AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.695C>T	9.37:g.115652267G>A	ENSP00000363345:p.Ser232Leu		Somatic					p.S232L	NM_033051	NP_149040	WXS	Illumina HiSeq	Unspecified	Q9BY10	TSCOT_HUMAN			1	927	-			232			Cytoplasmic (Potential).		B1ALK1|Q86VT0|Q96NE2	Missense_Mutation	SNP	ENST00000374228.4	37	c.695C>T	CCDS6786.1	.	.	.	.	.	.	.	.	.	.	G	0.698	-0.791993	0.02884	2.27E-4	0.0	ENSG00000119457	ENST00000374228	T	0.58652	0.32	5.32	4.42	0.53409	Major facilitator superfamily domain, general substrate transporter (1);	2.546210	0.01104	N	0.005446	T	0.50837	0.1639	L	0.34521	1.04	0.09310	N	1	B	0.32829	0.386	B	0.25759	0.063	T	0.46978	-0.9152	10	0.41790	T	0.15	-0.0033	12.275	0.54730	0.0808:0.0:0.9192:0.0	.	232	Q9BY10	TSCOT_HUMAN	L	232	ENSP00000363345:S232L	ENSP00000363345:S232L	S	-	2	0	SLC46A2	114692088	0.371000	0.25056	0.009000	0.14445	0.492000	0.33523	3.657000	0.54474	1.235000	0.43724	0.549000	0.68633	TCG		0.607	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051		13	41	0	0	0	0	13	41				
ASTN2	23245	broad.mit.edu	37	9	119976974	119976974	+	Silent	SNP	C	C	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr9:119976974C>A	ENST00000313400.4	-	3	778	c.678G>T	c.(676-678)gcG>gcT	p.A226A	ASTN2_ENST00000373996.3_Silent_p.A226A|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000361209.2_Silent_p.A226A			O75129	ASTN2_HUMAN	astrotactin 2	226					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GGGCGTACAGCGCCACGGTGA	0.602																																						uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(676-678)GCG>GCT		astrotactin 2 isoform c							43.0	42.0	42.0					9																	119976974		2203	4300	6503	SO:0001819	synonymous_variant	23245					integral to membrane		g.chr9:119976974C>A	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.678G>T	9.37:g.119976974C>A			Somatic				ASTN2_uc004bjr.1_Silent_p.A226A|ASTN2_uc004bjt.1_Silent_p.A226A	p.A226A	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			3	779	-			226			Helical; (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37	c.678G>T																																																																																					0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		25	29	1	0	4.78e-09	8.12e-09	25	29				
UCK1	83549	broad.mit.edu	37	9	134404963	134404963	+	Missense_Mutation	SNP	C	C	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr9:134404963C>G	ENST00000372215.4	-	3	370	c.277G>C	c.(277-279)Gat>Cat	p.D93H	UCK1_ENST00000459858.1_5'UTR|UCK1_ENST00000372210.3_Missense_Mutation_p.D84H|UCK1_ENST00000372211.3_Missense_Mutation_p.D98H|UCK1_ENST00000372208.3_Missense_Mutation_p.D93H	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1	93					CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		AAATCATTATCAAAGGCATCT	0.547																																					Melanoma(42;523 1129 28385 43975 48113)	uc004cay.2		NA																	0					0						c.(277-279)GAT>CAT		uridine-cytidine kinase 1 isoform a							208.0	171.0	184.0					9																	134404963		2203	4300	6503	SO:0001583	missense	83549				pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity	g.chr9:134404963C>G	AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.277G>C	9.37:g.134404963C>G	ENSP00000361289:p.Asp93His		Somatic				UCK1_uc010mzk.2_Missense_Mutation_p.D84H|UCK1_uc004cba.2_Missense_Mutation_p.D93H|UCK1_uc004caz.2_RNA	p.D93H	NM_031432	NP_113620	WXS	Illumina HiSeq	Unspecified	Q9HA47	UCK1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)	3	378	-			93					Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	Missense_Mutation	SNP	ENST00000372215.4	37	c.277G>C	CCDS6944.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601005	0.87055	.	.	ENSG00000130717	ENST00000372215;ENST00000372208;ENST00000372211;ENST00000372210	.	.	.	4.48	4.48	0.54585	Phosphoribulokinase/uridine kinase (1);	0.000000	0.85682	D	0.000000	D	0.86075	0.5846	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.90021	0.4128	9	0.72032	D	0.01	-25.5865	16.3171	0.82932	0.0:1.0:0.0:0.0	.	84;93;93	Q5JT10;Q9HA47-2;Q9HA47	.;.;UCK1_HUMAN	H	93;93;98;84	.	ENSP00000361282:D93H	D	-	1	0	UCK1	133394784	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.314000	0.78988	2.308000	0.77769	0.655000	0.94253	GAT		0.547	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054726.1	NM_031432		17	91	0	0	0	0	17	91				
WDR5	11091	broad.mit.edu	37	9	137017113	137017113	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr9:137017113G>A	ENST00000358625.3	+	9	764	c.593G>A	c.(592-594)tGg>tAg	p.W198*	WDR5_ENST00000425041.1_Nonsense_Mutation_p.W198*	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	198					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		AGTCGCATCTGGGACACCGCC	0.557																																						uc004cey.2		NA																	0					0						c.(592-594)TGG>TAG		WD repeat domain 5							163.0	159.0	160.0					9																	137017113		2203	4300	6503	SO:0001587	stop_gained	11091				histone H3 acetylation|histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|MLL1 complex|Set1C/COMPASS complex	protein binding	g.chr9:137017113G>A	AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.593G>A	9.37:g.137017113G>A	ENSP00000351446:p.Trp198*		Somatic				WDR5_uc004cez.2_Nonsense_Mutation_p.W198*	p.W198*	NM_017588	NP_060058	WXS	Illumina HiSeq	Unspecified	P61964	WDR5_HUMAN		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)	9	764	+		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)	198			WD 4.		Q91VA5|Q9NWX7|Q9UGP9	Nonsense_Mutation	SNP	ENST00000358625.3	37	c.593G>A	CCDS6981.1	.	.	.	.	.	.	.	.	.	.	G	37	6.626254	0.97718	.	.	ENSG00000196363	ENST00000358625;ENST00000425041	.	.	.	3.75	3.75	0.43078	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4966	0.67691	0.0:0.0:1.0:0.0	.	.	.	.	X	198	.	ENSP00000351446:W198X	W	+	2	0	WDR5	136006934	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	8.727000	0.91480	1.811000	0.52892	0.462000	0.41574	TGG		0.557	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254621.1	NM_052821		17	160	0	0	0	0	17	160				
AKAP4	8852	broad.mit.edu	37	X	49957554	49957554	+	Missense_Mutation	SNP	G	G	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chrX:49957554G>A	ENST00000376056.2	-	5	1933	c.1783C>T	c.(1783-1785)Cac>Tac	p.H595Y	AKAP4_ENST00000358526.2_Missense_Mutation_p.H604Y|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.H221Y|AKAP4_ENST00000376064.3_Missense_Mutation_p.H595Y					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GGGGCTCTGTGAGATTCTAGT	0.458																																						uc004dow.1		NA																	0				kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8						c.(1810-1812)CAC>TAC		A-kinase anchor protein 4 isoform 1							108.0	90.0	96.0					X																	49957554		2203	4300	6503	SO:0001583	missense	8852				cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding	g.chrX:49957554G>A	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1783C>T	X.37:g.49957554G>A	ENSP00000365224:p.His595Tyr		Somatic				AKAP4_uc004dov.1_Missense_Mutation_p.H221Y|AKAP4_uc010njp.1_Missense_Mutation_p.H426Y|AKAP4_uc004dou.1_Missense_Mutation_p.H595Y	p.H604Y	NM_003886	NP_003877	WXS	Illumina HiSeq	Unspecified	Q5JQC9	AKAP4_HUMAN			5	1934	-	Ovarian(276;0.236)		604						Missense_Mutation	SNP	ENST00000376056.2	37	c.1810C>T	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	G	0.759	-0.769835	0.02974	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064	T;T;T;T	0.06768	3.26;3.26;3.26;3.26	5.14	4.27	0.50696	A-kinase anchor 110kDa, C-terminal (1);	0.706063	0.12844	N	0.434578	T	0.12092	0.0294	L	0.36672	1.1	0.09310	N	1	P;D	0.53619	0.812;0.961	B;P	0.51701	0.212;0.677	T	0.17837	-1.0356	9	.	.	.	-1.0023	8.759	0.34663	0.1082:0.0:0.8918:0.0	.	604;221	Q5JQC9;A6ND82	AKAP4_HUMAN;.	Y	595;221;604;595	ENSP00000365224:H595Y;ENSP00000365226:H221Y;ENSP00000351327:H604Y;ENSP00000365232:H595Y	.	H	-	1	0	AKAP4	49844294	0.370000	0.25047	0.327000	0.25402	0.020000	0.10135	1.239000	0.32719	0.961000	0.38030	0.525000	0.51046	CAC		0.458	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886		18	27	0	0	0	0	18	27				
H2BFWT	158983	broad.mit.edu	37	X	103268089	103268089	+	Silent	SNP	T	T	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chrX:103268089T>C	ENST00000217926.5	-	1	170	c.144A>G	c.(142-144)aaA>aaG	p.K48K	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	48						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						AGTTGGCCTCTTTGGGCTCCT	0.627																																						uc004elr.2		NA																	0				ovary(1)	1						c.(142-144)AAA>AAG		H2B histone family, member W, testis-specific							75.0	60.0	65.0					X																	103268089		2203	4300	6503	SO:0001819	synonymous_variant	158983				nucleosome assembly	nuclear membrane|nucleosome	DNA binding	g.chrX:103268089T>C	BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.144A>G	X.37:g.103268089T>C			Somatic					p.K48K	NM_001002916	NP_001002916	WXS	Illumina HiSeq	Unspecified	Q7Z2G1	H2BWT_HUMAN			1	168	-			48					B1AK72|Q147W3	Silent	SNP	ENST00000217926.5	37	c.144A>G	CCDS35362.1																																																																																				0.627	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057756.2	NM_001002916		7	10	0	0	0	0	7	10				
HNRNPR	10236	broad.mit.edu	37	1	23637236	23637241	+	In_Frame_Del	DEL	GGTCCC	GGTCCC	-			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr1:23637236_23637241delGGTCCC	ENST00000374612.1	-	11	1731_1736	c.1608_1613delGGGACC	c.(1606-1614)ttgggacca>tta	p.GP537del	HNRNPR_ENST00000302271.6_In_Frame_Del_p.GP537del|HNRNPR_ENST00000426846.2_In_Frame_Del_p.GP377del|HNRNPR_ENST00000427764.2_In_Frame_Del_p.GP499del|HNRNPR_ENST00000478691.1_In_Frame_Del_p.GP439del|HNRNPR_ENST00000606561.1_In_Frame_Del_p.GP398del|HNRNPR_ENST00000476660.1_5'UTR|HNRNPR_ENST00000374616.3_In_Frame_Del_p.GP540del	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	537	RNA-binding RGG-box.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		GCCTCTTGGTGGTCCCAAAGGTGCCC	0.646																																						uc001bgr.3		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(1606-1614)TTGGGACCA>TTA		heterogeneous nuclear ribonucleoprotein R																																				SO:0001651	inframe_deletion	10236					catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr1:23637236_23637241delGGTCCC	AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.1608_1613delGGGACC	1.37:g.23637236_23637241delGGTCCC	ENSP00000363741:p.Gly537_Pro538del		Somatic				HNRNPR_uc001bgo.2_In_Frame_Del_p.GP147del|HNRNPR_uc001bgp.3_In_Frame_Del_p.GP540del|HNRNPR_uc009vqk.2_In_Frame_Del_p.GP439del|HNRNPR_uc001bgs.3_In_Frame_Del_p.GP436del|HNRNPR_uc010odw.1_In_Frame_Del_p.GP499del|HNRNPR_uc010odx.1_In_Frame_Del_p.GP377del|HNRNPR_uc009vql.2_In_Frame_Del_p.GP398del	p.GP537del	NM_005826	NP_005817	WXS	Illumina HiSeq	Unspecified	O43390	HNRPR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)	11	1767_1772	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)	537_538			RNA-binding RGG-box.		Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	In_Frame_Del	DEL	ENST00000374612.1	37	c.1608_1613delGGGACC	CCDS232.1																																																																																				0.646	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008889.1	NM_005826		14	75	NA	NA	NA	NA	14	75	---	---	---	---
B3GAT3	26229	broad.mit.edu	37	11	62388037	62388038	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr11:62388037_62388038insG	ENST00000265471.5	-	2	415_416	c.188_189insC	c.(187-189)cctfs	p.P63fs	B3GAT3_ENST00000534026.1_Frame_Shift_Ins_p.P63fs|B3GAT3_ENST00000531383.1_Frame_Shift_Ins_p.P63fs	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	63					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						GGGCAGGGGCAGGGGGTGGCCG	0.634																																						uc001ntw.2		NA																	0					0						c.(187-189)CCTfs		beta-1,3-glucuronyltransferase 3																																				SO:0001589	frameshift_variant	26229				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|manganese ion binding	g.chr11:62388037_62388038insG	AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.189dupC	11.37:g.62388042_62388042dupG	ENSP00000265471:p.Pro63fs		Somatic				B3GAT3_uc009ynz.2_Frame_Shift_Ins_p.P56fs|B3GAT3_uc001ntx.2_RNA|B3GAT3_uc010rlz.1_Frame_Shift_Ins_p.P63fs	p.P63fs	NM_012200	NP_036332	WXS	Illumina HiSeq	Unspecified	O94766	B3GA3_HUMAN			2	217_218	-			63			Lumenal (Potential).		B7ZAB3|Q96I06|Q9UEP0	Frame_Shift_Ins	INS	ENST00000265471.5	37	c.188_189insC	CCDS8025.1																																																																																				0.634	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200		7	44	NA	NA	NA	NA	7	44	---	---	---	---
EMG1	10436	broad.mit.edu	37	12	7080212	7080213	+	Splice_Site	INS	-	-	C	rs11428482|rs374779752|rs17857448		TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr12:7080212_7080213insC	ENST00000261406.6	+	2	267_268	c.124_125insC	c.(124-126)ttt>tCtt	p.F42fs	PHB2_ENST00000542912.1_5'Flank|PHB2_ENST00000546111.1_5'Flank|PHB2_ENST00000399433.2_5'Flank|EMG1_ENST00000546220.1_3'UTR|PHB2_ENST00000440277.1_5'Flank|PHB2_ENST00000535923.1_5'Flank|PHB2_ENST00000544134.1_5'Flank	NM_006331.7	NP_006322.4			EMG1 N1-specific pseudouridine methyltransferase																		GAGGCCGTAGTTTATTGTGGTG	0.569																																						uc001qsh.3		NA																	0					0						c.e2+1		ribosome biogenesis protein NEP1				3746,4		1873,0,2						5.4	1.0		dbSNP_120	28	7902,2		3951,0,1	no	frameshift	EMG1	NM_006331.7		5824,0,3	A1A1,A1R,RR		0.0253,0.1067,0.0515				11648,6				SO:0001630	splice_region_variant	10436				ribosomal small subunit biogenesis	cytoplasm|nucleolus	rRNA (pseudouridine) methyltransferase activity|rRNA binding	g.chr12:7080212_7080213insC	U72514	CCDS73430.1	12p13	2013-05-22	2013-05-22			ENSG00000126749			16912	protein-coding gene	gene with protein product		611531	"""EMG1 nucleolar protein homolog (S. cerevisiae)"""			9074930, 11935223, 19463982	Standard	NM_006331		Approved	C2F, NEP1, Grcc2f	uc001qsh.4	Q92979		ENST00000261406.6:c.124-1->C	12.37:g.7080212_7080213insC			Somatic				PHB2_uc001qsd.2_5'Flank|PHB2_uc010sft.1_5'Flank|PHB2_uc010sfu.1_5'Flank|EMG1_uc009zfo.2_RNA|EMG1_uc010sfv.1_RNA	p.L43_splice	NM_006331	NP_006322	WXS	Illumina HiSeq	Unspecified	Q92979	NEP1_HUMAN			2	272	+									Splice_Site	INS	ENST00000261406.6	37	c.129_splice																																																																																					0.569	EMG1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006331	Frame_Shift_Ins	7	28	NA	NA	NA	NA	7	28	---	---	---	---
SLFN5	162394	broad.mit.edu	37	17	33592632	33592633	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr17:33592632_33592633insA	ENST00000299977.4	+	5	2549_2550	c.2401_2402insA	c.(2401-2403)gaafs	p.E801fs	SLFN5_ENST00000542451.1_3'UTR	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	801					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		AAGTGAAGTGGAAAAATATAAA	0.426																																						uc002hjf.3		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2401-2403)GAAfs		schlafen family member 5																																				SO:0001589	frameshift_variant	162394				cell differentiation		ATP binding	g.chr17:33592632_33592633insA	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.2406dupA	17.37:g.33592637_33592637dupA	ENSP00000299977:p.Glu801fs		Somatic				SLFN5_uc010wcg.1_3'UTR	p.E801fs	NM_144975	NP_659412	WXS	Illumina HiSeq	Unspecified	Q08AF3	SLFN5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)	5	2518_2519	+		Ovarian(249;0.17)	801					Q08AF2|Q8WU54|Q96A82	Frame_Shift_Ins	INS	ENST00000299977.4	37	c.2401_2402insA	CCDS32619.1																																																																																				0.426	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	NM_144975		16	72	NA	NA	NA	NA	16	72	---	---	---	---
URI1	8725	broad.mit.edu	37	19	30433493	30433494	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr19:30433493_30433494insC	ENST00000542441.2	+	1	336_337	c.39_40insC	c.(40-42)cccfs	p.P14fs	URI1_ENST00000360605.4_Intron|URI1_ENST00000392271.1_5'UTR|URI1_ENST00000312051.6_5'UTR			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	14					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										CCGACCCCTCGCCCCCTTCGGC	0.762																																						uc002nsr.2		NA																	0				ovary(1)|kidney(1)	2						c.(37-42)TCGCCCfs		RPB5-mediating protein isoform a																																				SO:0001589	frameshift_variant	8725				protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding	g.chr19:30433493_30433494insC	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.44dupC	19.37:g.30433498_30433498dupC	ENSP00000442436:p.Pro14fs		Somatic				C19orf2_uc002nsq.2_Intron|C19orf2_uc002nss.2_5'UTR	p.S13fs	NM_003796	NP_003787	WXS	Illumina HiSeq	Unspecified	O94763	RMP_HUMAN	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)	1	69_70	+	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	13_14					A8K805|H7BY42|Q8TC23|Q9UNU3	Frame_Shift_Ins	INS	ENST00000542441.2	37	c.39_40insC	CCDS12420.1																																																																																				0.762	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447		3	6	NA	NA	NA	NA	3	6	---	---	---	---
TBC1D14	57533	broad.mit.edu	37	4	7026838	7026848	+	Frame_Shift_Del	DEL	TCCTGAAGCTG	TCCTGAAGCTG	-			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr4:7026838_7026848delTCCTGAAGCTG	ENST00000409757.4	+	13	1989_1999	c.1865_1875delTCCTGAAGCTG	c.(1864-1875)atcctgaagctgfs	p.ILKL622fs	TBC1D14_ENST00000451522.2_Frame_Shift_Del_p.ILKL342fs|TBC1D14_ENST00000446947.2_Frame_Shift_Del_p.ILKL269fs|TBC1D14_ENST00000448507.1_Frame_Shift_Del_p.ILKL622fs|TBC1D14_ENST00000410031.1_Frame_Shift_Del_p.ILKL394fs	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	622					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						GCCCTGGGCATCCTGAAGCTGTTCGAGGACA	0.588																																						uc011bwg.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1864-1875)ATCCTGAAGCTGfs		TBC1 domain family, member 14 isoform a																																				SO:0001589	frameshift_variant	57533					intracellular	Rab GTPase activator activity	g.chr4:7026838_7026848delTCCTGAAGCTG	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1865_1875delTCCTGAAGCTG	4.37:g.7026838_7026848delTCCTGAAGCTG	ENSP00000386921:p.Ile622fs		Somatic				TBC1D14_uc003gjs.3_Frame_Shift_Del_p.I622fs|TBC1D14_uc010idh.2_Frame_Shift_Del_p.I342fs|TBC1D14_uc011bwh.1_Frame_Shift_Del_p.I269fs|TBC1D14_uc003gju.3_Frame_Shift_Del_p.I113fs	p.I622fs	NM_001113361	NP_001106832	WXS	Illumina HiSeq	Unspecified	Q9P2M4	TBC14_HUMAN			13	1944_1954	+			622_625					B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Frame_Shift_Del	DEL	ENST00000409757.4	37	c.1865_1875delTCCTGAAGCTG	CCDS3394.2																																																																																				0.588	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773		19	88	NA	NA	NA	NA	19	88	---	---	---	---
CADPS2	93664	broad.mit.edu	37	7	122153341	122153341	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chr7:122153341delA	ENST00000449022.2	-	9	1523	c.1504delT	c.(1504-1506)tggfs	p.W502fs	CADPS2_ENST00000334010.7_Frame_Shift_Del_p.W502fs|CADPS2_ENST00000313070.7_Frame_Shift_Del_p.W502fs|CADPS2_ENST00000476131.1_5'UTR|CADPS2_ENST00000412584.2_Frame_Shift_Del_p.W502fs	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	502	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						CATCTTTTCCAAACCTTCTGT	0.323																																						uc010lkp.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1504-1506)TGGfs		Ca2+-dependent activator protein for secretion 2							62.0	59.0	60.0					7																	122153341		1811	4057	5868	SO:0001589	frameshift_variant	93664				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding	g.chr7:122153341delA		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1504delT	7.37:g.122153341delA	ENSP00000398481:p.Trp502fs		Somatic				CADPS2_uc003vkg.3_Frame_Shift_Del_p.W202fs|CADPS2_uc010lkq.2_Frame_Shift_Del_p.W502fs	p.W502fs	NM_017954	NP_060424	WXS	Illumina HiSeq	Unspecified	Q86UW7	CAPS2_HUMAN			9	1667	-			502			PH.		A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Frame_Shift_Del	DEL	ENST00000449022.2	37	c.1504delT	CCDS55158.1																																																																																				0.323	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954		2	4	NA	NA	NA	NA	2	4	---	---	---	---
KDM5C	8242	broad.mit.edu	37	X	53240037	53240038	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CR-7367-01A-11D-2012-08	TCGA-CR-7367-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	b82e34db-7b0e-4bbd-bc42-ba063ac42409	b93dc36c-99c1-4b6d-88c1-97d65bad89d2	g.chrX:53240037_53240038insA	ENST00000375401.3	-	11	1935_1936	c.1403_1404insT	c.(1402-1404)gagfs	p.E468fs	KDM5C_ENST00000375379.3_Frame_Shift_Ins_p.E468fs|KDM5C_ENST00000404049.3_Frame_Shift_Ins_p.E467fs|KDM5C_ENST00000375383.3_Frame_Shift_Ins_p.E427fs|KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000452825.3_Frame_Shift_Ins_p.E401fs|KDM5C-IT1_ENST00000412242.1_RNA	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	468	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TGGTAGCATACTCCTGCCAGGT	0.455			"""N, F, S"""		clear cell renal carcinoma																																	uc004drz.2		NA		Rec	yes		X	Xp11.22-p11.21	8242	N|F|S	lysine (K)-specific demethylase 5C (JARID1C)			E			clear cell renal carcinoma		0				kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						c.(1402-1404)GAGfs		jumonji, AT rich interactive domain 1C isoform																																				SO:0001589	frameshift_variant	8242				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding	g.chrX:53240037_53240038insA	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1403_1404insT	X.37:g.53240037_53240038insA	ENSP00000364550:p.Glu468fs		Somatic				KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Frame_Shift_Ins_p.E401fs|KDM5C_uc004dsa.2_Frame_Shift_Ins_p.E467fs	p.E468fs	NM_004187	NP_004178	WXS	Illumina HiSeq	Unspecified	P41229	KDM5C_HUMAN			11	1936_1937	-			468			JmjC.		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Ins	INS	ENST00000375401.3	37	c.1403_1404insT	CCDS14351.1																																																																																				0.455	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		17	33	NA	NA	NA	NA	17	33	---	---	---	---
