#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
DVL1	1855	broad.mit.edu	37	1	1273764	1273764	+	Silent	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:1273764C>A	ENST00000378888.5	-	13	1676	c.1392G>T	c.(1390-1392)cgG>cgT	p.R464R	DVL1_ENST00000378891.5_Silent_p.R439R			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	464	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGGCCTCCCGCCGCTCCTTGA	0.657																																						uc001aer.3		NA																	0					0						c.(1315-1317)CGG>CGT		dishevelled 1							38.0	37.0	37.0					1																	1273764		2202	4294	6496	SO:0001819	synonymous_variant	1855				canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity	g.chr1:1273764C>A	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1392G>T	1.37:g.1273764C>A			Somatic				DVL1_uc002quu.2_Silent_p.R181R|DVL1_uc009vka.2_Silent_p.R122R|DVL1_uc001aeu.1_Silent_p.R198R	p.R439R	NM_004421	NP_004412	WXS	Illumina HiSeq	Unspecified	O14640	DVL1_HUMAN		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	13	1364	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	464			DEP.		Q5TA33|Q5TA35	Silent	SNP	ENST00000378888.5	37	c.1317G>T																																																																																					0.657	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000008490.1	NM_004421		6	10	1	0	0.00198382	0.00212523	6	10				
RAD54L	8438	broad.mit.edu	37	1	46726604	46726604	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:46726604A>G	ENST00000371975.4	+	7	1357	c.683A>G	c.(682-684)aAt>aGt	p.N228S	RAD54L_ENST00000442598.1_Missense_Mutation_p.N228S|RAD54L_ENST00000473251.1_3'UTR	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	228	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		AACTGGTACAATGAGGTTGGG	0.512								Direct reversal of damage;Homologous recombination																														uc009vye.2		NA																	0				ovary(2)|skin(1)	3						c.(682-684)AAT>AGT	Direct_reversal_of_damage|Homologous_recombination	RAD54-like protein							94.0	90.0	91.0					1																	46726604		2203	4300	6503	SO:0001583	missense	8438				meiosis	nucleus	ATP binding|DNA binding|helicase activity	g.chr1:46726604A>G	X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.683A>G	1.37:g.46726604A>G	ENSP00000361043:p.Asn228Ser		Somatic				RAD54L_uc001cpl.2_Missense_Mutation_p.N228S|RAD54L_uc001cpm.1_Missense_Mutation_p.N48S	p.N228S	NM_001142548	NP_001136020	WXS	Illumina HiSeq	Unspecified	Q92698	RAD54_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)	8	797	+	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)	228			Helicase ATP-binding.		Q5TE31|Q6IUY3	Missense_Mutation	SNP	ENST00000371975.4	37	c.683A>G	CCDS532.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020183	0.54576	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	D;D	0.93426	-3.22;-3.22	5.5	4.37	0.52481	DEAD-like helicase (2);SNF2-related (1);	0.096735	0.64402	D	0.000001	D	0.87018	0.6073	N	0.25992	0.78	0.58432	D	0.999997	B;B	0.30326	0.049;0.276	B;B	0.27715	0.006;0.082	D	0.85130	0.0974	10	0.39692	T	0.17	-22.7812	11.1078	0.48214	0.9278:0.0:0.0722:0.0	.	48;228	G3V1N0;Q92698	.;RAD54_HUMAN	S	228;228;48	ENSP00000396113:N228S;ENSP00000361043:N228S	ENSP00000361043:N228S	N	+	2	0	RAD54L	46499191	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.226000	0.72277	2.231000	0.72958	0.459000	0.35465	AAT		0.512	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021272.1	NM_003579		5	43	0	0	0	0	5	43				
RPE65	6121	broad.mit.edu	37	1	68896799	68896799	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:68896799G>A	ENST00000262340.5	-	13	1452	c.1399C>T	c.(1399-1401)Cca>Tca	p.P467S		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	467					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						GGTTCTGATGGGTATGAATCA	0.393																																						uc001dei.1		NA																	0				ovary(1)	1						c.(1399-1401)CCA>TCA		retinal pigment epithelium-specific protein							93.0	90.0	91.0					1																	68896799		2203	4300	6503	SO:0001583	missense	6121				visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity	g.chr1:68896799G>A	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1399C>T	1.37:g.68896799G>A	ENSP00000262340:p.Pro467Ser		Somatic					p.P467S	NM_000329	NP_000320	WXS	Illumina HiSeq	Unspecified	Q16518	RPE65_HUMAN			13	1453	-			467					A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	c.1399C>T	CCDS643.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633767	0.87660	.	.	ENSG00000116745	ENST00000262340	D	0.95342	-3.68	5.29	5.29	0.74685	.	0.096084	0.64402	D	0.000001	D	0.97579	0.9207	M	0.89478	3.035	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.98006	1.0363	10	0.66056	D	0.02	-2.9406	18.9313	0.92566	0.0:0.0:1.0:0.0	.	467	Q16518	RPE65_HUMAN	S	467	ENSP00000262340:P467S	ENSP00000262340:P467S	P	-	1	0	RPE65	68669387	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.375000	0.97178	2.489000	0.83994	0.555000	0.69702	CCA		0.393	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329		19	36	0	0	0	0	19	36				
FAM63A	55793	broad.mit.edu	37	1	150974779	150974779	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:150974779C>G	ENST00000361936.5	-	3	1269	c.315G>C	c.(313-315)agG>agC	p.R105S	FAM63A_ENST00000493834.2_Missense_Mutation_p.R10S|FAM63A_ENST00000361738.6_Missense_Mutation_p.R153S|FAM63A_ENST00000470877.1_Intron|FAM63A_ENST00000312210.5_5'UTR	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A	105						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCTGTCGGGTCCTGGGGGACT	0.577																																						uc001ewf.2		NA																	0				ovary(1)	1						c.(313-315)AGG>AGC		hypothetical protein LOC55793 isoform 1							96.0	98.0	97.0					1																	150974779		2203	4300	6503	SO:0001583	missense	55793						protein binding	g.chr1:150974779C>G	BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.315G>C	1.37:g.150974779C>G	ENSP00000354814:p.Arg105Ser		Somatic				FAM63A_uc001ewc.2_5'UTR|FAM63A_uc010pcm.1_Missense_Mutation_p.R10S|FAM63A_uc001ewd.2_5'UTR|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Missense_Mutation_p.R153S|FAM63A_uc001ewg.2_Missense_Mutation_p.R105S	p.R105S	NM_018379	NP_001156731	WXS	Illumina HiSeq	Unspecified	Q8N5J2	FA63A_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		3	1999	-	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		105					B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	Missense_Mutation	SNP	ENST00000361936.5	37	c.315G>C	CCDS976.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871438	0.33069	.	.	ENSG00000143409	ENST00000361936;ENST00000361738;ENST00000493834	T;T;T	0.45668	0.92;0.89;0.96	5.0	4.01	0.46588	.	0.285739	0.31312	N	0.007874	T	0.10508	0.0257	N	0.20685	0.6	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.14023	0.006;0.01	T	0.06463	-1.0825	10	0.28530	T	0.3	-27.5104	5.9275	0.19120	0.0:0.7976:0.0:0.2024	.	153;105	Q8N5J2-3;Q8N5J2	.;FA63A_HUMAN	S	105;153;10	ENSP00000354814:R105S;ENSP00000354669:R153S;ENSP00000437174:R10S	ENSP00000354669:R153S	R	-	3	2	FAM63A	149241403	0.642000	0.27260	0.998000	0.56505	0.995000	0.86356	0.908000	0.28545	2.578000	0.87016	0.655000	0.94253	AGG		0.577	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411753.1	NM_018379		8	85	0	0	0	0	8	85				
DENND4B	9909	broad.mit.edu	37	1	153910068	153910068	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:153910068G>A	ENST00000361217.4	-	15	2546	c.2128C>T	c.(2128-2130)Cgg>Tgg	p.R710W		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	710					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AACTCAGCCCGTAGCTCTGGG	0.612																																						uc001fdd.1		NA																	0				ovary(1)	1						c.(2128-2130)CGG>TGG		DENN/MADD domain containing 4B							52.0	55.0	54.0					1																	153910068		1967	4148	6115	SO:0001583	missense	9909							g.chr1:153910068G>A	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2128C>T	1.37:g.153910068G>A	ENSP00000354597:p.Arg710Trp		Somatic					p.R710W	NM_014856	NP_055671	WXS	Illumina HiSeq	Unspecified	O75064	DEN4B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		15	2529	-	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		710					Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	c.2128C>T	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734073	0.69189	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.07327	3.2;3.2	4.86	3.92	0.45320	.	0.481828	0.19961	N	0.102208	T	0.04363	0.0120	L	0.46157	1.445	0.23528	N	0.997485	P	0.44260	0.83	B	0.42692	0.395	T	0.15150	-1.0447	10	0.72032	D	0.01	-11.6424	11.2103	0.48795	0.0:0.0:0.6553:0.3446	.	710	O75064	DEN4B_HUMAN	W	710;721	ENSP00000354597:R710W;ENSP00000357635:R721W	ENSP00000354597:R710W	R	-	1	2	DENND4B	152176692	0.003000	0.15002	0.987000	0.45799	0.960000	0.62799	1.278000	0.33179	1.196000	0.43129	0.563000	0.77884	CGG		0.612	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806		12	38	0	0	0	0	12	38				
TDRD10	126668	broad.mit.edu	37	1	154480950	154480950	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:154480950T>C	ENST00000368480.3	+	4	219	c.134T>C	c.(133-135)aTt>aCt	p.I45T	TDRD10_ENST00000368482.4_Missense_Mutation_p.I45T			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	45	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCACTGGATATTTCTAAGGTA	0.378																																						uc009wow.2		NA																	0				ovary(1)	1						c.(133-135)ATT>ACT		tudor domain containing 10 isoform a							233.0	214.0	220.0					1																	154480950		1852	4095	5947	SO:0001583	missense	126668						nucleotide binding|RNA binding	g.chr1:154480950T>C	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.134T>C	1.37:g.154480950T>C	ENSP00000357465:p.Ile45Thr		Somatic				TDRD10_uc001ffd.2_Missense_Mutation_p.I45T	p.I45T	NM_001098475	NP_001091945	WXS	Illumina HiSeq	Unspecified	Q5VZ19	TDR10_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		4	972	+	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		45			RRM.		A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	c.134T>C	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	T	6.663	0.490792	0.12702	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.06608	3.28;3.28	1.97	1.97	0.26223	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.01189	0.0039	N	0.20530	0.585	0.21762	N	0.999556	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.004	T	0.47935	-0.9078	9	0.21014	T	0.42	.	5.949	0.19235	0.0:0.0:0.0:1.0	.	45;45	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	T	45	ENSP00000357467:I45T;ENSP00000357465:I45T	ENSP00000357465:I45T	I	+	2	0	TDRD10	152747574	0.000000	0.05858	0.671000	0.29857	0.027000	0.11550	0.168000	0.16622	1.160000	0.42584	0.372000	0.22366	ATT		0.378	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499		44	81	0	0	0	0	44	81				
ACKR1	2532	broad.mit.edu	37	1	159175705	159175705	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:159175705C>G	ENST00000368122.2	+	2	1155	c.476C>G	c.(475-477)gCa>gGa	p.A159G	CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000537147.1_Missense_Mutation_p.A159G|DARC_ENST00000368121.2_Missense_Mutation_p.A161G	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		159					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					AGACTGGGTGCAGGCCAGGTC	0.632																																						uc001fto.2		NA																	0				ovary(1)|lung(1)	2						c.(475-477)GCA>GGA		Duffy blood group antigen isoform b							41.0	33.0	36.0					1																	159175705		2203	4300	6503	SO:0001583	missense	2532				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity	g.chr1:159175705C>G																												ENST00000368122.2:c.476C>G	1.37:g.159175705C>G	ENSP00000357104:p.Ala159Gly		Somatic				DARC_uc001ftp.3_Missense_Mutation_p.A161G	p.A159G	NM_002036	NP_002027	WXS	Illumina HiSeq	Unspecified	Q16570	DUFFY_HUMAN			2	716	+	all_hematologic(112;0.0429)		159			Cytoplasmic (Potential).		A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	c.476C>G	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.572282	0.65765	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.38077	1.16;1.16;1.16	5.23	-1.88	0.07713	.	.	.	.	.	T	0.21427	0.0516	L	0.39898	1.24	0.09310	N	1	D;D	0.62365	0.991;0.991	P;P	0.61722	0.893;0.893	T	0.07309	-1.0779	9	0.87932	D	0	-19.9237	0.9698	0.01413	0.2571:0.38:0.1267:0.2363	.	161;159	Q5Y7A1;Q16570	.;DUFFY_HUMAN	G	159;159;159;161	ENSP00000357104:A159G;ENSP00000441985:A159G;ENSP00000357103:A161G	ENSP00000352341:A159G	A	+	2	0	DARC	157442329	0.000000	0.05858	0.000000	0.03702	0.951000	0.60555	-0.626000	0.05527	-0.194000	0.10399	0.561000	0.74099	GCA		0.632	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2			3	28	0	0	0	0	3	28				
ATP1A4	480	broad.mit.edu	37	1	160124906	160124906	+	Silent	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:160124906C>A	ENST00000368081.4	+	3	750	c.279C>A	c.(277-279)acC>acA	p.T93T		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	93					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CACCCCCCACCACTCCAGAAT	0.527																																						uc001fve.3		NA																	0				ovary(2)|skin(2)	4						c.(277-279)ACC>ACA		Na+/K+ -ATPase alpha 4 subunit isoform 1							108.0	108.0	108.0					1																	160124906		2203	4300	6503	SO:0001819	synonymous_variant	480				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity	g.chr1:160124906C>A	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.279C>A	1.37:g.160124906C>A			Somatic				ATP1A4_uc001fvf.3_RNA	p.T93T	NM_144699	NP_653300	WXS	Illumina HiSeq	Unspecified	Q13733	AT1A4_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		3	758	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		93			Cytoplasmic (Potential).		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	ENST00000368081.4	37	c.279C>A	CCDS1197.1																																																																																				0.527	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699		16	68	1	0	1.34e-09	1.69e-09	16	68				
CD84	8832	broad.mit.edu	37	1	160535331	160535331	+	Missense_Mutation	SNP	C	C	T	rs201663416		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:160535331C>T	ENST00000311224.4	-	2	317	c.251G>A	c.(250-252)cGg>cAg	p.R84Q	CD84_ENST00000368048.3_Missense_Mutation_p.R84Q|CD84_ENST00000368047.3_5'UTR|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000368051.3_Missense_Mutation_p.R84Q|CD84_ENST00000368054.3_Missense_Mutation_p.R84Q|CD84_ENST00000534968.1_Intron	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	84	Ig-like V-type.				blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R84L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GGCATGTATCCGTTCATAATA	0.438																																						uc001fwh.3		NA																	1	Substitution - Missense(1)	p.R84W(1)	lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(250-252)CGG>CAG		CD84 molecule							267.0	232.0	244.0					1																	160535331		2203	4300	6503	SO:0001583	missense	8832				blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity	g.chr1:160535331C>T	AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.251G>A	1.37:g.160535331C>T	ENSP00000312367:p.Arg84Gln		Somatic				CD84_uc001fwf.3_Missense_Mutation_p.R84Q|CD84_uc001fwg.3_Missense_Mutation_p.R84Q|CD84_uc009wtn.2_Missense_Mutation_p.R84Q|CD84_uc001fwi.3_Intron|CD84_uc001fwj.2_Missense_Mutation_p.R84Q|CD84_uc001fwk.2_Missense_Mutation_p.R84Q	p.R84Q	NM_003874	NP_003865	WXS	Illumina HiSeq	Unspecified	Q9UIB8	SLAF5_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0175)		2	275	-	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		84			Extracellular (Potential).		B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Missense_Mutation	SNP	ENST00000311224.4	37	c.251G>A	CCDS53396.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189567	0.78789	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	5.11	5.11	0.69529	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.47078	0.1426	M	0.73319	2.225	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.42949	-0.9421	10	0.66056	D	0.02	-12.0244	14.2208	0.65826	0.0:1.0:0.0:0.0	.	84;84;84;84;84;84	Q9UIB8-5;Q9UIB8-6;Q9UIB8-4;Q9UIB8;Q9UIB8-2;Q9UIB8-3	.;.;.;SLAF5_HUMAN;.;.	Q	84	ENSP00000357033:R84Q;ENSP00000357027:R84Q;ENSP00000312367:R84Q;ENSP00000357030:R84Q;ENSP00000353163:R84Q;ENSP00000357026:R84Q	ENSP00000312367:R84Q	R	-	2	0	CD84	158801955	0.711000	0.27906	0.040000	0.18447	0.064000	0.16182	3.579000	0.53900	2.814000	0.96858	0.591000	0.81541	CGG		0.438	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059092.1	NM_003874		23	146	0	0	0	0	23	146				
DNM3	26052	broad.mit.edu	37	1	171956944	171956944	+	Splice_Site	SNP	C	C	A	rs200490605	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:171956944C>A	ENST00000355305.5	+	3	541	c.384C>A	c.(382-384)caC>caA	p.H128Q	DNM3_ENST00000358155.4_Splice_Site_p.H128Q|DNM3_ENST00000367733.2_Splice_Site_p.H128Q|DNM3_ENST00000367731.1_Splice_Site_p.H128Q|DNM3_ENST00000520906.1_Splice_Site_p.H128Q			Q9UQ16	DYN3_HUMAN	dynamin 3	128	Dynamin-type G.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ATTCCCCACACGGTAAGTAAA	0.348																																						uc001gie.2		NA																	0				breast(1)	1						c.(382-384)CAC>CAA		dynamin 3 isoform a							102.0	107.0	105.0					1																	171956944		1829	4079	5908	SO:0001630	splice_region_variant	26052				endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding	g.chr1:171956944C>A	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.385+1C>A	1.37:g.171956944C>A			Somatic				DNM3_uc001gid.3_Missense_Mutation_p.H128Q|DNM3_uc009wwb.2_Missense_Mutation_p.H128Q|DNM3_uc001gif.2_Missense_Mutation_p.H128Q	p.H128Q	NM_015569	NP_056384	WXS	Illumina HiSeq	Unspecified	Q9UQ16	DYN3_HUMAN			3	560	+			128					A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	37	c.384C>A		.	.	.	.	.	.	.	.	.	.	T	13.71	2.317169	0.40996	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	D;D;D;D;D;D	0.96940	-3.72;-3.72;-3.72;-3.72;-3.72;-4.18	5.27	2.85	0.33270	.	0.105674	0.64402	D	0.000005	D	0.92974	0.7764	M	0.76838	2.35	0.45307	D	0.998301	B;P;P;P	0.47409	0.437;0.895;0.807;0.619	B;B;B;B	0.43274	0.353;0.414;0.414;0.249	D	0.89976	0.4097	10	0.72032	D	0.01	.	7.9198	0.29839	0.0:0.2756:0.0:0.7244	.	128;128;128;128	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	Q	128;128;128;128;128;128;18	ENSP00000350876:H128Q;ENSP00000356707:H128Q;ENSP00000347457:H128Q;ENSP00000356705:H128Q;ENSP00000429701:H128Q;ENSP00000429416:H18Q	ENSP00000347457:H128Q	H	+	3	2	DNM3	170223567	1.000000	0.71417	0.998000	0.56505	0.832000	0.47134	0.686000	0.25392	0.009000	0.14813	-0.254000	0.11334	CAC		0.348	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	Missense_Mutation	10	88	1	0	3.86e-05	4.44e-05	10	88				
PAPPA2	60676	broad.mit.edu	37	1	176708895	176708895	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:176708895T>C	ENST00000367662.3	+	13	5096	c.3932T>C	c.(3931-3933)cTt>cCt	p.L1311P		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1311					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						AACCACTCTCTTGGTGAGTCT	0.478																																						uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(3931-3933)CTT>CCT		pappalysin 2 isoform 1							60.0	59.0	59.0					1																	176708895		1989	4161	6150	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176708895T>C	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3932T>C	1.37:g.176708895T>C	ENSP00000356634:p.Leu1311Pro		Somatic				PAPPA2_uc009www.2_RNA	p.L1311P	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			13	5096	+			1311					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.3932T>C	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.063258	0.76187	.	.	ENSG00000116183	ENST00000367662	T	0.02421	4.3	5.67	5.67	0.87782	.	0.130212	0.52532	D	0.000062	T	0.16471	0.0396	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.67900	0.954	T	0.00206	-1.1920	10	0.87932	D	0	-11.6779	14.1507	0.65381	0.0:0.0:0.0:1.0	.	1311	Q9BXP8	PAPP2_HUMAN	P	1311	ENSP00000356634:L1311P	ENSP00000356634:L1311P	L	+	2	0	PAPPA2	174975518	1.000000	0.71417	1.000000	0.80357	0.585000	0.36419	6.650000	0.74368	2.155000	0.67459	0.459000	0.35465	CTT		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			4	37	0	0	0	0	4	37				
PDC	5132	broad.mit.edu	37	1	186413572	186413572	+	Missense_Mutation	SNP	G	G	A	rs567786815		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:186413572G>A	ENST00000391997.2	-	4	367	c.280C>T	c.(280-282)Cgt>Tgt	p.R94C	PDC_ENST00000497198.1_Missense_Mutation_p.R42C|PDC_ENST00000456239.2_Missense_Mutation_p.R42C|PDC_ENST00000340129.5_Missense_Mutation_p.R94C	NM_002597.4	NP_002588.3	P20941	PHOS_HUMAN	phosducin	94					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of catalytic activity (GO:0043086)|phototransduction (GO:0007602)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	phospholipase inhibitor activity (GO:0004859)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		CACTGTCTACGGTATTTACGA	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		19258	0.001		0.0	False		,,,				2504	0.0					uc001gsa.2		NA																	0				skin(1)	1						c.(280-282)CGT>TGT		phosducin isoform a							117.0	118.0	117.0					1																	186413572		2203	4300	6503	SO:0001583	missense	5132				G-protein coupled receptor protein signaling pathway|phototransduction|visual perception	actin cytoskeleton|cytosol|nucleus|photoreceptor inner segment|photoreceptor outer segment	phospholipase inhibitor activity	g.chr1:186413572G>A	AF076464	CCDS1370.1, CCDS41447.1	1q25.2	2013-01-08			ENSG00000116703	ENSG00000116703			8759	protein-coding gene	gene with protein product		171490				8288249	Standard	NM_022576		Approved	MEKA	uc001gsa.4	P20941	OTTHUMG00000035575	ENST00000391997.2:c.280C>T	1.37:g.186413572G>A	ENSP00000375855:p.Arg94Cys		Somatic				PDC_uc001grz.2_Missense_Mutation_p.R42C	p.R94C	NM_002597	NP_002588	WXS	Illumina HiSeq	Unspecified	P20941	PHOS_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)	4	353	-		Breast(1374;1.53e-05)	94					Q14816|Q9UP22|Q9UP23	Missense_Mutation	SNP	ENST00000391997.2	37	c.280C>T	CCDS1370.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206268	0.79127	.	.	ENSG00000116703	ENST00000391997;ENST00000497198;ENST00000456239;ENST00000340129	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.58	5.58	0.84498	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.80592	0.4652	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.83571	0.0112	10	0.87932	D	0	-16.9774	19.5743	0.95436	0.0:0.0:1.0:0.0	.	94	P20941	PHOS_HUMAN	C	94;42;42;94	ENSP00000375855:R94C;ENSP00000422775:R42C;ENSP00000411564:R42C;ENSP00000342033:R94C	ENSP00000342033:R94C	R	-	1	0	PDC	184680195	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	5.958000	0.70330	2.611000	0.88343	0.655000	0.94253	CGT		0.368	PDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086347.2	NM_022577		4	110	0	0	0	0	4	110				
RGS18	64407	broad.mit.edu	37	1	192127873	192127873	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:192127873G>A	ENST00000367460.3	+	1	287	c.106G>A	c.(106-108)Gaa>Aaa	p.E36K	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	36					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AACAAGCAAAGAAGCCAAAAT	0.274																																						uc001gsg.2		NA																	0				ovary(3)	3						c.(106-108)GAA>AAA		regulator of G-protein signalling 18							49.0	52.0	51.0					1																	192127873		2202	4288	6490	SO:0001583	missense	64407				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192127873G>A	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.106G>A	1.37:g.192127873G>A	ENSP00000356430:p.Glu36Lys		Somatic					p.E36K	NM_130782	NP_570138	WXS	Illumina HiSeq	Unspecified	Q9NS28	RGS18_HUMAN			1	282	+			36					B2RD23	Missense_Mutation	SNP	ENST00000367460.3	37	c.106G>A	CCDS1374.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815861	0.50527	.	.	ENSG00000150681	ENST00000367460	T	0.49720	0.77	6.06	6.06	0.98353	.	0.312611	0.37715	N	0.001973	T	0.42810	0.1219	L	0.57536	1.79	0.44282	D	0.997149	P	0.36282	0.546	B	0.32980	0.156	T	0.31724	-0.9933	10	0.08837	T	0.75	.	17.359	0.87345	0.0:0.0:1.0:0.0	.	36	Q9NS28	RGS18_HUMAN	K	36	ENSP00000356430:E36K	ENSP00000356430:E36K	E	+	1	0	RGS18	190394496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.605000	0.67634	2.880000	0.98712	0.650000	0.86243	GAA		0.274	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782		12	25	0	0	0	0	12	25				
SRGAP2	23380	broad.mit.edu	37	1	206631989	206631989	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:206631989C>T	ENST00000414007.1	+	18	2108	c.2108C>T	c.(2107-2109)tCt>tTt	p.S703F	SRGAP2_ENST00000419187.2_Missense_Mutation_p.S161F			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	843					actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					CGTCCAGAATCTGGGAGCATC	0.582																																						uc001hdy.2		NA																	0					0						c.(2266-2268)TCT>TTT		SLIT-ROBO Rho GTPase activating protein 2							22.0	24.0	24.0					1																	206631989		1967	4155	6122	SO:0001583	missense	23380				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr1:206631989C>T	AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.2108C>T	1.37:g.206631989C>T	ENSP00000390898:p.Ser703Phe		Somatic				SRGAP2_uc010pru.1_Missense_Mutation_p.S679F	p.S756F	NM_015326	NP_056141	WXS	Illumina HiSeq	Unspecified	O75044	FNBP2_HUMAN			19	2600	+	Breast(84;0.137)		843			Ser-rich.			Missense_Mutation	SNP	ENST00000414007.1	37	c.2267C>T		.	.	.	.	.	.	.	.	.	.	C	18.68	3.676472	0.67928	.	.	ENSG00000163486	ENST00000414007;ENST00000419187	T;T	0.33654	3.02;1.4	6.06	6.06	0.98353	.	0.481335	0.23084	N	0.052101	T	0.60457	0.2270	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	T	0.58907	-0.7553	6	0.59425	D	0.04	.	19.609	0.95594	0.0:1.0:0.0:0.0	.	.	.	.	F	703;161	ENSP00000390898:S703F;ENSP00000397990:S161F	ENSP00000390898:S703F	S	+	2	0	SRGAP2	204698612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.579000	0.67457	2.882000	0.98803	0.655000	0.94253	TCT		0.582	SRGAP2-201	KNOWN	basic	protein_coding	protein_coding		NM_015326		6	4	0	0	0	0	6	4				
CR2	1380	broad.mit.edu	37	1	207646235	207646235	+	Silent	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:207646235A>G	ENST00000367058.3	+	10	1878	c.1689A>G	c.(1687-1689)ggA>ggG	p.G563G	CR2_ENST00000458541.2_Silent_p.G536G|CR2_ENST00000367059.3_Silent_p.G563G|CR2_ENST00000367057.3_Silent_p.G563G	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	563	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CAGAAAGAGGAGTGGAATTCA	0.507																																						uc001hfw.2		NA																	0				upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						c.(1687-1689)GGA>GGG		complement component (3d/Epstein Barr virus)							81.0	76.0	77.0					1																	207646235		2203	4300	6503	SO:0001819	synonymous_variant	1380				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity	g.chr1:207646235A>G	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1689A>G	1.37:g.207646235A>G			Somatic				CR2_uc001hfv.2_Silent_p.G563G|CR2_uc009xch.2_Silent_p.G563G|CR2_uc009xci.1_Silent_p.G48G	p.G563G	NM_001877	NP_001868	WXS	Illumina HiSeq	Unspecified	P20023	CR2_HUMAN			10	1783	+			563			Sushi 9.|Extracellular (Potential).		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	c.1689A>G	CCDS1478.1																																																																																				0.507	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877		7	52	0	0	0	0	7	52				
CAPN9	10753	broad.mit.edu	37	1	230903376	230903376	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:230903376C>A	ENST00000271971.2	+	5	739	c.626C>A	c.(625-627)aCt>aAt	p.T209N	RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000366666.2_Missense_Mutation_p.T146N|CAPN9_ENST00000354537.1_Missense_Mutation_p.T209N	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	209	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				ACCTTCCAAACTAAAGAGGCC	0.542																																						uc001htz.1		NA																	0				ovary(1)	1						c.(625-627)ACT>AAT		calpain 9 isoform 1							95.0	101.0	99.0					1																	230903376		2203	4300	6503	SO:0001583	missense	10753				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity	g.chr1:230903376C>A	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.626C>A	1.37:g.230903376C>A	ENSP00000271971:p.Thr209Asn		Somatic				CAPN9_uc009xfg.1_Missense_Mutation_p.T146N|CAPN9_uc001hua.1_Missense_Mutation_p.T209N	p.T209N	NM_006615	NP_006606	WXS	Illumina HiSeq	Unspecified	O14815	CAN9_HUMAN			5	739	+	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)	209			Calpain catalytic.		B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	c.626C>A	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.445720	0.25987	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	D;D;D	0.87491	-2.26;-2.26;-2.26	5.32	1.25	0.21368	Peptidase C2, calpain, catalytic domain (3);	0.322719	0.37483	N	0.002078	D	0.86896	0.6043	M	0.64170	1.965	0.09310	N	1	P;P;P	0.48764	0.82;0.915;0.82	P;P;P	0.51193	0.662;0.533;0.662	T	0.79356	-0.1837	10	0.87932	D	0	.	7.8757	0.29592	0.0:0.4005:0.0:0.5995	.	146;209;209	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	N	209;209;146	ENSP00000271971:T209N;ENSP00000346538:T209N;ENSP00000355626:T146N	ENSP00000271971:T209N	T	+	2	0	CAPN9	228969999	0.340000	0.24792	0.001000	0.08648	0.053000	0.15095	1.153000	0.31676	0.074000	0.16767	-0.797000	0.03246	ACT		0.542	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615		32	97	1	0	1.63e-12	2.15e-12	32	97				
OR2W3	343171	broad.mit.edu	37	1	248058896	248058896	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:248058896G>A	ENST00000360358.3	+	1	8	c.8G>A	c.(7-9)gGa>gAa	p.G3E	OR2W3_ENST00000537741.1_Missense_Mutation_p.G3E	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGATGGATGGAACCAATGGC	0.433																																						uc001idp.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(7-9)GGA>GAA		olfactory receptor, family 2, subfamily W,							61.0	56.0	58.0					1																	248058896		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248058896G>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.8G>A	1.37:g.248058896G>A	ENSP00000353516:p.Gly3Glu		Somatic				OR2W3_uc010pzb.1_Missense_Mutation_p.G3E	p.G3E	NM_001001957	NP_001001957	WXS	Illumina HiSeq	Unspecified	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	277	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		3			Extracellular (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.8G>A	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	G	0.682	-0.797698	0.02862	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.02916	4.11;4.11	5.19	3.24	0.37175	.	0.482598	0.19235	N	0.119319	T	0.01387	0.0045	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.46162	-0.9211	10	0.02654	T	1	.	14.1802	0.65568	0.0:0.2968:0.7032:0.0	.	3	Q7Z3T1	OR2W3_HUMAN	E	3	ENSP00000445853:G3E;ENSP00000353516:G3E	ENSP00000353516:G3E	G	+	2	0	OR2W3	246125519	0.002000	0.14202	0.002000	0.10522	0.002000	0.02628	1.242000	0.32755	0.706000	0.31912	0.609000	0.83330	GGA		0.433	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		6	24	0	0	0	0	6	24				
PTCHD3	374308	broad.mit.edu	37	10	27703080	27703080	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr10:27703080G>A	ENST00000438700.3	-	1	217	c.100C>T	c.(100-102)Cag>Tag	p.Q34*		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	34					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TCCGATTCCTGAGATTCCTGG	0.682																																						uc001itu.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(100-102)CAG>TAG		patched domain containing 3							63.0	79.0	73.0					10																	27703080		2203	4300	6503	SO:0001587	stop_gained	374308				spermatid development	integral to membrane	hedgehog receptor activity	g.chr10:27703080G>A	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.100C>T	10.37:g.27703080G>A	ENSP00000417658:p.Gln34*		Somatic					p.Q34*	NM_001034842	NP_001030014	WXS	Illumina HiSeq	Unspecified	Q3KNS1	PTHD3_HUMAN			1	218	-			34					I3L499|Q6ZU28	Nonsense_Mutation	SNP	ENST00000438700.3	37	c.100C>T	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.293025	0.40594	.	.	ENSG00000182077	ENST00000438700	.	.	.	1.8	-3.61	0.04556	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	0.9728	0.01420	0.2261:0.2371:0.3556:0.1813	.	.	.	.	X	34	.	ENSP00000417658:Q34X	Q	-	1	0	PTCHD3	27743086	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.467000	0.06664	-2.830000	0.00339	-1.860000	0.00561	CAG		0.682	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541		19	112	0	0	0	0	19	112				
AGAP6	414189	broad.mit.edu	37	10	51748544	51748544	+	Silent	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr10:51748544G>T	ENST00000374056.4	+	1	467	c.69G>T	c.(67-69)tcG>tcT	p.S23S	AGAP6_ENST00000412531.3_Silent_p.S23S			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	23					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						AGCAGGGGTCGGTGTGTCCCT	0.607																																						uc001jix.3		NA																	0				skin(1)	1						c.(67-69)TCG>TCT		ArfGAP with GTPase domain, ankyrin repeat and PH																																				SO:0001819	synonymous_variant	414189				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:51748544G>T		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.69G>T	10.37:g.51748544G>T			Somatic					p.S23S	NM_001077665	NP_001071133	WXS	Illumina HiSeq	Unspecified	Q5VW22	AGAP6_HUMAN			1	467	+			23						Silent	SNP	ENST00000374056.4	37	c.69G>T																																																																																					0.607	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665		30	38	1	0	2.08e-15	2.86e-15	30	38				
GRID1	2894	broad.mit.edu	37	10	87482808	87482808	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr10:87482808G>T	ENST00000327946.7	-	12	2034	c.1949C>A	c.(1948-1950)gCc>gAc	p.A650D	GRID1_ENST00000536331.1_Missense_Mutation_p.A221D	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	650					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AGCAAGGTTGGCTGTGTAGGA	0.562										Multiple Myeloma(13;0.14)																												uc001kdl.1		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(1948-1950)GCC>GAC		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						118.0	87.0	97.0					10																	87482808		2203	4300	6503	SO:0001583	missense	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87482808G>T	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1949C>A	10.37:g.87482808G>T	ENSP00000330148:p.Ala650Asp	Multiple Myeloma(13;0.14)	Somatic				GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.A221D	p.A650D	NM_017551	NP_060021	WXS	Illumina HiSeq	Unspecified	Q9ULK0	GRID1_HUMAN			12	2050	-			650			Helical; (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	c.1949C>A	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	31	5.074272	0.94000	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.74737	-0.87;-0.87	5.95	5.95	0.96441	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.134244	0.64402	D	0.000002	D	0.91257	0.7244	H	0.96365	3.81	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.93199	0.6590	10	0.87932	D	0	.	19.3527	0.94395	0.0:0.0:1.0:0.0	.	650	Q9ULK0	GRID1_HUMAN	D	650;221	ENSP00000330148:A650D;ENSP00000444455:A221D	ENSP00000330148:A650D	A	-	2	0	GRID1	87472788	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	9.771000	0.98977	2.821000	0.97095	0.561000	0.74099	GCC		0.562	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		7	21	1	0	8.13e-05	9.23e-05	7	21				
HPSE2	60495	broad.mit.edu	37	10	100904156	100904156	+	Splice_Site	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr10:100904156T>A	ENST00000370552.3	-	3	508	c.449A>T	c.(448-450)gAc>gTc	p.D150V	HPSE2_ENST00000404542.1_Intron|HPSE2_ENST00000370549.1_Splice_Site_p.D150V|HPSE2_ENST00000370546.1_Splice_Site_p.D150V	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	150					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TCGAACAATGTCTACAAAAAG	0.388																																						uc001kpn.1		NA																	0				ovary(1)	1						c.(448-450)GAC>GTC		heparanase 2							71.0	74.0	73.0					10																	100904156		2203	4300	6503	SO:0001630	splice_region_variant	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100904156T>A	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.449-1A>T	10.37:g.100904156T>A			Somatic				HPSE2_uc009xwc.1_Missense_Mutation_p.D140V|HPSE2_uc001kpo.1_Missense_Mutation_p.D140V|HPSE2_uc009xwd.1_Intron	p.D150V	NM_021828	NP_068600	WXS	Illumina HiSeq	Unspecified	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	3	509	-			150					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	c.449A>T	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.348951	0.61183	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546	T;T;T	0.52057	0.68;1.31;1.21	5.81	5.81	0.92471	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50701	0.1631	M	0.66939	2.045	0.80722	D	1	P;B;P	0.44429	0.835;0.447;0.535	B;B;B	0.41088	0.347;0.147;0.188	T	0.56475	-0.7973	10	0.56958	D	0.05	.	16.1498	0.81605	0.0:0.0:0.0:1.0	.	150;150;150	Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;HPSE2_HUMAN	V	150	ENSP00000359583:D150V;ENSP00000359580:D150V;ENSP00000359577:D150V	ENSP00000359577:D150V	D	-	2	0	HPSE2	100894146	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.552000	0.82192	2.216000	0.71823	0.528000	0.53228	GAC		0.388	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	Missense_Mutation	12	58	0	0	0	0	12	58				
WNT8B	7479	broad.mit.edu	37	10	102239717	102239717	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr10:102239717G>C	ENST00000343737.5	+	3	317	c.189G>C	c.(187-189)tgG>tgC	p.W63C		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	63					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		GGGACCGCTGGAACTGCCCTG	0.557																																						uc001krb.2		NA																	0				ovary(1)|breast(1)|large_intestine(1)|skin(1)	4						c.(187-189)TGG>TGC		wingless-type MMTV integration site family,							79.0	73.0	75.0					10																	102239717		2203	4300	6503	SO:0001583	missense	7479				anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|determination of dorsal identity|endoderm development|eye development|gastrulation|hypothalamus development|negative regulation of anterior neural cell fate commitment of the neural plate by Wnt receptor signaling pathway|otic placode formation|positive regulation of gene expression|response to estradiol stimulus|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity	g.chr10:102239717G>C	X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.189G>C	10.37:g.102239717G>C	ENSP00000340677:p.Trp63Cys		Somatic					p.W63C	NM_003393	NP_003384	WXS	Illumina HiSeq	Unspecified	Q93098	WNT8B_HUMAN		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)	3	303	+		Colorectal(252;0.117)	63					O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	ENST00000343737.5	37	c.189G>C	CCDS7494.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404227	0.42613	.	.	ENSG00000075290	ENST00000343737	D	0.92446	-3.04	5.54	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.97720	0.9252	H	0.98333	4.205	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99211	1.0876	10	0.87932	D	0	.	15.7601	0.78073	0.0:0.0:0.8625:0.1375	.	63	Q93098	WNT8B_HUMAN	C	63	ENSP00000340677:W63C	ENSP00000340677:W63C	W	+	3	0	WNT8B	102229707	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	9.476000	0.97823	1.323000	0.45263	-0.324000	0.08512	TGG		0.557	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049867.1	NM_003393		16	29	0	0	0	0	16	29				
NLRP6	171389	broad.mit.edu	37	11	284380	284380	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:284380G>C	ENST00000312165.5	+	6	2352	c.2352G>C	c.(2350-2352)caG>caC	p.Q784H	RP11-326C3.2_ENST00000533924.1_RNA|NLRP6_ENST00000534750.1_Missense_Mutation_p.Q783H	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	784					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTGGCCGCAGTGCAGGGTGC	0.701																																						uc010qvs.1		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(2350-2352)CAG>CAC		NLR family, pyrin domain containing 6							32.0	35.0	34.0					11																	284380		2203	4300	6503	SO:0001583	missense	171389					cytoplasm	ATP binding	g.chr11:284380G>C	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.2352G>C	11.37:g.284380G>C	ENSP00000309767:p.Gln784His		Somatic				NLRP6_uc010qvt.1_Missense_Mutation_p.Q783H	p.Q784H	NM_138329	NP_612202	WXS	Illumina HiSeq	Unspecified	P59044	NALP6_HUMAN		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)	6	2352	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	784					A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	c.2352G>C	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	G	5.872	0.345070	0.11126	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.52526	0.66;0.66	3.06	2.11	0.27256	.	1.284280	0.06013	N	0.649892	T	0.35653	0.0939	N	0.25647	0.755	0.09310	N	1	B;B	0.28512	0.014;0.214	B;B	0.28784	0.018;0.094	T	0.28933	-1.0028	10	0.30078	T	0.28	.	8.4489	0.32858	0.1259:0.0:0.8741:0.0	.	783;784	E9PJZ8;P59044	.;NALP6_HUMAN	H	783;784	ENSP00000433617:Q783H;ENSP00000309767:Q784H	ENSP00000309767:Q784H	Q	+	3	2	NLRP6	274380	0.029000	0.19370	0.967000	0.41034	0.336000	0.28762	-0.010000	0.12743	0.600000	0.29862	0.456000	0.33151	CAG		0.701	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329		11	17	0	0	0	0	11	17				
OR10A3	26496	broad.mit.edu	37	11	7960207	7960207	+	Silent	SNP	C	C	T	rs200152269		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:7960207C>T	ENST00000360759.3	-	1	934	c.861G>A	c.(859-861)ccG>ccA	p.P287P		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	287					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TATAGATGAGCGGATTGAGCA	0.413																																						uc010rbi.1		NA																	0				pancreas(1)	1						c.(859-861)CCG>CCA		olfactory receptor, family 10, subfamily A,		C		0,4402		0,0,2201	163.0	151.0	155.0		861	-2.5	0.5	11		155	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	OR10A3	NM_001003745.1		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		287/315	7960207	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	26496				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:7960207C>T	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.861G>A	11.37:g.7960207C>T			Somatic					p.P287P	NM_001003745	NP_001003745	WXS	Illumina HiSeq	Unspecified	P58181	O10A3_HUMAN		Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	1	861	-			287			Helical; Name=7; (Potential).		B9EH39|Q6IF58|Q96R11	Silent	SNP	ENST00000360759.3	37	c.861G>A	CCDS31421.1																																																																																				0.413	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745		19	42	0	0	0	0	19	42				
MRGPRX3	117195	broad.mit.edu	37	11	18159486	18159486	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:18159486G>C	ENST00000396275.2	+	3	1098	c.737G>C	c.(736-738)tGg>tCg	p.W246S		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CACCTGGATTGGAAAGTCTTA	0.507																																						uc001mnu.2		NA																	0				ovary(1)|pancreas(1)	2						c.(736-738)TGG>TCG		MAS-related GPR, member X3							108.0	105.0	106.0					11																	18159486		2200	4293	6493	SO:0001583	missense	117195					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:18159486G>C		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.737G>C	11.37:g.18159486G>C	ENSP00000379571:p.Trp246Ser		Somatic					p.W246S	NM_054031	NP_473372	WXS	Illumina HiSeq	Unspecified	Q96LB0	MRGX3_HUMAN			3	1098	+			246			Extracellular (Potential).		B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	37	c.737G>C	CCDS7830.1	.	.	.	.	.	.	.	.	.	.	G	2.145	-0.395789	0.04899	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.70516	-0.49;4.4	1.12	-2.24	0.06909	GPCR, rhodopsin-like superfamily (1);	3.955300	0.00397	N	0.000042	T	0.41627	0.1167	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14062	-1.0486	10	0.18710	T	0.47	.	0.3422	0.00335	0.2088:0.1671:0.2131:0.411	.	246	Q96LB0	MRGX3_HUMAN	S	246	ENSP00000379571:W246S;ENSP00000436242:W246S	ENSP00000379571:W246S	W	+	2	0	MRGPRX3	18116062	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.543000	0.00934	-1.594000	0.01615	-0.838000	0.03060	TGG		0.507	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031		5	52	0	0	0	0	5	52				
OR5F1	338674	broad.mit.edu	37	11	55761981	55761981	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:55761981C>T	ENST00000278409.1	-	1	120	c.121G>A	c.(121-123)Gga>Aga	p.G41R		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	41					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					CCGAGATTTCCCAGTACTGTA	0.433																																						uc010riv.1		NA																	0				ovary(1)|pancreas(1)	2						c.(121-123)GGA>AGA		olfactory receptor, family 5, subfamily F,							58.0	55.0	56.0					11																	55761981		2201	4296	6497	SO:0001583	missense	338674				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55761981C>T	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.121G>A	11.37:g.55761981C>T	ENSP00000278409:p.Gly41Arg		Somatic					p.G41R	NM_003697	NP_003688	WXS	Illumina HiSeq	Unspecified	O95221	OR5F1_HUMAN			1	121	-	Esophageal squamous(21;0.00448)		41			Helical; Name=1; (Potential).		Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	c.121G>A	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432050	0.43122	.	.	ENSG00000149133	ENST00000278409	T	0.04406	3.63	3.03	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.25680	0.0625	M	0.93062	3.375	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04522	-1.0945	9	0.87932	D	0	.	8.9992	0.36072	0.0:0.8811:0.0:0.1189	.	41	O95221	OR5F1_HUMAN	R	41	ENSP00000278409:G41R	ENSP00000278409:G41R	G	-	1	0	OR5F1	55518557	0.001000	0.12720	0.008000	0.14137	0.106000	0.19336	1.514000	0.35834	0.391000	0.25143	0.297000	0.19635	GGA		0.433	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697		17	42	0	0	0	0	17	42				
OR9G4	283189	broad.mit.edu	37	11	56510760	56510760	+	Silent	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:56510760G>A	ENST00000302957.3	-	1	527	c.528C>T	c.(526-528)gcC>gcT	p.A176A		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GGAATGTATTGGCAGTATGGG	0.448																																						uc010rjo.1		NA																	0				ovary(2)|skin(1)	3						c.(526-528)GCC>GCT		olfactory receptor, family 9, subfamily G,							75.0	77.0	76.0					11																	56510760		2201	4296	6497	SO:0001819	synonymous_variant	283189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56510760G>A	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.528C>T	11.37:g.56510760G>A			Somatic					p.A176A	NM_001005284	NP_001005284	WXS	Illumina HiSeq	Unspecified	Q8NGQ1	OR9G4_HUMAN			1	528	-			176			Extracellular (Potential).		Q6IF62|Q96RA9	Silent	SNP	ENST00000302957.3	37	c.528C>T	CCDS31537.1																																																																																				0.448	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284		27	66	0	0	0	0	27	66				
GLYATL1	92292	broad.mit.edu	37	11	58715400	58715400	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:58715400C>A	ENST00000317391.4	+	5	488	c.148C>A	c.(148-150)Cct>Act	p.P50T	GLYATL1_ENST00000300079.5_Missense_Mutation_p.P81T|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	50						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	GGATTCCTGGCCTGAATATCA	0.547																																						uc001nnf.2		NA																	0				ovary(1)	1						c.(148-150)CCT>ACT		SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	Glycine(DB00145)						143.0	117.0	126.0					11																	58715400		2201	4295	6496	SO:0001583	missense	92292					mitochondrion	glycine N-acyltransferase activity	g.chr11:58715400C>A	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.148C>A	11.37:g.58715400C>A	ENSP00000322223:p.Pro50Thr		Somatic				uc001nng.1_Intron|GLYATL1_uc001nnh.1_Missense_Mutation_p.P81T|GLYATL1_uc001nni.1_Missense_Mutation_p.P50T|GLYATL1_uc001nnj.1_Missense_Mutation_p.P50T	p.P50T			WXS	Illumina HiSeq	Unspecified	Q969I3	GLYL1_HUMAN			5	524	+			50					A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	37	c.148C>A	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	13.70	2.315498	0.40996	.	.	ENSG00000166840	ENST00000525608;ENST00000526351;ENST00000444580;ENST00000317391;ENST00000532726;ENST00000300079	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	3.4	2.44	0.29823	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	0.000000	0.56097	U	0.000037	T	0.57431	0.2053	M	0.83774	2.66	0.23704	N	0.997068	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.48007	-0.9072	10	0.87932	D	0	.	7.5071	0.27551	0.2566:0.7434:0.0:0.0	.	81;50	Q969I3-2;Q969I3	.;GLYL1_HUMAN	T	50;73;50;50;50;81	ENSP00000433716:P50T;ENSP00000434652:P73T;ENSP00000322223:P50T;ENSP00000436116:P50T;ENSP00000300079:P81T	ENSP00000300079:P81T	P	+	1	0	GLYATL1	58471976	0.996000	0.38824	0.156000	0.22583	0.006000	0.05464	1.225000	0.32551	0.549000	0.28973	0.411000	0.27672	CCT		0.547	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661		12	49	1	0	1.58e-08	1.97e-08	12	49				
MRGPRF	116535	broad.mit.edu	37	11	68777336	68777336	+	Missense_Mutation	SNP	C	C	T	rs143408398	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:68777336C>T	ENST00000309099.6	-	2	416	c.34G>A	c.(34-36)Ggc>Agc	p.G12S	RP11-554A11.6_ENST00000569432.1_RNA|RP11-554A11.6_ENST00000538407.2_RNA|MRGPRF_ENST00000320913.6_Missense_Mutation_p.G12S|MRGPRF_ENST00000441623.1_Missense_Mutation_p.G12S|RP11-554A11.6_ENST00000569428.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	12						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TTCCTGTTGCCGGGATGGGCC	0.672													C|||	3	0.000599042	0.0023	0.0	5008	,	,		16544	0.0		0.0	False		,,,				2504	0.0					uc001ooo.3		NA																	0					0						c.(34-36)GGC>AGC		MAS-related GPR, member F		C	SER/GLY,SER/GLY	1,4399	2.1+/-5.4	0,1,2199	78.0	70.0	73.0		34,34	-6.6	0.0	11	dbSNP_134	73	0,8588		0,0,4294	no	missense,missense	MRGPRF	NM_001098515.1,NM_145015.4	56,56	0,1,6493	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	12/344,12/344	68777336	1,12987	2200	4294	6494	SO:0001583	missense	116535					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr11:68777336C>T	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.34G>A	11.37:g.68777336C>T	ENSP00000309782:p.Gly12Ser		Somatic				MRGPRF_uc001oop.3_Missense_Mutation_p.G12S|uc001ooq.2_5'Flank	p.G12S	NM_001098515	NP_001091985	WXS	Illumina HiSeq	Unspecified	Q96AM1	MRGRF_HUMAN	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		2	401	-			12			Extracellular (Potential).		B3KV43|Q8NBK8	Missense_Mutation	SNP	ENST00000309099.6	37	c.34G>A	CCDS8188.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829514	0.32329	2.27E-4	0.0	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543;ENST00000320913	T;T;T	0.61392	3.55;3.55;0.11	3.29	-6.58	0.01836	.	2.879980	0.01212	N	0.007865	T	0.26484	0.0647	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39901	-0.9591	10	0.02654	T	1	-10.9957	2.8033	0.05420	0.1343:0.4105:0.2711:0.1841	.	12	Q96AM1	MRGRF_HUMAN	S	12	ENSP00000403660:G12S;ENSP00000309782:G12S;ENSP00000323414:G12S	ENSP00000309782:G12S	G	-	1	0	MRGPRF	68533912	0.000000	0.05858	0.000000	0.03702	0.518000	0.34316	-0.590000	0.05760	-1.756000	0.01318	-0.696000	0.03686	GGC		0.672	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396875.1	NM_145015		6	85	0	0	0	0	6	85				
DLG2	1740	broad.mit.edu	37	11	83770475	83770475	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:83770475G>A	ENST00000532653.1	-	6	789	c.487C>T	c.(487-489)Cac>Tac	p.H163Y	DLG2_ENST00000537455.1_5'UTR|DLG2_ENST00000531015.1_Missense_Mutation_p.H130Y|DLG2_ENST00000330014.6_Missense_Mutation_p.H102Y|DLG2_ENST00000543673.1_Missense_Mutation_p.H268Y|DLG2_ENST00000398309.2_Missense_Mutation_p.H163Y|DLG2_ENST00000398301.2_Missense_Mutation_p.H202Y|DLG2_ENST00000524982.1_Missense_Mutation_p.H163Y|DLG2_ENST00000280241.8_Missense_Mutation_p.H202Y|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000376104.2_Missense_Mutation_p.H268Y|DLG2_ENST00000418306.2_Missense_Mutation_p.H112Y			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GCTTTACTGTGGGAAACCTCT	0.473																																						uc001paj.2		NA																	0				ovary(3)|pancreas(2)|skin(1)	6						c.(487-489)CAC>TAC		chapsyn-110 isoform 2							90.0	82.0	85.0					11																	83770475		1921	4151	6072	SO:0001583	missense	1740					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding	g.chr11:83770475G>A	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.487C>T	11.37:g.83770475G>A	ENSP00000435849:p.His163Tyr		Somatic				DLG2_uc001pai.2_Missense_Mutation_p.H112Y|DLG2_uc010rsy.1_Missense_Mutation_p.H130Y|DLG2_uc010rsz.1_Missense_Mutation_p.H163Y|DLG2_uc010rta.1_Missense_Mutation_p.H163Y|DLG2_uc001pak.2_Missense_Mutation_p.H268Y|DLG2_uc010rtb.1_Missense_Mutation_p.H130Y|DLG2_uc001pal.1_Missense_Mutation_p.H163Y|DLG2_uc001pam.1_Missense_Mutation_p.H202Y	p.H163Y	NM_001364	NP_001355	WXS	Illumina HiSeq	Unspecified	Q15700	DLG2_HUMAN			6	790	-		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)	163			PDZ 1.		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37	c.487C>T		.	.	.	.	.	.	.	.	.	.	G	29.3	4.996219	0.93167	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301;ENST00000398299	T;T;T;T;T;T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08	5.17	5.17	0.71159	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000001	T	0.47746	0.1462	M	0.71920	2.185	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.998;0.998;1.0;0.999	D;D;D;D;D;D;D;D	0.97110	0.998;0.999;1.0;0.999;0.989;0.992;1.0;0.997	T	0.40553	-0.9557	9	.	.	.	.	18.6643	0.91483	0.0:0.0:1.0:0.0	.	130;163;163;102;202;268;163;112	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	Y	163;268;112;268;202;102;163;163;268;130;202;80	ENSP00000381355:H163Y;ENSP00000365272:H268Y;ENSP00000402275:H112Y;ENSP00000441994:H268Y;ENSP00000280241:H202Y;ENSP00000381353:H102Y;ENSP00000432894:H163Y;ENSP00000435849:H163Y;ENSP00000433848:H130Y;ENSP00000381346:H202Y;ENSP00000381344:H80Y	.	H	-	1	0	DLG2	83448123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.420000	0.82092	0.460000	0.39030	CAC		0.473	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364		7	44	0	0	0	0	7	44				
NOX4	50507	broad.mit.edu	37	11	89135493	89135493	+	Splice_Site	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:89135493C>A	ENST00000263317.4	-	9	1085		c.e9+1		NOX4_ENST00000375979.3_Intron|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000424319.1_Splice_Site|NOX4_ENST00000527626.1_Splice_Site|NOX4_ENST00000413594.2_Splice_Site|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000535633.1_Splice_Site|NOX4_ENST00000528341.1_Splice_Site|NOX4_ENST00000343727.5_Splice_Site|NOX4_ENST00000532825.1_Splice_Site|NOX4_ENST00000534731.1_Splice_Site|NOX4_ENST00000527956.1_Splice_Site|NOX4_ENST00000542487.1_Splice_Site			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4						bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ATTAATCTGACCTGTGGAAAA	0.353																																						uc001pct.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.e9+1		NADPH oxidase 4 isoform a							35.0	38.0	37.0					11																	89135493		2200	4295	6495	SO:0001630	splice_region_variant	50507				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity	g.chr11:89135493C>A	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.846+1G>T	11.37:g.89135493C>A			Somatic				NOX4_uc009yvr.2_Splice_Site_p.Q257_splice|NOX4_uc001pcu.2_Splice_Site_p.Q208_splice|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Splice_Site_p.Q282_splice|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Splice_Site_p.Q116_splice|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Splice_Site_p.Q258_splice|NOX4_uc009yvq.2_Splice_Site_p.Q258_splice	p.Q282_splice	NM_016931	NP_058627	WXS	Illumina HiSeq	Unspecified	Q9NPH5	NOX4_HUMAN			9	1085	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)						A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Splice_Site	SNP	ENST00000263317.4	37	c.846_splice	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531733	0.64972	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1262	0.86714	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOX4	88775141	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.879000	0.69690	2.097000	0.63578	0.467000	0.42956	.		0.353	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	Intron	10	46	1	0	0.000673444	0.00073492	10	46				
PDZD3	79849	broad.mit.edu	37	11	119059095	119059095	+	Silent	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:119059095G>T	ENST00000531114.1	+	6	1641	c.1092G>T	c.(1090-1092)ctG>ctT	p.L364L	PDZD3_ENST00000322712.4_Silent_p.L284L|PDZD3_ENST00000525131.1_Silent_p.L285L|PDZD3_ENST00000392817.2_Silent_p.L364L|PDZD3_ENST00000355547.5_Silent_p.L298L			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3	364	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		ACCCGGGACTGCCAGCCAAGA	0.642																																						uc001pwb.2		NA																	0				breast(1)	1						c.(1090-1092)CTG>CTT		RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;							52.0	54.0	54.0					11																	119059095		2200	4295	6495	SO:0001819	synonymous_variant	79849				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding	g.chr11:119059095G>T	AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	ENST00000531114.1:c.1092G>T	11.37:g.119059095G>T			Somatic				PDZD3_uc001pvy.2_Silent_p.L284L|PDZD3_uc001pvz.2_Silent_p.L298L|PDZD3_uc010rzd.1_Silent_p.L285L|PDZD3_uc001pwa.2_5'UTR	p.L364L			WXS	Illumina HiSeq	Unspecified	Q86UT5	NHRF4_HUMAN		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)	6	1616	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)	364			PDZ 3.		Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	Silent	SNP	ENST00000531114.1	37	c.1092G>T																																																																																					0.642	PDZD3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388471.1	NM_024791		13	55	1	0	1.36e-06	1.63e-06	13	55				
TMEM225	338661	broad.mit.edu	37	11	123753941	123753941	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr11:123753941T>C	ENST00000375026.2	-	4	798	c.582A>G	c.(580-582)ccA>ccG	p.P194P		NM_001013743.1	NP_001013765.1	Q6GV28	TM225_HUMAN	transmembrane protein 225	194					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	28						CAGTGCATTCTGGTAATGAAA	0.428																																						uc001pzi.2		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						c.(580-582)CCA>CCG		transmembrane protein 225							154.0	141.0	146.0					11																	123753941		2202	4299	6501	SO:0001819	synonymous_variant	338661					integral to membrane		g.chr11:123753941T>C	AY634366	CCDS31697.1	11q24.1	2014-06-13			ENSG00000204300	ENSG00000204300			32390	protein-coding gene	gene with protein product	"""PMP22 claudin domain containing"", ""protein phosphatase 1, regulatory subunit 154"""						Standard	XM_006718832		Approved	PMP22CD, PPP1R154	uc001pzi.3	Q6GV28	OTTHUMG00000165959	ENST00000375026.2:c.582A>G	11.37:g.123753941T>C			Somatic					p.P194P	NM_001013743	NP_001013765	WXS	Illumina HiSeq	Unspecified	Q6GV28	TM225_HUMAN			4	790	-			194						Silent	SNP	ENST00000375026.2	37	c.582A>G	CCDS31697.1																																																																																				0.428	TMEM225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387260.1	NM_001013743		23	73	0	0	0	0	23	73				
CD163	9332	broad.mit.edu	37	12	7649408	7649408	+	Splice_Site	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:7649408C>G	ENST00000359156.4	-	5	1302		c.e5+1		CD163_ENST00000541972.1_Splice_Site|CD163_ENST00000396620.3_Splice_Site|CD163_ENST00000432237.2_Splice_Site	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule						acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TTTTAACTTACCAGAACATGT	0.413																																						uc001qsz.3		NA																	0				ovary(6)|pancreas(1)|skin(1)	8						c.e5+1		CD163 antigen isoform a							80.0	65.0	70.0					12																	7649408		2203	4300	6503	SO:0001630	splice_region_variant	9332				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity	g.chr12:7649408C>G	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1099+1G>C	12.37:g.7649408C>G			Somatic				CD163_uc001qta.3_Splice_Site_p.D367_splice|CD163_uc009zfw.2_Splice_Site_p.D367_splice	p.D367_splice	NM_004244	NP_004235	WXS	Illumina HiSeq	Unspecified	Q86VB7	C163A_HUMAN			5	1227	-								C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Splice_Site	SNP	ENST00000359156.4	37	c.1099_splice	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.133089	0.56828	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9559	0.64147	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CD163	7540675	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	7.664000	0.83830	2.562000	0.86427	0.561000	0.74099	.		0.413	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	Intron	9	73	0	0	0	0	9	73				
PRH1	5554	broad.mit.edu	37	12	11034867	11034867	+	Silent	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:11034867T>A	ENST00000428168.2	-	4	505	c.468A>T	c.(466-468)ccA>ccT	p.P156P	PRR4_ENST00000536668.1_5'UTR	NM_006250.3	NP_006241.2	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 1	156						extracellular space (GO:0005615)				endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(232;0.245)		GAGGTCCTTGTGGGCGGCCCC	0.572																																						uc001qzc.2		NA																	0					0						c.(466-468)CCA>CCT		proline-rich protein HaeIII subfamily 1							66.0	77.0	73.0					12																	11034867		2203	4298	6501	SO:0001819	synonymous_variant	5554					extracellular space	protein binding	g.chr12:11034867T>A			12p13.2	2013-05-10			ENSG00000231887	ENSG00000231887			9366	protein-coding gene	gene with protein product		168730				3009472	Standard	NM_001291314		Approved	Pa	uc021qvf.1	P02810		ENST00000428168.2:c.468A>T	12.37:g.11034867T>A			Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_RNA|PRB4_uc001qzf.1_Intron	p.P156P	NM_006250	NP_006241	WXS	Illumina HiSeq	Unspecified	P02810	PRPC_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.245)	8	1056	-			156					A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Silent	SNP	ENST00000428168.2	37	c.468A>T																																																																																					0.572	PRH1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006250		32	147	0	0	0	0	32	147				
ATF7IP	55729	broad.mit.edu	37	12	14613818	14613818	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:14613818G>A	ENST00000540793.1	+	8	2703	c.2548G>A	c.(2548-2550)Gtg>Atg	p.V850M	ATF7IP_ENST00000536444.1_Missense_Mutation_p.V849M|ATF7IP_ENST00000261168.4_Missense_Mutation_p.V850M|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.V849M|ATF7IP_ENST00000544627.1_Missense_Mutation_p.V858M			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	850					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CGTTCCTTCTGTGCCCAGTCC	0.478																																						uc001rbw.2		NA																	0				lung(3)|ovary(1)|skin(1)	5						c.(2548-2550)GTG>ATG		activating transcription factor 7 interacting							178.0	151.0	160.0					12																	14613818		2203	4300	6503	SO:0001583	missense	55729				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding	g.chr12:14613818G>A	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2548G>A	12.37:g.14613818G>A	ENSP00000444589:p.Val850Met		Somatic				ATF7IP_uc010shs.1_3'UTR|ATF7IP_uc001rbu.2_Missense_Mutation_p.V850M|ATF7IP_uc001rbv.1_Missense_Mutation_p.V849M|ATF7IP_uc001rbx.2_Missense_Mutation_p.V849M|ATF7IP_uc010sht.1_3'UTR|ATF7IP_uc001rby.3_Missense_Mutation_p.V850M|ATF7IP_uc001rca.2_Missense_Mutation_p.V850M	p.V850M	NM_018179	NP_060649	WXS	Illumina HiSeq	Unspecified	Q6VMQ6	MCAF1_HUMAN			9	2706	+			850					F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	c.2548G>A	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028059	0.35797	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.21543	2.14;2.0;2.14;2.14;2.14	6.16	5.26	0.73747	.	0.192713	0.36303	N	0.002664	T	0.17704	0.0425	L	0.45581	1.43	0.35942	D	0.833295	P;P;P;P	0.37207	0.587;0.587;0.587;0.587	B;B;B;B	0.36464	0.225;0.225;0.225;0.225	T	0.22068	-1.0227	9	.	.	.	-5.392	7.3158	0.26499	0.1329:0.0:0.7258:0.1414	.	849;850;849;461	G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;MCAF1_HUMAN;.;.	M	850;849;849;858;850	ENSP00000261168:V850M;ENSP00000443179:V849M;ENSP00000445955:V849M;ENSP00000440440:V858M;ENSP00000444589:V850M	.	V	+	1	0	ATF7IP	14505085	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.231000	0.51294	1.586000	0.49944	0.650000	0.86243	GTG		0.478	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179		31	113	0	0	0	0	31	113				
PLEKHA5	54477	broad.mit.edu	37	12	19475473	19475473	+	Silent	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:19475473C>T	ENST00000299275.6	+	15	2017	c.2011C>T	c.(2011-2013)Cta>Tta	p.L671L	PLEKHA5_ENST00000539256.1_Silent_p.L429L|PLEKHA5_ENST00000359180.3_Silent_p.L671L|PLEKHA5_ENST00000543806.1_Silent_p.L590L|PLEKHA5_ENST00000538714.1_Silent_p.L729L|PLEKHA5_ENST00000355397.3_Silent_p.L729L|PLEKHA5_ENST00000424268.1_Silent_p.L602L|PLEKHA5_ENST00000317589.4_Silent_p.L671L|PLEKHA5_ENST00000429027.2_Silent_p.L774L	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	671					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GCAAGCTTTGCTATCAGCCAG	0.363																																					Pancreas(196;329 2193 11246 14234 19524)	uc001reb.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(2011-2013)CTA>TTA		pleckstrin homology domain containing, family A							80.0	77.0	78.0					12																	19475473		2203	4300	6503	SO:0001819	synonymous_variant	54477						1-phosphatidylinositol binding|protein binding	g.chr12:19475473C>T	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2011C>T	12.37:g.19475473C>T			Somatic				PLEKHA5_uc010sie.1_Silent_p.L774L|PLEKHA5_uc001rea.2_Silent_p.L729L|PLEKHA5_uc009zin.2_Silent_p.L429L|PLEKHA5_uc010sif.1_Silent_p.L602L|PLEKHA5_uc010sig.1_Silent_p.L590L|PLEKHA5_uc010sih.1_Silent_p.L563L|PLEKHA5_uc001rec.1_Silent_p.L417L|PLEKHA5_uc009zio.2_5'UTR	p.L671L	NM_019012	NP_061885	WXS	Illumina HiSeq	Unspecified	Q9HAU0	PKHA5_HUMAN			15	2097	+	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)		671					A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	ENST00000299275.6	37	c.2011C>T	CCDS8682.1																																																																																				0.363	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012		28	47	0	0	0	0	28	47				
SYT10	341359	broad.mit.edu	37	12	33532866	33532866	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:33532866G>T	ENST00000228567.3	-	6	1697	c.1401C>A	c.(1399-1401)tgC>tgA	p.C467*	SYT10_ENST00000535526.1_Nonsense_Mutation_p.C286*	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	467	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GTCCTGTTCTGCACACTCCTA	0.453																																						uc001rll.1		NA																	0				ovary(1)|skin(1)	2						c.(1399-1401)TGC>TGA		synaptotagmin X							240.0	192.0	208.0					12																	33532866		2203	4300	6503	SO:0001587	stop_gained	341359					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr12:33532866G>T	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.1401C>A	12.37:g.33532866G>T	ENSP00000228567:p.Cys467*		Somatic				SYT10_uc009zju.1_Nonsense_Mutation_p.C277*	p.C467*	NM_198992	NP_945343	WXS	Illumina HiSeq	Unspecified	Q6XYQ8	SYT10_HUMAN			6	1698	-	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)		467			C2 2.|Cytoplasmic (Potential).		Q495U2	Nonsense_Mutation	SNP	ENST00000228567.3	37	c.1401C>A	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	G	37	6.159918	0.97334	.	.	ENSG00000110975	ENST00000228567;ENST00000535526	.	.	.	4.3	-2.72	0.05968	.	0.000000	0.45361	U	0.000368	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7092	0.57080	0.7221:0.0:0.2779:0.0	.	.	.	.	X	467;286	.	ENSP00000228567:C467X	C	-	3	2	SYT10	33424133	1.000000	0.71417	0.017000	0.16124	0.809000	0.45718	1.132000	0.31418	-0.536000	0.06298	-0.142000	0.14014	TGC		0.453	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992		21	98	1	0	1.96e-10	2.51e-10	21	98				
LRRK2	120892	broad.mit.edu	37	12	40734242	40734242	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:40734242C>G	ENST00000298910.7	+	41	6153	c.6095C>G	c.(6094-6096)tCa>tGa	p.S2032*		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2032	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATAAAAACATCAGAGGGCACA	0.443																																						uc001rmg.3		NA																	0				ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24						c.(6094-6096)TCA>TGA		leucine-rich repeat kinase 2							154.0	132.0	139.0					12																	40734242		2203	4300	6503	SO:0001587	stop_gained	120892				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding	g.chr12:40734242C>G	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6095C>G	12.37:g.40734242C>G	ENSP00000298910:p.Ser2032*		Somatic				LRRK2_uc009zjw.2_Nonsense_Mutation_p.S870*|LRRK2_uc001rmi.2_Nonsense_Mutation_p.S865*	p.S2032*	NM_198578	NP_940980	WXS	Illumina HiSeq	Unspecified	Q5S007	LRRK2_HUMAN			41	6216	+	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)	2032			Protein kinase.		A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	ENST00000298910.7	37	c.6095C>G	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	47	13.547061	0.99748	.	.	ENSG00000188906	ENST00000298910	.	.	.	5.69	4.79	0.61399	.	0.108084	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	16.7439	0.85467	0.0:0.8708:0.1292:0.0	.	.	.	.	X	2032	.	ENSP00000298910:S2032X	S	+	2	0	LRRK2	39020509	1.000000	0.71417	0.660000	0.29694	0.975000	0.68041	4.654000	0.61469	1.388000	0.46506	0.650000	0.86243	TCA		0.443	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		17	72	0	0	0	0	17	72				
HOXC6	3223	broad.mit.edu	37	12	54422697	54422697	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:54422697C>T	ENST00000243108.4	+	1	556	c.392C>T	c.(391-393)tCg>tTg	p.S131L	HOXC6_ENST00000394331.3_Missense_Mutation_p.S49L|RP11-834C11.14_ENST00000512206.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|HOXC4_ENST00000303406.4_Intron	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6	131					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGAATGAATTCGCACAGTGGT	0.473																																						uc001sev.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(391-393)TCG>TTG		homeobox C6 isoform 1							67.0	73.0	71.0					12																	54422697		2203	4300	6503	SO:0001583	missense	3223				regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:54422697C>T		CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.392C>T	12.37:g.54422697C>T	ENSP00000243108:p.Ser131Leu		Somatic				HOXC6_uc001ses.2_Missense_Mutation_p.S49L|HOXC5_uc001set.2_Intron|HOXC4_uc001seu.2_Intron	p.S131L	NM_004503	NP_004494	WXS	Illumina HiSeq	Unspecified	P09630	HXC6_HUMAN			1	504	+			131					B2RBV2|Q6DK09	Missense_Mutation	SNP	ENST00000243108.4	37	c.392C>T	CCDS8871.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264208	0.59431	.	.	ENSG00000197757	ENST00000504315;ENST00000509328;ENST00000394331;ENST00000243108	D;D	0.95588	-3.75;-3.75	5.26	3.42	0.39159	Homeodomain-related (1);	0.130518	0.53938	D	0.000050	D	0.93403	0.7896	M	0.89414	3.03	0.80722	D	1	P	0.38335	0.627	B	0.27170	0.077	D	0.90338	0.4357	10	0.11485	T	0.65	.	11.4068	0.49902	0.1423:0.7209:0.1368:0.0	.	131	P09630	HXC6_HUMAN	L	49;49;49;131	ENSP00000377864:S49L;ENSP00000243108:S131L	ENSP00000243108:S131L	S	+	2	0	HOXC6	52708964	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.238000	0.78173	0.772000	0.33382	0.655000	0.94253	TCG		0.473	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358943.2			4	79	0	0	0	0	4	79				
NXPH4	11247	broad.mit.edu	37	12	57619381	57619381	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:57619381G>A	ENST00000349394.5	+	2	953	c.778G>A	c.(778-780)Gag>Aag	p.E260K	Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	260	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						GTGCTTCACCGAGCACACGCA	0.567																																						uc010srf.1		NA																	0					0						c.(778-780)GAG>AAG		neurexophilin 4 precursor							53.0	56.0	55.0					12																	57619381		2203	4300	6503	SO:0001583	missense	11247				neuropeptide signaling pathway	extracellular region		g.chr12:57619381G>A	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.778G>A	12.37:g.57619381G>A	ENSP00000333593:p.Glu260Lys		Somatic				NXPH4_uc009zpj.2_Missense_Mutation_p.E66K	p.E260K	NM_007224	NP_009155	WXS	Illumina HiSeq	Unspecified	O95158	NXPH4_HUMAN			2	953	+			260			V (Cys-rich).		A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	ENST00000349394.5	37	c.778G>A	CCDS8933.1	.	.	.	.	.	.	.	.	.	.	G	32	5.172087	0.94807	.	.	ENSG00000182379	ENST00000349394	.	.	.	3.92	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.73393	0.3581	L	0.52011	1.625	0.58432	D	0.999999	D	0.76494	0.999	D	0.81914	0.995	T	0.77242	-0.2660	9	0.87932	D	0	-18.8431	14.8376	0.70194	0.0:0.0:1.0:0.0	.	260	O95158	NXPH4_HUMAN	K	260	.	ENSP00000333593:E260K	E	+	1	0	NXPH4	55905648	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	9.354000	0.97083	2.004000	0.58718	0.462000	0.41574	GAG		0.567	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224		16	24	0	0	0	0	16	24				
ALX1	8092	broad.mit.edu	37	12	85680630	85680630	+	Splice_Site	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:85680630G>C	ENST00000316824.3	+	3	686		c.e3-1			NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1						anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		taaataattaGGTTTGGTTTC	0.318																																						uc001tae.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.e3-1		cartilage paired-class homeoprotein 1							32.0	30.0	31.0					12																	85680630		2201	4297	6498	SO:0001630	splice_region_variant	8092				brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:85680630G>C	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.532-1G>C	12.37:g.85680630G>C			Somatic					p.V178_splice	NM_006982	NP_008913	WXS	Illumina HiSeq	Unspecified	Q15699	ALX1_HUMAN		GBM - Glioblastoma multiforme(134;0.134)	3	536	+								Q546C8|Q96FH4	Splice_Site	SNP	ENST00000316824.3	37	c.532_splice	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427953	0.83667	.	.	ENSG00000180318	ENST00000316824	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2245	0.98337	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALX1	84204761	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.864000	0.99589	2.770000	0.95276	0.650000	0.86243	.		0.318	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	Intron	4	13	0	0	0	0	4	13				
KIAA1033	23325	broad.mit.edu	37	12	105515902	105515902	+	Silent	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:105515902G>A	ENST00000332180.5	+	10	759	c.672G>A	c.(670-672)ctG>ctA	p.L224L		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						CAAGGTTACTGAAATCTGTCC	0.279																																						uc001tld.2		NA																	0				kidney(1)|central_nervous_system(1)	2						c.(670-672)CTG>CTA		hypothetical protein LOC23325							58.0	54.0	55.0					12																	105515902		1783	4059	5842	SO:0001819	synonymous_variant	23325				endosome transport	WASH complex		g.chr12:105515902G>A	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.672G>A	12.37:g.105515902G>A			Somatic				KIAA1033_uc010swr.1_Silent_p.L224L|KIAA1033_uc010sws.1_Silent_p.L36L	p.L224L	NM_015275	NP_056090	WXS	Illumina HiSeq	Unspecified	Q2M389	WAHS7_HUMAN			10	759	+			224						Silent	SNP	ENST00000332180.5	37	c.672G>A	CCDS41826.1																																																																																				0.279	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275		7	64	0	0	0	0	7	64				
ISCU	23479	broad.mit.edu	37	12	108959132	108959132	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr12:108959132T>C	ENST00000311893.9	+	3	286	c.264T>C	c.(262-264)gcT>gcC	p.A88A	ISCU_ENST00000539593.1_Silent_p.A88A|ISCU_ENST00000338291.4_Silent_p.A63A|ISCU_ENST00000431221.2_Silent_p.A88A|ISCU_ENST00000535729.1_Silent_p.A88A|ISCU_ENST00000392807.4_Silent_p.A63A|ISCU_ENST00000547005.1_Silent_p.A88A	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	88					iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)			kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						TTGTGGATGCTAGGTTTAAAA	0.473																																						uc010sxc.1		NA																	0					0						c.(262-264)GCT>GCC		iron-sulfur cluster assembly enzyme isoform							143.0	140.0	141.0					12																	108959132		2203	4300	6503	SO:0001819	synonymous_variant	23479				iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold	g.chr12:108959132T>C	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.264T>C	12.37:g.108959132T>C			Somatic				ISCU_uc010sxa.1_Silent_p.A88A|ISCU_uc010sxb.1_Silent_p.A88A|ISCU_uc001tnc.3_Silent_p.A63A|ISCU_uc009zuy.2_Silent_p.A63A|ISCU_uc010sxd.1_Silent_p.A88A	p.A88A	NM_213595	NP_998760	WXS	Illumina HiSeq	Unspecified	Q9H1K1	ISCU_HUMAN			3	369	+			88					Q6P713|Q99617|Q9H1K2	Silent	SNP	ENST00000311893.9	37	c.264T>C	CCDS44966.1																																																																																				0.473	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301		5	48	0	0	0	0	5	48				
ERCC5	2073	broad.mit.edu	37	13	103520608	103520608	+	Splice_Site	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr13:103520608G>C	ENST00000355739.4	+	12	4101		c.e12+1		ERCC5_ENST00000375954.1_Splice_Site|BIVM-ERCC5_ENST00000602836.1_Splice_Site	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5						DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TAAAATTCTCGTAAGGTCTTT	0.373			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													uc001vpw.2		NA	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""			E		skin basal cell|skin squamous cell|melanoma			0				ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						c.e12+1	Direct_reversal_of_damage|NER	XPG-complementing protein							62.0	67.0	65.0					13																	103520608		2203	4300	6503	SO:0001630	splice_region_variant	2073	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding	g.chr13:103520608G>C	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2678+1G>C	13.37:g.103520608G>C			Somatic				ERCC5_uc001vpu.1_Splice_Site_p.S1347_splice|ERCC5_uc010tjc.1_Splice_Site|ERCC5_uc010tjd.1_Splice_Site_p.S725_splice	p.S893_splice	NM_000123	NP_000114	WXS	Illumina HiSeq	Unspecified	P28715	ERCC5_HUMAN			12	3121	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)							A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Splice_Site	SNP	ENST00000355739.4	37	c.2678_splice	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873196	0.72180	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6425	0.88140	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERCC5	102318609	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.552000	0.90682	2.185000	0.69588	0.491000	0.48974	.		0.373	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		Intron	3	44	0	0	0	0	3	44				
MYO16	23026	broad.mit.edu	37	13	109779811	109779811	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr13:109779811C>A	ENST00000357550.2	+	30	3939	c.3898C>A	c.(3898-3900)Cca>Aca	p.P1300T	MYO16_ENST00000457511.2_Missense_Mutation_p.P812T|MYO16_ENST00000356711.2_Missense_Mutation_p.P1300T	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCGCCCAAGCCAAAGAGGGA	0.657																																						uc001vqt.1		NA																	0				ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(3898-3900)CCA>ACA		myosin heavy chain Myr 8							32.0	35.0	34.0					13																	109779811		2203	4300	6503	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109779811C>A		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3898C>A	13.37:g.109779811C>A	ENSP00000350160:p.Pro1300Thr		Somatic				MYO16_uc010agk.1_Missense_Mutation_p.P1322T|MYO16_uc010tjh.1_Missense_Mutation_p.P812T	p.P1300T	NM_015011	NP_055826	WXS	Illumina HiSeq	Unspecified	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		31	4024	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		1300						Missense_Mutation	SNP	ENST00000357550.2	37	c.3898C>A	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324133	0.81580	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	T;T;T	0.78364	-1.17;-1.17;-1.17	5.5	5.5	0.81552	.	0.000000	0.40469	U	0.001097	D	0.88782	0.6530	M	0.80982	2.52	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.88776	0.3267	9	.	.	.	.	18.4132	0.90559	0.0:1.0:0.0:0.0	.	812;1300	F8W883;Q9Y6X6	.;MYO16_HUMAN	T	1300;1300;812	ENSP00000349145:P1300T;ENSP00000350160:P1300T;ENSP00000401633:P812T	.	P	+	1	0	MYO16	108577812	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.969000	0.76092	2.584000	0.87258	0.563000	0.77884	CCA		0.657	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		10	13	1	0	2.18e-05	2.52e-05	10	13				
G2E3	55632	broad.mit.edu	37	14	31071100	31071100	+	Splice_Site	SNP	G	G	T	rs60676717		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr14:31071100G>T	ENST00000206595.6	+	9	1031	c.877G>T	c.(877-879)Gga>Tga	p.G293*	G2E3_ENST00000438909.2_Splice_Site_p.G247*|G2E3_ENST00000553504.1_Splice_Site_p.G323*|G2E3_ENST00000544007.1_3'UTR	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	293					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						CTACAATTCAGGTAATTTTTT	0.318																																						uc001wqk.2		NA																	0				ovary(2)|skin(1)	3						c.(877-879)GGA>TGA		G2/M-phase specific E3 ubiquitin ligase							66.0	65.0	65.0					14																	31071100		2203	4300	6503	SO:0001630	splice_region_variant	55632				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding	g.chr14:31071100G>T	AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.877+1G>T	14.37:g.31071100G>T			Somatic				G2E3_uc010tpe.1_Nonsense_Mutation_p.G208*|G2E3_uc010tpf.1_Nonsense_Mutation_p.G247*	p.G293*	NM_017769	NP_060239	WXS	Illumina HiSeq	Unspecified	Q7L622	G2E3_HUMAN			9	1031	+			293					Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Nonsense_Mutation	SNP	ENST00000206595.6	37	c.877G>T	CCDS9638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	16.776407|16.776407	0.99871|0.99871	.|.	.|.	ENSG00000092140|ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504|ENST00000552515	.|.	.|.	.|.	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	0.320888|.	0.32204|.	N|.	0.006421|.	.|T	.|0.76528	.|0.4000	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74103	.|-0.3773	.|3	0.48119|.	T|.	0.1|.	-3.3986|-3.3986	19.2068|19.2068	0.93734|0.93734	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|M	293;247;323|58	.|.	ENSP00000206595:G293X|.	G|R	+|+	1|2	0|0	G2E3|G2E3	30140851|30140851	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	5.407000|5.407000	0.66363|0.66363	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GGA|AGG		0.318	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	Nonsense_Mutation	30	30	1	0	3.18e-06	3.77e-06	30	30				
DACT1	51339	broad.mit.edu	37	14	59105250	59105250	+	Silent	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr14:59105250G>T	ENST00000335867.4	+	1	354	c.330G>T	c.(328-330)ctG>ctT	p.L110L	DACT1_ENST00000541264.2_5'Flank|DACT1_ENST00000556859.1_Intron|DACT1_ENST00000395153.3_Silent_p.L110L|DACT1_ENST00000555845.1_Intron			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	110	Required for self-association. {ECO:0000250}.				dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						ACATCTTGCTGCTAAGAAAGC	0.687																																						uc001xdw.2		NA																	0				large_intestine(2)|lung(2)|ovary(1)	5						c.(328-330)CTG>CTT		dapper 1 isoform 1							31.0	33.0	32.0					14																	59105250		1969	4141	6110	SO:0001819	synonymous_variant	51339				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus		g.chr14:59105250G>T	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.330G>T	14.37:g.59105250G>T			Somatic				DACT1_uc010trv.1_Intron|DACT1_uc001xdx.2_Silent_p.L110L|DACT1_uc010trw.1_5'Flank	p.L110L	NM_016651	NP_057735	WXS	Illumina HiSeq	Unspecified	Q9NYF0	DACT1_HUMAN			1	494	+			110			Potential.		A8MYJ2|Q86TY0	Silent	SNP	ENST00000335867.4	37	c.330G>T	CCDS9736.1																																																																																				0.687	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651		5	10	1	0	5.94e-07	7.17e-07	5	10				
GALNT16	57452	broad.mit.edu	37	14	69808451	69808451	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr14:69808451G>A	ENST00000337827.4	+	12	1568	c.1241G>A	c.(1240-1242)tGg>tAg	p.W414*	GALNT16_ENST00000553669.1_Nonsense_Mutation_p.W414*|GALNT16_ENST00000448469.3_Nonsense_Mutation_p.W414*	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	414					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										TCCTTCCGCTGGTACCTGGAG	0.612																																						uc010aqu.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1240-1242)TGG>TAG		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							86.0	57.0	67.0					14																	69808451		2203	4300	6503	SO:0001587	stop_gained	57452					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr14:69808451G>A	AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.1241G>A	14.37:g.69808451G>A	ENSP00000336729:p.Trp414*		Somatic				GALNTL1_uc001xla.1_Nonsense_Mutation_p.W414*|GALNTL1_uc001xlb.1_Nonsense_Mutation_p.W414*	p.W414*	NM_020692	NP_065743	WXS	Illumina HiSeq	Unspecified	Q8N428	GLTL1_HUMAN		all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)	12	1334	+			414			Lumenal (Potential).		Q4KMG3|Q58A55|Q9ULT9	Nonsense_Mutation	SNP	ENST00000337827.4	37	c.1241G>A	CCDS32107.1	.	.	.	.	.	.	.	.	.	.	G	38	7.280948	0.98182	.	.	ENSG00000100626	ENST00000337827;ENST00000536652;ENST00000448469;ENST00000553669	.	.	.	5.48	5.48	0.80851	.	0.060066	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.364	0.94454	0.0:0.0:1.0:0.0	.	.	.	.	X	414;40;414;414	.	ENSP00000336729:W414X	W	+	2	0	GALNTL1	68878204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.615000	0.98356	2.547000	0.85894	0.655000	0.94253	TGG		0.612	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412434.1	NM_001168368		8	12	0	0	0	0	8	12				
SLC8A3	6547	broad.mit.edu	37	14	70633619	70633619	+	Silent	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr14:70633619G>T	ENST00000381269.2	-	2	2274	c.1521C>A	c.(1519-1521)ccC>ccA	p.P507P	SLC8A3_ENST00000356921.2_Silent_p.P507P|SLC8A3_ENST00000528359.1_Silent_p.P507P|SLC8A3_ENST00000534137.1_Silent_p.P507P|SLC8A3_ENST00000357887.3_Silent_p.P507P	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	507					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CCCGAGGCAAGGGAAGACTGT	0.498																																						uc001xly.2		NA																	0				skin(3)|ovary(2)|breast(2)	7						c.(1519-1521)CCC>CCA		solute carrier family 8 (sodium/calcium							66.0	66.0	66.0					14																	70633619		2203	4300	6503	SO:0001819	synonymous_variant	6547				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding	g.chr14:70633619G>T	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1521C>A	14.37:g.70633619G>T			Somatic				SLC8A3_uc001xlw.2_Silent_p.P507P|SLC8A3_uc001xlx.2_Silent_p.P507P|SLC8A3_uc001xlz.2_Silent_p.P507P|SLC8A3_uc010ara.2_RNA	p.P507P	NM_183002	NP_892114	WXS	Illumina HiSeq	Unspecified	P57103	NAC3_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)	2	2275	-			507			Cytoplasmic (Potential).		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	c.1521C>A	CCDS35498.1																																																																																				0.498	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			29	34	1	0	4.88e-14	6.6e-14	29	34				
ATG2B	55102	broad.mit.edu	37	14	96797952	96797952	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr14:96797952T>C	ENST00000359933.4	-	11	2384	c.1491A>G	c.(1489-1491)tcA>tcG	p.S497S		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	497					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATTCATCCACTGAAACAGATC	0.308																																						uc001yfi.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(1489-1491)TCA>TCG		ATG2 autophagy related 2 homolog B							59.0	53.0	55.0					14																	96797952		1810	4084	5894	SO:0001819	synonymous_variant	55102							g.chr14:96797952T>C	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.1491A>G	14.37:g.96797952T>C			Somatic					p.S497S	NM_018036	NP_060506	WXS	Illumina HiSeq	Unspecified	Q96BY7	ATG2B_HUMAN		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)	11	1856	-		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)	497					Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	ENST00000359933.4	37	c.1491A>G	CCDS9944.2																																																																																				0.308	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036		11	50	0	0	0	0	11	50				
EXOC3L4	91828	broad.mit.edu	37	14	103573762	103573762	+	Splice_Site	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr14:103573762C>T	ENST00000380069.3	+	8	1659	c.1583C>T	c.(1582-1584)cCg>cTg	p.P528L		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	528					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						TGTCCCCAGCCGCTCTTCAGG	0.632																																						uc001ymk.2		NA																	0					0						c.(1582-1584)CCG>CTG		hypothetical protein LOC91828							55.0	54.0	54.0					14																	103573762		2203	4300	6503	SO:0001630	splice_region_variant	91828							g.chr14:103573762C>T	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1582-1C>T	14.37:g.103573762C>T			Somatic					p.P528L	NM_001077594	NP_001071062	WXS	Illumina HiSeq	Unspecified	Q17RC7	EX3L4_HUMAN	Epithelial(46;0.221)		8	1659	+		Melanoma(154;0.155)	528					Q14CR2	Missense_Mutation	SNP	ENST00000380069.3	37	c.1583C>T	CCDS32163.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211514	0.39102	.	.	ENSG00000205436	ENST00000380069	T	0.09817	2.94	4.79	2.55	0.30701	.	0.237021	0.33980	N	0.004376	T	0.18045	0.0433	L	0.60455	1.87	0.58432	D	0.99999	D	0.71674	0.998	P	0.54889	0.763	T	0.01001	-1.1485	10	0.56958	D	0.05	-11.2312	7.5785	0.27950	0.0:0.7612:0.0:0.2388	.	528	Q17RC7	EX3L4_HUMAN	L	528	ENSP00000369409:P528L	ENSP00000369409:P528L	P	+	2	0	EXOC3L4	102643515	0.858000	0.29795	0.945000	0.38365	0.343000	0.28985	1.310000	0.33551	0.997000	0.38969	0.205000	0.17691	CCG		0.632	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	Missense_Mutation	21	24	0	0	0	0	21	24				
ARHGAP11A	9824	broad.mit.edu	37	15	32926132	32926132	+	Splice_Site	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr15:32926132A>G	ENST00000361627.3	+	10	1957		c.e10-1		ARHGAP11A_ENST00000567348.1_Splice_Site|ARHGAP11A_ENST00000565905.1_Splice_Site|ARHGAP11A_ENST00000563864.1_Splice_Site|ARHGAP11A_ENST00000543522.1_Splice_Site	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		CACTTCTTCTAGAGTGGAATC	0.333																																					Colon(45;757 1134 30003 36652)	uc001zgy.1		NA																	0				skin(3)|breast(2)|urinary_tract(1)	6						c.e10-2		Rho GTPase activating protein 11A isoform 1							23.0	23.0	23.0					15																	32926132		2199	4300	6499	SO:0001630	splice_region_variant	9824				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:32926132A>G	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1236-1A>G	15.37:g.32926132A>G			Somatic				ARHGAP11A_uc010ubw.1_Splice_Site_p.R223_splice|ARHGAP11A_uc001zgw.2_Splice_Site_p.R412_splice|ARHGAP11A_uc001zgx.2_Splice_Site_p.R384_splice|ARHGAP11A_uc010ubx.1_Splice_Site_p.R223_splice	p.R412_splice	NM_014783	NP_055598	WXS	Illumina HiSeq	Unspecified	Q6P4F7	RHGBA_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	10	1958	+		all_lung(180;1.3e-11)						B4DZN9|Q6PI96|Q9Y3S6	Splice_Site	SNP	ENST00000361627.3	37	c.1236_splice	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	11.04	1.520496	0.27211	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9178	0.79535	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP11A	30713424	1.000000	0.71417	0.967000	0.41034	0.025000	0.11179	8.838000	0.92115	2.216000	0.71823	0.533000	0.62120	.		0.333	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	Intron	6	8	0	0	0	0	6	8				
ZWILCH	55055	broad.mit.edu	37	15	66821212	66821212	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr15:66821212C>T	ENST00000307897.5	+	11	1372	c.992C>T	c.(991-993)gCa>gTa	p.A331V	ZWILCH_ENST00000535141.2_Missense_Mutation_p.A217V|ZWILCH_ENST00000565627.1_Missense_Mutation_p.A217V|ZWILCH_ENST00000446801.2_Missense_Mutation_p.A217V	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	331					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						GACACTGCTGCAGTCGATCGT	0.408																																						uc002aqb.2		NA																	0				ovary(1)	1						c.(991-993)GCA>GTA		Zwilch							112.0	102.0	105.0					15																	66821212		2201	4299	6500	SO:0001583	missense	55055				cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding	g.chr15:66821212C>T	AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.992C>T	15.37:g.66821212C>T	ENSP00000311429:p.Ala331Val		Somatic				ZWILCH_uc010bhu.1_Missense_Mutation_p.A217V|ZWILCH_uc002aqa.2_Missense_Mutation_p.A217V|ZWILCH_uc010bhv.2_Missense_Mutation_p.A217V	p.A331V	NM_017975	NP_060445	WXS	Illumina HiSeq	Unspecified	Q9H900	ZWILC_HUMAN			11	1238	+			331					B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	ENST00000307897.5	37	c.992C>T	CCDS10219.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659626	0.88154	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.50813	0.76;0.73;0.73	5.4	5.4	0.78164	.	0.067275	0.64402	D	0.000009	T	0.69931	0.3166	M	0.71581	2.175	0.45129	D	0.998143	D	0.89917	1.0	D	0.91635	0.999	T	0.71676	-0.4521	10	0.66056	D	0.02	-20.2641	19.5405	0.95272	0.0:1.0:0.0:0.0	.	331	Q9H900	ZWILC_HUMAN	V	331;217;217	ENSP00000311429:A331V;ENSP00000402217:A217V;ENSP00000437749:A217V	ENSP00000311429:A331V	A	+	2	0	ZWILCH	64608266	0.998000	0.40836	0.158000	0.22627	0.300000	0.27592	4.043000	0.57354	2.695000	0.91970	0.462000	0.41574	GCA		0.408	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256904.4	NM_017975		7	37	0	0	0	0	7	37				
C15orf59	388135	broad.mit.edu	37	15	74032449	74032449	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr15:74032449G>A	ENST00000569673.1	-	3	1895	c.691C>T	c.(691-693)Cac>Tac	p.H231Y	C15orf59_ENST00000558834.1_5'UTR|C15orf59_ENST00000379822.4_Missense_Mutation_p.H231Y			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	231										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GAGGGCTTGTGGGGGCCTGCA	0.652																																						uc002avy.2		NA																	0				pancreas(1)	1						c.(691-693)CAC>TAC		hypothetical protein LOC388135							41.0	44.0	43.0					15																	74032449		2198	4297	6495	SO:0001583	missense	388135							g.chr15:74032449G>A		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.691C>T	15.37:g.74032449G>A	ENSP00000457205:p.His231Tyr		Somatic					p.H231Y	NM_001039614	NP_001034703	WXS	Illumina HiSeq	Unspecified	Q2T9L4	CO059_HUMAN			2	1036	-			231						Missense_Mutation	SNP	ENST00000569673.1	37	c.691C>T	CCDS32289.1	.	.	.	.	.	.	.	.	.	.	G	0.100	-1.153483	0.01700	.	.	ENSG00000205363	ENST00000379822	.	.	.	4.62	3.71	0.42584	.	0.751514	0.12450	N	0.467823	T	0.16685	0.0401	N	0.08118	0	0.21861	N	0.999501	B	0.11235	0.004	B	0.11329	0.006	T	0.18840	-1.0324	9	0.02654	T	1	.	10.3818	0.44117	0.0922:0.0:0.9078:0.0	.	231	Q2T9L4	CO059_HUMAN	Y	231	.	ENSP00000369150:H231Y	H	-	1	0	C15orf59	71819502	0.941000	0.31946	0.952000	0.39060	0.698000	0.40448	0.403000	0.20982	1.158000	0.42547	0.561000	0.74099	CAC		0.652	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614		3	47	0	0	0	0	3	47				
ADAMTS7	11173	broad.mit.edu	37	15	79080663	79080663	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr15:79080663C>T	ENST00000388820.4	-	8	1442	c.1232G>A	c.(1231-1233)cGa>cAa	p.R411Q	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	411	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GATGAAAGGTCGTTTCCCAAC	0.612																																						uc002bej.3		NA																	0					0						c.(1231-1233)CGA>CAA		ADAM metallopeptidase with thrombospondin type 1							159.0	136.0	143.0					15																	79080663		2196	4293	6489	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79080663C>T	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1232G>A	15.37:g.79080663C>T	ENSP00000373472:p.Arg411Gln		Somatic				ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Missense_Mutation_p.R411Q	p.R411Q	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			8	1443	-			411			Peptidase M12B.		Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.1232G>A	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040431	0.55003	.	.	ENSG00000136378	ENST00000388820	T	0.03441	3.93	5.37	0.0853	0.14441	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.068763	0.56097	D	0.000031	T	0.02380	0.0073	L	0.37630	1.12	0.35551	D	0.80384	B;P	0.35844	0.334;0.524	B;B	0.28916	0.059;0.096	T	0.55309	-0.8161	10	0.25106	T	0.35	.	5.4694	0.16662	0.1278:0.5715:0.0:0.3007	.	411;411	A8MQ00;Q9UKP4	.;ATS7_HUMAN	Q	411	ENSP00000373472:R411Q	ENSP00000373472:R411Q	R	-	2	0	ADAMTS7	76867718	0.945000	0.32115	0.997000	0.53966	0.835000	0.47333	0.308000	0.19314	0.011000	0.14865	-0.320000	0.08662	CGA		0.612	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		39	79	0	0	0	0	39	79				
NTRK3	4916	broad.mit.edu	37	15	88472648	88472648	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr15:88472648G>A	ENST00000360948.2	-	16	2068	c.1907C>T	c.(1906-1908)gCa>gTa	p.A636V	NTRK3_ENST00000394480.2_Missense_Mutation_p.A636V|NTRK3_ENST00000355254.2_Missense_Mutation_p.A636V|NTRK3_ENST00000558676.1_Missense_Mutation_p.A628V|NTRK3_ENST00000357724.2_Missense_Mutation_p.A628V|NTRK3_ENST00000542733.2_Missense_Mutation_p.A538V|NTRK3_ENST00000557856.1_Missense_Mutation_p.A628V	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	636	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			AAGGATCATTGCATCTGGCCC	0.592			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																												uc002bme.1		NA		Dom	yes		15	15q25	4916	T	"""neurotrophic tyrosine kinase, receptor, type 3"""			"""E, M"""	ETV6		congenital fibrosarcoma|Secretory breast 	ETV6/NTRK3(234)	0				soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281						c.(1906-1908)GCA>GTA		neurotrophic tyrosine kinase, receptor, type 3							46.0	43.0	44.0					15																	88472648		2201	4299	6500	SO:0001583	missense	4916				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr15:88472648G>A	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1907C>T	15.37:g.88472648G>A	ENSP00000354207:p.Ala636Val	TSP Lung(13;0.10)	Somatic				NTRK3_uc002bmh.2_Missense_Mutation_p.A628V|NTRK3_uc002bmf.1_Missense_Mutation_p.A636V|NTRK3_uc010upl.1_Missense_Mutation_p.A538V|NTRK3_uc010bnh.1_Missense_Mutation_p.A628V	p.A636V	NM_001012338	NP_001012338	WXS	Illumina HiSeq	Unspecified	Q16288	NTRK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.211)		16	2069	-			636			Cytoplasmic (Potential).|Protein kinase.		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	c.1907C>T	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985505	0.93044	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733	D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.051475	0.85682	D	0.000000	D	0.91161	0.7216	L	0.31294	0.92	0.80722	D	1	D;D;D;D;P	0.71674	0.998;0.998;0.975;0.998;0.933	D;D;P;D;P	0.74023	0.982;0.982;0.893;0.969;0.838	D	0.92539	0.6040	10	0.87932	D	0	.	17.6599	0.88189	0.0:0.0:1.0:0.0	.	538;628;628;636;636	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	V	636;636;628;636;538	ENSP00000377990:A636V;ENSP00000354207:A636V;ENSP00000350356:A628V;ENSP00000347397:A636V;ENSP00000437773:A538V	ENSP00000347397:A636V	A	-	2	0	NTRK3	86273652	1.000000	0.71417	0.959000	0.39883	0.989000	0.77384	7.655000	0.83696	2.409000	0.81822	0.655000	0.94253	GCA		0.592	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				6	29	0	0	0	0	6	29				
CRTC3	64784	broad.mit.edu	37	15	91185222	91185222	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr15:91185222G>T	ENST00000268184.6	+	15	1714	c.1710G>T	c.(1708-1710)gaG>gaT	p.E570D	CRTC3_ENST00000420329.2_Missense_Mutation_p.E569D|RP11-387D10.2_ENST00000559531.1_RNA			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	570					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			GCCTGCCTGAGGTCAGCCTGA	0.562			T	MAML2	salivary gland mucoepidermoid																																	uc002bpp.2		NA		Dom	yes		15	15q26.1	64784	T	CREB regulated transcription coactivator 3			E	MAML2		salivary gland mucoepidermoid	CRTC3/MAML2(26)	0				salivary_gland(26)|ovary(1)	27						c.(1708-1710)GAG>GAT		transducer of regulated CREB protein 3 isoform							75.0	68.0	70.0					15																	91185222		2198	4298	6496	SO:0001583	missense	64784				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chr15:91185222G>T		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1710G>T	15.37:g.91185222G>T	ENSP00000268184:p.Glu570Asp		Somatic				CRTC3_uc002bpo.2_Missense_Mutation_p.E569D	p.E570D	NM_022769	NP_073606	WXS	Illumina HiSeq	Unspecified	Q6UUV7	CRTC3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0745)		15	1816	+	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		570					Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	37	c.1710G>T	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	G	6.975	0.549935	0.13374	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.14144	2.53;2.56	4.93	0.942	0.19525	Transducer of regulated CREB activity, C-terminal (1);	0.056069	0.64402	N	0.000001	T	0.15912	0.0383	L	0.35414	1.06	0.45662	D	0.998581	D;D	0.69078	0.997;0.996	D;D	0.79108	0.992;0.987	T	0.39702	-0.9601	10	0.05721	T	0.95	-14.99	5.6462	0.17590	0.2461:0.155:0.5989:0.0	.	570;569	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	D	533;570;569	ENSP00000268184:E570D;ENSP00000416573:E569D	ENSP00000268184:E570D	E	+	3	2	CRTC3	88986226	1.000000	0.71417	0.969000	0.41365	0.022000	0.10575	1.634000	0.37123	0.025000	0.15241	-0.211000	0.12701	GAG		0.562	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769		7	59	1	0	1.26e-09	1.6e-09	7	59				
ZSCAN10	84891	broad.mit.edu	37	16	3139838	3139838	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr16:3139838G>A	ENST00000252463.2	-	5	1519	c.1432C>T	c.(1432-1434)Cgc>Tgc	p.R478C	ZSCAN10_ENST00000575108.1_Missense_Mutation_p.R139C|RP11-473M20.9_ENST00000571404.1_lincRNA|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.R396C	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	478					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						TGCTCGCTGCGCCGGAAGGCC	0.731																																						uc002ctv.1		NA																	0				ovary(1)	1						c.(1432-1434)CGC>TGC		zinc finger and SCAN domain containing 10							5.0	5.0	5.0					16																	3139838		2070	4076	6146	SO:0001583	missense	84891				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3139838G>A	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1432C>T	16.37:g.3139838G>A	ENSP00000252463:p.Arg478Cys		Somatic				ZSCAN10_uc002cty.1_Missense_Mutation_p.R139C|ZSCAN10_uc002ctw.1_Missense_Mutation_p.R396C|ZSCAN10_uc002ctx.1_Missense_Mutation_p.R406C	p.R478C	NM_032805	NP_116194	WXS	Illumina HiSeq	Unspecified	Q96SZ4	ZSC10_HUMAN			5	1520	-			478			C2H2-type 6.		B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	c.1432C>T	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.734707	0.48939	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T;T	0.20463	2.07;3.18	5.34	4.3	0.51218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.159466	0.28371	N	0.015599	T	0.24005	0.0581	L	0.28458	0.855	0.58432	D	0.999999	D;D;P	0.89917	0.999;1.0;0.642	P;P;B	0.52793	0.709;0.643;0.027	T	0.00745	-1.1584	10	0.51188	T	0.08	-38.7178	12.0496	0.53500	0.0:0.0:0.7511:0.2488	.	139;411;478	Q96SZ4-2;Q1WWM2;Q96SZ4	.;.;ZSC10_HUMAN	C	411;478	ENSP00000440047:R411C;ENSP00000252463:R478C	ENSP00000252463:R478C	R	-	1	0	ZSCAN10	3079839	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.439000	0.21575	2.505000	0.84491	0.563000	0.77884	CGC		0.731	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805		3	9	0	0	0	0	3	9				
ERCC4	2072	broad.mit.edu	37	16	14024633	14024633	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr16:14024633G>A	ENST00000311895.7	+	5	868	c.859G>A	c.(859-861)Gat>Aat	p.D287N	CTD-2135D7.2_ENST00000575137.1_RNA|ERCC4_ENST00000574781.1_3'UTR|ERCC4_ENST00000575156.1_Missense_Mutation_p.D287N|CTD-2135D7.2_ENST00000570663.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	287	Helicase-like.|Leucine-zipper 2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						CTTAGTTCAGGATTTGAAGAT	0.373			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													uc002dce.2		NA	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	Mis|N|F	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""			E		skin basal cell|skin squamous cell|melanoma			0				lung(4)|ovary(3)|skin(2)|pancreas(1)	10						c.(859-861)GAT>AAT	Direct_reversal_of_damage|NER	excision repair cross-complementing rodent							95.0	85.0	89.0					16																	14024633		2197	4300	6497	SO:0001583	missense	2072	Xeroderma_Pigmentosum	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity	g.chr16:14024633G>A	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.859G>A	16.37:g.14024633G>A	ENSP00000310520:p.Asp287Asn		Somatic				ERCC4_uc010bva.2_Missense_Mutation_p.D287N	p.D287N	NM_005236	NP_005227	WXS	Illumina HiSeq	Unspecified	Q92889	XPF_HUMAN			5	868	+			287			Leucine-zipper 2.		A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	37	c.859G>A	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035204	0.93575	.	.	ENSG00000175595	ENST00000311895;ENST00000439007;ENST00000389138	T	0.63913	-0.07	5.9	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.81786	0.4896	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.85555	0.1224	10	0.87932	D	0	-34.2418	14.1328	0.65266	0.0713:0.0:0.9287:0.0	.	287;287	A5PKV6;Q92889	.;XPF_HUMAN	N	287;276;276	ENSP00000310520:D287N	ENSP00000310520:D287N	D	+	1	0	ERCC4	13932134	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.471000	0.97696	1.501000	0.48654	0.650000	0.86243	GAT		0.373	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236		3	35	0	0	0	0	3	35				
CPNE2	221184	broad.mit.edu	37	16	57180102	57180102	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr16:57180102G>A	ENST00000535318.2	+	16	1769	c.1408G>A	c.(1408-1410)Gtg>Atg	p.V470M	CPNE2_ENST00000565874.1_Missense_Mutation_p.V470M|CPNE2_ENST00000290776.8_Missense_Mutation_p.V470M|CPNE2_ENST00000565951.1_3'UTR|CPNE2_ENST00000537605.1_Missense_Mutation_p.V368M			Q96FN4	CPNE2_HUMAN	copine II	470	VWFA.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				CATCATCATCGTGGGCGTGGG	0.617																																						uc002eks.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1408-1410)GTG>ATG		copine II							62.0	37.0	46.0					16																	57180102		2198	4297	6495	SO:0001583	missense	221184							g.chr16:57180102G>A		CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.1408G>A	16.37:g.57180102G>A	ENSP00000439018:p.Val470Met		Somatic				CPNE2_uc010cct.1_Missense_Mutation_p.V496M|CPNE2_uc010ccu.1_Missense_Mutation_p.V470M|CPNE2_uc002ekt.1_Missense_Mutation_p.V166M	p.V470M	NM_152727	NP_689940	WXS	Illumina HiSeq	Unspecified	Q96FN4	CPNE2_HUMAN			15	1637	+		all_neural(199;0.224)	470			VWFA.		Q68D19|Q719H8|Q86XP9	Missense_Mutation	SNP	ENST00000535318.2	37	c.1408G>A	CCDS10774.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982342	0.74474	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	T;T;T	0.32023	1.47;1.47;1.47	5.52	5.52	0.82312	von Willebrand factor, type A (1);Copine (1);	0.068846	0.64402	D	0.000014	T	0.68577	0.3016	H	0.97240	3.965	0.43222	D	0.995104	D;D;D	0.89917	0.997;0.998;1.0	D;D;D	0.77557	0.911;0.99;0.99	T	0.79186	-0.1907	10	0.87932	D	0	-4.6071	12.7373	0.57232	0.075:0.0:0.925:0.0	.	470;454;470	A8K8A4;B2RD40;Q96FN4	.;.;CPNE2_HUMAN	M	470;368;470	ENSP00000290776:V470M;ENSP00000445468:V368M;ENSP00000439018:V470M	ENSP00000290776:V470M	V	+	1	0	CPNE2	55737603	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.909000	0.56363	2.583000	0.87209	0.555000	0.69702	GTG		0.617	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	NM_152727		4	7	0	0	0	0	4	7				
CDH8	1006	broad.mit.edu	37	16	61891110	61891110	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr16:61891110C>A	ENST00000577390.1	-	4	1534	c.580G>T	c.(580-582)Gct>Tct	p.A194S	CDH8_ENST00000584337.1_Missense_Mutation_p.A194S|CDH8_ENST00000577730.1_Missense_Mutation_p.A194S|CDH8_ENST00000299345.6_Missense_Mutation_p.A194S	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	194	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.A194T(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GGGTCATCAGCGTCGGTCGCA	0.383																																						uc002eog.1		NA																	1	Substitution - Missense(1)		biliary_tract(1)	ovary(6)|skin(2)|breast(1)	9						c.(580-582)GCT>TCT		cadherin 8, type 2 preproprotein							85.0	76.0	79.0					16																	61891110		2203	4300	6503	SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61891110C>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.580G>T	16.37:g.61891110C>A	ENSP00000462701:p.Ala194Ser		Somatic				CDH8_uc002eoh.2_5'UTR	p.A194S	NM_001796	NP_001787	WXS	Illumina HiSeq	Unspecified	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	4	832	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	194			Extracellular (Potential).|Cadherin 2.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	c.580G>T	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549619	0.65311	.	.	ENSG00000150394	ENST00000299345	T	0.53857	0.6	5.75	5.75	0.90469	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.77525	0.4143	M	0.82323	2.585	0.58432	D	0.999999	P	0.44734	0.842	D	0.70716	0.97	T	0.78590	-0.2145	10	0.87932	D	0	.	19.9535	0.97211	0.0:1.0:0.0:0.0	.	194	P55286	CADH8_HUMAN	S	194	ENSP00000299345:A194S	ENSP00000299345:A194S	A	-	1	0	CDH8	60448611	1.000000	0.71417	0.996000	0.52242	0.289000	0.27227	5.569000	0.67391	2.710000	0.92621	0.557000	0.71058	GCT		0.383	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		18	52	1	0	7.08e-05	8.07e-05	18	52				
CMTM3	123920	broad.mit.edu	37	16	66642247	66642247	+	Silent	SNP	G	G	A	rs149684359		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr16:66642247G>A	ENST00000424011.2	+	3	709	c.183G>A	c.(181-183)gcG>gcA	p.A61A	CMTM3_ENST00000566121.1_5'UTR|CMTM3_ENST00000565003.1_5'UTR|CMTM3_ENST00000565922.1_Intron|CMTM3_ENST00000361909.4_Silent_p.A61A|CMTM3_ENST00000460097.1_5'UTR|CMTM3_ENST00000564060.1_Silent_p.A61A|CMTM3_ENST00000565666.1_5'UTR|CMTM3_ENST00000360086.4_Intron|CMTM3_ENST00000568477.1_5'UTR|CMTM3_ENST00000567572.1_Silent_p.A61A|CMTM3_ENST00000562707.1_Silent_p.A61A			Q96MX0	CKLF3_HUMAN	CKLF-like MARVEL transmembrane domain containing 3	61	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)|positive regulation of B cell receptor signaling pathway (GO:0050861)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				central_nervous_system(1)|endometrium(1)|lung(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0671)|Epithelial(162;0.164)		GCTATGTGGCGTCCTCAGCAT	0.527											OREG0023859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		21060	0.0		0.0	False		,,,				2504	0.0					uc002epu.2		NA																	0				central_nervous_system(1)	1						c.(181-183)GCG>GCA		chemokine-like factor superfamily 3		G	,	0,4402		0,0,2201	177.0	158.0	164.0		183,183	-9.3	0.0	16	dbSNP_134	164	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	CMTM3	NM_144601.3,NM_181553.2	,	0,3,6498	AA,AG,GG		0.0349,0.0,0.0231	,	61/183,61/183	66642247	3,12999	2201	4300	6501	SO:0001819	synonymous_variant	123920				chemotaxis	extracellular space|integral to membrane	cytokine activity	g.chr16:66642247G>A	AK056324	CCDS10815.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140931	ENSG00000140931			19174	protein-coding gene	gene with protein product		607886	"""chemokine-like factor superfamily 3"""	CKLFSF3		15087455	Standard	NM_144601		Approved	FLJ31762, BNAS2	uc002epv.3	Q96MX0	OTTHUMG00000137503	ENST00000424011.2:c.183G>A	16.37:g.66642247G>A			Somatic	OREG0023859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1093	CMTM3_uc002epv.2_Silent_p.A61A|CMTM3_uc002epw.2_Silent_p.A61A|CMTM3_uc002epx.2_Silent_p.A61A|CMTM3_uc002epy.2_RNA	p.A61A	NM_001048251	NP_001041716	WXS	Illumina HiSeq	Unspecified	Q96MX0	CKLF3_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0671)|Epithelial(162;0.164)	3	442	+		Ovarian(137;0.0563)	61			MARVEL.		A6NCL9|Q8IUU8|Q8IWQ6|Q8IYE2|Q8IZ39|Q8IZ59	Silent	SNP	ENST00000424011.2	37	c.183G>A	CCDS10815.1																																																																																				0.527	CMTM3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268814.2	NM_144601		13	119	0	0	0	0	13	119				
TP53	7157	broad.mit.edu	37	17	7578416	7578416	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr17:7578416C>A	ENST00000269305.4	-	5	703	c.514G>T	c.(514-516)Gtt>Ttt	p.V172F	TP53_ENST00000420246.2_Missense_Mutation_p.V172F|TP53_ENST00000359597.4_Missense_Mutation_p.V172F|TP53_ENST00000445888.2_Missense_Mutation_p.V172F|TP53_ENST00000413465.2_Missense_Mutation_p.V172F|TP53_ENST00000455263.2_Missense_Mutation_p.V172F|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	172	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V172F(14)|p.0?(8)|p.V172I(7)|p.E171fs*2(3)|p.V172fs*2(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.T170fs*8(1)|p.V172_R174delVVR(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.V172_E180delVVRRCPHHE(1)|p.V40F(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.E78fs*2(1)|p.V172fs*9(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.E39fs*2(1)|p.V79F(1)|p.E171_V172delEV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCCTCACAACCTCCGTCATG	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		54	Substitution - Missense(23)|Deletion - Frameshift(16)|Whole gene deletion(8)|Deletion - In frame(6)|Insertion - Frameshift(1)	p.V172F(10)|p.V172D(8)|p.V172I(7)|p.0?(7)|p.V172V(4)|p.V172A(4)|p.V172fs*2(3)|p.V172G(3)|p.V173fs*59(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V172_R174delVVR(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.E171fs*61(1)|p.V172_E180delVVRRCPHHE(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.T170fs*8(1)|p.V172fs*9(1)|p.H168fs*69(1)|p.E171_H179delEVVRRCPHH(1)|p.E171_V172delEV(1)	large_intestine(11)|breast(10)|lung(6)|oesophagus(5)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|liver(3)|stomach(2)|urinary_tract(2)|ovary(2)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(514-516)GTT>TTT	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							52.0	52.0	52.0					17																	7578416		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578416C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.514G>T	17.37:g.7578416C>A	ENSP00000269305:p.Val172Phe	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.V172F|TP53_uc002gih.2_Missense_Mutation_p.V172F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V40F|TP53_uc010cng.1_Missense_Mutation_p.V40F|TP53_uc002gii.1_Missense_Mutation_p.V40F|TP53_uc010cnh.1_Missense_Mutation_p.V172F|TP53_uc010cni.1_Missense_Mutation_p.V172F|TP53_uc002gij.2_Missense_Mutation_p.V172F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.V79F|TP53_uc002gio.2_Missense_Mutation_p.V40F|TP53_uc010vug.1_Missense_Mutation_p.V133F	p.V172F	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	5	708	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	172		V -> A (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.514G>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183082	0.78677	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99860	-7.25;-7.25;-7.25;-7.25;-7.25;-7.25;-7.25;-7.25	5.59	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.063062	0.64402	D	0.000008	D	0.99854	0.9932	M	0.88310	2.945	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.961;1.0;0.999;1.0;1.0	D	0.96581	0.9430	10	0.87932	D	0	-20.1368	12.5365	0.56144	0.0:0.9188:0.0:0.0812	.	133;172;172;79;172;172;172	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	172;172;172;172;172;172;161;79;40;79;40	ENSP00000410739:V172F;ENSP00000352610:V172F;ENSP00000269305:V172F;ENSP00000398846:V172F;ENSP00000391127:V172F;ENSP00000391478:V172F;ENSP00000425104:V40F;ENSP00000423862:V79F	ENSP00000269305:V172F	V	-	1	0	TP53	7519141	1.000000	0.71417	0.713000	0.30519	0.434000	0.31775	4.932000	0.63476	1.503000	0.48686	0.655000	0.94253	GTT		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		28	32	1	0	7.01e-11	9.04e-11	28	32				
DHRS7C	201140	broad.mit.edu	37	17	9674889	9674889	+	Silent	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr17:9674889G>A	ENST00000330255.5	-	6	867	c.855C>T	c.(853-855)taC>taT	p.Y285Y	DHRS7C_ENST00000571134.1_Silent_p.Y284Y	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	285					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						AGGTGCGGACGTACACGGCGG	0.612																																						uc010vvb.1		NA																	0					0						c.(853-855)TAC>TAT		dehydrogenase/reductase (SDR family) member 7C							53.0	61.0	58.0					17																	9674889		2068	4199	6267	SO:0001819	synonymous_variant	201140					extracellular region	binding|oxidoreductase activity	g.chr17:9674889G>A		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.855C>T	17.37:g.9674889G>A			Somatic				DHRS7C_uc010cof.2_Silent_p.Y284Y	p.Y285Y	NM_001105571	NP_001099041	WXS	Illumina HiSeq	Unspecified	A6NNS2	DRS7C_HUMAN			6	855	-			285					B7ZW74|B9EJH3	Silent	SNP	ENST00000330255.5	37	c.855C>T	CCDS56020.1																																																																																				0.612	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	XM_113912		4	14	0	0	0	0	4	14				
ZNF286B	729288	broad.mit.edu	37	17	18565761	18565761	+	Missense_Mutation	SNP	C	C	T	rs2649399	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr17:18565761C>T	ENST00000545289.1	-	5	1308	c.1058G>A	c.(1057-1059)aGg>aAg	p.R353K	ZNF286B_ENST00000285274.5_3'UTR	NM_001145045.1	NP_001138517.1	P0CG31	Z286B_HUMAN	zinc finger protein 286B	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(1)	2						TTCATAAGGCCTCACTCCAGT	0.358													.|||	183	0.0365415	0.1346	0.0058	5008	,	,		21901	0.0		0.001	False		,,,				2504	0.0					uc010vyd.1		NA																	0					0						c.(1057-1059)AGG>AAG		zinc finger protein 286B																																				SO:0001583	missense	729288				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr17:18565761C>T		CCDS58523.1	17p11.2	2013-01-08			ENSG00000249459	ENSG00000249459		"""Zinc fingers, C2H2-type"""	33241	protein-coding gene	gene with protein product	"""zinc finger protein 590"""		"""zinc finger protein 286-like"", ""zinc finger 286C pseudogene"""	ZNF286L, ZNF286C			Standard	NM_001145045		Approved	ZNF590	uc010vyd.1	P0CG31	OTTHUMG00000178136	ENST00000545289.1:c.1058G>A	17.37:g.18565761C>T	ENSP00000461413:p.Arg353Lys		Somatic					p.R353K	NM_001145045	NP_001138517	WXS	Illumina HiSeq	Unspecified	P0CG31	Z286B_HUMAN			5	1309	-			353						Missense_Mutation	SNP	ENST00000545289.1	37	c.1058G>A	CCDS58523.1																																																																																				0.358	ZNF286B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_001723047		3	19	0	0	0	0	3	19				
MYCBPAP	84073	broad.mit.edu	37	17	48602314	48602314	+	Missense_Mutation	SNP	C	C	T	rs140934764	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr17:48602314C>T	ENST00000323776.5	+	13	2003	c.1841C>T	c.(1840-1842)cCg>cTg	p.P614L	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.P577L	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GTCTTGACCCCGGAGCGCACA	0.627																																						uc010wmr.1		NA																	0				urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6						c.(1840-1842)CCG>CTG		Myc-binding protein-associated protein		C	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	75.0	75.0	75.0		1841	5.9	0.6	17	dbSNP_134	75	9,8591	7.1+/-27.0	0,9,4291	yes	missense	MYCBPAP	NM_032133.4	98	0,10,6493	TT,TC,CC		0.1047,0.0227,0.0769	probably-damaging	614/985	48602314	10,12996	2203	4300	6503	SO:0001583	missense	84073				cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding	g.chr17:48602314C>T	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1841C>T	17.37:g.48602314C>T	ENSP00000323184:p.Pro614Leu		Somatic				MYCBPAP_uc002iqz.2_RNA	p.P614L	NM_032133	NP_115509	WXS	Illumina HiSeq	Unspecified	Q8TBZ2	MYBPP_HUMAN	BRCA - Breast invasive adenocarcinoma(22;1.23e-09)		13	2003	+	Breast(11;1.23e-18)		577						Missense_Mutation	SNP	ENST00000323776.5	37	c.1841C>T	CCDS32680.2	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419271	0.62622	2.27E-4	0.001047	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.52526	0.66;0.66	5.88	5.88	0.94601	.	0.118215	0.56097	D	0.000034	T	0.72153	0.3425	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74601	-0.3611	10	0.87932	D	0	-23.4337	18.4646	0.90750	0.0:1.0:0.0:0.0	.	577	Q8TBZ2	MYBPP_HUMAN	L	614;577	ENSP00000323184:P614L;ENSP00000397209:P577L	ENSP00000323184:P614L	P	+	2	0	MYCBPAP	45957313	0.987000	0.35691	0.639000	0.29394	0.107000	0.19398	3.775000	0.55349	2.804000	0.96469	0.650000	0.86243	CCG		0.627	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133		25	62	0	0	0	0	25	62				
MPPE1	65258	broad.mit.edu	37	18	11893517	11893517	+	Missense_Mutation	SNP	C	C	T	rs374298301		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr18:11893517C>T	ENST00000588072.1	-	4	1561	c.340G>A	c.(340-342)Gtc>Atc	p.V114I	MPPE1_ENST00000309976.9_Missense_Mutation_p.V114I|MPPE1_ENST00000344987.7_Missense_Mutation_p.V114I|MPPE1_ENST00000399978.2_Missense_Mutation_p.V114I|MPPE1_ENST00000317235.7_Missense_Mutation_p.V114I	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	114					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						AGGATGAAGACGACTTCCGGC	0.532																																						uc002kqf.2		NA																	0					0						c.(340-342)GTC>ATC		metallophosphoesterase 1 precursor		C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	92.0	79.0	83.0		340,340	1.2	0.1	18		83	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MPPE1	NM_001242904.1,NM_023075.5	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	114/334,114/397	11893517	1,13005	2203	4300	6503	SO:0001583	missense	65258				ER to Golgi vesicle-mediated transport|GPI anchor biosynthetic process	cis-Golgi network|endoplasmic reticulum exit site|ER-Golgi intermediate compartment membrane|integral to membrane	GPI anchor binding|manganese ion binding|phosphoric diester hydrolase activity	g.chr18:11893517C>T	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.340G>A	18.37:g.11893517C>T	ENSP00000465894:p.Val114Ile		Somatic				MPPE1_uc002kqn.2_Missense_Mutation_p.V114I|MPPE1_uc002kqg.2_RNA|MPPE1_uc002kqh.2_RNA|MPPE1_uc002kqi.2_RNA|MPPE1_uc002kqj.2_Missense_Mutation_p.V114I|MPPE1_uc002kqk.2_Missense_Mutation_p.V114I|MPPE1_uc002kql.2_Missense_Mutation_p.V114I|MPPE1_uc002kqm.2_Missense_Mutation_p.V114I|MPPE1_uc010dla.1_Missense_Mutation_p.V114I	p.V114I	NM_023075	NP_075563	WXS	Illumina HiSeq	Unspecified	Q53F39	MPPE1_HUMAN			4	981	-			114					B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Missense_Mutation	SNP	ENST00000588072.1	37	c.340G>A	CCDS11853.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.026023	0.35701	0.0	1.16E-4	ENSG00000154889	ENST00000317235;ENST00000309976;ENST00000317251;ENST00000344987;ENST00000399978	T;T;T;T;T	0.72615	2.09;2.09;2.09;-0.67;2.09	5.97	1.21	0.21127	Calcineurin-like phosphoesterase superfamily domain (1);	0.217151	0.47455	N	0.000227	T	0.59404	0.2191	M	0.62723	1.935	0.44136	D	0.99692	B;B;B;B;B;B	0.32893	0.1;0.025;0.122;0.389;0.1;0.049	B;B;B;B;B;B	0.31614	0.036;0.011;0.06;0.133;0.036;0.03	T	0.44726	-0.9309	10	0.18710	T	0.47	-15.4715	6.7062	0.23252	0.1148:0.6383:0.0:0.2469	.	114;114;17;114;114;114	Q53F39-3;Q53F39-4;B3KNP1;Q53F39-5;Q53F39-2;Q53F39	.;.;.;.;.;MPPE1_HUMAN	I	114;114;17;114;114	ENSP00000327257:V114I;ENSP00000311200:V114I;ENSP00000312935:V17I;ENSP00000339423:V114I;ENSP00000382860:V114I	ENSP00000311200:V114I	V	-	1	0	MPPE1	11883517	0.438000	0.25602	0.060000	0.19600	0.482000	0.33219	1.085000	0.30840	-0.059000	0.13154	-0.137000	0.14449	GTC		0.532	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075		8	45	0	0	0	0	8	45				
ZNF519	162655	broad.mit.edu	37	18	14106206	14106206	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr18:14106206T>C	ENST00000590202.1	-	3	485	c.333A>G	c.(331-333)aaA>aaG	p.K111K	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	111					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						CAGTTAAATGTTTGTTATGAC	0.333																																						uc002kst.1		NA																	0					0						c.(331-333)AAA>AAG		zinc finger protein 519							71.0	69.0	70.0					18																	14106206		2203	4298	6501	SO:0001819	synonymous_variant	162655				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:14106206T>C	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.333A>G	18.37:g.14106206T>C			Somatic				ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	p.K111K	NM_145287	NP_660330	WXS	Illumina HiSeq	Unspecified	Q8TB69	ZN519_HUMAN			3	486	-			111						Silent	SNP	ENST00000590202.1	37	c.333A>G	CCDS32797.1																																																																																				0.333	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1	NM_145287		12	51	0	0	0	0	12	51				
ASXL3	80816	broad.mit.edu	37	18	31322978	31322978	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr18:31322978G>T	ENST00000269197.5	+	12	3166	c.3166G>T	c.(3166-3168)Gat>Tat	p.D1056Y		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1056	Ala-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GACCCTCGCAGATATCAAGGC	0.587																																						uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3166-3168)GAT>TAT		additional sex combs like 3							28.0	29.0	29.0					18																	31322978		1896	4098	5994	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31322978G>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3166G>T	18.37:g.31322978G>T	ENSP00000269197:p.Asp1056Tyr		Somatic				ASXL3_uc002kxq.2_Missense_Mutation_p.D763Y	p.D1056Y	NM_030632	NP_085135	WXS	Illumina HiSeq	Unspecified	Q9C0F0	ASXL3_HUMAN			12	3221	+			1056			Ala-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.3166G>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208041	0.79240	.	.	ENSG00000141431	ENST00000269197	T	0.55588	0.51	5.9	5.9	0.94986	.	1.043150	0.07508	N	0.908385	T	0.77260	0.4104	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.70117	-0.4960	10	0.87932	D	0	.	20.2861	0.98535	0.0:0.0:1.0:0.0	.	1056	Q9C0F0	ASXL3_HUMAN	Y	1056	ENSP00000269197:D1056Y	ENSP00000269197:D1056Y	D	+	1	0	ASXL3	29576976	1.000000	0.71417	0.908000	0.35775	0.957000	0.61999	9.177000	0.94849	2.786000	0.95864	0.650000	0.86243	GAT		0.587	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			4	9	1	0	1.24e-05	1.45e-05	4	9				
RIT2	6014	broad.mit.edu	37	18	40323626	40323626	+	Silent	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr18:40323626G>T	ENST00000326695.5	-	5	657	c.486C>A	c.(484-486)acC>acA	p.T162T	RIT2_ENST00000589109.1_3'UTR|RIT2_ENST00000590910.1_3'UTR	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	162					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGGCTGCAGAGGTCTCAAAAA	0.378																																						uc002lav.2		NA																	0				ovary(1)	1						c.(484-486)ACC>ACA		Ras-like without CAAX 2							80.0	81.0	81.0					18																	40323626		2203	4300	6503	SO:0001819	synonymous_variant	6014				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity	g.chr18:40323626G>T	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.486C>A	18.37:g.40323626G>T			Somatic				RIT2_uc010dnf.2_3'UTR	p.T162T	NM_002930	NP_002921	WXS	Illumina HiSeq	Unspecified	Q99578	RIT2_HUMAN			5	659	-			162					B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Silent	SNP	ENST00000326695.5	37	c.486C>A	CCDS11921.1																																																																																				0.378	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255852.1	NM_002930		26	44	1	0	4.48e-21	6.21e-21	26	44				
ST8SIA5	29906	broad.mit.edu	37	18	44266168	44266168	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr18:44266168T>A	ENST00000315087.7	-	5	1198	c.538A>T	c.(538-540)Agg>Tgg	p.R180W	ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000536490.1_Missense_Mutation_p.R149W|ST8SIA5_ENST00000538168.1_Missense_Mutation_p.R216W	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	180					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						TTGATCTCCCTCCCGCAGCGG	0.587																																						uc002lcj.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(538-540)AGG>TGG		ST8 alpha-N-acetyl-neuraminide							81.0	69.0	73.0					18																	44266168		2203	4300	6503	SO:0001583	missense	29906				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane		g.chr18:44266168T>A	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.538A>T	18.37:g.44266168T>A	ENSP00000321343:p.Arg180Trp		Somatic				ST8SIA5_uc002lci.1_Missense_Mutation_p.R27W|ST8SIA5_uc010xcy.1_Missense_Mutation_p.R216W|ST8SIA5_uc010xcz.1_Missense_Mutation_p.R149W	p.R180W	NM_013305	NP_037437	WXS	Illumina HiSeq	Unspecified	O15466	SIA8E_HUMAN			5	1106	-			180			Lumenal (Potential).		B7Z1K9|Q6IAW7	Missense_Mutation	SNP	ENST00000315087.7	37	c.538A>T	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.136222	0.77662	.	.	ENSG00000101638	ENST00000315087;ENST00000538168;ENST00000536490	T;T;T	0.32515	1.45;1.45;1.45	5.34	2.86	0.33363	.	0.167341	0.49916	D	0.000127	T	0.47322	0.1439	M	0.73217	2.22	0.36737	D	0.882014	P;P;D	0.57571	0.947;0.942;0.98	P;P;P	0.56343	0.762;0.656;0.796	T	0.59005	-0.7535	10	0.87932	D	0	0.1317	13.2976	0.60307	0.0:0.0:0.5027:0.4973	.	149;216;180	F5H8D1;B7Z1K9;O15466	.;.;SIA8E_HUMAN	W	180;216;149	ENSP00000321343:R180W;ENSP00000445492:R216W;ENSP00000443683:R149W	ENSP00000321343:R180W	R	-	1	2	ST8SIA5	42520166	0.998000	0.40836	0.959000	0.39883	0.968000	0.65278	1.606000	0.36826	0.312000	0.23038	0.402000	0.26972	AGG		0.587	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305		5	48	0	0	0	0	5	48				
HCN2	610	broad.mit.edu	37	19	608035	608035	+	Silent	SNP	C	C	T	rs145436026	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:608035C>T	ENST00000251287.2	+	4	1343	c.1290C>T	c.(1288-1290)taC>taT	p.Y430Y		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	430					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCATCGGGTACGGCCGGCAGG	0.617													C|||	6	0.00119808	0.0045	0.0	5008	,	,		19035	0.0		0.0	False		,,,				2504	0.0				Melanoma(145;1175 2427 8056 36306)	uc002lpe.2		NA																	0					0						c.(1288-1290)TAC>TAT		hyperpolarization activated cyclic		C		24,4382		0,24,2179	82.0	62.0	69.0		1290	1.0	1.0	19	dbSNP_134	69	0,8600		0,0,4300	no	coding-synonymous	HCN2	NM_001194.3		0,24,6479	TT,TC,CC		0.0,0.5447,0.1845		430/890	608035	24,12982	2203	4300	6503	SO:0001819	synonymous_variant	610				cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity	g.chr19:608035C>T	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1290C>T	19.37:g.608035C>T			Somatic					p.Y430Y	NM_001194	NP_001185	WXS	Illumina HiSeq	Unspecified	Q9UL51	HCN2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1343	+		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	430					O60742|O60743|O75267|Q9UBS2	Silent	SNP	ENST00000251287.2	37	c.1290C>T	CCDS12035.1																																																																																				0.617	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452100.1	NM_001194		7	50	0	0	0	0	7	50				
C3	718	broad.mit.edu	37	19	6709693	6709693	+	Splice_Site	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:6709693A>T	ENST00000245907.6	-	14	1938		c.e14+1			NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ACTGGCCCTTACCTTACTCTG	0.627																																						uc002mfm.2		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.e14+1		complement component 3 precursor							134.0	141.0	139.0					19																	6709693		2203	4300	6503	SO:0001630	splice_region_variant	718				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding	g.chr19:6709693A>T	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1845+1T>A	19.37:g.6709693A>T			Somatic					p.K615_splice	NM_000064	NP_000055	WXS	Illumina HiSeq	Unspecified	P01024	CO3_HUMAN		GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	14	1907	-								A7E236	Splice_Site	SNP	ENST00000245907.6	37	c.1845_splice	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	a	13.05	2.119938	0.37436	.	.	ENSG00000125730	ENST00000245907	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4868	0.61371	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C3	6660693	1.000000	0.71417	0.951000	0.38953	0.316000	0.28119	5.221000	0.65272	1.848000	0.53677	0.449000	0.29647	.		0.627	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	Intron	16	168	0	0	0	0	16	168				
MUC16	94025	broad.mit.edu	37	19	9059076	9059076	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:9059076T>C	ENST00000397910.4	-	3	28573	c.28370A>G	c.(28369-28371)cAc>cGc	p.H9457R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9459	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGAGAGGAGTGGCTACTCCC	0.498																																						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(28369-28371)CAC>CGC		mucin 16							89.0	90.0	90.0					19																	9059076		2009	4176	6185	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9059076T>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28370A>G	19.37:g.9059076T>C	ENSP00000381008:p.His9457Arg		Somatic					p.H9457R	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	28574	-			9459			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.28370A>G	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	3.212	-0.161507	0.06502	.	.	ENSG00000181143	ENST00000397910	T	0.21191	2.02	1.98	-3.96	0.04106	.	.	.	.	.	T	0.10551	0.0258	N	0.19112	0.55	.	.	.	B	0.06786	0.001	B	0.14023	0.01	T	0.31558	-0.9939	8	0.87932	D	0	.	2.9587	0.05886	0.4544:0.0:0.3329:0.2127	.	9457	B5ME49	.	R	9457	ENSP00000381008:H9457R	ENSP00000381008:H9457R	H	-	2	0	MUC16	8920076	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.076000	0.11412	-0.935000	0.03728	0.255000	0.18592	CAC		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		20	79	0	0	0	0	20	79				
MUC16	94025	broad.mit.edu	37	19	9062974	9062974	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:9062974C>A	ENST00000397910.4	-	3	24675	c.24472G>T	c.(24472-24474)Gtc>Ttc	p.V8158F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8160	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGGAGGTGACTTCTGTCCTG	0.542																																						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(24472-24474)GTC>TTC		mucin 16							123.0	120.0	121.0					19																	9062974		2051	4209	6260	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9062974C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24472G>T	19.37:g.9062974C>A	ENSP00000381008:p.Val8158Phe		Somatic					p.V8158F	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			3	24676	-			8160			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.24472G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	6.239	0.412303	0.11812	.	.	ENSG00000181143	ENST00000397910	T	0.02837	4.14	3.24	-0.36	0.12568	.	.	.	.	.	T	0.02012	0.0063	N	0.24115	0.695	.	.	.	B	0.20052	0.041	B	0.17098	0.017	T	0.45338	-0.9268	8	0.87932	D	0	.	1.633	0.02736	0.2039:0.4388:0.2285:0.1288	.	8158	B5ME49	.	F	8158	ENSP00000381008:V8158F	ENSP00000381008:V8158F	V	-	1	0	MUC16	8923974	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.008000	0.01456	0.037000	0.15575	0.508000	0.49915	GTC		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		16	75	1	0	6.72e-11	8.69e-11	16	75				
KEAP1	9817	broad.mit.edu	37	19	10610277	10610277	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:10610277T>A	ENST00000171111.5	-	2	980	c.433A>T	c.(433-435)Atc>Ttc	p.I145F	KEAP1_ENST00000393623.2_Missense_Mutation_p.I145F|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	145	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CCCATGGAGATGGAGGCCGTG	0.592																																						uc002moq.1		NA																	0				lung(12)|breast(3)|ovary(1)|pancreas(1)	17						c.(433-435)ATC>TTC		kelch-like ECH-associated protein 1							162.0	130.0	141.0					19																	10610277		2203	4300	6503	SO:0001583	missense	9817				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	g.chr19:10610277T>A	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.433A>T	19.37:g.10610277T>A	ENSP00000171111:p.Ile145Phe		Somatic				KEAP1_uc002mor.1_Missense_Mutation_p.I145F	p.I145F	NM_012289	NP_036421	WXS	Illumina HiSeq	Unspecified	Q14145	KEAP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		2	589	-			145			BTB.		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	c.433A>T	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.544231	0.86022	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.69175	-0.38;-0.38	4.81	4.81	0.61882	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.81192	0.4771	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.83892	0.0285	10	0.87932	D	0	.	12.3271	0.55018	0.0:0.0:0.0:1.0	.	145	Q14145	KEAP1_HUMAN	F	145	ENSP00000171111:I145F;ENSP00000377245:I145F	ENSP00000171111:I145F	I	-	1	0	KEAP1	10471277	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.884000	0.63135	1.811000	0.52892	0.459000	0.35465	ATC		0.592	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289		14	36	0	0	0	0	14	36				
SIN3B	23309	broad.mit.edu	37	19	16977364	16977364	+	Silent	SNP	C	C	T	rs138346712	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:16977364C>T	ENST00000248054.5	+	12	1824	c.1803C>T	c.(1801-1803)gaC>gaT	p.D601D	SIN3B_ENST00000379803.1_Silent_p.D633D|SIN3B_ENST00000595541.1_Silent_p.D191D					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						GCGTCTACGACGAGGTAAAGC	0.627													C|||	3	0.000599042	0.0	0.0014	5008	,	,		18833	0.0		0.002	False		,,,				2504	0.0					uc002ney.1		NA																	0				ovary(2)	2						c.(1897-1899)GAC>GAT		SIN3 homolog B, transcription regulator		C		2,4404	4.2+/-10.8	0,2,2201	94.0	68.0	77.0		1899	-3.8	0.4	19	dbSNP_134	77	11,8589	7.7+/-29.5	0,11,4289	no	coding-synonymous	SIN3B	NM_015260.2		0,13,6490	TT,TC,CC		0.1279,0.0454,0.1		633/1163	16977364	13,12993	2203	4300	6503	SO:0001819	synonymous_variant	23309				cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	protein binding	g.chr19:16977364C>T	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.1803C>T	19.37:g.16977364C>T			Somatic				SIN3B_uc002nez.1_Silent_p.D601D|SIN3B_uc010xpi.1_Silent_p.D191D	p.D633D	NM_015260	NP_056075	WXS	Illumina HiSeq	Unspecified	O75182	SIN3B_HUMAN			13	1913	+			633						Silent	SNP	ENST00000248054.5	37	c.1899C>T																																																																																					0.627	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260		17	22	0	0	0	0	17	22				
ZNF536	9745	broad.mit.edu	37	19	30936564	30936564	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:30936564G>A	ENST00000355537.3	+	2	2242	c.2095G>A	c.(2095-2097)Ggg>Agg	p.G699R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	699					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGAGGAGAGCGGGGTCGGAGG	0.697																																						uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(2095-2097)GGG>AGG		zinc finger protein 536							16.0	20.0	19.0					19																	30936564		2194	4282	6476	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30936564G>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2095G>A	19.37:g.30936564G>A	ENSP00000347730:p.Gly699Arg		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.G699R	p.G699R	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	2233	+	Esophageal squamous(110;0.0834)		699					A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.2095G>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587769	0.66105	.	.	ENSG00000198597	ENST00000355537	T	0.10192	2.9	5.51	5.51	0.81932	.	0.051779	0.85682	D	0.000000	T	0.20047	0.0482	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.11084	-1.0602	10	0.11182	T	0.66	-35.3702	19.4311	0.94768	0.0:0.0:1.0:0.0	.	699;699	A7E228;O15090	.;ZN536_HUMAN	R	699	ENSP00000347730:G699R	ENSP00000347730:G699R	G	+	1	0	ZNF536	35628404	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	9.378000	0.97191	2.557000	0.86248	0.655000	0.94253	GGG		0.697	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		14	13	0	0	0	0	14	13				
ANKRD27	84079	broad.mit.edu	37	19	33131245	33131245	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:33131245T>C	ENST00000306065.4	-	11	1109	c.951A>G	c.(949-951)ttA>ttG	p.L317L	ANKRD27_ENST00000587352.1_Silent_p.L317L	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	317	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CAAGCAAGTATAACAGGACTG	0.448																																						uc002ntn.1		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(949-951)TTA>TTG		ankyrin repeat domain 27 (VPS9 domain)							129.0	118.0	122.0					19																	33131245		2203	4300	6503	SO:0001819	synonymous_variant	84079				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity	g.chr19:33131245T>C	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.951A>G	19.37:g.33131245T>C			Somatic				ANKRD27_uc002nto.1_Silent_p.L317L	p.L317L	NM_032139	NP_115515	WXS	Illumina HiSeq	Unspecified	Q96NW4	ANR27_HUMAN			11	1107	-	Esophageal squamous(110;0.137)		317			VPS9.		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Silent	SNP	ENST00000306065.4	37	c.951A>G	CCDS32986.1																																																																																				0.448	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139		17	51	0	0	0	0	17	51				
LRFN3	79414	broad.mit.edu	37	19	36430643	36430643	+	Silent	SNP	C	C	T	rs112518812		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:36430643C>T	ENST00000588831.1	+	3	1370	c.316C>T	c.(316-318)Ctg>Ttg	p.L106L	LRFN3_ENST00000246529.3_Silent_p.L106L			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	106					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CTTCGCCGACCTGCGGGCCCT	0.706																																						uc002oco.2		NA																	0					0						c.(316-318)CTG>TTG		leucine rich repeat and fibronectin type III							13.0	15.0	15.0					19																	36430643		2160	4175	6335	SO:0001819	synonymous_variant	79414				cell adhesion	axon|cell junction|dendrite|integral to membrane|postsynaptic membrane|presynaptic membrane		g.chr19:36430643C>T	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.316C>T	19.37:g.36430643C>T			Somatic					p.L106L	NM_024509	NP_078785	WXS	Illumina HiSeq	Unspecified	Q9BTN0	LRFN3_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		2	768	+	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		106			Extracellular (Potential).		Q6UY10	Silent	SNP	ENST00000588831.1	37	c.316C>T	CCDS12483.1																																																																																				0.706	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2	NM_024509		5	28	0	0	0	0	5	28				
CLIP3	25999	broad.mit.edu	37	19	36517871	36517871	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:36517871G>A	ENST00000360535.4	-	4	610	c.383C>T	c.(382-384)gCt>gTt	p.A128V	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.A128V	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	128					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GTGGGCCCCAGCTTTGCACGC	0.617																																						uc010eeq.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(382-384)GCT>GTT		CAP-GLY domain containing linker protein 3							58.0	54.0	55.0					19																	36517871		2203	4300	6503	SO:0001583	missense	25999				chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding	g.chr19:36517871G>A	AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.383C>T	19.37:g.36517871G>A	ENSP00000353732:p.Ala128Val		Somatic				uc002ocy.2_Intron|CLIP3_uc002ocz.1_Missense_Mutation_p.A128V	p.A128V	NM_015526	NP_056341	WXS	Illumina HiSeq	Unspecified	Q96DZ5	CLIP3_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		3	665	-	Esophageal squamous(110;0.162)		128			ANK 1.		A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	ENST00000360535.4	37	c.383C>T	CCDS12486.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706821	0.89018	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	T	0.53206	0.63	5.28	4.25	0.50352	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	L	0.54323	1.7	0.58432	D	0.999998	D	0.55172	0.97	P	0.51742	0.678	T	0.53585	-0.8418	10	0.51188	T	0.08	-14.6277	11.6126	0.51069	0.087:0.0:0.913:0.0	.	128	Q96DZ5	CLIP3_HUMAN	V	128;10;104	ENSP00000353732:A128V	ENSP00000353732:A128V	A	-	2	0	CLIP3	41209711	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	7.482000	0.81143	1.229000	0.43630	0.455000	0.32223	GCT		0.617	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526		4	34	0	0	0	0	4	34				
FCGBP	8857	broad.mit.edu	37	19	40424009	40424009	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:40424009C>A	ENST00000221347.6	-	4	2201	c.2194G>T	c.(2194-2196)Gtt>Ttt	p.V732F		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	732			V -> A (in dbSNP:rs34181317).			extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGTCCCCAACCGAGATGCCA	0.617																																						uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(2194-2196)GTT>TTT		Fc fragment of IgG binding protein precursor							61.0	62.0	61.0					19																	40424009		2203	4300	6503	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40424009C>A	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2194G>T	19.37:g.40424009C>A	ENSP00000221347:p.Val732Phe		Somatic					p.V732F	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		4	2202	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		732					O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.2194G>T	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705432	0.30232	.	.	ENSG00000090920	ENST00000221347	T	0.79352	-1.26	5.23	-0.31	0.12765	Uncharacterised domain, cysteine-rich (2);	0.645541	0.13101	N	0.413814	D	0.84028	0.5382	M	0.80982	2.52	0.09310	N	1	D	0.67145	0.996	D	0.67900	0.954	T	0.71600	-0.4544	10	0.72032	D	0.01	.	5.0505	0.14505	0.0:0.3857:0.1594:0.455	.	732	Q9Y6R7	FCGBP_HUMAN	F	732	ENSP00000221347:V732F	ENSP00000221347:V732F	V	-	1	0	FCGBP	45115849	0.000000	0.05858	0.016000	0.15963	0.059000	0.15707	-3.224000	0.00551	0.127000	0.18452	0.650000	0.86243	GTT		0.617	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		18	49	1	0	6.5e-13	8.67e-13	18	49				
ZNF836	162962	broad.mit.edu	37	19	52663759	52663759	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:52663759C>A	ENST00000322146.8	-	4	622	c.101G>T	c.(100-102)tGg>tTg	p.W34L	ZNF836_ENST00000597252.1_Missense_Mutation_p.W34L|ZNF836_ENST00000597065.1_Missense_Mutation_p.W34L|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CATCACATCCCAGTACAAAGC	0.433																																						uc010ydi.1		NA																	0					0						c.(100-102)TGG>TTG		zinc finger protein 836							115.0	122.0	119.0					19																	52663759		2203	4300	6503	SO:0001583	missense	162962				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52663759C>A	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.101G>T	19.37:g.52663759C>A	ENSP00000325038:p.Trp34Leu		Somatic				ZNF836_uc010ydj.1_Missense_Mutation_p.W34L	p.W34L	NM_001102657	NP_001096127	WXS	Illumina HiSeq	Unspecified	Q6ZNA1	ZN836_HUMAN			4	475	-			34			KRAB.			Missense_Mutation	SNP	ENST00000322146.8	37	c.101G>T	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	C	8.564	0.878390	0.17395	.	.	ENSG00000196267	ENST00000322146	T	0.01725	4.67	2.06	-0.561	0.11785	Krueppel-associated box (4);	.	.	.	.	T	0.01124	0.0037	N	0.11364	0.135	0.21325	N	0.99972	B	0.14012	0.009	B	0.16289	0.015	T	0.47086	-0.9144	9	0.54805	T	0.06	.	3.9891	0.09529	0.2285:0.6208:0.0:0.1507	.	34	Q6ZNA1	ZN836_HUMAN	L	34	ENSP00000325038:W34L	ENSP00000325038:W34L	W	-	2	0	ZNF836	57355571	0.000000	0.05858	0.097000	0.21041	0.796000	0.44982	-1.648000	0.01995	-0.221000	0.09973	-0.424000	0.05967	TGG		0.433	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657		12	84	1	0	0.00010058	0.000114019	12	84				
ZNF264	9422	broad.mit.edu	37	19	57723895	57723895	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:57723895A>T	ENST00000263095.6	+	4	1844	c.1430A>T	c.(1429-1431)cAc>cTc	p.H477L	ZNF264_ENST00000536056.1_Missense_Mutation_p.H477L	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TTCAGCATCCACACTGGAGAG	0.542																																						uc002qob.2		NA																	0				ovary(2)	2						c.(1429-1431)CAC>CTC		zinc finger protein 264							64.0	65.0	64.0					19																	57723895		2203	4300	6503	SO:0001583	missense	9422				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57723895A>T	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1430A>T	19.37:g.57723895A>T	ENSP00000263095:p.His477Leu		Somatic					p.H477L	NM_003417	NP_003408	WXS	Illumina HiSeq	Unspecified	O43296	ZN264_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)	4	1843	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)	477			C2H2-type 10.		A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	c.1430A>T	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825492	0.71143	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.67345	-0.26;-0.26	2.35	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85120	0.5624	H	0.96333	3.805	0.36752	D	0.882834	D	0.76494	0.999	D	0.80764	0.994	D	0.89051	0.3455	9	0.87932	D	0	.	9.882	0.41238	1.0:0.0:0.0:0.0	.	477	O43296	ZN264_HUMAN	L	477	ENSP00000263095:H477L;ENSP00000440376:H477L	ENSP00000263095:H477L	H	+	2	0	ZNF264	62415707	1.000000	0.71417	0.999000	0.59377	0.884000	0.51177	8.440000	0.90311	1.344000	0.45657	0.402000	0.26972	CAC		0.542	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1			9	26	0	0	0	0	9	26				
TACR1	6869	broad.mit.edu	37	2	75425690	75425690	+	Missense_Mutation	SNP	G	G	A	rs138993766	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:75425690G>A	ENST00000305249.5	-	1	1136	c.371C>T	c.(370-372)aCg>aTg	p.T124M	TACR1_ENST00000409848.3_Missense_Mutation_p.T124M	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	124					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	GGCCACAGCCGTCATGGAGTA	0.512													G|||	2	0.000399361	0.0015	0.0	5008	,	,		21030	0.0		0.0	False		,,,				2504	0.0				Pancreas(64;62 1268 3653 14826 43765)	uc002sng.2		NA																	0				ovary(1)	1						c.(370-372)ACG>ATG		tachykinin receptor 1 isoform long	Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	G	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	103.0	100.0	101.0		371,371	5.4	1.0	2	dbSNP_134	101	0,8600		0,0,4300	no	missense,missense	TACR1	NM_001058.3,NM_015727.2	81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	124/408,124/312	75425690	1,13005	2203	4300	6503	SO:0001583	missense	6869				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding	g.chr2:75425690G>A	M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.371C>T	2.37:g.75425690G>A	ENSP00000303522:p.Thr124Met		Somatic				TACR1_uc002snh.2_Missense_Mutation_p.T124M	p.T124M	NM_001058	NP_001049	WXS	Illumina HiSeq	Unspecified	P25103	NK1R_HUMAN			1	956	-			124			Helical; Name=3; (Potential).		A8K150	Missense_Mutation	SNP	ENST00000305249.5	37	c.371C>T	CCDS1958.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935794	0.73442	2.27E-4	0.0	ENSG00000115353	ENST00000305249;ENST00000409848	T;T	0.74002	-0.8;-0.8	5.41	5.41	0.78517	GPCR, rhodopsin-like superfamily (1);	0.046253	0.85682	D	0.000000	T	0.82084	0.4960	M	0.63428	1.95	0.80722	D	1	D	0.69078	0.997	P	0.62184	0.899	T	0.77907	-0.2412	10	0.23891	T	0.37	.	16.7297	0.85431	0.0:0.0:1.0:0.0	.	124	P25103	NK1R_HUMAN	M	124	ENSP00000303522:T124M;ENSP00000386448:T124M	ENSP00000303522:T124M	T	-	2	0	TACR1	75279198	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	9.595000	0.98260	2.798000	0.96311	0.655000	0.94253	ACG		0.512	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252239.3	NM_001058		9	51	0	0	0	0	9	51				
TFCP2L1	29842	broad.mit.edu	37	2	122038776	122038776	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:122038776G>A	ENST00000263707.5	-	2	231	c.134C>T	c.(133-135)cCa>cTa	p.P45L		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	45	Mediate transcriptional repression.				cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					TTGCAGGGGTGGCAGGCGGGC	0.617																																						uc002tmx.2		NA																	0				pancreas(2)|ovary(1)	3						c.(133-135)CCA>CTA		LBP-9							88.0	96.0	93.0					2																	122038776		2203	4300	6503	SO:0001583	missense	29842				female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr2:122038776G>A	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.134C>T	2.37:g.122038776G>A	ENSP00000263707:p.Pro45Leu		Somatic				TFCP2L1_uc010flr.2_Missense_Mutation_p.P45L	p.P45L	NM_014553	NP_055368	WXS	Illumina HiSeq	Unspecified	Q9NZI6	TF2L1_HUMAN			2	227	-	Renal(3;0.01)		45			Mediate transcriptional repression.		Q4ZG43	Missense_Mutation	SNP	ENST00000263707.5	37	c.134C>T	CCDS2134.1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234646	0.22626	.	.	ENSG00000115112	ENST00000263707	T	0.15952	2.38	5.2	3.35	0.38373	CP2 transcription factor (1);	0.360527	0.30277	N	0.009983	T	0.11879	0.0289	N	0.21617	0.685	0.53005	D	0.999961	B;B	0.20550	0.005;0.046	B;B	0.30716	0.02;0.119	T	0.12630	-1.0540	10	0.15066	T	0.55	.	10.4619	0.44585	0.0727:0.1344:0.7928:0.0	.	45;45	Q5JV87;Q9NZI6	.;TF2L1_HUMAN	L	45	ENSP00000263707:P45L	ENSP00000263707:P45L	P	-	2	0	TFCP2L1	121755246	1.000000	0.71417	0.833000	0.33012	0.915000	0.54546	4.006000	0.57083	0.553000	0.29044	-0.140000	0.14226	CCA		0.617	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553		40	134	0	0	0	0	40	134				
GYPC	2995	broad.mit.edu	37	2	127447862	127447862	+	Silent	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:127447862C>A	ENST00000259254.4	+	2	412	c.81C>A	c.(79-81)acC>acA	p.T27T	GYPC_ENST00000464053.1_3'UTR|GYPC_ENST00000409836.3_Intron|GYPC_ENST00000356887.7_Silent_p.T6T	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	27						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		CTGCCTCCACCACAATGCATA	0.532																																					Melanoma(110;806 1600 6704 9981 33404)	uc002tnq.2		NA																	0				central_nervous_system(1)	1						c.(79-81)ACC>ACA		glycophorin C isoform 1							143.0	109.0	120.0					2																	127447862		2203	4300	6503	SO:0001819	synonymous_variant	2995					cortical cytoskeleton|integral to plasma membrane	protein binding	g.chr2:127447862C>A		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.81C>A	2.37:g.127447862C>A			Somatic				GYPC_uc002tnr.2_Intron|GYPC_uc010flv.2_RNA	p.T27T	NM_002101	NP_002092	WXS	Illumina HiSeq	Unspecified	P04921	GLPC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.075)	2	237	+	Colorectal(110;0.0533)		27			Extracellular.		B2R522|Q53SV9|Q92642	Silent	SNP	ENST00000259254.4	37	c.81C>A	CCDS2136.1																																																																																				0.532	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101		8	38	1	0	0.000442599	0.000491155	8	38				
GYPC	2995	broad.mit.edu	37	2	127453707	127453707	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:127453707T>G	ENST00000259254.4	+	4	707	c.376T>G	c.(376-378)Tac>Gac	p.Y126D	GYPC_ENST00000464053.1_3'UTR|GYPC_ENST00000409836.3_Missense_Mutation_p.Y107D|GYPC_ENST00000356887.7_Missense_Mutation_p.Y105D	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	126						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		CAGAAAGGAGTACTTTATTTG	0.552																																					Melanoma(110;806 1600 6704 9981 33404)	uc002tnq.2		NA																	0				central_nervous_system(1)	1						c.(376-378)TAC>GAC		glycophorin C isoform 1							94.0	79.0	84.0					2																	127453707		2203	4300	6503	SO:0001583	missense	2995					cortical cytoskeleton|integral to plasma membrane	protein binding	g.chr2:127453707T>G		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.376T>G	2.37:g.127453707T>G	ENSP00000259254:p.Tyr126Asp		Somatic				GYPC_uc002tnr.2_Missense_Mutation_p.Y107D|GYPC_uc010flv.2_RNA	p.Y126D	NM_002101	NP_002092	WXS	Illumina HiSeq	Unspecified	P04921	GLPC_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.075)	4	532	+	Colorectal(110;0.0533)		126			Cytoplasmic.		B2R522|Q53SV9|Q92642	Missense_Mutation	SNP	ENST00000259254.4	37	c.376T>G	CCDS2136.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111540	0.77210	.	.	ENSG00000136732	ENST00000259254;ENST00000356887;ENST00000409836	T;T;T	0.37411	1.6;1.2;1.82	5.22	5.22	0.72569	.	.	.	.	.	T	0.63640	0.2528	M	0.85630	2.765	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.70468	-0.4863	9	0.87932	D	0	-5.0711	13.9264	0.63966	0.0:0.0:0.0:1.0	.	105;126	P04921-2;P04921	.;GLPC_HUMAN	D	126;105;107	ENSP00000259254:Y126D;ENSP00000349354:Y105D;ENSP00000386904:Y107D	ENSP00000259254:Y126D	Y	+	1	0	GYPC	127170177	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.472000	0.80996	1.971000	0.57363	0.459000	0.35465	TAC		0.552	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101		8	19	0	0	0	0	8	19				
IWS1	55677	broad.mit.edu	37	2	128262822	128262822	+	Silent	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:128262822A>G	ENST00000295321.4	-	3	916	c.657T>C	c.(655-657)ccT>ccC	p.P219P	IWS1_ENST00000455721.2_Silent_p.P226P|AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000486662.1_5'UTR	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	219	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CACTGACCTGAGGTTTAGGAA	0.512																																						uc002ton.2		NA																	0				ovary(1)	1						c.(655-657)CCT>CCC		IWS1 homolog							130.0	138.0	135.0					2																	128262822		2203	4300	6503	SO:0001819	synonymous_variant	55677				transcription, DNA-dependent	nucleus	DNA binding	g.chr2:128262822A>G	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.657T>C	2.37:g.128262822A>G			Somatic				IWS1_uc010yzl.1_RNA|IWS1_uc010fma.2_RNA	p.P219P	NM_017969	NP_060439	WXS	Illumina HiSeq	Unspecified	Q96ST2	IWS1_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0735)	3	960	-	Colorectal(110;0.1)		219			Glu-rich.		Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Silent	SNP	ENST00000295321.4	37	c.657T>C	CCDS2146.1																																																																																				0.512	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969		32	195	0	0	0	0	32	195				
AMER3	205147	broad.mit.edu	37	2	131521962	131521962	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:131521962C>A	ENST00000423981.1	+	2	2427	c.2317C>A	c.(2317-2319)Cag>Aag	p.Q773K	AMER3_ENST00000321420.4_Missense_Mutation_p.Q773K	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	773					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										TGTGGAGGACCAGCCCTTGCA	0.672																																						uc002trw.2		NA																	0				pancreas(2)|ovary(1)	3						c.(2317-2319)CAG>AAG		hypothetical protein LOC205147							27.0	27.0	27.0					2																	131521962		2203	4300	6503	SO:0001583	missense	205147							g.chr2:131521962C>A	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2317C>A	2.37:g.131521962C>A	ENSP00000392700:p.Gln773Lys		Somatic				FAM123C_uc010fmv.2_Missense_Mutation_p.Q773K|FAM123C_uc010fms.1_Missense_Mutation_p.Q773K|FAM123C_uc010fmt.1_Missense_Mutation_p.Q773K|FAM123C_uc010fmu.1_Missense_Mutation_p.Q773K	p.Q773K	NM_152698	NP_689911	WXS	Illumina HiSeq	Unspecified	Q8N944	F123C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	2	2507	+	Colorectal(110;0.1)		773					B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	c.2317C>A	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.758782	0.00657	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.42513	0.97;0.97	2.79	0.609	0.17575	.	2.004290	0.02820	N	0.125403	T	0.23451	0.0567	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.14227	-1.0480	10	0.02654	T	1	.	3.3804	0.07252	0.0:0.5564:0.258:0.1856	.	773	Q8N944	F123C_HUMAN	K	773	ENSP00000314914:Q773K;ENSP00000392700:Q773K	ENSP00000314914:Q773K	Q	+	1	0	FAM123C	131238432	0.139000	0.22563	0.002000	0.10522	0.006000	0.05464	0.182000	0.16900	0.135000	0.18707	0.462000	0.41574	CAG		0.672	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		5	26	1	0	1.24e-05	1.45e-05	5	26				
LRP1B	53353	broad.mit.edu	37	2	141208173	141208173	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:141208173C>A	ENST00000389484.3	-	63	10992	c.10021G>T	c.(10021-10023)Gac>Tac	p.D3341Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3341	LDL-receptor class A 21. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D3341Y(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCACCACAGTCATCCACGGTG	0.358										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		lung(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(10021-10023)GAC>TAC		low density lipoprotein-related protein 1B							127.0	125.0	126.0					2																	141208173		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141208173C>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10021G>T	2.37:g.141208173C>A	ENSP00000374135:p.Asp3341Tyr	TSP Lung(27;0.18)	Somatic					p.D3341Y	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	63	10993	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	3341			Extracellular (Potential).|LDL-receptor class A 21.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.10021G>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.943776	0.92593	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99042	-5.36	5.51	5.51	0.81932	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99701	0.9886	H	0.99475	4.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97154	0.9833	10	0.87932	D	0	.	19.769	0.96353	0.0:1.0:0.0:0.0	.	3341	Q9NZR2	LRP1B_HUMAN	Y	3341;3279	ENSP00000374135:D3341Y	ENSP00000374135:D3341Y	D	-	1	0	LRP1B	140924643	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.741000	0.84997	2.757000	0.94681	0.585000	0.79938	GAC		0.358	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		18	51	1	0	8.34e-07	1e-06	18	51				
TTN	7273	broad.mit.edu	37	2	179395327	179395327	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:179395327C>T	ENST00000591111.1	-	308	101316	c.101092G>A	c.(101092-101094)Gat>Aat	p.D33698N	TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D26399N|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D32771N|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D35339N|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.D26274N|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D26466N|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000604571.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33698	Ig-like 148.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGGTACCATCTGCTGAATAA	0.393																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(98311-98313)GAT>AAT		titin isoform N2-A							113.0	102.0	105.0					2																	179395327		1860	4111	5971	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179395327C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.101092G>A	2.37:g.179395327C>T	ENSP00000465570:p.Asp33698Asn		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D26466N|TTN_uc010zfi.1_Missense_Mutation_p.D26399N|TTN_uc010zfj.1_Missense_Mutation_p.D26274N|TTN_uc002umq.2_5'Flank	p.D32771N	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		307	98535	-			33698					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.98311G>A		.	.	.	.	.	.	.	.	.	.	C	17.27	3.347707	0.61183	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	5.23	5.23	0.72850	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49983	0.1589	L	0.28014	0.82	0.42349	D	0.99236	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.55412	-0.8145	9	0.87932	D	0	.	18.8263	0.92121	0.0:1.0:0.0:0.0	.	26274;26399;26466;33698	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	32771;26274;26466;26399;26271	ENSP00000343764:D32771N;ENSP00000434586:D26274N;ENSP00000340554:D26466N;ENSP00000352154:D26399N	ENSP00000340554:D26466N	D	-	1	0	TTN	179103573	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.788000	0.62439	2.453000	0.82957	0.561000	0.74099	GAT		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		3	61	0	0	0	0	3	61				
SLC4A3	6508	broad.mit.edu	37	2	220501091	220501091	+	Silent	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:220501091C>G	ENST00000358055.3	+	15	2771	c.2259C>G	c.(2257-2259)ctC>ctG	p.L753L	SLC4A3_ENST00000373762.3_Silent_p.L780L|SLC4A3_ENST00000273063.6_Silent_p.L780L|SLC4A3_ENST00000373760.2_Silent_p.L753L|SLC4A3_ENST00000317151.3_Silent_p.L753L			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	753	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCGGCGTCCTCTTCTCTCTGC	0.622																																						uc002vmp.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5						c.(2257-2259)CTC>CTG		solute carrier family 4, anion exchanger, member							110.0	94.0	100.0					2																	220501091		2203	4299	6502	SO:0001819	synonymous_variant	6508				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity	g.chr2:220501091C>G		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2259C>G	2.37:g.220501091C>G			Somatic				SLC4A3_uc002vmo.3_Silent_p.L780L|SLC4A3_uc010fwm.2_Silent_p.L303L|SLC4A3_uc010fwn.1_Silent_p.L262L	p.L753L	NM_005070	NP_005061	WXS	Illumina HiSeq	Unspecified	P48751	B3A3_HUMAN		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	15	2528	+		Renal(207;0.0183)	753			Helical; (Potential).|Membrane (anion exchange).		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	37	c.2259C>G	CCDS2445.1																																																																																				0.622	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070		21	52	0	0	0	0	21	52				
EPHA4	2043	broad.mit.edu	37	2	222347263	222347263	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr2:222347263T>A	ENST00000281821.2	-	5	1168	c.1127A>T	c.(1126-1128)aAg>aTg	p.K376M	EPHA4_ENST00000409854.1_Missense_Mutation_p.K376M|EPHA4_ENST00000409938.1_Missense_Mutation_p.K376M|EPHA4_ENST00000392071.4_Missense_Mutation_p.K325M	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	376	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGGTCGGCACTTGCTGGGGTC	0.517																																						uc002vmq.2		NA																	0				lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12						c.(1126-1128)AAG>ATG		ephrin receptor EphA4 precursor							210.0	219.0	216.0					2																	222347263		2203	4300	6503	SO:0001583	missense	2043					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr2:222347263T>A	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1127A>T	2.37:g.222347263T>A	ENSP00000281821:p.Lys376Met		Somatic				EPHA4_uc002vmr.2_Missense_Mutation_p.K376M|EPHA4_uc010zlm.1_Missense_Mutation_p.K317M|EPHA4_uc010zln.1_Missense_Mutation_p.K376M	p.K376M	NM_004438	NP_004429	WXS	Illumina HiSeq	Unspecified	P54764	EPHA4_HUMAN		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)	5	1169	-		Renal(207;0.0183)	376			Extracellular (Potential).|Fibronectin type-III 1.		A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	37	c.1127A>T	CCDS2447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.12|16.12	3.032722|3.032722	0.54790|0.54790	.|.	.|.	ENSG00000116106|ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071;ENST00000443796|ENST00000441679	T;T;T;T;T|.	0.73047|.	-0.7;-0.71;-0.7;-0.71;3.91|.	6.06|6.06	4.93|4.93	0.64822|0.64822	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.101122|.	0.64402|.	D|.	0.000002|.	T|T	0.34337|0.34337	0.0894|0.0894	N|N	0.24115|0.24115	0.695|0.695	0.32759|0.32759	N|N	0.505369|0.505369	B|.	0.29432|.	0.244|.	B|.	0.39152|.	0.292|.	T|T	0.42361|0.42361	-0.9456|-0.9456	10|5	0.52906|.	T|.	0.07|.	.|.	5.5375|5.5375	0.17020|0.17020	0.0:0.2657:0.0:0.7343|0.0:0.2657:0.0:0.7343	.|.	376|.	P54764|.	EPHA4_HUMAN|.	M|C	376;376;376;325;80|113	ENSP00000281821:K376M;ENSP00000386276:K376M;ENSP00000386829:K376M;ENSP00000375923:K325M;ENSP00000395917:K80M|.	ENSP00000281821:K376M|.	K|S	-|-	2|1	0|0	EPHA4|EPHA4	222055507|222055507	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	2.158000|2.158000	0.42329|0.42329	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	AAG|AGT		0.517	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3			61	182	0	0	0	0	61	182				
SEL1L2	80343	broad.mit.edu	37	20	13846030	13846030	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr20:13846030A>G	ENST00000284951.5	-	16	1609	c.1535T>C	c.(1534-1536)gTa>gCa	p.V512A	SEL1L2_ENST00000378072.5_Intron|SEL1L2_ENST00000486903.1_Intron			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	512						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						GCTTTGAGCTACTTCATACCC	0.383																																						uc010gcf.2		NA																	0				ovary(2)	2						c.(1534-1536)GTA>GCA		sel-1 suppressor of lin-12-like 2 precursor							146.0	143.0	144.0					20																	13846030		1872	4098	5970	SO:0001583	missense	80343					integral to membrane	binding	g.chr20:13846030A>G	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1535T>C	20.37:g.13846030A>G	ENSP00000284951:p.Val512Ala		Somatic				SEL1L2_uc002woq.3_Missense_Mutation_p.V373A|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	p.V512A	NM_025229	NP_079505	WXS	Illumina HiSeq	Unspecified	Q5TEA6	SE1L2_HUMAN			16	1617	-			512			Extracellular (Potential).		B4DXX5	Missense_Mutation	SNP	ENST00000284951.5	37	c.1535T>C		.	.	.	.	.	.	.	.	.	.	A	18.73	3.685996	0.68157	.	.	ENSG00000101251	ENST00000284951	T	0.49720	0.77	5.78	5.78	0.91487	Tetratricopeptide-like helical (1);	0.000000	0.52532	D	0.000080	T	0.67126	0.2860	M	0.78049	2.395	0.58432	D	0.999995	D	0.69078	0.997	D	0.72625	0.978	T	0.65689	-0.6107	10	0.25751	T	0.34	-19.0967	14.0601	0.64795	1.0:0.0:0.0:0.0	.	512	Q5TEA6	SE1L2_HUMAN	A	512	ENSP00000284951:V512A	ENSP00000284951:V512A	V	-	2	0	SEL1L2	13794030	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.529000	0.73812	2.194000	0.70268	0.533000	0.62120	GTA		0.383	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229		31	76	0	0	0	0	31	76				
DZANK1	55184	broad.mit.edu	37	20	18379176	18379176	+	Silent	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr20:18379176C>T	ENST00000358866.6	-	13	1549	c.1527G>A	c.(1525-1527)agG>agA	p.R509R	DZANK1_ENST00000357236.4_Silent_p.R395R|DZANK1_ENST00000329494.5_Silent_p.R511R|DZANK1_ENST00000262547.5_Silent_p.R509R|DZANK1_ENST00000487128.1_5'UTR			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	509							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						CCTTTCCCATCCTGGGTTCTG	0.512																																						uc010zsa.1		NA																	0				ovary(1)	1						c.(1582-1584)AGG>AGA		hypothetical protein LOC55184							142.0	141.0	141.0					20																	18379176		1960	4151	6111	SO:0001819	synonymous_variant	55184					intracellular	zinc ion binding	g.chr20:18379176C>T	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1527G>A	20.37:g.18379176C>T			Somatic				C20orf12_uc010zrz.1_Silent_p.R47R|C20orf12_uc002wqp.3_Silent_p.R219R|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Silent_p.R395R|C20orf12_uc002wqq.3_Silent_p.R509R	p.R528R	NM_001099407	NP_001092877	WXS	Illumina HiSeq	Unspecified	Q9NVP4	CT012_HUMAN			14	1793	-		Myeloproliferative disorder(85;0.0122)	336					B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Silent	SNP	ENST00000358866.6	37	c.1584G>A	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255186	0.22965	.	.	ENSG00000089091	ENST00000358866	.	.	.	5.39	4.45	0.53987	.	.	.	.	.	T	0.56717	0.2004	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54437	-0.8294	4	.	.	.	-25.2442	7.1437	0.25570	0.0:0.7086:0.0:0.2914	.	.	.	.	E	308	.	.	G	-	2	0	C20orf12	18327176	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.457000	0.21875	1.409000	0.46915	0.655000	0.94253	GGA		0.512	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407		23	72	0	0	0	0	23	72				
ASXL1	171023	broad.mit.edu	37	20	31024686	31024686	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr20:31024686A>T	ENST00000375687.4	+	13	4595	c.4171A>T	c.(4171-4173)Agt>Tgt	p.S1391C	ASXL1_ENST00000306058.5_Missense_Mutation_p.S1386C	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1391					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TACTGGGCATAGTCCCCTGGA	0.542			"""F, N, Mis"""		"""MDS, CMML"""																																	uc002wxs.2		NA		Rec	yes		20	20q11.1	171023	F|N|Mis	additional sex combs like 1			L			MDS|CMML		0				haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248						c.(4171-4173)AGT>TGT		additional sex combs like 1 isoform 1							92.0	97.0	96.0					20																	31024686		2203	4300	6503	SO:0001583	missense	171023				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding	g.chr20:31024686A>T	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.4171A>T	20.37:g.31024686A>T	ENSP00000364839:p.Ser1391Cys		Somatic				ASXL1_uc010geb.2_Missense_Mutation_p.S1282C	p.S1391C	NM_015338	NP_056153	WXS	Illumina HiSeq	Unspecified	Q8IXJ9	ASXL1_HUMAN			12	4597	+			1391					B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	c.4171A>T	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	A	7.979	0.750737	0.15778	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.15718	2.4;2.4	4.69	3.65	0.41850	.	0.236109	0.38058	N	0.001828	T	0.11537	0.0281	N	0.19112	0.55	0.09310	N	1	D;D	0.60575	0.988;0.988	P;P	0.46975	0.533;0.533	T	0.12578	-1.0542	10	0.66056	D	0.02	-9.7983	3.5243	0.07753	0.6199:0.233:0.1471:0.0	.	1386;1391	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	C	1391;1391;1391;1312;1386	ENSP00000364839:S1391C;ENSP00000305119:S1386C	ENSP00000305119:S1386C	S	+	1	0	ASXL1	30488347	0.002000	0.14202	0.307000	0.25127	0.006000	0.05464	1.408000	0.34668	1.276000	0.44395	0.533000	0.62120	AGT		0.542	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338		24	102	0	0	0	0	24	102				
DSCAM	1826	broad.mit.edu	37	21	41711115	41711115	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr21:41711115C>T	ENST00000400454.1	-	7	1915	c.1438G>A	c.(1438-1440)Gga>Aga	p.G480R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	480	Ig-like C2-type 5.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CGGTAGACTCCCCCGTCCCGG	0.562																																					Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(1438-1440)GGA>AGA		Down syndrome cell adhesion molecule isoform							76.0	80.0	78.0					21																	41711115		2057	4194	6251	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41711115C>T	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1438G>A	21.37:g.41711115C>T	ENSP00000383303:p.Gly480Arg		Somatic				DSCAM_uc002yyr.1_RNA	p.G480R	NM_001389	NP_001380	WXS	Illumina HiSeq	Unspecified	O60469	DSCAM_HUMAN			7	1890	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	480			Extracellular (Potential).|Ig-like C2-type 5.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.1438G>A	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725367	0.68959	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.81247	-1.47;-1.11	5.97	5.97	0.96955	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.055235	0.64402	D	0.000001	D	0.93759	0.8005	H	0.99336	4.52	0.80722	D	1	P	0.51147	0.942	P	0.56434	0.798	D	0.95366	0.8460	10	0.62326	D	0.03	.	20.3983	0.98986	0.0:1.0:0.0:0.0	.	480	O60469	DSCAM_HUMAN	R	480;232	ENSP00000383303:G480R;ENSP00000385342:G232R	ENSP00000383303:G480R	G	-	1	0	DSCAM	40632985	1.000000	0.71417	0.988000	0.46212	0.055000	0.15305	7.681000	0.84073	2.825000	0.97269	0.655000	0.94253	GGA		0.562	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		17	26	0	0	0	0	17	26				
FAM207A	85395	broad.mit.edu	37	21	46386972	46386972	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr21:46386972G>C	ENST00000291634.6	+	4	424	c.376G>C	c.(376-378)Gag>Cag	p.E126Q	FAM207A_ENST00000479127.1_3'UTR|FAM207A_ENST00000397826.3_Missense_Mutation_p.E111Q	NM_058190.2	NP_478070.1	Q9NSI2	F207A_HUMAN	family with sequence similarity 207, member A	126																	AAAACTGGCTGAGCAGAAGCA	0.637																																						uc002zgl.2		NA																	0					0						c.(376-378)GAG>CAG		hypothetical protein LOC85395							21.0	23.0	22.0					21																	46386972		2200	4298	6498	SO:0001583	missense	85395							g.chr21:46386972G>C		CCDS13718.1	21q22.3	2011-08-15	2011-08-15	2011-08-15	ENSG00000160256	ENSG00000160256			15811	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 70"""	C21orf70			Standard	NM_058190		Approved	PRED56	uc002zgl.3	Q9NSI2	OTTHUMG00000090293	ENST00000291634.6:c.376G>C	21.37:g.46386972G>C	ENSP00000291634:p.Glu126Gln		Somatic				C21orf70_uc002zgm.2_Missense_Mutation_p.E111Q	p.E126Q	NM_058190	NP_478070	WXS	Illumina HiSeq	Unspecified	Q9NSI2	CU070_HUMAN		Colorectal(79;0.248)	4	394	+			126						Missense_Mutation	SNP	ENST00000291634.6	37	c.376G>C	CCDS13718.1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.233583	0.22626	.	.	ENSG00000160256	ENST00000291634;ENST00000397826;ENST00000458015	T;T;T	0.42513	0.97;0.97;0.97	3.58	1.71	0.24356	.	0.374618	0.25689	N	0.028942	T	0.45856	0.1363	L	0.48877	1.53	0.20074	N	0.999934	D;D	0.67145	0.996;0.996	P;D	0.63877	0.856;0.919	T	0.20042	-1.0287	10	0.35671	T	0.21	-22.4931	4.2732	0.10796	0.1199:0.0:0.6559:0.2243	.	111;126	Q9NSI2-2;Q9NSI2	.;F207A_HUMAN	Q	126;111;111	ENSP00000291634:E126Q;ENSP00000380926:E111Q;ENSP00000404964:E111Q	ENSP00000291634:E126Q	E	+	1	0	C21orf70	45211400	0.882000	0.30256	0.360000	0.25837	0.314000	0.28054	1.199000	0.32235	0.472000	0.27344	0.563000	0.77884	GAG		0.637	FAM207A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206639.1	NM_058190		11	11	0	0	0	0	11	11				
COL6A1	1291	broad.mit.edu	37	21	47423497	47423497	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr21:47423497C>A	ENST00000361866.3	+	35	2771	c.2657C>A	c.(2656-2658)cCa>cAa	p.P886Q	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	886	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CAGCAGCGCCCAGAGCGGGCG	0.687																																						uc002zhu.1		NA																	0				ovary(1)	1						c.(2656-2658)CCA>CAA		collagen, type VI, alpha 1 precursor	Palifermin(DB00039)						26.0	28.0	27.0					21																	47423497		2201	4296	6497	SO:0001583	missense	1291				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding	g.chr21:47423497C>A	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2657C>A	21.37:g.47423497C>A	ENSP00000355180:p.Pro886Gln		Somatic				COL6A1_uc010gqd.1_Missense_Mutation_p.P217Q|COL6A1_uc002zhv.1_Missense_Mutation_p.P217Q|COL6A1_uc002zhw.1_5'UTR	p.P886Q	NM_001848	NP_001839	WXS	Illumina HiSeq	Unspecified	P12109	CO6A1_HUMAN		Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	35	2759	+	all_hematologic(128;0.24)		886			C-terminal globular domain.|VWFA 3.		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	c.2657C>A	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.328596	0.41197	.	.	ENSG00000142156	ENST00000361866	D	0.90385	-2.66	4.41	4.41	0.53225	von Willebrand factor, type A (3);	0.656970	0.14686	N	0.304464	D	0.89248	0.6661	N	0.14661	0.345	0.35626	D	0.809832	D	0.76494	0.999	D	0.85130	0.997	D	0.85708	0.1317	10	0.13108	T	0.6	-19.55	12.3857	0.55330	0.0:1.0:0.0:0.0	.	886	P12109	CO6A1_HUMAN	Q	886	ENSP00000355180:P886Q	ENSP00000355180:P886Q	P	+	2	0	COL6A1	46247925	0.953000	0.32496	0.670000	0.29842	0.134000	0.20937	2.756000	0.47549	2.291000	0.77112	0.530000	0.56133	CCA		0.687	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848		6	25	1	0	0.00116845	0.00125943	6	25				
SMARCB1	6598	broad.mit.edu	37	22	24133989	24133989	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr22:24133989A>C	ENST00000263121.7	+	2	336	c.140A>C	c.(139-141)tAc>tCc	p.Y47S	SMARCB1_ENST00000407422.3_Missense_Mutation_p.Y47S|SMARCB1_ENST00000407082.3_Missense_Mutation_p.Y47S|SMARCB1_ENST00000344921.6_Missense_Mutation_p.Y47S	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	47					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.Y47fs*22(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				TACAAGAGATACCCCTCACTC	0.478			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																uc002zyb.2		NA	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	D|N|F|S	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""			M		malignant rhabdoid	malignant rhabdoid 		3	Unknown(2)|Deletion - Frameshift(1)	p.Y47*(6)|p.?(2)|p.Y47fs*22(1)	soft_tissue(3)	soft_tissue(193)|central_nervous_system(172)|haematopoietic_and_lymphoid_tissue(23)|meninges(5)|skin(5)|bone(4)|ovary(2)|endometrium(1)|lung(1)|pancreas(1)	407						c.(139-141)TAC>TCC		SWI/SNF related, matrix associated, actin							133.0	122.0	125.0					22																	24133989		2203	4300	6503	SO:0001583	missense	6598	Rhabdoid_Predisposition_syndrome|Schwannomatosis			cell cycle|chromatin remodeling|DNA integration|interspecies interaction between organisms|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|retroviral genome replication|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleolus|nucleoplasm|SWI/SNF complex	p53 binding	g.chr22:24133989A>C	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.140A>C	22.37:g.24133989A>C	ENSP00000263121:p.Tyr47Ser		Somatic				SMARCB1_uc002zyg.2_Missense_Mutation_p.Y47S|SMARCB1_uc011ajb.1_Missense_Mutation_p.Y47S|SMARCB1_uc002zya.2_Missense_Mutation_p.Y47S|SMARCB1_uc002zyc.2_Missense_Mutation_p.Y47S|SMARCB1_uc002zyd.2_Missense_Mutation_p.Y47S|SMARCB1_uc002zye.1_Missense_Mutation_p.Y10S|SMARCB1_uc002zyf.1_RNA|SMARCB1_uc010gue.1_RNA	p.Y47S	NM_003073	NP_003064	WXS	Illumina HiSeq	Unspecified	Q12824	SNF5_HUMAN			2	347	+		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)	47					O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	37	c.140A>C	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284295	0.80803	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32	5.59	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.96160	0.8748	M	0.78801	2.425	0.80722	D	1	P;D;D;D;D;D	0.89917	0.946;1.0;1.0;1.0;0.992;0.995	P;D;D;D;D;D	0.80764	0.723;0.981;0.994;0.983;0.927;0.979	D	0.96069	0.9044	10	0.87932	D	0	-23.0593	12.4654	0.55755	0.86:0.1399:0.0:0.0	.	47;47;47;47;47;47	B4E117;B4DRT1;G5E975;Q17S11;Q12824;C9JTA6	.;.;.;.;SNF5_HUMAN;.	S	47	ENSP00000388489:Y47S;ENSP00000340883:Y47S;ENSP00000263121:Y47S;ENSP00000383984:Y47S;ENSP00000385226:Y47S	ENSP00000263121:Y47S	Y	+	2	0	SMARCB1	22463989	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.028000	0.93712	1.051000	0.40369	0.529000	0.55759	TAC		0.478	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073		13	147	0	0	0	0	13	147				
HMGXB4	10042	broad.mit.edu	37	22	35661578	35661578	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr22:35661578G>C	ENST00000216106.5	+	5	1325	c.1197G>C	c.(1195-1197)gaG>gaC	p.E399D	HMGXB4_ENST00000444518.2_Missense_Mutation_p.E290D	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	399					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						aggacaaagagagagagagag	0.463																																						uc003anl.2		NA																	0				breast(1)|skin(1)	2						c.(1195-1197)GAG>GAC		high-mobility group protein 2-like 1							14.0	16.0	15.0					22																	35661578		2171	4279	6450	SO:0001583	missense	10042				endosome to lysosome transport|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	NURF complex	DNA binding	g.chr22:35661578G>C	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1197G>C	22.37:g.35661578G>C	ENSP00000216106:p.Glu399Asp		Somatic				HMGXB4_uc011amh.1_Missense_Mutation_p.E290D|HMGXB4_uc003ank.2_Missense_Mutation_p.E290D	p.E399D	NM_001003681	NP_001003681	WXS	Illumina HiSeq	Unspecified	Q9UGU5	HMGX4_HUMAN			5	1371	+			399					O75672|O75673|Q9UMT5	Missense_Mutation	SNP	ENST00000216106.5	37	c.1197G>C	CCDS33641.1	.	.	.	.	.	.	.	.	.	.	G	6.885	0.532820	0.13127	.	.	ENSG00000100281	ENST00000444518;ENST00000216106	T;T	0.19105	2.17;2.17	5.74	-0.342	0.12635	High mobility group, superfamily (1);	0.483830	0.22837	N	0.055037	T	0.09379	0.0231	N	0.14661	0.345	0.26941	N	0.966251	B	0.13145	0.007	B	0.10450	0.005	T	0.31806	-0.9930	9	.	.	.	-9.7135	6.9359	0.24466	0.2499:0.2085:0.5415:0.0	.	399	Q9UGU5	HMGX4_HUMAN	D	290;399	ENSP00000398302:E290D;ENSP00000216106:E399D	.	E	+	3	2	HMGXB4	33991578	0.126000	0.22350	0.981000	0.43875	0.907000	0.53573	-0.806000	0.04525	0.045000	0.15804	0.650000	0.86243	GAG		0.463	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487		6	21	0	0	0	0	6	21				
GGA1	26088	broad.mit.edu	37	22	38016247	38016247	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr22:38016247T>C	ENST00000343632.4	+	5	692	c.306T>C	c.(304-306)taT>taC	p.Y102Y	GGA1_ENST00000381756.5_Silent_p.Y119Y|GGA1_ENST00000337437.4_Silent_p.Y69Y|GGA1_ENST00000406772.1_Silent_p.Y29Y|GGA1_ENST00000325180.8_Silent_p.Y102Y	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	102	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					CCCTGAAGTATCTGGGCTCTC	0.592																																						uc003atc.2		NA																	0				breast(2)|ovary(1)	3						c.(304-306)TAT>TAC		golgi associated, gamma adaptin ear containing,							116.0	108.0	111.0					22																	38016247		2203	4300	6503	SO:0001819	synonymous_variant	26088				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding	g.chr22:38016247T>C	AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.306T>C	22.37:g.38016247T>C			Somatic				GGA1_uc003atd.2_Silent_p.Y102Y|GGA1_uc003ate.2_Silent_p.Y102Y|GGA1_uc003atf.2_Silent_p.Y29Y	p.Y102Y	NM_013365	NP_037497	WXS	Illumina HiSeq	Unspecified	Q9UJY5	GGA1_HUMAN			5	671	+	Melanoma(58;0.0574)		102			VHS.		A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Silent	SNP	ENST00000343632.4	37	c.306T>C	CCDS13951.1																																																																																				0.592	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075873.3	NM_013365		51	89	0	0	0	0	51	89				
SRGAP3	9901	broad.mit.edu	37	3	9027554	9027554	+	Silent	SNP	C	C	A	rs147085328	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:9027554C>A	ENST00000383836.3	-	22	3376	c.2949G>T	c.(2947-2949)acG>acT	p.T983T	SRGAP3_ENST00000360413.3_Silent_p.T959T	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	983					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CCTGCTTGACCGTGTTCTGCC	0.647			T	RAF1	pilocytic astrocytoma																																	uc003brf.1		NA		Dom	yes		3	3p25.3	9901	T	SLIT-ROBO Rho GTPase activating protein 3			M	RAF1		pilocytic astrocytoma	SRGAP3/RAF1(4)	0				central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9						c.(2947-2949)ACG>ACT		SLIT-ROBO Rho GTPase activating protein 3							54.0	54.0	54.0					3																	9027554		2203	4300	6503	SO:0001819	synonymous_variant	9901				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr3:9027554C>A	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2949G>T	3.37:g.9027554C>A			Somatic				SRGAP3_uc003brg.1_Silent_p.T959T	p.T983T	NM_014850	NP_055665	WXS	Illumina HiSeq	Unspecified	O43295	SRGP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.0563)	22	3625	-			983			Potential.		Q8IX13|Q8IZV8	Silent	SNP	ENST00000383836.3	37	c.2949G>T	CCDS2572.1																																																																																				0.647	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3			15	46	1	0	1.52e-12	2.01e-12	15	46				
TGM4	7047	broad.mit.edu	37	3	44929184	44929184	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:44929184C>G	ENST00000296125.4	+	3	265	c.197C>G	c.(196-198)cCg>cGg	p.P66R		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	66					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TCTCCAGGGCCGAATCCTAGC	0.592																																						uc003coc.3		NA																	0				ovary(1)	1						c.(196-198)CCG>CGG		transglutaminase 4 (prostate)	L-Glutamine(DB00130)						62.0	61.0	61.0					3																	44929184		2203	4300	6503	SO:0001583	missense	7047				peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity	g.chr3:44929184C>G	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.197C>G	3.37:g.44929184C>G	ENSP00000296125:p.Pro66Arg		Somatic				TGM4_uc003coa.2_Missense_Mutation_p.P66R|TGM4_uc003cob.2_Intron	p.P66R	NM_003241	NP_003232	WXS	Illumina HiSeq	Unspecified	P49221	TGM4_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	3	270	+			66					Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	c.197C>G	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	C	1.821	-0.472297	0.04445	.	.	ENSG00000163810	ENST00000296125	D	0.87256	-2.23	1.63	-3.27	0.05048	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	2.353210	0.04544	N	0.388657	D	0.84347	0.5452	M	0.72118	2.19	0.09310	N	1	B;B	0.29805	0.257;0.023	B;B	0.35859	0.212;0.014	T	0.65121	-0.6245	10	0.21540	T	0.41	.	3.7635	0.08613	0.0:0.2935:0.3962:0.3104	.	66;66	P49221;B4YUQ1	TGM4_HUMAN;.	R	66	ENSP00000296125:P66R	ENSP00000296125:P66R	P	+	2	0	TGM4	44904188	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-2.241000	0.01196	-1.389000	0.02090	-0.444000	0.05651	CCG		0.592	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241		18	22	0	0	0	0	18	22				
ACY1	95	broad.mit.edu	37	3	52021202	52021202	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:52021202G>A	ENST00000404366.2	+	10	843	c.697G>A	c.(697-699)Gaa>Aaa	p.E233K	ACY1_ENST00000476854.1_Intron|ACY1_ENST00000494103.1_Missense_Mutation_p.E161K|ACY1_ENST00000458031.2_Missense_Mutation_p.E323K|ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.E334K|ACY1_ENST00000476351.1_Missense_Mutation_p.E198K	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	233			E -> D (in ACY1D; loss of activity). {ECO:0000269|PubMed:16465618}.		cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CCGGGAGAAGGAATGGCAGAG	0.552																																						uc003dcp.2		NA																	0				breast(1)|skin(1)	2						c.(697-699)GAA>AAA		aminoacylase 1	L-Aspartic Acid(DB00128)						94.0	101.0	99.0					3																	52021202		2203	4300	6503	SO:0001583	missense	95				cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity	g.chr3:52021202G>A	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.697G>A	3.37:g.52021202G>A	ENSP00000384296:p.Glu233Lys		Somatic				ACY1_uc011bea.1_Missense_Mutation_p.E323K|ACY1_uc011beb.1_Missense_Mutation_p.E233K|ACY1_uc003dcq.2_Missense_Mutation_p.E233K	p.E233K	NM_000666	NP_000657	WXS	Illumina HiSeq	Unspecified	Q03154	ACY1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	10	758	+			233		E -> D (in ACY1D; loss of activity).			C9J6I6|C9J9D8|C9JWD4	Missense_Mutation	SNP	ENST00000404366.2	37	c.697G>A	CCDS2844.1	.	.	.	.	.	.	.	.	.	.	G	34	5.302322	0.95601	.	.	ENSG00000114786;ENSG00000114786;ENSG00000114786;ENSG00000243989;ENSG00000243989;ENSG00000243989	ENST00000458031;ENST00000463937;ENST00000232907;ENST00000476351;ENST00000494103;ENST00000404366	T;T;T;T;T	0.57273	0.41;0.41;0.41;0.74;0.41	4.99	4.99	0.66335	Peptidase M20, dimerisation (2);	0.000000	0.85682	D	0.000000	T	0.76681	0.4021	M	0.90650	3.135	0.58432	D	0.999999	P;D;D	0.60160	0.95;0.987;0.974	P;D;D	0.67103	0.908;0.949;0.93	T	0.82552	-0.0400	10	0.87932	D	0	-16.0802	16.0592	0.80826	0.0:0.0:1.0:0.0	.	233;323;233	B4DPC3;B4DNW0;Q03154	.;.;ACY1_HUMAN	K	323;334;233;198;161;233	ENSP00000390557:E323K;ENSP00000420487:E334K;ENSP00000417056:E198K;ENSP00000417618:E161K;ENSP00000384296:E233K	ENSP00000384296:E233K	E	+	1	0	ACY1;RP11-155D18.11	51996242	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.099000	0.76981	2.333000	0.79357	0.561000	0.74099	GAA		0.552	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666		48	58	0	0	0	0	48	58				
MYH15	22989	broad.mit.edu	37	3	108195314	108195314	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:108195314A>T	ENST00000273353.3	-	13	1279	c.1223T>A	c.(1222-1224)gTa>gAa	p.V408E		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	408	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CAAGCACTTTACCAACTCAGA	0.383																																						uc003dxa.1		NA																	0				ovary(5)|central_nervous_system(2)	7						c.(1222-1224)GTA>GAA		myosin, heavy polypeptide 15							84.0	78.0	80.0					3																	108195314		1892	4119	6011	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108195314A>T	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1223T>A	3.37:g.108195314A>T	ENSP00000273353:p.Val408Glu		Somatic					p.V408E	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			13	1280	-			408			Myosin head-like.			Missense_Mutation	SNP	ENST00000273353.3	37	c.1223T>A	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122484	0.37436	.	.	ENSG00000144821	ENST00000273353	D	0.85773	-2.03	5.62	3.22	0.36961	Myosin head, motor domain (2);	.	.	.	.	D	0.83166	0.5195	L	0.28458	0.855	0.09310	N	0.999993	P	0.44877	0.845	P	0.52598	0.703	T	0.72861	-0.4164	9	0.87932	D	0	.	8.4349	0.32780	0.7994:0.1323:0.0683:0.0	.	408	Q9Y2K3	MYH15_HUMAN	E	408	ENSP00000273353:V408E	ENSP00000273353:V408E	V	-	2	0	MYH15	109678004	0.672000	0.27530	0.089000	0.20774	0.007000	0.05969	5.028000	0.64115	0.404000	0.25506	-1.123000	0.02005	GTA		0.383	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		4	34	0	0	0	0	4	34				
MORC1	27136	broad.mit.edu	37	3	108688550	108688550	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:108688550T>A	ENST00000483760.1	-	25	2550	c.2507A>T	c.(2506-2508)cAg>cTg	p.Q836L	MORC1_ENST00000232603.5_Missense_Mutation_p.Q857L					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTTGTTCATCTGCTCTGGGCA	0.363																																						uc003dxl.2		NA																	0				ovary(3)|skin(3)|breast(2)	8						c.(2569-2571)CAG>CTG		MORC family CW-type zinc finger 1							122.0	112.0	116.0					3																	108688550		2203	4300	6503	SO:0001583	missense	27136				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	g.chr3:108688550T>A	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2507A>T	3.37:g.108688550T>A	ENSP00000417282:p.Gln836Leu		Somatic				MORC1_uc011bhn.1_Missense_Mutation_p.Q836L	p.Q857L	NM_014429	NP_055244	WXS	Illumina HiSeq	Unspecified	Q86VD1	MORC1_HUMAN			26	2657	-			857						Missense_Mutation	SNP	ENST00000483760.1	37	c.2570A>T		.	.	.	.	.	.	.	.	.	.	T	1.452	-0.564795	0.03939	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06608	3.29;3.28	5.12	2.62	0.31277	.	1.986740	0.02112	N	0.054905	T	0.05960	0.0155	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.37220	-0.9715	10	0.27785	T	0.31	1.8189	4.8095	0.13337	0.1636:0.0891:0.0:0.7473	.	836;857	E7ERX1;Q86VD1	.;MORC1_HUMAN	L	857;836	ENSP00000232603:Q857L;ENSP00000417282:Q836L	ENSP00000232603:Q857L	Q	-	2	0	MORC1	110171240	0.103000	0.21917	0.095000	0.20976	0.108000	0.19459	0.771000	0.26633	0.455000	0.26910	-0.336000	0.08194	CAG		0.363	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			10	56	0	0	0	0	10	56				
COL6A6	131873	broad.mit.edu	37	3	130282012	130282012	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:130282012C>A	ENST00000358511.6	+	2	196	c.165C>A	c.(163-165)agC>agA	p.S55R	COL6A6_ENST00000453409.2_Missense_Mutation_p.S55R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	55	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AAATGATCAGCAGTCTCCCCA	0.502																																						uc010htl.2		NA																	0				ovary(6)|central_nervous_system(1)|pancreas(1)	8						c.(163-165)AGC>AGA		collagen type VI alpha 6 precursor							152.0	143.0	145.0					3																	130282012		1934	4133	6067	SO:0001583	missense	131873				axon guidance|cell adhesion	collagen		g.chr3:130282012C>A	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.165C>A	3.37:g.130282012C>A	ENSP00000351310:p.Ser55Arg		Somatic					p.S55R	NM_001102608	NP_001096078	WXS	Illumina HiSeq	Unspecified	A6NMZ7	CO6A6_HUMAN			2	196	+			55			Nonhelical region.|VWFA 1.		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	c.165C>A	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.416043	0.25552	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78707	-1.2;-1.2	5.36	3.54	0.40534	von Willebrand factor, type A (3);	0.786434	0.11991	N	0.509844	T	0.65554	0.2702	L	0.38175	1.15	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.50474	-0.8824	10	0.21014	T	0.42	.	7.5589	0.27839	0.1359:0.7156:0.0:0.1486	.	55	A6NMZ7	CO6A6_HUMAN	R	55	ENSP00000351310:S55R;ENSP00000399236:S55R	ENSP00000351310:S55R	S	+	3	2	COL6A6	131764702	0.000000	0.05858	0.724000	0.30704	0.939000	0.58152	-0.014000	0.12656	1.391000	0.46566	0.561000	0.74099	AGC		0.502	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608		22	118	1	0	7.45e-12	9.7e-12	22	118				
PLSCR2	57047	broad.mit.edu	37	3	146173132	146173132	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:146173132G>T	ENST00000497985.1	-	6	873	c.434C>A	c.(433-435)tCt>tAt	p.S145Y	PLSCR2_ENST00000336685.2_Missense_Mutation_p.S72Y	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	145					phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						AAAAGGTCTAGACCGCCCACA	0.413																																						uc003evv.1		NA																	0					0						c.(214-216)TCT>TAT		phospholipid scramblase 2							135.0	133.0	134.0					3																	146173132		2203	4300	6503	SO:0001583	missense	57047				phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity	g.chr3:146173132G>T		CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.434C>A	3.37:g.146173132G>T	ENSP00000420132:p.Ser145Tyr		Somatic				PLSCR2_uc003evw.1_Missense_Mutation_p.S141Y	p.S72Y	NM_020359	NP_065092	WXS	Illumina HiSeq	Unspecified	Q9NRY7	PLS2_HUMAN			5	548	-			72			Cytoplasmic (By similarity).		B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Missense_Mutation	SNP	ENST00000497985.1	37	c.215C>A	CCDS56284.1	.	.	.	.	.	.	.	.	.	.	.	4.789	0.146721	0.09134	.	.	ENSG00000163746	ENST00000336685;ENST00000535500;ENST00000497985;ENST00000489015	T;T;T	0.23950	1.88;1.88;1.88	3.1	-6.2	0.02072	.	1.984570	0.03509	U	0.219232	T	0.29914	0.0748	L	0.56280	1.765	0.09310	N	1	D;B	0.61697	0.99;0.036	D;B	0.63597	0.916;0.027	T	0.52245	-0.8601	10	0.02654	T	1	.	1.5392	0.02551	0.202:0.178:0.1506:0.4693	.	165;72	Q7Z4L7;Q9NRY7	.;PLS2_HUMAN	Y	72;164;145;72	ENSP00000338707:S72Y;ENSP00000420132:S145Y;ENSP00000418444:S72Y	ENSP00000338707:S72Y	S	-	2	0	PLSCR2	147655822	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.880000	0.04183	-2.572000	0.00467	-0.312000	0.09012	TCT		0.413	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000355264.1	NM_020359		16	103	1	0	2.63e-14	3.56e-14	16	103				
ZIC4	84107	broad.mit.edu	37	3	147113700	147113700	+	Silent	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:147113700C>A	ENST00000383075.3	-	3	1139	c.627G>T	c.(625-627)ccG>ccT	p.P209P	ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000525172.2_Silent_p.P259P|ZIC4_ENST00000484399.1_Silent_p.P209P|ZIC4_ENST00000473123.1_Silent_p.P209P|ZIC4_ENST00000425731.3_Silent_p.P247P	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	209						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P209P(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TCCCACACCCCGGGAAAGGAC	0.532																																						uc003ewd.1		NA																	1	Substitution - coding silent(1)		endometrium(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(625-627)CCG>CCT		zinc finger protein of the cerebellum 4							81.0	92.0	88.0					3																	147113700		2197	4300	6497	SO:0001819	synonymous_variant	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147113700C>A	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.627G>T	3.37:g.147113700C>A			Somatic				ZIC4_uc003ewc.1_Silent_p.P139P|ZIC4_uc011bno.1_Silent_p.P259P	p.P209P	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			3	900	-			209			C2H2-type 3.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Silent	SNP	ENST00000383075.3	37	c.627G>T	CCDS43160.1																																																																																				0.532	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			18	107	1	0	6.94e-10	8.82e-10	18	107				
GMPS	8833	broad.mit.edu	37	3	155623996	155623996	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:155623996T>C	ENST00000496455.2	+	5	805	c.470T>C	c.(469-471)gTa>gCa	p.V157A	GMPS_ENST00000476145.1_3'UTR|GMPS_ENST00000295920.7_Missense_Mutation_p.V58A	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	157	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	GGAGATAGTGTAGACAAAGTA	0.323			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)	uc003faq.2		NA		Dom	yes		3	3q24	8833	T	guanine monphosphate synthetase			L	MLL		AML		0				ovary(2)|lung(1)	3						c.(469-471)GTA>GCA		guanine monophosphate synthetase	L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						176.0	175.0	175.0					3																	155623996		1856	4092	5948	SO:0001583	missense	8833				glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity	g.chr3:155623996T>C	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.470T>C	3.37:g.155623996T>C	ENSP00000419851:p.Val157Ala		Somatic				GMPS_uc011bom.1_Missense_Mutation_p.V58A	p.V157A	NM_003875	NP_003866	WXS	Illumina HiSeq	Unspecified	P49915	GUAA_HUMAN	Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		5	805	+			157			Glutamine amidotransferase type-1.		A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	37	c.470T>C	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	T	31	5.080772	0.94050	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	D;D	0.91464	-2.85;-2.85	5.89	5.89	0.94794	Glutamine amidotransferase type 1 (2);GMP synthase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94440	0.8211	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76575	0.98;0.988	D	0.94898	0.8054	10	0.87932	D	0	-17.6834	16.3083	0.82859	0.0:0.0:0.0:1.0	.	58;157	F8W720;P49915	.;GUAA_HUMAN	A	157;58;106;157	ENSP00000419851:V157A;ENSP00000295920:V58A	ENSP00000295920:V58A	V	+	2	0	GMPS	157106690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.562000	0.82300	2.250000	0.74265	0.455000	0.32223	GTA		0.323	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2			90	109	0	0	0	0	90	109				
SMC4	10051	broad.mit.edu	37	3	160148867	160148867	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:160148867A>C	ENST00000357388.3	+	20	3439	c.2988A>C	c.(2986-2988)gaA>gaC	p.E996D	SMC4_ENST00000462787.1_Intron|SMC4_ENST00000469762.1_Missense_Mutation_p.E971D|SMC4_ENST00000344722.5_Missense_Mutation_p.E996D|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000360111.2_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	996					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGCTTCAAGAATTAAAAGTTA	0.328																																						uc003fdh.2		NA																	0				ovary(1)|breast(1)	2						c.(2986-2988)GAA>GAC		SMC4 structural maintenance of chromosomes							51.0	53.0	52.0					3																	160148867		2203	4297	6500	SO:0001583	missense	10051				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity	g.chr3:160148867A>C	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2988A>C	3.37:g.160148867A>C	ENSP00000349961:p.Glu996Asp		Somatic				IFT80_uc003fda.2_Intron|SMC4_uc003fdi.2_Missense_Mutation_p.E971D|SMC4_uc003fdj.2_Missense_Mutation_p.E996D|SMC4_uc010hwd.2_Intron|SMC4_uc003fdl.2_Missense_Mutation_p.E699D	p.E996D	NM_001002800	NP_001002800	WXS	Illumina HiSeq	Unspecified	Q9NTJ3	SMC4_HUMAN	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		20	3101	+			996			Potential.		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	c.2988A>C	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.219683	0.79464	.	.	ENSG00000113810	ENST00000357388;ENST00000469762;ENST00000344722;ENST00000545277	T;T;T	0.79845	-1.31;-1.06;-1.31	5.95	2.2	0.27929	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.82079	0.4959	L	0.55834	1.745	0.80722	D	1	B;D;P	0.56746	0.046;0.977;0.461	B;P;B	0.57283	0.119;0.817;0.269	T	0.77613	-0.2522	10	0.37606	T	0.19	-20.7636	9.7084	0.40229	0.7171:0.0:0.2829:0.0	.	971;971;996	B3KXX5;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	D	996;971;996;590	ENSP00000349961:E996D;ENSP00000417964:E971D;ENSP00000341382:E996D	ENSP00000341382:E996D	E	+	3	2	SMC4	161631561	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	2.446000	0.44908	0.139000	0.18822	0.533000	0.62120	GAA		0.328	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1			12	100	0	0	0	0	12	100				
SLC7A14	57709	broad.mit.edu	37	3	170198783	170198783	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:170198783G>A	ENST00000231706.5	-	7	1603	c.1288C>T	c.(1288-1290)Cga>Tga	p.R430*	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	430					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GGTTGGTATCGAAGGAGCAAG	0.512																																						uc003fgz.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5						c.(1288-1290)CGA>TGA		solute carrier family 7 (cationic amino acid							134.0	115.0	122.0					3																	170198783		2203	4300	6503	SO:0001587	stop_gained	57709					integral to membrane	amino acid transmembrane transporter activity	g.chr3:170198783G>A	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1288C>T	3.37:g.170198783G>A	ENSP00000231706:p.Arg430*		Somatic				CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	p.R430*	NM_020949	NP_066000	WXS	Illumina HiSeq	Unspecified	Q8TBB6	S7A14_HUMAN	Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)		7	1604	-	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		430					B3KV33|Q9HCF9	Nonsense_Mutation	SNP	ENST00000231706.5	37	c.1288C>T	CCDS33892.1	.	.	.	.	.	.	.	.	.	.	G	41	8.654097	0.98901	.	.	ENSG00000013293	ENST00000231706	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.3552	0.90355	0.0:0.0:1.0:0.0	.	.	.	.	X	430	.	ENSP00000231706:R430X	R	-	1	2	SLC7A14	171681477	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	9.230000	0.95299	2.337000	0.79520	0.655000	0.94253	CGA		0.512	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949		8	82	0	0	0	0	8	82				
NAALADL2	254827	broad.mit.edu	37	3	175184932	175184932	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:175184932G>C	ENST00000454872.1	+	8	1621	c.1493G>C	c.(1492-1494)gGa>gCa	p.G498A	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	498						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TCTTGGGGAGGAACAGCTTTT	0.388																																						uc003fit.2		NA																	0				pancreas(1)	1						c.(1492-1494)GGA>GCA		N-acetylated alpha-linked acidic dipeptidase 2							77.0	74.0	75.0					3																	175184932		1883	4117	6000	SO:0001583	missense	254827				proteolysis	integral to membrane	peptidase activity	g.chr3:175184932G>C		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1493G>C	3.37:g.175184932G>C	ENSP00000404705:p.Gly498Ala		Somatic				NAALADL2_uc003fiu.1_Missense_Mutation_p.G491A|NAALADL2_uc010hwy.1_Missense_Mutation_p.G272A|NAALADL2_uc010hwz.1_Missense_Mutation_p.G92A	p.G498A	NM_207015	NP_996898	WXS	Illumina HiSeq	Unspecified	Q58DX5	NADL2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)	8	1580	+	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	498			Extracellular (Potential).		Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	37	c.1493G>C	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	G	9.473	1.096123	0.20552	.	.	ENSG00000177694	ENST00000454872	T	0.48201	0.82	5.43	4.56	0.56223	Peptidase M28 (1);	0.059678	0.64402	D	0.000005	T	0.44008	0.1273	N	0.20530	0.585	0.35205	D	0.774587	D	0.63046	0.992	D	0.63597	0.916	T	0.45804	-0.9236	10	0.02654	T	1	-1.8078	11.3942	0.49832	0.1461:0.0:0.8539:0.0	.	498	Q58DX5	NADL2_HUMAN	A	498	ENSP00000404705:G498A	ENSP00000404705:G498A	G	+	2	0	NAALADL2	176667626	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.470000	0.66756	1.305000	0.44909	0.585000	0.79938	GGA		0.388	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015		7	102	0	0	0	0	7	102				
CLDN16	10686	broad.mit.edu	37	3	190126229	190126229	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:190126229T>A	ENST00000264734.2	+	4	967	c.719T>A	c.(718-720)aTg>aAg	p.M240K	CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	240					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		TGGCTCGGAATGGCTGGGTCT	0.388																																						uc003fsi.2		NA																	0				ovary(1)	1						c.(718-720)ATG>AAG		claudin 16							174.0	168.0	170.0					3																	190126229		2203	4300	6503	SO:0001583	missense	10686				calcium-independent cell-cell adhesion|cellular metal ion homeostasis|excretion	integral to membrane|tight junction	identical protein binding|magnesium ion transmembrane transporter activity|structural molecule activity	g.chr3:190126229T>A	AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.719T>A	3.37:g.190126229T>A	ENSP00000264734:p.Met240Lys		Somatic				CLDN16_uc010hze.2_Intron	p.M240K	NM_006580	NP_006571	WXS	Illumina HiSeq	Unspecified	Q9Y5I7	CLD16_HUMAN	Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)	4	787	+	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		240			Helical; (Potential).			Missense_Mutation	SNP	ENST00000264734.2	37	c.719T>A	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534918	0.85812	.	.	ENSG00000113946	ENST00000264734	D	0.88431	-2.38	5.6	5.6	0.85130	.	0.052388	0.85682	D	0.000000	D	0.92590	0.7646	M	0.63428	1.95	0.80722	D	1	D	0.67145	0.996	P	0.62089	0.898	D	0.93354	0.6721	10	0.87932	D	0	-26.813	14.9561	0.71113	0.0:0.0:0.0:1.0	.	240	Q9Y5I7	CLD16_HUMAN	K	240	ENSP00000264734:M240K	ENSP00000264734:M240K	M	+	2	0	CLDN16	191608923	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.806000	0.69150	2.120000	0.65058	0.455000	0.32223	ATG		0.388	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580		6	240	0	0	0	0	6	240				
COL25A1	84570	broad.mit.edu	37	4	110223145	110223145	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:110223145C>T	ENST00000399132.1	-	2	561	c.31G>A	c.(31-33)Ggg>Agg	p.G11R	COL25A1_ENST00000399126.1_Missense_Mutation_p.G11R|AC004051.2_ENST00000500526.1_lincRNA|COL25A1_ENST00000399127.1_Missense_Mutation_p.G11R	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TCCCGGCCCCCTCCTTTCCCT	0.637																																						uc003hze.1		NA																	0				ovary(2)	2						c.(31-33)GGG>AGG		collagen, type XXV, alpha 1 isoform 1							29.0	32.0	31.0					4																	110223145		1957	4138	6095	SO:0001583	missense	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:110223145C>T	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.31G>A	4.37:g.110223145C>T	ENSP00000382083:p.Gly11Arg		Somatic				COL25A1_uc003hzg.2_Missense_Mutation_p.G11R|COL25A1_uc003hzh.1_Missense_Mutation_p.G11R	p.G11R	NM_198721	NP_942014	WXS	Illumina HiSeq	Unspecified	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	2	562	-		Hepatocellular(203;0.217)	11			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000399132.1	37	c.31G>A	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.088134	0.55968	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653;ENST00000505591	D;D;D	0.93189	-2.93;-3.08;-3.18	4.73	2.99	0.34606	.	0.742259	0.11717	N	0.536282	D	0.86715	0.5999	L	0.27053	0.805	0.24595	N	0.993807	P;B;B	0.41313	0.745;0.343;0.077	B;B;B	0.36418	0.224;0.109;0.034	T	0.75619	-0.3255	9	.	.	.	0.0156	10.0459	0.42186	0.0:0.8317:0.0:0.1683	.	11;11;11	A8MWQ5;Q9BXS0-2;Q9BXS0	.;.;COPA1_HUMAN	R	11	ENSP00000382083:G11R;ENSP00000382078:G11R;ENSP00000382077:G11R	.	G	-	1	0	COL25A1	110442594	0.901000	0.30685	0.177000	0.23020	0.093000	0.18481	3.021000	0.49651	0.722000	0.32252	0.561000	0.74099	GGG		0.637	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		9	34	0	0	0	0	9	34				
TRPC3	7222	broad.mit.edu	37	4	122836027	122836027	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:122836027G>A	ENST00000379645.3	-	4	1322	c.1249C>T	c.(1249-1251)Cag>Tag	p.Q417*	TRPC3_ENST00000513531.1_Intron|TRPC3_ENST00000264811.5_Nonsense_Mutation_p.Q344*	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	332					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GCTATGGTCTGCTCCCTTAGG	0.547																																						uc003ieg.2		NA																	0				ovary(2)	2						c.(1249-1251)CAG>TAG		transient receptor potential cation channel,							138.0	99.0	112.0					4																	122836027		2203	4300	6503	SO:0001587	stop_gained	7222				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr4:122836027G>A	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1249C>T	4.37:g.122836027G>A	ENSP00000368966:p.Gln417*		Somatic				TRPC3_uc010inr.2_Intron|TRPC3_uc003ief.2_Nonsense_Mutation_p.Q344*|TRPC3_uc011cgl.1_Nonsense_Mutation_p.Q81*	p.Q417*	NM_001130698	NP_001124170	WXS	Illumina HiSeq	Unspecified	Q13507	TRPC3_HUMAN			4	1323	-			332			Cytoplasmic (Potential).		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Nonsense_Mutation	SNP	ENST00000379645.3	37	c.1249C>T	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	41	9.063303	0.99053	.	.	ENSG00000138741	ENST00000264811;ENST00000379645	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.4604	19.3937	0.94596	0.0:0.0:1.0:0.0	.	.	.	.	X	344;417	.	ENSP00000264811:Q344X	Q	-	1	0	TRPC3	123055477	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	9.753000	0.98904	2.586000	0.87340	0.655000	0.94253	CAG		0.547	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305		5	26	0	0	0	0	5	26				
KIAA1109	84162	broad.mit.edu	37	4	123249348	123249348	+	Silent	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:123249348G>C	ENST00000264501.4	+	66	11458	c.11085G>C	c.(11083-11085)gtG>gtC	p.V3695V	KIAA1109_ENST00000388738.3_Silent_p.V3695V			Q2LD37	K1109_HUMAN	KIAA1109	3695					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CATGTTCTGTGTTCAGTTCTC	0.438																																						uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(11083-11085)GTG>GTC		fragile site-associated protein							105.0	100.0	102.0					4																	123249348		1861	4086	5947	SO:0001819	synonymous_variant	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123249348G>C	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.11085G>C	4.37:g.123249348G>C			Somatic				KIAA1109_uc003iem.2_Silent_p.V86V	p.V3695V	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			64	11130	+			3695					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	c.11085G>C	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	G	9.045	0.990759	0.18966	.	.	ENSG00000138688	ENST00000306802	.	.	.	5.57	2.87	0.33458	.	.	.	.	.	T	0.56775	0.2008	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53114	-0.8484	4	.	.	.	.	8.1846	0.31330	0.3142:0.0:0.6858:0.0	.	.	.	.	S	106	.	.	C	+	2	0	KIAA1109	123468798	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	2.846000	0.48262	1.348000	0.45733	0.467000	0.42956	TGT		0.438	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		8	65	0	0	0	0	8	65				
PCDH10	57575	broad.mit.edu	37	4	134072460	134072460	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:134072460G>A	ENST00000264360.5	+	1	1991	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	389	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CGACTCAGAGGAGAATGGGCA	0.597																																						uc003iha.2		NA																	0				ovary(2)	2						c.(1165-1167)GAG>AAG		protocadherin 10 isoform 1 precursor							110.0	109.0	109.0					4																	134072460		2203	4300	6503	SO:0001583	missense	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134072460G>A	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1165G>A	4.37:g.134072460G>A	ENSP00000264360:p.Glu389Lys		Somatic				uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.E389K	p.E389K	NM_032961	NP_116586	WXS	Illumina HiSeq	Unspecified	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	1991	+			389			Cadherin 4.|Extracellular (Potential).		Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	c.1165G>A	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117194	0.56505	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.51574	0.7	4.68	4.68	0.58851	Cadherin (4);Cadherin-like (1);	0.000000	0.45867	D	0.000336	T	0.50034	0.1592	L	0.31120	0.905	0.80722	D	1	P;B	0.52170	0.951;0.022	P;B	0.54544	0.755;0.06	T	0.40289	-0.9571	10	0.27785	T	0.31	.	17.3997	0.87456	0.0:0.0:1.0:0.0	.	389;389	Q9P2E7;Q96SF0	PCD10_HUMAN;.	K	389	ENSP00000264360:E389K	ENSP00000264360:E389K	E	+	1	0	PCDH10	134291910	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.657000	0.98554	2.423000	0.82170	0.561000	0.74099	GAG		0.597	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		15	111	0	0	0	0	15	111				
INPP4B	8821	broad.mit.edu	37	4	143191916	143191916	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:143191916C>G	ENST00000513000.1	-	11	948	c.515G>C	c.(514-516)gGt>gCt	p.G172A	INPP4B_ENST00000509777.1_Missense_Mutation_p.G172A|INPP4B_ENST00000308502.4_Missense_Mutation_p.G172A|INPP4B_ENST00000508116.1_Missense_Mutation_p.G172A|INPP4B_ENST00000262992.4_Missense_Mutation_p.G172A	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	172					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CACTTTGCCACCATCTGAAGT	0.448																																						uc003iix.3		NA																	0				ovary(1)|lung(1)	2						c.(514-516)GGT>GCT		inositol polyphosphate-4-phosphatase, type II,							151.0	137.0	142.0					4																	143191916		2203	4300	6503	SO:0001583	missense	8821				signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity	g.chr4:143191916C>G	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.515G>C	4.37:g.143191916C>G	ENSP00000425487:p.Gly172Ala		Somatic				INPP4B_uc003iiw.3_Missense_Mutation_p.G172A|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_5'UTR|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Missense_Mutation_p.G43A	p.G172A	NM_003866	NP_003857	WXS	Illumina HiSeq	Unspecified	O15327	INP4B_HUMAN			11	1110	-	all_hematologic(180;0.158)		172					Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	c.515G>C	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644277	0.87859	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48	5.65	5.65	0.86999	.	0.054494	0.64402	D	0.000001	T	0.50565	0.1623	L	0.55481	1.735	0.54753	D	0.999982	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.975	T	0.25433	-1.0132	10	0.13853	T	0.58	.	19.3348	0.94312	0.0:1.0:0.0:0.0	.	43;172	B7Z6T2;O15327	.;INP4B_HUMAN	A	172;172;172;43;172;172;172;43	ENSP00000425487:G172A;ENSP00000262992:G172A;ENSP00000308441:G172A;ENSP00000423954:G172A;ENSP00000422793:G172A;ENSP00000427250:G172A;ENSP00000421065:G43A	ENSP00000262992:G172A	G	-	2	0	INPP4B	143411366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.004000	0.57068	2.660000	0.90430	0.655000	0.94253	GGT		0.448	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866		4	55	0	0	0	0	4	55				
USP38	84640	broad.mit.edu	37	4	144135671	144135671	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:144135671C>T	ENST00000307017.4	+	9	3048	c.2542C>T	c.(2542-2544)Cac>Tac	p.H848Y	USP38_ENST00000510377.1_Missense_Mutation_p.H848Y	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	848	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CGTTGTGGTTCACTCTGGTAT	0.413																																						uc003ijb.2		NA																	0				lung(2)|ovary(1)|breast(1)|pancreas(1)	5						c.(2542-2544)CAC>TAC		ubiquitin specific peptidase 38							100.0	93.0	95.0					4																	144135671		2203	4300	6503	SO:0001583	missense	84640				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr4:144135671C>T	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.2542C>T	4.37:g.144135671C>T	ENSP00000303434:p.His848Tyr		Somatic				USP38_uc003ija.3_Missense_Mutation_p.H848Y|USP38_uc003ijc.2_RNA	p.H848Y	NM_032557	NP_115946	WXS	Illumina HiSeq	Unspecified	Q8NB14	UBP38_HUMAN			9	3076	+	all_hematologic(180;0.158)		848					B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	c.2542C>T	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076858	0.76415	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	D;D	0.93712	-3.27;-3.27	5.48	5.48	0.80851	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.98239	0.9417	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99201	1.0873	10	0.87932	D	0	-5.6272	19.7147	0.96110	0.0:1.0:0.0:0.0	.	848;848	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	Y	848	ENSP00000427647:H848Y;ENSP00000303434:H848Y	ENSP00000303434:H848Y	H	+	1	0	USP38	144355121	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.583000	0.82559	2.732000	0.93576	0.591000	0.81541	CAC		0.413	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557		7	38	0	0	0	0	7	38				
TKTL2	84076	broad.mit.edu	37	4	164394370	164394370	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:164394370G>C	ENST00000280605.3	-	1	677	c.517C>G	c.(517-519)Cac>Gac	p.H173D		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	173						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AAGTTGTAGTGGGAGGCAAAA	0.552																																						uc003iqp.3		NA																	0				ovary(2)|skin(2)|pancreas(1)	5						c.(517-519)CAC>GAC		transketolase-like 2							78.0	79.0	79.0					4																	164394370		2203	4300	6503	SO:0001583	missense	84076					cytoplasm	metal ion binding|transketolase activity	g.chr4:164394370G>C	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.517C>G	4.37:g.164394370G>C	ENSP00000280605:p.His173Asp		Somatic					p.H173D	NM_032136	NP_115512	WXS	Illumina HiSeq	Unspecified	Q9H0I9	TKTL2_HUMAN			1	678	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	173					A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	c.517C>G	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819779	0.32145	.	.	ENSG00000151005	ENST00000280605	T	0.24538	1.85	4.13	3.28	0.37604	Transketolase, N-terminal (1);	0.144240	0.46145	D	0.000303	T	0.54515	0.1863	M	0.93763	3.455	0.53688	D	0.99997	D	0.63880	0.993	P	0.62560	0.904	T	0.64170	-0.6470	10	0.59425	D	0.04	-16.8643	10.3513	0.43937	0.0982:0.0:0.9018:0.0	.	173	Q9H0I9	TKTL2_HUMAN	D	173	ENSP00000280605:H173D	ENSP00000280605:H173D	H	-	1	0	TKTL2	164613820	0.836000	0.29430	0.988000	0.46212	0.327000	0.28475	0.272000	0.18644	1.314000	0.45095	0.655000	0.94253	CAC		0.552	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136		9	52	0	0	0	0	9	52				
GPM6A	2823	broad.mit.edu	37	4	176622906	176622906	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:176622906C>A	ENST00000280187.7	-	3	95	c.50G>T	c.(49-51)tGc>tTc	p.C17F	GPM6A_ENST00000515090.1_Missense_Mutation_p.C10F|GPM6A_ENST00000393658.2_Missense_Mutation_p.C17F|GPM6A_ENST00000506894.1_Missense_Mutation_p.C6F	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	17					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		TTTGATACAGCATTCAAAACA	0.428																																						uc003iuf.2		NA																	0					0						c.(49-51)TGC>TTC		glycoprotein M6A isoform 2							66.0	68.0	67.0					4																	176622906		2203	4300	6503	SO:0001583	missense	2823					cell surface|integral to membrane		g.chr4:176622906C>A		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.50G>T	4.37:g.176622906C>A	ENSP00000280187:p.Cys17Phe		Somatic				GPM6A_uc011ckj.1_Missense_Mutation_p.C10F|GPM6A_uc003iug.2_Missense_Mutation_p.C17F|GPM6A_uc003iuh.2_Missense_Mutation_p.C6F	p.C17F	NM_201591	NP_963885	WXS	Illumina HiSeq	Unspecified	P51674	GPM6A_HUMAN		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)	2	854	-		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	17			Cytoplasmic (Potential).		B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	ENST00000280187.7	37	c.50G>T	CCDS3824.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503409	0.85176	.	.	ENSG00000150625	ENST00000280187;ENST00000393658;ENST00000506894;ENST00000515090;ENST00000503397;ENST00000513365;ENST00000505304	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-5.93;-5.93	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	M	0.66378	2.025	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.998;0.998	D	0.99457	1.0942	10	0.87932	D	0	-6.8566	20.3011	0.98612	0.0:1.0:0.0:0.0	.	10;6;17	B7Z642;E9PHI5;P51674	.;.;GPM6A_HUMAN	F	17;17;6;10;9;17;10	ENSP00000280187:C17F;ENSP00000377268:C17F;ENSP00000421578:C6F;ENSP00000423984:C10F;ENSP00000422959:C9F;ENSP00000423122:C17F;ENSP00000425463:C10F	ENSP00000280187:C17F	C	-	2	0	GPM6A	176859900	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.487000	0.81328	2.804000	0.96469	0.650000	0.86243	TGC		0.428	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1			8	73	1	0	0.000157383	0.000177647	8	73				
WDR17	116966	broad.mit.edu	37	4	177071267	177071267	+	Silent	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr4:177071267A>G	ENST00000280190.4	+	16	2349	c.2193A>G	c.(2191-2193)gaA>gaG	p.E731E	WDR17_ENST00000393643.2_Silent_p.E707E|WDR17_ENST00000507824.2_Silent_p.E714E|WDR17_ENST00000508596.1_Silent_p.E707E			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	731										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AGGAAATAGAAAAACTAACTG	0.348																																						uc003iuj.2		NA																	0				ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6						c.(2191-2193)GAA>GAG		WD repeat domain 17 isoform 1							78.0	82.0	81.0					4																	177071267		2203	4297	6500	SO:0001819	synonymous_variant	116966							g.chr4:177071267A>G	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2193A>G	4.37:g.177071267A>G			Somatic				WDR17_uc003iuk.2_Silent_p.E707E|WDR17_uc003ium.3_Silent_p.E707E|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_5'Flank	p.E731E	NM_170710	NP_733828	WXS	Illumina HiSeq	Unspecified	Q8IZU2	WDR17_HUMAN		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)	16	2349	+		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	731					E7EQX0|Q0QD35	Silent	SNP	ENST00000280190.4	37	c.2193A>G	CCDS3825.1																																																																																				0.348	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2			8	29	0	0	0	0	8	29				
CTNND2	1501	broad.mit.edu	37	5	10992697	10992697	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:10992697G>C	ENST00000304623.8	-	19	3366	c.3177C>G	c.(3175-3177)atC>atG	p.I1059M	CTNND2_ENST00000458100.2_Missense_Mutation_p.I626M|CTNND2_ENST00000511377.1_Missense_Mutation_p.I968M|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.I1001M|CTNND2_ENST00000503622.1_Missense_Mutation_p.I722M	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1059					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCACAGGGGAGATGGAGGGCG	0.577																																						uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(3175-3177)ATC>ATG		catenin (cadherin-associated protein), delta 2							106.0	97.0	100.0					5																	10992697		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:10992697G>C	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3177C>G	5.37:g.10992697G>C	ENSP00000307134:p.Ile1059Met		Somatic				CTNND2_uc010itt.2_Missense_Mutation_p.I968M|CTNND2_uc011cmy.1_Missense_Mutation_p.I722M|CTNND2_uc011cmz.1_Missense_Mutation_p.I626M|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.I651M	p.I1059M	NM_001332	NP_001323	WXS	Illumina HiSeq	Unspecified	Q9UQB3	CTND2_HUMAN			19	3322	-			1059					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.3177C>G	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061331	0.55432	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.78481	-1.05;-1.09;-1.05;-1.18;-1.18	5.18	4.29	0.51040	.	0.244803	0.40818	N	0.001009	T	0.70298	0.3208	L	0.48642	1.525	0.58432	D	0.999998	P;P;P	0.44578	0.736;0.578;0.838	B;B;B	0.42422	0.3;0.3;0.387	T	0.70342	-0.4898	10	0.41790	T	0.15	-11.1032	8.9304	0.35666	0.0761:0.0:0.7785:0.1454	.	722;651;1059	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	M	1059;1001;968;154;626;722	ENSP00000307134:I1059M;ENSP00000352661:I1001M;ENSP00000426510:I968M;ENSP00000391155:I626M;ENSP00000426887:I722M	ENSP00000307134:I1059M	I	-	3	3	CTNND2	11045697	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.615000	0.54167	2.420000	0.82092	0.650000	0.86243	ATC		0.577	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		31	59	0	0	0	0	31	59				
CTNND2	1501	broad.mit.edu	37	5	11111052	11111052	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:11111052A>C	ENST00000304623.8	-	14	2570	c.2381T>G	c.(2380-2382)cTc>cGc	p.L794R	CTNND2_ENST00000458100.2_Missense_Mutation_p.L361R|CTNND2_ENST00000511377.1_Missense_Mutation_p.L703R|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.L794R|CTNND2_ENST00000503622.1_Missense_Mutation_p.L457R	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	794					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						CTCGCCACAGAGTAGCCCGTC	0.552																																						uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(2380-2382)CTC>CGC		catenin (cadherin-associated protein), delta 2							153.0	160.0	157.0					5																	11111052		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11111052A>C	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2381T>G	5.37:g.11111052A>C	ENSP00000307134:p.Leu794Arg		Somatic				CTNND2_uc010itt.2_Missense_Mutation_p.L703R|CTNND2_uc011cmy.1_Missense_Mutation_p.L457R|CTNND2_uc011cmz.1_Missense_Mutation_p.L361R|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.L361R	p.L794R	NM_001332	NP_001323	WXS	Illumina HiSeq	Unspecified	Q9UQB3	CTND2_HUMAN			14	2526	-			794					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.2381T>G	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.630700	0.87660	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.066417	0.64402	D	0.000012	D	0.88926	0.6570	L	0.35793	1.09	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.989	D;D;P	0.83275	0.996;0.996;0.768	D	0.89549	0.3798	10	0.54805	T	0.06	-18.1532	16.0204	0.80478	1.0:0.0:0.0:0.0	.	457;361;794	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	R	794;794;703;361;457	ENSP00000307134:L794R;ENSP00000352661:L794R;ENSP00000426510:L703R;ENSP00000391155:L361R;ENSP00000426887:L457R	ENSP00000307134:L794R	L	-	2	0	CTNND2	11164052	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.174000	0.68829	0.533000	0.62120	CTC		0.552	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		34	224	0	0	0	0	34	224				
CTNND2	1501	broad.mit.edu	37	5	11565132	11565132	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:11565132C>T	ENST00000304623.8	-	3	400	c.211G>A	c.(211-213)Gct>Act	p.A71T	CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000511377.1_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.A71T|CTNND2_ENST00000503622.1_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	71					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGCCGTTCAGCCTCCAGCTCT	0.502																																						uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(211-213)GCT>ACT		catenin (cadherin-associated protein), delta 2							87.0	70.0	76.0					5																	11565132		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11565132C>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.211G>A	5.37:g.11565132C>T	ENSP00000307134:p.Ala71Thr		Somatic				CTNND2_uc010itt.2_5'UTR|CTNND2_uc011cmy.1_5'UTR|CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	p.A71T	NM_001332	NP_001323	WXS	Illumina HiSeq	Unspecified	Q9UQB3	CTND2_HUMAN			3	356	-			71			Potential.		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.211G>A	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468860	0.84533	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000502551;ENST00000508761	T;T	0.77750	-1.05;-1.12	5.77	4.9	0.64082	.	0.000000	0.64402	D	0.000012	T	0.66790	0.2825	L	0.29908	0.895	0.80722	D	1	P	0.38922	0.651	B	0.35859	0.212	T	0.66590	-0.5885	10	0.33940	T	0.23	-9.119	14.7597	0.69596	0.0:0.845:0.155:0.0	.	71	Q9UQB3	CTND2_HUMAN	T	71;71;57;57	ENSP00000307134:A71T;ENSP00000352661:A71T	ENSP00000307134:A71T	A	-	1	0	CTNND2	11618132	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.389000	0.79806	1.563000	0.49615	0.655000	0.94253	GCT		0.502	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		6	38	0	0	0	0	6	38				
DNAH5	1767	broad.mit.edu	37	5	13717426	13717426	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:13717426T>G	ENST00000265104.4	-	73	12807	c.12703A>C	c.(12703-12705)Aag>Cag	p.K4235Q		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4235					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCAGTACCTTTTTGACATCC	0.507									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(12703-12705)AAG>CAG		dynein, axonemal, heavy chain 5							61.0	48.0	53.0					5																	13717426		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13717426T>G	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12703A>C	5.37:g.13717426T>G	ENSP00000265104:p.Lys4235Gln		Somatic				DNAH5_uc003jfc.2_Missense_Mutation_p.K403Q	p.K4235Q	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			73	12745	-	Lung NSC(4;0.00476)		4235					Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.12703A>C	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.296592	0.81025	.	.	ENSG00000039139	ENST00000265104	T	0.08807	3.05	5.54	5.54	0.83059	Dynein heavy chain (1);	0.098906	0.64402	N	0.000002	T	0.17492	0.0420	L	0.56396	1.775	0.80722	D	1	P	0.38745	0.645	P	0.46419	0.516	T	0.00373	-1.1781	10	0.56958	D	0.05	.	15.6836	0.77391	0.0:0.0:0.0:1.0	.	4235	Q8TE73	DYH5_HUMAN	Q	4235	ENSP00000265104:K4235Q	ENSP00000265104:K4235Q	K	-	1	0	DNAH5	13770426	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.215000	0.72206	2.105000	0.64084	0.533000	0.62120	AAG		0.507	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		3	18	0	0	0	0	3	18				
DNAH5	1767	broad.mit.edu	37	5	13788883	13788883	+	Silent	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:13788883C>T	ENST00000265104.4	-	51	8693	c.8589G>A	c.(8587-8589)gtG>gtA	p.V2863V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2863					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCCACAATCCACCAAGAGTT	0.413									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(8587-8589)GTG>GTA		dynein, axonemal, heavy chain 5							130.0	125.0	127.0					5																	13788883		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13788883C>T	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8589G>A	5.37:g.13788883C>T			Somatic					p.V2863V	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			51	8631	-	Lung NSC(4;0.00476)		2863					Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.8589G>A	CCDS3882.1																																																																																				0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		38	86	0	0	0	0	38	86				
DNAH5	1767	broad.mit.edu	37	5	13864670	13864670	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:13864670C>T	ENST00000265104.4	-	28	4536	c.4432G>A	c.(4432-4434)Gag>Aag	p.E1478K	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1478	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGGCAACACTCGCTGAAATCA	0.527									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(4432-4434)GAG>AAG		dynein, axonemal, heavy chain 5							56.0	55.0	56.0					5																	13864670		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13864670C>T	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4432G>A	5.37:g.13864670C>T	ENSP00000265104:p.Glu1478Lys		Somatic					p.E1478K	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			28	4474	-	Lung NSC(4;0.00476)		1478			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.4432G>A	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	35	5.482459	0.96307	.	.	ENSG00000039139	ENST00000265104	T	0.59224	0.28	5.32	5.32	0.75619	Dynein heavy chain, domain-2 (1);	0.052479	0.85682	N	0.000000	T	0.78799	0.4340	M	0.85197	2.74	0.80722	D	1	D	0.69078	0.997	D	0.66716	0.946	T	0.81521	-0.0895	10	0.56958	D	0.05	.	19.0581	0.93074	0.0:1.0:0.0:0.0	.	1478	Q8TE73	DYH5_HUMAN	K	1478	ENSP00000265104:E1478K	ENSP00000265104:E1478K	E	-	1	0	DNAH5	13917670	1.000000	0.71417	0.981000	0.43875	0.969000	0.65631	7.695000	0.84257	2.488000	0.83962	0.632000	0.83419	GAG		0.527	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		9	45	0	0	0	0	9	45				
DNAH5	1767	broad.mit.edu	37	5	13885171	13885171	+	Silent	SNP	A	A	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:13885171A>C	ENST00000265104.4	-	19	3014	c.2910T>G	c.(2908-2910)ctT>ctG	p.L970L	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	970	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TAACTTTCAGAAGAGCATCCA	0.418									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(2908-2910)CTT>CTG		dynein, axonemal, heavy chain 5							133.0	125.0	128.0					5																	13885171		2203	4300	6503	SO:0001819	synonymous_variant	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13885171A>C	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2910T>G	5.37:g.13885171A>C			Somatic					p.L970L	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			19	2952	-	Lung NSC(4;0.00476)		970			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	c.2910T>G	CCDS3882.1																																																																																				0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		21	83	0	0	0	0	21	83				
CDH18	1016	broad.mit.edu	37	5	19721468	19721468	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:19721468C>A	ENST00000507958.1	-	7	1621	c.631G>T	c.(631-633)Gac>Tac	p.D211Y	CDH18_ENST00000382275.1_Missense_Mutation_p.D211Y|CDH18_ENST00000511273.1_Missense_Mutation_p.D211Y|CDH18_ENST00000502796.1_Missense_Mutation_p.D211Y|CDH18_ENST00000506372.1_Missense_Mutation_p.D211Y|CDH18_ENST00000274170.4_Missense_Mutation_p.D211Y			Q13634	CAD18_HUMAN	cadherin 18, type 2	211	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D211N(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GTTTTAGGGTCGACGGAGAAG	0.448																																						uc003jgc.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(5)|large_intestine(1)|skin(1)	7						c.(631-633)GAC>TAC		cadherin 18, type 2 preproprotein							166.0	147.0	153.0					5																	19721468		2203	4300	6503	SO:0001583	missense	1016				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:19721468C>A	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.631G>T	5.37:g.19721468C>A	ENSP00000425093:p.Asp211Tyr		Somatic				CDH18_uc003jgd.2_Missense_Mutation_p.D211Y|CDH18_uc011cnm.1_Missense_Mutation_p.D211Y	p.D211Y	NM_004934	NP_004925	WXS	Illumina HiSeq	Unspecified	Q13634	CAD18_HUMAN			4	1008	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		211			Extracellular (Potential).|Cadherin 2.		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	c.631G>T	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030744	0.75504	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.87047	0.6080	H	0.97659	4.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91494	0.5214	9	.	.	.	.	17.9639	0.89094	0.0:1.0:0.0:0.0	.	211;211	B4DHG6;Q13634	.;CAD18_HUMAN	Y	211;211;211;211;211;211;157;211	ENSP00000371710:D211Y;ENSP00000425093:D211Y;ENSP00000274170:D211Y;ENSP00000424931:D211Y;ENSP00000422138:D211Y;ENSP00000427383:D157Y;ENSP00000425854:D211Y	.	D	-	1	0	CDH18	19757225	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	7.764000	0.85297	2.571000	0.86741	0.650000	0.86243	GAC		0.448	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934		30	72	1	0	9.65e-13	1.28e-12	30	72				
CDH12	1010	broad.mit.edu	37	5	21752180	21752180	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:21752180A>G	ENST00000382254.1	-	15	3137	c.2051T>C	c.(2050-2052)aTt>aCt	p.I684T	CDH12_ENST00000504376.2_Missense_Mutation_p.I684T|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Missense_Mutation_p.I644T|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	684					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GTTCTCCTCAATCACTTTTGG	0.458										HNSCC(59;0.17)																												uc010iuc.2		NA																	0				ovary(2)	2						c.(2050-2052)ATT>ACT		cadherin 12, type 2 preproprotein							164.0	141.0	149.0					5																	21752180		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21752180A>G	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2051T>C	5.37:g.21752180A>G	ENSP00000371689:p.Ile684Thr	HNSCC(59;0.17)	Somatic				CDH12_uc011cno.1_Missense_Mutation_p.I644T|CDH12_uc003jgk.2_Missense_Mutation_p.I684T|uc003jgj.2_Intron	p.I684T	NM_004061	NP_004052	WXS	Illumina HiSeq	Unspecified	P55289	CAD12_HUMAN			12	2509	-			684			Cytoplasmic (Potential).		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.2051T>C	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.193390	0.38707	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.76839	-1.05;-1.05;-1.05	5.27	5.27	0.74061	Cadherin, cytoplasmic domain (1);	0.229124	0.44483	D	0.000451	T	0.80065	0.4555	M	0.75447	2.3	0.47994	D	0.99956	B;P	0.37914	0.041;0.611	B;B	0.41036	0.098;0.346	T	0.81252	-0.1017	10	0.48119	T	0.1	.	15.1958	0.73088	1.0:0.0:0.0:0.0	.	644;684	B7Z2U6;P55289	.;CAD12_HUMAN	T	684;684;644	ENSP00000423577:I684T;ENSP00000371689:I684T;ENSP00000428786:I644T	ENSP00000371689:I684T	I	-	2	0	CDH12	21787937	1.000000	0.71417	0.993000	0.49108	0.893000	0.52053	5.014000	0.64029	2.004000	0.58718	0.383000	0.25322	ATT		0.458	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		8	64	0	0	0	0	8	64				
PCDHGB3	56102	broad.mit.edu	37	5	140750005	140750005	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr5:140750005G>T	ENST00000576222.1	+	1	175	c.44G>T	c.(43-45)cGa>cTa	p.R15L	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	15					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCAGAGGCGAATGCTATTT	0.552																																						uc003ljw.1		NA																	0					0						c.(43-45)CGA>CTA		protocadherin gamma subfamily B, 3 isoform 1							44.0	52.0	50.0					5																	140750005		1889	4106	5995	SO:0001583	missense	56102				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140750005G>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.44G>T	5.37:g.140750005G>T	ENSP00000461862:p.Arg15Leu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc011dat.1_Missense_Mutation_p.R15L	p.R15L	NM_018924	NP_061747	WXS	Illumina HiSeq	Unspecified	Q9Y5G1	PCDGF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	44	+			15					A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	c.44G>T	CCDS58980.1																																																																																				0.552	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		17	31	1	0	1.15e-07	1.41e-07	17	31				
HIST1H3H	8357	broad.mit.edu	37	6	27777865	27777865	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:27777865A>T	ENST00000369163.2	+	1	24	c.14A>T	c.(13-15)aAg>aTg	p.K5M	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	5					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						GCGCGTACGAAGCAGACTGCT	0.567																																						uc003njm.2		NA																	0				ovary(1)	1						c.(13-15)AAG>ATG		histone cluster 1, H3h							41.0	46.0	44.0					6																	27777865		2200	4299	6499	SO:0001583	missense	8357				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:27777865A>T	Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.14A>T	6.37:g.27777865A>T	ENSP00000358160:p.Lys5Met		Somatic				HIST1H2BL_uc003njl.2_5'Flank	p.K5M	NM_003536	NP_003527	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	24	+			5					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000369163.2	37	c.14A>T	CCDS4627.1	.	.	.	.	.	.	.	.	.	.	.	9.389	1.074913	0.20227	.	.	ENSG00000203813	ENST00000369163	T	0.49720	0.77	4.18	4.18	0.49190	.	.	.	.	.	T	0.52075	0.1712	.	.	.	0.43508	D	0.995761	.	.	.	.	.	.	T	0.59679	-0.7409	6	0.87932	D	0	.	13.109	0.59263	1.0:0.0:0.0:0.0	.	.	.	.	M	5	ENSP00000358160:K5M	ENSP00000358160:K5M	K	+	2	0	HIST1H3H	27885844	1.000000	0.71417	0.982000	0.44146	0.118000	0.20060	8.903000	0.92573	1.831000	0.53308	0.533000	0.62120	AAG		0.567	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040151.1	NM_003536		20	35	0	0	0	0	20	35				
GPX5	2880	broad.mit.edu	37	6	28500099	28500099	+	Splice_Site	SNP	T	T	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:28500099T>G	ENST00000412168.2	+	4	450	c.361T>G	c.(361-363)Tat>Gat	p.Y121D	GPX5_ENST00000469384.1_Splice_Site_p.G81G|GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	121					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	TTGTTGCAGGTATGTCCGTCC	0.428																																						uc003nll.2		NA																	0				skin(1)	1						c.(361-363)TAT>GAT		glutathione peroxidase 5 isoform 1 precursor	Glutathione(DB00143)						128.0	115.0	120.0					6																	28500099		2203	4300	6503	SO:0001630	splice_region_variant	2880				lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr6:28500099T>G	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.360-1T>G	6.37:g.28500099T>G			Somatic				GPX5_uc003nlm.2_Silent_p.G81G|GPX5_uc003nln.2_RNA	p.Y121D	NM_001509	NP_001500	WXS	Illumina HiSeq	Unspecified	O75715	GPX5_HUMAN			4	363	+			121					A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	37	c.361T>G	CCDS4652.1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.221870	0.58560	.	.	ENSG00000224586	ENST00000412168	T	0.04015	3.73	4.16	3.01	0.34805	Thioredoxin-like fold (2);	0.125358	0.56097	D	0.000032	T	0.04952	0.0133	L	0.31804	0.96	0.80722	D	1	D	0.65815	0.995	D	0.68621	0.959	T	0.33240	-0.9876	10	0.87932	D	0	-17.7677	7.9786	0.30170	0.0:0.0995:0.0:0.9005	.	121	O75715	GPX5_HUMAN	D	121	ENSP00000392398:Y121D	ENSP00000392398:Y121D	Y	+	1	0	GPX5	28608078	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.088000	0.30877	0.941000	0.37499	0.533000	0.62120	TAT		0.428	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2		Missense_Mutation	6	41	0	0	0	0	6	41				
SNRPC	6631	broad.mit.edu	37	6	34741320	34741320	+	Silent	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:34741320G>A	ENST00000244520.5	+	6	591	c.453G>A	c.(451-453)cgG>cgA	p.R151R	SNRPC_ENST00000374017.3_Silent_p.R172R|SNRPC_ENST00000374018.1_Silent_p.R110R	NM_003093.2	NP_003084.1			small nuclear ribonucleoprotein polypeptide C											endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	6						TGCCCACTCGGCCCGGAATGA	0.557																																					NSCLC(131;576 1831 5287 11175 13324)	uc003ojt.1		NA																	0				pancreas(1)	1						c.(451-453)CGG>CGA		small nuclear ribonucleoprotein polypeptide C							72.0	69.0	70.0					6																	34741320		2203	4300	6503	SO:0001819	synonymous_variant	6631				spliceosomal snRNP assembly	Cajal body|U1 snRNP	protein homodimerization activity|single-stranded RNA binding|zinc ion binding	g.chr6:34741320G>A		CCDS34436.1	6p21	2014-03-06			ENSG00000124562	ENSG00000124562			11157	protein-coding gene	gene with protein product		603522				2971157, 8532530	Standard	NR_029472		Approved	U1-C, Yhc1	uc003ojt.2	P09234	OTTHUMG00000014555	ENST00000244520.5:c.453G>A	6.37:g.34741320G>A			Somatic					p.R151R	NM_003093	NP_003084	WXS	Illumina HiSeq	Unspecified	P09234	RU1C_HUMAN			6	468	+			151						Silent	SNP	ENST00000244520.5	37	c.453G>A	CCDS34436.1																																																																																				0.557	SNRPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040255.1	NM_003093		10	47	0	0	0	0	10	47				
ZNF318	24149	broad.mit.edu	37	6	43325349	43325349	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:43325349C>T	ENST00000361428.2	-	3	780	c.703G>A	c.(703-705)Gat>Aat	p.D235N	ZNF318_ENST00000318149.3_Missense_Mutation_p.D235N	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	235					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GGACTATAATCAGATCGATGC	0.458																																						uc003oux.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(703-705)GAT>AAT		zinc finger protein 318							106.0	97.0	100.0					6																	43325349		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43325349C>T	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.703G>A	6.37:g.43325349C>T	ENSP00000354964:p.Asp235Asn		Somatic				ZNF318_uc003ouw.2_RNA	p.D235N	NM_014345	NP_055160	WXS	Illumina HiSeq	Unspecified	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		3	781	-			235					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.703G>A	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130798	0.77549	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.03772	3.81;3.81	5.62	3.84	0.44239	.	0.376496	0.28730	N	0.014337	T	0.02929	0.0087	N	0.24115	0.695	0.26345	N	0.977292	D	0.55385	0.971	P	0.55749	0.783	T	0.40997	-0.9533	10	0.45353	T	0.12	-1.5815	10.5451	0.45056	0.0:0.8504:0.0:0.1496	.	235	Q5VUA4	ZN318_HUMAN	N	235	ENSP00000323032:D235N;ENSP00000354964:D235N	ENSP00000323032:D235N	D	-	1	0	ZNF318	43433327	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.508000	0.53378	0.736000	0.32559	-0.266000	0.10368	GAT		0.458	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		13	91	0	0	0	0	13	91				
POLR1C	9533	broad.mit.edu	37	6	43488440	43488440	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:43488440G>A	ENST00000372389.3	+	7	821	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	RP3-337H4.9_ENST00000607571.1_RNA|POLR1C_ENST00000304004.3_Missense_Mutation_p.V245M|POLR1C_ENST00000372344.2_Intron	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	245					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GCTTGAGCCCGTGGAAGGGGA	0.537																																						uc003ovn.2		NA																	0					0						c.(733-735)GTG>ATG		RNA polymerase I subunit isoform 1							107.0	105.0	106.0					6																	43488440		2203	4300	6503	SO:0001583	missense	9533				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity	g.chr6:43488440G>A	AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.733G>A	6.37:g.43488440G>A	ENSP00000361465:p.Val245Met		Somatic				POLR1C_uc003ovo.1_Missense_Mutation_p.V245M	p.V245M	NM_203290	NP_976035	WXS	Illumina HiSeq	Unspecified	O15160	RPAC1_HUMAN	Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)		7	790	+	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		245					O75395|Q5JTE3	Missense_Mutation	SNP	ENST00000372389.3	37	c.733G>A	CCDS4901.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724622	0.68959	.	.	ENSG00000171453	ENST00000372389;ENST00000304004	D;T	0.83837	-1.77;-0.77	5.14	3.3	0.37823	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.242690	0.41823	D	0.000813	D	0.84229	0.5426	L	0.61387	1.9	0.54753	D	0.999989	D;D	0.71674	0.998;0.997	D;D	0.67231	0.939;0.95	D	0.85468	0.1171	10	0.66056	D	0.02	-14.6617	10.043	0.42169	0.222:0.0:0.778:0.0	.	245;245	O15160-2;O15160	.;RPAC1_HUMAN	M	245	ENSP00000361465:V245M;ENSP00000307212:V245M	ENSP00000307212:V245M	V	+	1	0	POLR1C	43596418	0.988000	0.35896	0.959000	0.39883	0.976000	0.68499	1.976000	0.40579	1.271000	0.44313	0.591000	0.81541	GTG		0.537	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040652.3	NM_004875		6	105	0	0	0	0	6	105				
MUT	4594	broad.mit.edu	37	6	49425487	49425487	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:49425487C>A	ENST00000274813.3	-	3	797	c.670G>T	c.(670-672)Gaa>Taa	p.E224*		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	224					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCATAAATTCCTTTAGTATA	0.328																																						uc003ozg.3		NA																	0					0	GRCh37	CM060367	MUT	M		c.(670-672)GAA>TAA		methylmalonyl Coenzyme A mutase precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						71.0	63.0	66.0					6																	49425487		2203	4298	6501	SO:0001587	stop_gained	4594				fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity	g.chr6:49425487C>A		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.670G>T	6.37:g.49425487C>A	ENSP00000274813:p.Glu224*		Somatic					p.E224*	NM_000255	NP_000246	WXS	Illumina HiSeq	Unspecified	P22033	MUTA_HUMAN			3	925	-	Lung NSC(77;0.0376)		224					A8K953|Q5SYZ3|Q96B11|Q9UD64	Nonsense_Mutation	SNP	ENST00000274813.3	37	c.670G>T	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	C	38	6.696576	0.97772	.	.	ENSG00000146085	ENST00000274813	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.9372	19.2703	0.94006	0.0:1.0:0.0:0.0	.	.	.	.	X	224	.	ENSP00000274813:E224X	E	-	1	0	MUT	49533446	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.398000	0.79919	2.873000	0.98535	0.561000	0.74099	GAA		0.328	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1			17	25	1	0	8.6e-14	1.16e-13	17	25				
RIMS1	22999	broad.mit.edu	37	6	72892001	72892001	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:72892001G>C	ENST00000521978.1	+	6	827	c.827G>C	c.(826-828)gGg>gCg	p.G276A	RIMS1_ENST00000491071.2_Missense_Mutation_p.G276A|RIMS1_ENST00000348717.5_Missense_Mutation_p.G276A|RIMS1_ENST00000517960.1_Missense_Mutation_p.G276A|RIMS1_ENST00000518273.1_Missense_Mutation_p.G276A|RIMS1_ENST00000522291.1_Missense_Mutation_p.G276A|RIMS1_ENST00000264839.7_Missense_Mutation_p.G276A|RIMS1_ENST00000520567.1_Missense_Mutation_p.G276A	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	276					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AAGACCCCAGGGCTTTCCGAG	0.488																																						uc003pga.2		NA																	0				ovary(7)|pancreas(2)|breast(1)	10						c.(826-828)GGG>GCG		regulating synaptic membrane exocytosis 1							32.0	36.0	35.0					6																	72892001		1840	4089	5929	SO:0001583	missense	22999				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr6:72892001G>C	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.827G>C	6.37:g.72892001G>C	ENSP00000428417:p.Gly276Ala		Somatic				RIMS1_uc011dyb.1_5'UTR|RIMS1_uc003pgc.2_5'UTR|RIMS1_uc003pgb.3_5'UTR	p.G276A	NM_014989	NP_055804	WXS	Illumina HiSeq	Unspecified	Q86UR5	RIMS1_HUMAN			6	904	+		all_epithelial(107;0.179)|all_hematologic(105;0.212)	276					A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	c.827G>C	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	G	2.207	-0.381692	0.04966	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.13901	2.55;2.7;2.61;2.7;2.69;2.69;2.69;2.63	5.13	1.94	0.25998	.	0.404574	0.19703	N	0.108000	T	0.01124	0.0037	N	0.03177	-0.4	0.21105	N	0.999785	B	0.02656	0.0	B	0.04013	0.001	T	0.48281	-0.9049	10	0.02654	T	1	-10.0912	8.669	0.34138	0.0:0.4493:0.3158:0.2349	.	276	Q86UR5	RIMS1_HUMAN	A	276	ENSP00000430101:G276A;ENSP00000275037:G276A;ENSP00000264839:G276A;ENSP00000429959:G276A;ENSP00000430408:G276A;ENSP00000430502:G276A;ENSP00000430932:G276A;ENSP00000428417:G276A	ENSP00000264839:G276A	G	+	2	0	RIMS1	72948722	0.186000	0.23225	0.007000	0.13788	0.885000	0.51271	1.312000	0.33574	0.534000	0.28695	0.462000	0.41574	GGG		0.488	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			17	38	0	0	0	0	17	38				
FUT9	10690	broad.mit.edu	37	6	96651233	96651233	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:96651233G>T	ENST00000302103.5	+	3	528	c.202G>T	c.(202-204)Gtg>Ttg	p.V68L		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	68					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		TACTATTCTGGTGTGGGTGTG	0.438																																					Melanoma(98;1369 1476 6592 22940 26587)	uc003pop.3		NA																	0				skin(4)|ovary(1)	5						c.(202-204)GTG>TTG		fucosyltransferase 9 (alpha (1,3)							128.0	116.0	120.0					6																	96651233		2203	4300	6503	SO:0001583	missense	10690				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity	g.chr6:96651233G>T	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.202G>T	6.37:g.96651233G>T	ENSP00000302599:p.Val68Leu		Somatic					p.V68L	NM_006581	NP_006572	WXS	Illumina HiSeq	Unspecified	Q9Y231	FUT9_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.08)	3	543	+		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)	68			Lumenal (Potential).		Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	37	c.202G>T	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	G	5.029	0.190962	0.09547	.	.	ENSG00000172461	ENST00000302103	T	0.18174	2.23	5.17	4.14	0.48551	.	0.228496	0.43110	D	0.000618	T	0.01387	0.0045	N	0.02357	-0.585	0.41904	D	0.990434	B	0.02656	0.0	B	0.11329	0.006	T	0.45789	-0.9237	10	0.02654	T	1	-8.2879	5.4061	0.16323	0.6685:0.0:0.3315:0.0	.	68	Q9Y231	FUT9_HUMAN	L	68	ENSP00000302599:V68L	ENSP00000302599:V68L	V	+	1	0	FUT9	96757954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.690000	0.47001	1.092000	0.41356	0.655000	0.94253	GTG		0.438	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581		15	61	1	0	4.75e-09	5.97e-09	15	61				
GRIK2	2898	broad.mit.edu	37	6	102074485	102074485	+	Missense_Mutation	SNP	G	G	T	rs201893729		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:102074485G>T	ENST00000421544.1	+	3	1004	c.514G>T	c.(514-516)Gtc>Ttc	p.V172F	GRIK2_ENST00000413795.1_Missense_Mutation_p.V172F|GRIK2_ENST00000369137.3_Missense_Mutation_p.V172F|GRIK2_ENST00000369138.1_Missense_Mutation_p.V172F|GRIK2_ENST00000358361.3_Missense_Mutation_p.V172F|GRIK2_ENST00000369134.4_Missense_Mutation_p.V123F|GRIK2_ENST00000318991.6_Missense_Mutation_p.V172F	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	172					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GTGGAAAACCGTCACGGTTGT	0.408																																						uc003pqp.3		NA																	0				ovary(2)|pancreas(1)|breast(1)|skin(1)	5						c.(514-516)GTC>TTC		glutamate receptor, ionotropic, kainate 2	L-Glutamic Acid(DB00142)						73.0	77.0	76.0					6																	102074485		2203	4300	6503	SO:0001583	missense	2898				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	g.chr6:102074485G>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.514G>T	6.37:g.102074485G>T	ENSP00000397026:p.Val172Phe		Somatic				GRIK2_uc003pqn.2_Missense_Mutation_p.V172F|GRIK2_uc003pqo.3_Missense_Mutation_p.V172F|GRIK2_uc010kcw.2_Missense_Mutation_p.V172F	p.V172F	NM_021956	NP_068775	WXS	Illumina HiSeq	Unspecified	Q13002	GRIK2_HUMAN		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	3	763	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	172			Extracellular (Potential).		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	c.514G>T	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.728131	0.48833	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	D;D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	5.79	5.79	0.91817	Extracellular ligand-binding receptor (1);	0.135274	0.49305	D	0.000153	D	0.82962	0.5151	N	0.12422	0.21	0.58432	D	0.999998	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.65443	0.924;0.935;0.924	T	0.80525	-0.1344	10	0.15952	T	0.53	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	172;172;172	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	F	172;172;172;172;172;172;172;123;134	ENSP00000397026:V172F;ENSP00000405596:V172F;ENSP00000358134:V172F;ENSP00000351128:V172F;ENSP00000358133:V172F;ENSP00000313276:V172F;ENSP00000358130:V123F	ENSP00000313276:V172F	V	+	1	0	GRIK2	102181178	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.647000	0.83462	2.718000	0.92993	0.655000	0.94253	GTC		0.408	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			10	47	1	0	5.51e-06	6.48e-06	10	47				
ZBTB24	9841	broad.mit.edu	37	6	109787534	109787534	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr6:109787534C>A	ENST00000230122.3	-	7	1781	c.1614G>T	c.(1612-1614)caG>caT	p.Q538H	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	538					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		ATGGCTGTAGCTGAAGAATAT	0.453																																						uc003ptl.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1612-1614)CAG>CAT		zinc finger and BTB domain containing 24 isoform							143.0	133.0	136.0					6																	109787534		2203	4300	6503	SO:0001583	missense	9841				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:109787534C>A	AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1614G>T	6.37:g.109787534C>A	ENSP00000230122:p.Gln538His		Somatic				MICAL1_uc011eaq.1_5'Flank|ZBTB24_uc011ear.1_RNA|ZBTB24_uc010kds.1_Missense_Mutation_p.Q482H|ZBTB24_uc010kdt.1_RNA	p.Q538H	NM_014797	NP_055612	WXS	Illumina HiSeq	Unspecified	O43167	ZBT24_HUMAN		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)	7	1782	-		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)	538					Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	c.1614G>T	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628681	0.46944	.	.	ENSG00000112365	ENST00000230122	T	0.12255	2.7	6.06	3.14	0.36123	.	0.054392	0.85682	N	0.000000	T	0.04182	0.0116	L	0.29908	0.895	0.43152	D	0.994927	B	0.26445	0.149	B	0.23419	0.046	T	0.13764	-1.0497	10	0.72032	D	0.01	-26.7045	8.2517	0.31730	0.2366:0.6482:0.0:0.1152	.	538	O43167	ZBT24_HUMAN	H	538	ENSP00000230122:Q538H	ENSP00000230122:Q538H	Q	-	3	2	ZBTB24	109894227	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.019000	0.30014	1.531000	0.49152	0.655000	0.94253	CAG		0.453	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797		25	52	1	0	3.17e-13	4.25e-13	25	52				
DNAH11	8701	broad.mit.edu	37	7	21678667	21678667	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr7:21678667G>A	ENST00000409508.3	+	28	4959	c.4928G>A	c.(4927-4929)gGa>gAa	p.G1643E	DNAH11_ENST00000328843.6_Missense_Mutation_p.G1648E	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1648	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CTCTCAAAAGGAGCTCAGCCT	0.403									Kartagener syndrome																													uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(4942-4944)GGA>GAA		dynein, axonemal, heavy chain 11							123.0	118.0	119.0					7																	21678667		1870	4097	5967	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21678667G>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4928G>A	7.37:g.21678667G>A	ENSP00000475939:p.Gly1643Glu		Somatic					p.G1648E	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			28	4974	+			1648			Stem (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.4943G>A		.	.	.	.	.	.	.	.	.	.	G	28.7	4.943233	0.92593	.	.	ENSG00000105877	ENST00000328843	T	0.61040	0.14	5.78	5.78	0.91487	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.76378	0.3979	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.63597	0.916	T	0.78607	-0.2138	9	0.87932	D	0	.	18.7707	0.91890	0.0:0.0:1.0:0.0	.	1648	Q96DT5	DYH11_HUMAN	E	1648	ENSP00000330671:G1648E	ENSP00000330671:G1648E	G	+	2	0	DNAH11	21645192	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.166000	0.94766	2.729000	0.93468	0.650000	0.86243	GGA		0.403	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		22	17	0	0	0	0	22	17				
SRRM3	222183	broad.mit.edu	37	7	75912371	75912371	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr7:75912371A>G	ENST00000326382.8	+	14	1892	c.1685A>G	c.(1684-1686)aAg>aGg	p.K562R	SRRM3_ENST00000388802.4_Missense_Mutation_p.K562R	NM_001110199.1	NP_001103669.1	A6NNA2	SRRM3_HUMAN	serine/arginine repetitive matrix 3	562	Arg-rich.									NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)	8						CCCATCCGCAAGCGGCGCCGG	0.761																																						uc010ldi.2		NA																	0					0						c.(1684-1686)AAG>AGG		serine/arginine repetitive matrix 3							5.0	6.0	6.0					7																	75912371		1264	3071	4335	SO:0001583	missense	222183							g.chr7:75912371A>G	AK092590		7q11.23	2014-02-12			ENSG00000177679	ENSG00000177679			26729	protein-coding gene	gene with protein product							Standard	NM_001291831		Approved	FLJ37078	uc010ldi.2	A6NNA2	OTTHUMG00000130489	ENST00000326382.8:c.1685A>G	7.37:g.75912371A>G	ENSP00000325298:p.Lys562Arg		Somatic				SRRM3_uc003uet.1_5'UTR	p.K562R	NM_001110199	NP_001103669	WXS	Illumina HiSeq	Unspecified					14	1894	+								A6ND75	Missense_Mutation	SNP	ENST00000326382.8	37	c.1685A>G		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.5|23.5	4.423315|4.423315	0.83559|0.83559	.|.	.|.	ENSG00000177679|ENSG00000177679	ENST00000388802;ENST00000326382|ENST00000413003	.|.	.|.	.|.	4.08|4.08	4.08|4.08	0.47627|0.47627	.|.	0.288169|.	0.24291|.	N|.	0.039806|.	T|T	0.69387|0.69387	0.3105|0.3105	M|M	0.66939|0.66939	2.045|2.045	0.43304|0.43304	D|D	0.995303|0.995303	D|.	0.63880|.	0.993|.	D|.	0.72625|.	0.978|.	T|T	0.69285|0.69285	-0.5185|-0.5185	9|5	0.15066|.	T|.	0.55|.	-16.7701|-16.7701	12.2139|12.2139	0.54396|0.54396	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	562|.	A6NNA2|.	SRRM3_HUMAN|.	R|G	562|117	.|.	ENSP00000325298:K562R|.	K|S	+|+	2|1	0|0	SRRM3|SRRM3	75750307|75750307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.921000|0.921000	0.55340|0.55340	8.505000|8.505000	0.90515|0.90515	1.471000|1.471000	0.48121|0.48121	0.379000|0.379000	0.24179|0.24179	AAG|AGC		0.761	SRRM3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000252889.2	NM_001110199		4	11	0	0	0	0	4	11				
CACNA2D1	781	broad.mit.edu	37	7	81626562	81626562	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr7:81626562G>T	ENST00000356253.5	-	20	1907	c.1652C>A	c.(1651-1653)cCc>cAc	p.P551H	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.P532H			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	551	Cache.				calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CTGAGATTTGGGGTTCTACAC	0.333																																						uc003uhr.1		NA																	0				ovary(5)|pancreas(1)	6						c.(1594-1596)CCC>CAC		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						154.0	153.0	153.0					7																	81626562		2203	4300	6503	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81626562G>T	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1652C>A	7.37:g.81626562G>T	ENSP00000348589:p.Pro551His		Somatic					p.P532H	NM_000722	NP_000713	WXS	Illumina HiSeq	Unspecified	P54289	CA2D1_HUMAN			19	1851	-			551			Extracellular (Potential).|Cache.		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.1595C>A		.	.	.	.	.	.	.	.	.	.	G	17.07	3.295319	0.60086	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.06768	3.27;3.26	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.09512	0.0234	N	0.08118	0	0.80722	D	1	D	0.54601	0.967	P	0.55161	0.77	T	0.22836	-1.0205	10	0.66056	D	0.02	-7.922	12.2742	0.54724	0.0785:0.0:0.9215:0.0	.	532	P54289-2	.	H	532;551;551	ENSP00000349320:P532H;ENSP00000348589:P551H	ENSP00000284088:P551H	P	-	2	0	CACNA2D1	81464498	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	4.880000	0.63107	2.561000	0.86390	0.591000	0.81541	CCC		0.333	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				23	89	1	0	5.45e-15	7.47e-15	23	89				
COG5	10466	broad.mit.edu	37	7	106898718	106898718	+	Splice_Site	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr7:106898718C>T	ENST00000347053.3	-	15	1829	c.1779G>A	c.(1777-1779)aaG>aaA	p.K593K	COG5_ENST00000393603.2_Splice_Site_p.K593K|COG5_ENST00000297135.3_Splice_Site_p.K593K	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	593					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						aaataGTTACCTTTGTTACTG	0.313																																						uc003ved.2		NA																	0				central_nervous_system(2)|skin(2)	4						c.(1777-1779)AAG>AAA		component of oligomeric golgi complex 5 isoform							111.0	106.0	108.0					7																	106898718		2203	4300	6503	SO:0001630	splice_region_variant	10466				intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding	g.chr7:106898718C>T	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1779+1G>A	7.37:g.106898718C>T			Somatic				COG5_uc003vec.2_Silent_p.K593K|COG5_uc003vee.2_Silent_p.K593K	p.K593K	NM_181733	NP_859422	WXS	Illumina HiSeq	Unspecified	Q9UP83	COG5_HUMAN			15	2304	-			593					A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Silent	SNP	ENST00000347053.3	37	c.1779G>A	CCDS5743.1																																																																																				0.313	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4		Silent	8	80	0	0	0	0	8	80				
SSPO	23145	broad.mit.edu	37	7	149522074	149522074	+	RNA	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr7:149522074T>C	ENST00000378016.2	+	0	13861							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGGAGTCTGTGGGGGCCATG	0.647																																						uc010lpk.2		NA																	0					0						c.(13861-13863)TGG>CGG		SCO-spondin precursor							11.0	14.0	13.0					7																	149522074		2010	4155	6165			23145				cell adhesion	extracellular space	peptidase inhibitor activity	g.chr7:149522074T>C	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149522074T>C			Somatic				SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_Intron|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_Intron	p.W4621R	NM_198455	NP_940857	WXS	Illumina HiSeq	Unspecified	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)		97	13861	+	Melanoma(164;0.165)|Ovarian(565;0.177)		4621			TSP type-1 23.		Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37	c.13861T>C																																																																																					0.647	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				3	10	0	0	0	0	3	10				
CSMD1	64478	broad.mit.edu	37	8	2855570	2855570	+	Silent	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:2855570G>A	ENST00000520002.1	-	55	8898	c.8343C>T	c.(8341-8343)agC>agT	p.S2781S	CSMD1_ENST00000537824.1_Silent_p.S2780S|CSMD1_ENST00000542608.1_Silent_p.S2722S|CSMD1_ENST00000602557.1_Silent_p.S2781S|CSMD1_ENST00000400186.3_Silent_p.S2723S|CSMD1_ENST00000602723.1_Silent_p.S2723S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2781	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTGGCCGTTGCTCCGACACT	0.547																																						uc011kwk.1		NA																	0				breast(20)|large_intestine(5)	25						c.(8341-8343)AGC>AGT		CUB and Sushi multiple domains 1 precursor							70.0	70.0	70.0					8																	2855570		2049	4194	6243	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:2855570G>A			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8343C>T	8.37:g.2855570G>A			Somatic				CSMD1_uc011kwj.1_Silent_p.S2110S|CSMD1_uc010lrg.2_Silent_p.S791S	p.S2781S	NM_033225	NP_150094	WXS	Illumina HiSeq	Unspecified	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	54	8733	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2781			Extracellular (Potential).|Sushi 19.		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.8343C>T		.	.	.	.	.	.	.	.	.	.	G	11.24	1.580239	0.28180	.	.	ENSG00000183117	ENST00000335551	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7909	0.63140	0.0695:0.0:0.9305:0.0	.	.	.	.	X	2198	.	.	Q	-	1	0	CSMD1	2842977	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	2.019000	0.41001	2.884000	0.98904	0.655000	0.94253	CAA		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		6	40	0	0	0	0	6	40				
PPP1R3B	79660	broad.mit.edu	37	8	8998840	8998840	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:8998840C>A	ENST00000310455.3	-	2	472	c.322G>T	c.(322-324)Gag>Tag	p.E108*	RP11-10A14.3_ENST00000520017.1_RNA|PPP1R3B_ENST00000519699.1_Nonsense_Mutation_p.E108*|RP11-10A14.3_ENST00000522057.1_RNA	NM_001201329.1|NM_024607.3	NP_001188258.1|NP_078883.2	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory subunit 3B	108					glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase regulator activity (GO:0019888)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	12				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		ACAAAGCTCTCGCTCTCTGCT	0.478																																						uc003wsn.3		NA																	0				ovary(1)|skin(1)	2						c.(322-324)GAG>TAG		protein phosphatase 1, regulatory (inhibitor)							79.0	75.0	76.0					8																	8998840		2203	4300	6503	SO:0001587	stop_gained	79660				glycogen metabolic process			g.chr8:8998840C>A	AK024067	CCDS5973.1	8p23.1	2012-04-17	2011-10-04		ENSG00000173281	ENSG00000173281		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14942	protein-coding gene	gene with protein product	"""PP1 subunit R4"", ""hepatic glycogen-targeting subunit, G(L)"""	610541	"""protein phosphatase 1, regulatory (inhibitor) subunit 3B"""			11948623, 17555403	Standard	NM_024607		Approved	GL, FLJ14005, PPP1R4	uc003wsn.4	Q86XI6	OTTHUMG00000129329	ENST00000310455.3:c.322G>T	8.37:g.8998840C>A	ENSP00000308318:p.Glu108*		Somatic				PPP1R3B_uc003wso.3_Nonsense_Mutation_p.E107*	p.E108*	NM_024607	NP_078883	WXS	Illumina HiSeq	Unspecified	Q86XI6	PPR3B_HUMAN		COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)	2	487	-			108					B3KTV3|Q9H812	Nonsense_Mutation	SNP	ENST00000310455.3	37	c.322G>T	CCDS5973.1	.	.	.	.	.	.	.	.	.	.	C	38	6.978587	0.97979	.	.	ENSG00000173281	ENST00000310455;ENST00000519699	.	.	.	5.68	5.68	0.88126	.	0.373401	0.32852	N	0.005572	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-35.869	18.7812	0.91933	0.0:1.0:0.0:0.0	.	.	.	.	X	108	.	ENSP00000308318:E108X	E	-	1	0	PPP1R3B	9036250	0.996000	0.38824	1.000000	0.80357	0.989000	0.77384	3.086000	0.50159	2.678000	0.91216	0.561000	0.74099	GAG		0.478	PPP1R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251472.1	NM_024607		12	56	1	0	5.51e-06	6.48e-06	12	56				
DLC1	10395	broad.mit.edu	37	8	12943411	12943411	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:12943411G>T	ENST00000276297.4	-	18	4905	c.4496C>A	c.(4495-4497)tCt>tAt	p.S1499Y	DLC1_ENST00000520226.1_Missense_Mutation_p.S988Y|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Missense_Mutation_p.S1096Y|DLC1_ENST00000358919.2_Missense_Mutation_p.S1062Y	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1499	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						ATGTCCAAAAGATTTTGTGTA	0.378																																						uc003wwm.2		NA																	0				ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						c.(4495-4497)TCT>TAT		deleted in liver cancer 1 isoform 1							147.0	129.0	135.0					8																	12943411		2203	4300	6503	SO:0001583	missense	10395				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding	g.chr8:12943411G>T	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4496C>A	8.37:g.12943411G>T	ENSP00000276297:p.Ser1499Tyr		Somatic				DLC1_uc003wwk.1_Missense_Mutation_p.S1062Y|DLC1_uc003wwl.1_Missense_Mutation_p.S1096Y|DLC1_uc011kxx.1_Missense_Mutation_p.S988Y	p.S1499Y	NM_182643	NP_872584	WXS	Illumina HiSeq	Unspecified	Q96QB1	RHG07_HUMAN			18	4940	-			1499			START.		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	c.4496C>A	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440755	0.43326	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	5.17	5.17	0.71159	Lipid-binding START (3);START-like domain (1);	0.446035	0.24922	N	0.034536	T	0.75042	0.3796	N	0.24115	0.695	0.80722	D	1	P;P;P	0.45011	0.847;0.848;0.755	P;P;B	0.49887	0.625;0.516;0.264	T	0.75510	-0.3292	10	0.56958	D	0.05	.	9.8163	0.40853	0.0741:0.1408:0.7851:0.0	.	1499;1096;1062	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	Y	1499;1062;438;1096;988	ENSP00000276297:S1499Y;ENSP00000351797:S1062Y;ENSP00000422595:S1096Y;ENSP00000428028:S988Y	ENSP00000276297:S1499Y	S	-	2	0	DLC1	12987782	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.791000	0.55469	2.865000	0.98341	0.655000	0.94253	TCT		0.378	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		20	49	1	0	1.02e-10	1.31e-10	20	49				
MSR1	4481	broad.mit.edu	37	8	15978072	15978072	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:15978072G>T	ENST00000262101.5	-	9	1198	c.1077C>A	c.(1075-1077)caC>caA	p.H359Q	MSR1_ENST00000445506.2_Missense_Mutation_p.H377Q|MSR1_ENST00000355282.2_Intron|MSR1_ENST00000350896.3_Intron			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	359	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)	p.H359H(3)		haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CCCTCCCCTCGTGAGGGCCGC	0.483																																						uc003wwz.2		NA																	3	Substitution - coding silent(3)		haematopoietic_and_lymphoid_tissue(3)	ovary(1)	1						c.(1075-1077)CAC>CAA		macrophage scavenger receptor 1 isoform type 1							75.0	77.0	76.0					8																	15978072		2203	4300	6503	SO:0001583	missense	4481				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity	g.chr8:15978072G>T	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.1077C>A	8.37:g.15978072G>T	ENSP00000262101:p.His359Gln		Somatic				MSR1_uc010lsu.2_Missense_Mutation_p.H377Q|MSR1_uc003wxa.2_Intron	p.H359Q	NM_138715	NP_619729	WXS	Illumina HiSeq	Unspecified	P21757	MSRE_HUMAN		Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)	9	1275	-			359			SRCR.|Extracellular (Potential).		D3DSP3|O60505|P21759|Q45F10	Missense_Mutation	SNP	ENST00000262101.5	37	c.1077C>A	CCDS5995.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929943	0.34096	.	.	ENSG00000038945	ENST00000262101;ENST00000445506	T;T	0.28069	1.63;1.63	4.84	-7.1	0.01547	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.000000	0.40385	N	0.001120	T	0.42040	0.1185	L	0.55743	1.74	0.22648	N	0.998895	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.982	T	0.46233	-0.9206	10	0.37606	T	0.19	.	16.1393	0.81512	0.3221:0.0:0.6779:0.0	.	377;359	B4DDJ5;P21757	.;MSRE_HUMAN	Q	359;377	ENSP00000262101:H359Q;ENSP00000405453:H377Q	ENSP00000262101:H359Q	H	-	3	2	MSR1	16022443	0.000000	0.05858	0.279000	0.24732	0.093000	0.18481	-1.374000	0.02566	-1.322000	0.02278	-0.302000	0.09304	CAC		0.483	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2			26	65	1	0	1.75e-13	2.36e-13	26	65				
TEX15	56154	broad.mit.edu	37	8	30705035	30705035	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:30705035T>C	ENST00000256246.2	-	1	1573	c.1499A>G	c.(1498-1500)tAt>tGt	p.Y500C	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	500					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTTGTCTCCATATATGTTCTC	0.308																																						uc003xil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7						c.(1498-1500)TAT>TGT		testis expressed 15							123.0	114.0	117.0					8																	30705035		2202	4299	6501	SO:0001583	missense	56154							g.chr8:30705035T>C	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1499A>G	8.37:g.30705035T>C	ENSP00000256246:p.Tyr500Cys		Somatic					p.Y500C	NM_031271	NP_112561	WXS	Illumina HiSeq	Unspecified	Q9BXT5	TEX15_HUMAN		KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)	1	1499	-			500						Missense_Mutation	SNP	ENST00000256246.2	37	c.1499A>G	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	T	9.688	1.151233	0.21371	.	.	ENSG00000133863	ENST00000256246	T	0.10960	2.82	5.61	-1.71	0.08133	.	0.925733	0.09107	N	0.847609	T	0.06416	0.0165	N	0.17082	0.46	0.09310	N	1	B	0.14438	0.01	B	0.16722	0.016	T	0.40421	-0.9564	10	0.87932	D	0	.	5.8723	0.18810	0.0:0.4001:0.225:0.3749	.	500	Q9BXT5	TEX15_HUMAN	C	500	ENSP00000256246:Y500C	ENSP00000256246:Y500C	Y	-	2	0	TEX15	30824577	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	-0.093000	0.11111	-0.105000	0.12132	0.528000	0.53228	TAT		0.308	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			18	88	0	0	0	0	18	88				
LETM2	137994	broad.mit.edu	37	8	38261968	38261968	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:38261968A>T	ENST00000379957.4	+	8	1289	c.1162A>T	c.(1162-1164)Acc>Tcc	p.T388S	LETM2_ENST00000528827.1_3'UTR|LETM2_ENST00000527710.1_Missense_Mutation_p.T174S|LETM2_ENST00000297720.5_Missense_Mutation_p.T293S|LETM2_ENST00000523983.2_Missense_Mutation_p.T341S|LETM2_ENST00000524874.1_Missense_Mutation_p.T340S|RP11-350N15.3_ENST00000533301.1_RNA	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2	388						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			CCTGTCCCGCACCTTCTACCT	0.557																																						uc003xlm.1		NA																	0					0						c.(1021-1023)ACC>TCC		leucine zipper-EF-hand containing transmembrane							184.0	147.0	160.0					8																	38261968		2203	4300	6503	SO:0001583	missense	137994					integral to membrane|mitochondrial inner membrane		g.chr8:38261968A>T	AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.1162A>T	8.37:g.38261968A>T	ENSP00000369291:p.Thr388Ser		Somatic				LETM2_uc011lbn.1_Missense_Mutation_p.T185S|LETM2_uc003xll.1_Missense_Mutation_p.T293S|LETM2_uc003xln.1_Missense_Mutation_p.T185S|LETM2_uc003xlo.1_Missense_Mutation_p.T185S	p.T341S	NM_144652	NP_653253	WXS	Illumina HiSeq	Unspecified	Q2VYF4	LETM2_HUMAN	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)		8	1192	+	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	388			Mitochondrial matrix (Potential).		A6NMG3|Q8NCR2|Q96LL1	Missense_Mutation	SNP	ENST00000379957.4	37	c.1021A>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.2|27.2	4.812314|4.812314	0.90707|0.90707	.|.	.|.	ENSG00000165046|ENSG00000165046	ENST00000527175|ENST00000297720;ENST00000524874;ENST00000379957;ENST00000523983;ENST00000527710	.|.	.|.	.|.	5.48|5.48	4.33|4.33	0.51752|0.51752	.|.	.|0.112759	.|0.64402	.|D	.|0.000013	T|T	0.50086|0.50086	0.1595|0.1595	M|M	0.64997|0.64997	1.995|1.995	0.46631|0.46631	D|D	0.999136|0.999136	.|P;P;D	.|0.54047	.|0.599;0.896;0.964	.|B;P;P	.|0.46796	.|0.146;0.459;0.527	T|T	0.56318|0.56318	-0.7999|-0.7999	5|9	.|0.72032	.|D	.|0.01	.|.	4.6737|4.6737	0.12701|0.12701	0.7321:0.0:0.2679:0.0|0.7321:0.0:0.2679:0.0	.|.	.|185;388;340	.|B7Z7T4;Q2VYF4;E9PMA4	.|.;LETM2_HUMAN;.	L|S	13|293;340;388;341;174	.|.	.|ENSP00000297720:T293S	H|T	+|+	2|1	0|0	LETM2|LETM2	38381125|38381125	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.984000|0.984000	0.73092|0.73092	6.912000|6.912000	0.75753|0.75753	2.223000|2.223000	0.72356|0.72356	0.524000|0.524000	0.50904|0.50904	CAC|ACC		0.557	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000381816.1	NM_144652		20	45	0	0	0	0	20	45				
RB1CC1	9821	broad.mit.edu	37	8	53570560	53570560	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:53570560T>A	ENST00000025008.5	-	14	2441	c.1918A>T	c.(1918-1920)Aag>Tag	p.K640*	RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.K640*|RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.K640*|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	640					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				GAATTTGCCTTTTGTTCACTC	0.378																																					GBM(180;1701 2102 13475 42023 52570)	uc003xre.3		NA																	0				ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11						c.(1918-1920)AAG>TAG		Rb1-inducible coiled coil protein 1 isoform 1							185.0	178.0	181.0					8																	53570560		2203	4300	6503	SO:0001587	stop_gained	9821				autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding	g.chr8:53570560T>A	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.1918A>T	8.37:g.53570560T>A	ENSP00000025008:p.Lys640*		Somatic				RB1CC1_uc003xrf.3_Nonsense_Mutation_p.K640*	p.K640*	NM_014781	NP_055596	WXS	Illumina HiSeq	Unspecified	Q8TDY2	RBCC1_HUMAN			14	2476	-		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)	640					Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	ENST00000025008.5	37	c.1918A>T	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	T	43	9.829961	0.99275	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.76	5.76	0.90799	.	1.272270	0.05279	N	0.519084	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0611	16.3695	0.83350	0.0:0.0:0.0:1.0	.	.	.	.	X	640	.	ENSP00000025008:K640X	K	-	1	0	RB1CC1	53733113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.651000	0.83577	2.315000	0.78130	0.533000	0.62120	AAG		0.378	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		26	84	0	0	0	0	26	84				
KCNB2	9312	broad.mit.edu	37	8	73848938	73848938	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:73848938G>A	ENST00000523207.1	+	3	1936	c.1348G>A	c.(1348-1350)Gtt>Att	p.V450I		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	450			V -> I (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.V450I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CGGAAGCATCGTTTCTATGAA	0.473																																						uc003xzb.2		NA																	1	Substitution - Missense(1)	p.V450I(1)	large_intestine(1)	skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7						c.(1348-1350)GTT>ATT		potassium voltage-gated channel, Shab-related							76.0	81.0	79.0					8																	73848938		2203	4300	6503	SO:0001583	missense	9312				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding	g.chr8:73848938G>A	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1348G>A	8.37:g.73848938G>A	ENSP00000430846:p.Val450Ile		Somatic					p.V450I	NM_004770	NP_004761	WXS	Illumina HiSeq	Unspecified	Q92953	KCNB2_HUMAN	Epithelial(68;0.105)		3	1936	+	Breast(64;0.137)		450		V -> I (in a colorectal cancer sample; somatic mutation).	Cytoplasmic (Potential).		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	c.1348G>A	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296133	0.81025	.	.	ENSG00000182674	ENST00000523207	D	0.97279	-4.32	5.74	5.74	0.90152	.	0.178810	0.26620	N	0.023364	D	0.97798	0.9277	M	0.72894	2.215	0.80722	D	1	D	0.57571	0.98	P	0.55391	0.775	D	0.97927	1.0318	10	0.56958	D	0.05	.	19.91	0.97023	0.0:0.0:1.0:0.0	.	450	Q92953	KCNB2_HUMAN	I	450	ENSP00000430846:V450I	ENSP00000430846:V450I	V	+	1	0	KCNB2	74011492	1.000000	0.71417	0.931000	0.37212	0.913000	0.54294	8.022000	0.88759	2.702000	0.92279	0.655000	0.94253	GTT		0.473	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		30	89	0	0	0	0	30	89				
ODF1	4956	broad.mit.edu	37	8	103564144	103564144	+	Silent	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:103564144C>G	ENST00000285402.3	+	1	345	c.189C>G	c.(187-189)cgC>cgG	p.R63R		NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	63	2 X 5 AA repeats of [RC]-C-L-C-D.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			AGCGATCACGCTCTTGCGGCC	0.493																																						uc003ykt.2		NA																	0				ovary(2)	2						c.(187-189)CGC>CGG		outer dense fiber of sperm tails 1							340.0	272.0	295.0					8																	103564144		2203	4300	6503	SO:0001819	synonymous_variant	4956				cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity	g.chr8:103564144C>G	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.189C>G	8.37:g.103564144C>G			Somatic					p.R63R	NM_024410	NP_077721	WXS	Illumina HiSeq	Unspecified	Q14990	ODFP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)		1	297	+	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		63			2 X 5 AA repeats of [RC]-C-L-C-D.		Q3SX72	Silent	SNP	ENST00000285402.3	37	c.189C>G	CCDS6293.1																																																																																				0.493	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			42	110	0	0	0	0	42	110				
CSMD3	114788	broad.mit.edu	37	8	113585863	113585863	+	Silent	SNP	C	C	T	rs200793759		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:113585863C>T	ENST00000297405.5	-	24	4153	c.3909G>A	c.(3907-3909)acG>acA	p.T1303T	CSMD3_ENST00000343508.3_Silent_p.T1263T|CSMD3_ENST00000352409.3_Silent_p.T1303T|CSMD3_ENST00000455883.2_Silent_p.T1199T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1303	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTAGATGAGTCGTTTTATCTT	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			C|||	1	0.000199681	0.0	0.0	5008	,	,		15051	0.0		0.001	False		,,,				2504	0.0					uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(3907-3909)ACG>ACA		CUB and Sushi multiple domains 3 isoform 1							94.0	94.0	94.0					8																	113585863		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:113585863C>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3909G>A	8.37:g.113585863C>T		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Silent_p.T575T|CSMD3_uc003ynt.2_Silent_p.T1263T|CSMD3_uc011lhx.1_Silent_p.T1199T	p.T1303T	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			24	4068	-			1303			Extracellular (Potential).|CUB 7.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.3909G>A	CCDS6315.1																																																																																				0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		26	77	0	0	0	0	26	77				
CSMD3	114788	broad.mit.edu	37	8	113599379	113599379	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:113599379G>T	ENST00000297405.5	-	23	4045	c.3801C>A	c.(3799-3801)tgC>tgA	p.C1267*	CSMD3_ENST00000343508.3_Nonsense_Mutation_p.C1227*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.C1267*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.C1163*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1267	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TACTATAAATGCATTCATGGT	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(3799-3801)TGC>TGA		CUB and Sushi multiple domains 3 isoform 1							137.0	126.0	130.0					8																	113599379		2203	4298	6501	SO:0001587	stop_gained	114788					integral to membrane|plasma membrane		g.chr8:113599379G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3801C>A	8.37:g.113599379G>T	ENSP00000297405:p.Cys1267*	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Nonsense_Mutation_p.C539*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.C1227*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.C1163*	p.C1267*	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			23	3960	-			1267			Extracellular (Potential).|CUB 7.		Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	c.3801C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	44	10.588169	0.99433	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.14	3.25	0.37280	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.3517	0.16040	0.3703:0.0:0.6297:0.0	.	.	.	.	X	1227;1267;607;1163;1267	.	ENSP00000297405:C1267X	C	-	3	2	CSMD3	113668555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.719000	0.38011	1.079000	0.41038	0.591000	0.81541	TGC		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		24	66	1	0	2.22e-12	2.92e-12	24	66				
ENPP2	5168	broad.mit.edu	37	8	120629736	120629736	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:120629736T>A	ENST00000075322.6	-	6	605	c.547A>T	c.(547-549)Agc>Tgc	p.S183C	ENPP2_ENST00000427067.2_Missense_Mutation_p.S179C|ENPP2_ENST00000522826.1_Missense_Mutation_p.S183C|ENPP2_ENST00000259486.6_Missense_Mutation_p.S183C	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	183					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATGACTTTGCTGCCTTTCTTC	0.398																																					Melanoma(20;305 879 2501 4818 31020)	uc003yot.1		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7						c.(547-549)AGC>TGC		autotaxin isoform 2 preproprotein							78.0	75.0	76.0					8																	120629736		2203	4300	6503	SO:0001583	missense	5168				cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding	g.chr8:120629736T>A	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.547A>T	8.37:g.120629736T>A	ENSP00000075322:p.Ser183Cys		Somatic				ENPP2_uc003yos.1_Missense_Mutation_p.S183C|ENPP2_uc010mdd.1_Missense_Mutation_p.S183C	p.S183C	NM_001040092	NP_001035181	WXS	Illumina HiSeq	Unspecified	Q13822	ENPP2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00185)		6	633	-	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		183					A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	c.547A>T	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.116220	0.77323	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522826;ENST00000075322;ENST00000520066	T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73	5.95	5.95	0.96441	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.375722	0.36932	N	0.002328	T	0.76248	0.3961	L	0.50333	1.59	0.30345	N	0.785352	P;P;P	0.48640	0.913;0.866;0.824	P;P;P	0.56474	0.799;0.505;0.698	T	0.77189	-0.2679	10	0.62326	D	0.03	.	12.3006	0.54872	0.0:0.0:0.1411:0.8589	.	183;183;183	E9PHP7;Q13822;Q13822-2	.;ENPP2_HUMAN;.	C	183;179;183;183;165	ENSP00000259486:S183C;ENSP00000403315:S179C;ENSP00000428291:S183C;ENSP00000075322:S183C;ENSP00000428304:S165C	ENSP00000075322:S183C	S	-	1	0	ENPP2	120698917	0.857000	0.29778	1.000000	0.80357	0.976000	0.68499	2.633000	0.46519	2.281000	0.76405	0.528000	0.53228	AGC		0.398	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			9	27	0	0	0	0	9	27				
FAM135B	51059	broad.mit.edu	37	8	139164844	139164844	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr8:139164844T>A	ENST00000395297.1	-	13	2044	c.1874A>T	c.(1873-1875)gAg>gTg	p.E625V		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	625										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CATCTTCCCCTCTTGATCTAT	0.463										HNSCC(54;0.14)																												uc003yuy.2		NA																	0				ovary(7)|skin(2)	9						c.(1873-1875)GAG>GTG		hypothetical protein LOC51059							126.0	123.0	124.0					8																	139164844		1884	4123	6007	SO:0001583	missense	51059							g.chr8:139164844T>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1874A>T	8.37:g.139164844T>A	ENSP00000378710:p.Glu625Val	HNSCC(54;0.14)	Somatic				FAM135B_uc003yux.2_Missense_Mutation_p.E526V|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.E187V|FAM135B_uc003yvb.2_Missense_Mutation_p.E187V	p.E625V	NM_015912	NP_056996	WXS	Illumina HiSeq	Unspecified	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		13	2045	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		625					B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	c.1874A>T	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	T	12.88	2.071180	0.36566	.	.	ENSG00000147724	ENST00000395297	T	0.18016	2.24	5.33	4.18	0.49190	.	0.669533	0.14706	N	0.303247	T	0.24314	0.0589	L	0.47716	1.5	0.09310	N	1	D;D;P	0.57571	0.98;0.98;0.877	P;P;B	0.53649	0.731;0.731;0.276	T	0.06285	-1.0835	10	0.33141	T	0.24	-10.8097	9.6044	0.39624	0.0:0.0847:0.0:0.9153	.	625;625;625	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	V	625	ENSP00000378710:E625V	ENSP00000276737:E625V	E	-	2	0	FAM135B	139234026	0.394000	0.25246	0.055000	0.19348	0.039000	0.13416	2.032000	0.41127	1.002000	0.39104	0.533000	0.62120	GAG		0.463	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		12	107	0	0	0	0	12	107				
KIAA1161	57462	broad.mit.edu	37	9	34370855	34370855	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:34370855A>C	ENST00000297625.7	-	2	2210	c.1985T>G	c.(1984-1986)cTg>cGg	p.L662R		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	696					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		ATCGGTGAGCAGCACCGGCGT	0.637																																						uc003zue.3		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(2086-2088)CTG>CGG		hypothetical protein LOC57462							38.0	43.0	41.0					9																	34370855		2025	4183	6208	SO:0001583	missense	57462				carbohydrate metabolic process	integral to membrane	hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr9:34370855A>C	AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.1985T>G	9.37:g.34370855A>C	ENSP00000297625:p.Leu662Arg		Somatic					p.L696R	NM_020702	NP_065753	WXS	Illumina HiSeq	Unspecified	Q6NSJ0	K1161_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)	3	2254	-			696			Extracellular (Potential).		Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	ENST00000297625.7	37	c.2087T>G		.	.	.	.	.	.	.	.	.	.	A	14.74	2.627022	0.46840	.	.	ENSG00000164976	ENST00000297625	D	0.91124	-2.79	5.78	5.78	0.91487	.	0.146440	0.46758	D	0.000262	D	0.89701	0.6791	N	0.25201	0.72	0.47737	D	0.999501	D	0.57571	0.98	P	0.56563	0.801	D	0.89262	0.3598	10	0.35671	T	0.21	-18.683	15.5785	0.76414	1.0:0.0:0.0:0.0	.	696	Q6NSJ0	K1161_HUMAN	R	662	ENSP00000297625:L662R	ENSP00000297625:L662R	L	-	2	0	KIAA1161	34360855	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.394000	0.59671	2.333000	0.79357	0.533000	0.62120	CTG		0.637	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000052158.1	XM_351807		13	15	0	0	0	0	13	15				
TGFBR1	7046	broad.mit.edu	37	9	101907135	101907135	+	Silent	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:101907135T>C	ENST00000374994.4	+	6	1212	c.1095T>C	c.(1093-1095)atT>atC	p.I365I	TGFBR1_ENST00000550253.1_Silent_p.I296I|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000374990.2_Silent_p.I288I|TGFBR1_ENST00000552516.1_Silent_p.I369I	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	365	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CAGATACCATTGATATTGCTC	0.348																																						uc004azc.2		NA																	0				lung(2)|ovary(1)	3						c.(1093-1095)ATT>ATC		transforming growth factor, beta receptor I							116.0	108.0	111.0					9																	101907135		2203	4300	6503	SO:0001819	synonymous_variant	7046				activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding	g.chr9:101907135T>C		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1095T>C	9.37:g.101907135T>C			Somatic				TGFBR1_uc004azd.2_Silent_p.I288I|TGFBR1_uc011lvc.1_Silent_p.I296I	p.I365I	NM_004612	NP_004603	WXS	Illumina HiSeq	Unspecified	P36897	TGFR1_HUMAN			6	1171	+		Acute lymphoblastic leukemia(62;0.0559)	365			Protein kinase.|Cytoplasmic (Potential).		Q6IR47|Q706C0|Q706C1	Silent	SNP	ENST00000374994.4	37	c.1095T>C	CCDS6738.1																																																																																				0.348	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3			15	56	0	0	0	0	15	56				
C9orf43	257169	broad.mit.edu	37	9	116185750	116185750	+	Nonsense_Mutation	SNP	G	G	T	rs186534707		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:116185750G>T	ENST00000288462.4	+	7	1074	c.628G>T	c.(628-630)Gaa>Taa	p.E210*	C9orf43_ENST00000374165.1_Nonsense_Mutation_p.E210*	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	210								p.E210K(1)		breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						GGCTCAATCCGAAGCGTTACC	0.498																																						uc004bho.3		NA																	1	Substitution - Missense(1)		prostate(1)		0						c.(628-630)GAA>TAA		hypothetical protein LOC257169							107.0	95.0	99.0					9																	116185750		2203	4300	6503	SO:0001587	stop_gained	257169							g.chr9:116185750G>T	BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.628G>T	9.37:g.116185750G>T	ENSP00000288462:p.Glu210*		Somatic				C9orf43_uc004bhp.2_Nonsense_Mutation_p.E210*	p.E210*	NM_152786	NP_689999	WXS	Illumina HiSeq	Unspecified	Q8TAL5	CI043_HUMAN			7	1024	+			210						Nonsense_Mutation	SNP	ENST00000288462.4	37	c.628G>T	CCDS6796.1	.	.	.	.	.	.	.	.	.	.	G	36	5.614847	0.96649	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	.	.	.	4.98	0.824	0.18818	.	0.898882	0.09445	N	0.801222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	0.0509	1.51	0.02494	0.1865:0.1684:0.4715:0.1736	.	.	.	.	X	210	.	ENSP00000288462:E210X	E	+	1	0	C9orf43	115225571	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.232000	0.17891	0.377000	0.24735	-0.176000	0.13171	GAA		0.498	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786		4	35	1	0	0.00909568	0.00960708	4	35				
OR1N2	138882	broad.mit.edu	37	9	125315468	125315468	+	Missense_Mutation	SNP	G	G	A	rs141317564		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:125315468G>A	ENST00000373688.2	+	1	78	c.20G>A	c.(19-21)cGc>cAc	p.R7H		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						TTTTATCTGCGCAGATCACAC	0.433																																						uc011lyx.1		NA																	0				ovary(2)|skin(2)	4						c.(19-21)CGC>CAC		olfactory receptor, family 1, subfamily N,		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	87.0	88.0	88.0		20	1.2	0.0	9	dbSNP_134	88	0,8600		0,0,4300	no	missense	OR1N2	NM_001004457.1	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	7/331	125315468	1,13005	2203	4300	6503	SO:0001583	missense	138882				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125315468G>A		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.20G>A	9.37:g.125315468G>A	ENSP00000362792:p.Arg7His		Somatic					p.R7H	NM_001004457	NP_001004457	WXS	Illumina HiSeq	Unspecified	Q8NGR9	OR1N2_HUMAN			1	20	+			7			Extracellular (Potential).		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	ENST00000373688.2	37	c.20G>A	CCDS35123.1	.	.	.	.	.	.	.	.	.	.	G	1.596	-0.527865	0.04112	2.27E-4	0.0	ENSG00000171501	ENST00000373688	T	0.01505	4.82	3.61	1.18	0.20946	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48658	-0.9016	9	0.32370	T	0.25	.	5.1241	0.14875	0.7248:0.0:0.2752:0.0	.	7	Q8NGR9	OR1N2_HUMAN	H	7	ENSP00000362792:R7H	ENSP00000362792:R7H	R	+	2	0	OR1N2	124355289	0.000000	0.05858	0.030000	0.17652	0.008000	0.06430	-0.284000	0.08422	0.135000	0.18707	-0.356000	0.07607	CGC		0.433	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2			9	66	0	0	0	0	9	66				
DENND1A	57706	broad.mit.edu	37	9	126219701	126219701	+	Missense_Mutation	SNP	C	C	T	rs139898166		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:126219701C>T	ENST00000373624.2	-	15	1313	c.1112G>A	c.(1111-1113)cGa>cAa	p.R371Q	DENND1A_ENST00000542603.1_Missense_Mutation_p.R113Q|DENND1A_ENST00000394219.3_Missense_Mutation_p.R339Q|DENND1A_ENST00000373618.1_Missense_Mutation_p.R339Q|DENND1A_ENST00000373620.3_Missense_Mutation_p.R371Q|DENND1A_ENST00000473039.1_Intron|DENND1A_ENST00000394215.2_Missense_Mutation_p.R341Q	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	371	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						AAGATCTAATCGACCATCAAT	0.433																																						uc004bnz.1		NA																	0				ovary(2)	2						c.(1111-1113)CGA>CAA		DENN/MADD domain containing 1A isoform 1		C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	109.0	105.0	106.0		1112,1112	5.5	1.0	9	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DENND1A	NM_020946.1,NM_024820.2	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	371/1010,371/560	126219701	1,13005	2203	4300	6503	SO:0001583	missense	57706					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity	g.chr9:126219701C>T	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1112G>A	9.37:g.126219701C>T	ENSP00000362727:p.Arg371Gln		Somatic				DENND1A_uc011lzl.1_Missense_Mutation_p.R146Q|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Missense_Mutation_p.R339Q|DENND1A_uc004boa.1_Missense_Mutation_p.R371Q|DENND1A_uc004bob.1_Missense_Mutation_p.R341Q|DENND1A_uc004boc.2_Missense_Mutation_p.R339Q	p.R371Q	NM_020946	NP_065997	WXS	Illumina HiSeq	Unspecified	Q8TEH3	DEN1A_HUMAN			15	1345	-			371			dDENN.		A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	c.1112G>A	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	C	35	5.518980	0.96416	0.0	1.16E-4	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.46	5.46	0.80206	dDENN (3);	0.000000	0.85682	D	0.000000	T	0.77308	0.4111	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0;0.994	T	0.80432	-0.1385	10	0.87932	D	0	-10.1027	19.6891	0.95991	0.0:1.0:0.0:0.0	.	339;329;339;341;371;371	Q8TEH3-6;Q8TEH3-7;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3	.;.;.;.;.;DEN1A_HUMAN	Q	371;113;339;371;341;339	ENSP00000362727:R371Q;ENSP00000437457:R113Q;ENSP00000377766:R339Q;ENSP00000362722:R371Q;ENSP00000377763:R341Q;ENSP00000362720:R339Q	ENSP00000362720:R339Q	R	-	2	0	DENND1A	125259522	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.442000	0.80503	2.706000	0.92434	0.655000	0.94253	CGA		0.433	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820		7	98	0	0	0	0	7	98				
CIZ1	25792	broad.mit.edu	37	9	130941207	130941207	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:130941207C>T	ENST00000393608.1	-	8	1481	c.1279G>A	c.(1279-1281)Gtc>Atc	p.V427I	CIZ1_ENST00000277465.4_Intron|CIZ1_ENST00000476727.2_Intron|CIZ1_ENST00000325721.8_Missense_Mutation_p.V398I|CIZ1_ENST00000538431.1_Missense_Mutation_p.V427I|CIZ1_ENST00000372938.5_Missense_Mutation_p.V427I|CIZ1_ENST00000357558.5_Intron|CIZ1_ENST00000372948.3_Intron|CIZ1_ENST00000372954.1_Intron|CIZ1_ENST00000541172.1_Missense_Mutation_p.V326I	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	427	Gln-rich.				maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						TGTGTCTGGACCTGCTTCTGC	0.627																																						uc004btt.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1279-1281)GTC>ATC		CDKN1A interacting zinc finger protein 1 isoform							160.0	140.0	147.0					9																	130941207		2203	4300	6503	SO:0001583	missense	25792					nucleus	nucleic acid binding|protein binding|zinc ion binding	g.chr9:130941207C>T	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1279G>A	9.37:g.130941207C>T	ENSP00000377232:p.Val427Ile		Somatic				CIZ1_uc004btr.2_Intron|CIZ1_uc004bts.2_Missense_Mutation_p.V398I|CIZ1_uc011maq.1_Intron|CIZ1_uc004btu.2_Intron|CIZ1_uc011mar.1_Missense_Mutation_p.V326I|CIZ1_uc011mas.1_Missense_Mutation_p.V457I|CIZ1_uc004btw.2_Intron|CIZ1_uc004btv.2_Missense_Mutation_p.V427I|CIZ1_uc004btx.2_Missense_Mutation_p.V403I	p.V427I	NM_001131016	NP_001124488	WXS	Illumina HiSeq	Unspecified	Q9ULV3	CIZ1_HUMAN			8	1442	-			427			Gln-rich.		A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	ENST00000393608.1	37	c.1279G>A	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633323	0.47049	.	.	ENSG00000148337	ENST00000393608;ENST00000538431;ENST00000325721;ENST00000541172;ENST00000372938;ENST00000415526	T;T;T;T;T;T	0.34859	1.44;1.34;1.34;1.75;1.44;2.02	4.23	4.23	0.50019	.	0.562806	0.16264	N	0.222090	T	0.16938	0.0407	N	0.08118	0	0.09310	N	0.999996	B;B;B;B	0.22211	0.004;0.066;0.004;0.007	B;B;B;B	0.18561	0.01;0.022;0.005;0.022	T	0.11203	-1.0597	9	.	.	.	-5.0357	8.2021	0.31430	0.0:0.8947:0.0:0.1053	.	427;427;427;398	B7Z3U7;F5H2X7;Q9ULV3;Q9ULV3-2	.;.;CIZ1_HUMAN;.	I	427;427;398;326;427;349	ENSP00000377232:V427I;ENSP00000439244:V427I;ENSP00000320374:V398I;ENSP00000445057:V326I;ENSP00000362029:V427I;ENSP00000398011:V349I	.	V	-	1	0	CIZ1	129981028	0.008000	0.16893	1.000000	0.80357	0.968000	0.65278	-0.319000	0.08039	2.647000	0.89833	0.561000	0.74099	GTC		0.627	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127		5	119	0	0	0	0	5	119				
FIBCD1	84929	broad.mit.edu	37	9	133799269	133799269	+	Splice_Site	SNP	T	T	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:133799269T>A	ENST00000372338.4	-	4	955		c.e4-2		FIBCD1_ENST00000372337.2_Splice_Site|FIBCD1_ENST00000448616.1_Splice_Site|FIBCD1_ENST00000253018.4_Splice_Site	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1							integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		GCCGGGAGCCTGAGGGAGGCA	0.647																																						uc004bzz.2		NA																	0					0						c.e4-1		fibrinogen C domain containing 1							58.0	53.0	55.0					9																	133799269		2203	4300	6503	SO:0001630	splice_region_variant	84929				signal transduction	extracellular space|integral to membrane	chitin binding|metal ion binding|receptor binding	g.chr9:133799269T>A	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.713-2A>T	9.37:g.133799269T>A			Somatic				FIBCD1_uc011mcc.1_Splice_Site_p.G238_splice	p.G238_splice	NM_032843	NP_116232	WXS	Illumina HiSeq	Unspecified	Q8N539	FBCD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)	4	958	-	all_hematologic(7;0.0028)							A3KFK0|Q6UXK6|Q96SJ7	Splice_Site	SNP	ENST00000372338.4	37	c.713_splice	CCDS6937.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.097121	0.56075	.	.	ENSG00000130720	ENST00000448616;ENST00000372338;ENST00000372337;ENST00000444139;ENST00000253018;ENST00000451466	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3085	0.49349	0.136:0.0:0.0:0.864	.	.	.	.	.	-1	.	.	.	-	.	.	FIBCD1	132789090	1.000000	0.71417	0.995000	0.50966	0.473000	0.32948	7.172000	0.77604	2.100000	0.63781	0.379000	0.24179	.		0.647	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843	Intron	8	64	0	0	0	0	8	64				
TBL1X	6907	broad.mit.edu	37	X	9660274	9660274	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:9660274G>T	ENST00000217964.7	+	9	1511	c.871G>T	c.(871-873)Gtc>Ttc	p.V291F	TBL1X_ENST00000380961.1_Missense_Mutation_p.V240F|TBL1X_ENST00000536365.1_Missense_Mutation_p.V240F|TBL1X_ENST00000407597.2_Missense_Mutation_p.V291F|TBL1X_ENST00000424279.1_Missense_Mutation_p.V240F	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	291					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TAACAAAGACGTCACCTCACT	0.557																																						uc010ndq.2		NA																	0				ovary(1)	1						c.(871-873)GTC>TTC		transducin beta-like 1X isoform a							104.0	85.0	92.0					X																	9660274		2203	4300	6503	SO:0001583	missense	6907				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:9660274G>T	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.871G>T	X.37:g.9660274G>T	ENSP00000217964:p.Val291Phe		Somatic				TBL1X_uc004csq.3_Missense_Mutation_p.V240F|TBL1X_uc010ndr.2_Missense_Mutation_p.V240F|TBL1X_uc004csr.2_Missense_Mutation_p.V291F|TBL1X_uc004css.2_Missense_Mutation_p.V242F	p.V291F	NM_001139466	NP_001132938	WXS	Illumina HiSeq	Unspecified	O60907	TBL1X_HUMAN			9	1239	+		Hepatocellular(5;0.000888)	291			WD 2.		A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	c.871G>T	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345072	0.82022	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79	4.35	4.35	0.52113	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87787	0.6265	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90594	0.4539	10	0.87932	D	0	.	16.5093	0.84280	0.0:0.0:1.0:0.0	.	254;291	Q59F53;O60907	.;TBL1X_HUMAN	F	291;240;240;240;291	ENSP00000385988:V291F;ENSP00000394097:V240F;ENSP00000445317:V240F;ENSP00000370348:V240F;ENSP00000217964:V291F	ENSP00000217964:V291F	V	+	1	0	TBL1X	9620274	1.000000	0.71417	0.951000	0.38953	0.650000	0.38633	9.060000	0.93907	1.895000	0.54865	0.600000	0.82982	GTC		0.557	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647		13	51	1	0	1.05e-09	1.33e-09	13	51				
CLCN4	1183	broad.mit.edu	37	X	10188916	10188916	+	Splice_Site	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:10188916G>T	ENST00000380833.4	+	12	2582	c.2191G>T	c.(2191-2193)Ggg>Tgg	p.G731W	CLCN4_ENST00000421085.2_Splice_Site_p.G637W|CLCN4_ENST00000380829.1_Splice_Site_p.G700W	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	731	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GACGCGGAGCGGGTGAGTAGC	0.562																																					Melanoma(74;1050 1296 1576 30544 38374)	uc004csy.3		NA																	0				ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						c.(2191-2193)GGG>TGG		chloride channel 4							68.0	59.0	62.0					X																	10188916		2203	4300	6503	SO:0001630	splice_region_variant	1183					early endosome membrane|integral to membrane|late endosome membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity	g.chrX:10188916G>T	X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.2192+1G>T	X.37:g.10188916G>T			Somatic				CLCN4_uc011mid.1_Missense_Mutation_p.G637W	p.G731W	NM_001830	NP_001821	WXS	Illumina HiSeq	Unspecified	P51793	CLCN4_HUMAN			12	2621	+			731			CBS 2.|Cytoplasmic (By similarity).		A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation	SNP	ENST00000380833.4	37	c.2191G>T	CCDS14137.1	.	.	.	.	.	.	.	.	.	.	g	27.6	4.845009	0.91197	.	.	ENSG00000073464	ENST00000380833;ENST00000380829;ENST00000421085	D;D;D	0.92149	-2.98;-2.98;-2.98	5.36	5.36	0.76844	Cystathionine beta-synthase, core (3);	0.053341	0.85682	D	0.000000	D	0.97813	0.9282	H	0.98133	4.155	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99636	1.0987	10	0.87932	D	0	-41.0862	18.267	0.90055	0.0:0.0:1.0:0.0	.	731	P51793	CLCN4_HUMAN	W	731;700;637	ENSP00000370213:G731W;ENSP00000370209:G700W;ENSP00000405754:G637W	ENSP00000370209:G700W	G	+	1	0	CLCN4	10148916	1.000000	0.71417	0.984000	0.44739	0.904000	0.53231	9.649000	0.98487	2.253000	0.74438	0.591000	0.81541	GGG		0.562	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055730.1		Missense_Mutation	21	56	1	0	1.56e-14	2.12e-14	21	56				
CDKL5	6792	broad.mit.edu	37	X	18616687	18616687	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:18616687G>T	ENST00000379989.3	+	12	1216	c.931G>T	c.(931-933)Gca>Tca	p.A311S	CDKL5_ENST00000379996.3_Missense_Mutation_p.A311S	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	311					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.A311T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					TTCAAGGTCAGCAAAAAGAAA	0.408																																						uc004cym.2		NA																	1	Substitution - Missense(1)	p.A311T(1)	stomach(1)	ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6						c.(931-933)GCA>TCA		cyclin-dependent kinase-like 5							101.0	88.0	92.0					X																	18616687		2203	4300	6503	SO:0001583	missense	6792				neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding	g.chrX:18616687G>T	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.931G>T	X.37:g.18616687G>T	ENSP00000369325:p.Ala311Ser		Somatic				CDKL5_uc004cyn.2_Missense_Mutation_p.A311S	p.A311S	NM_003159	NP_003150	WXS	Illumina HiSeq	Unspecified	O76039	CDKL5_HUMAN			11	1184	+	Hepatocellular(33;0.183)		311					G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	c.931G>T	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	6.928	0.540997	0.13250	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.68331	-0.32;-0.32	5.52	0.646	0.17789	Protein kinase-like domain (1);	0.259829	0.45126	D	0.000396	T	0.35913	0.0948	N	0.05124	-0.11	0.25198	N	0.990072	B	0.13145	0.007	B	0.12156	0.007	T	0.17319	-1.0373	10	0.14656	T	0.56	-1.5758	5.5931	0.17311	0.4325:0.0:0.4407:0.1267	.	311	O76039	CDKL5_HUMAN	S	311	ENSP00000369332:A311S;ENSP00000369325:A311S	ENSP00000369325:A311S	A	+	1	0	CDKL5	18526608	1.000000	0.71417	0.976000	0.42696	0.994000	0.84299	1.425000	0.34859	-0.340000	0.08388	-0.192000	0.12808	GCA		0.408	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159		14	77	1	0	1.58e-08	1.97e-08	14	77				
PHKA2	5256	broad.mit.edu	37	X	18972377	18972377	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:18972377C>A	ENST00000379942.4	-	2	897	c.232G>T	c.(232-234)Gag>Tag	p.E78*		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	78					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ATTACCTGCTCCAGCTCGTAG	0.542																																						uc004cyv.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(232-234)GAG>TAG		phosphorylase kinase, alpha 2 (liver)							139.0	107.0	118.0					X																	18972377		2203	4300	6503	SO:0001587	stop_gained	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18972377C>A		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.232G>T	X.37:g.18972377C>A	ENSP00000369274:p.Glu78*		Somatic				PHKA2_uc010nfh.1_RNA|PHKA2_uc010nfi.1_Nonsense_Mutation_p.E20*	p.E78*	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			2	662	-	Hepatocellular(33;0.183)		78					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Nonsense_Mutation	SNP	ENST00000379942.4	37	c.232G>T	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	C	44	10.664986	0.99446	.	.	ENSG00000044446	ENST00000379942	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-22.5766	18.4514	0.90704	0.0:1.0:0.0:0.0	.	.	.	.	X	78	.	ENSP00000369274:E78X	E	-	1	0	PHKA2	18882298	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	7.773000	0.85462	2.298000	0.77334	0.600000	0.82982	GAG		0.542	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		30	75	1	0	2.61e-14	3.55e-14	30	75				
DMD	1756	broad.mit.edu	37	X	32716006	32716006	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:32716006C>T	ENST00000357033.4	-	9	1147	c.941G>A	c.(940-942)cGg>cAg	p.R314Q	DMD_ENST00000288447.4_Missense_Mutation_p.R306Q|DMD_ENST00000378677.2_Missense_Mutation_p.R310Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	314					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAATGGGCTCCGTGTAGGGTC	0.453																																						uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(940-942)CGG>CAG		dystrophin Dp427m isoform							143.0	110.0	121.0					X																	32716006		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32716006C>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.941G>A	X.37:g.32716006C>T	ENSP00000354923:p.Arg314Gln		Somatic				DMD_uc004dcz.2_Missense_Mutation_p.R191Q|DMD_uc004dcy.1_Missense_Mutation_p.R310Q|DMD_uc004ddb.1_Missense_Mutation_p.R306Q|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.R306Q|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Intron	p.R314Q	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			9	1185	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	314					E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.941G>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.715839	0.30413	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.73047	0.1;0.1;-0.71	5.63	2.45	0.29901	.	0.262478	0.17983	N	0.155478	T	0.48352	0.1495	N	0.08118	0	0.80722	D	1	B;B;B;B	0.16802	0.019;0.001;0.001;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.36311	-0.9753	10	0.49607	T	0.09	.	9.8428	0.41008	0.0:0.6857:0.0:0.3143	.	306;306;314;310	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	Q	306;310;314;314;191;306	ENSP00000367948:R310Q;ENSP00000354923:R314Q;ENSP00000288447:R306Q	ENSP00000288447:R306Q	R	-	2	0	DMD	32625927	1.000000	0.71417	0.979000	0.43373	0.992000	0.81027	2.219000	0.42899	0.531000	0.28639	0.538000	0.68166	CGG		0.453	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		5	15	0	0	0	0	5	15				
FAM47A	158724	broad.mit.edu	37	X	34150048	34150048	+	Silent	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:34150048C>A	ENST00000346193.3	-	1	399	c.348G>T	c.(346-348)gcG>gcT	p.A116A		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	116										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GCTCTACGAACGCCTTCCGTG	0.552																																						uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(346-348)GCG>GCT		hypothetical protein LOC158724							88.0	84.0	85.0					X																	34150048		2202	4300	6502	SO:0001819	synonymous_variant	158724							g.chrX:34150048C>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.348G>T	X.37:g.34150048C>A			Somatic					p.A116A	NM_203408	NP_981953	WXS	Illumina HiSeq	Unspecified	Q5JRC9	FA47A_HUMAN			1	381	-			116					A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	c.348G>T	CCDS43926.1																																																																																				0.552	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		16	74	1	0	4.15e-12	5.42e-12	16	74				
BCOR	54880	broad.mit.edu	37	X	39913236	39913236	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:39913236C>A	ENST00000378444.4	-	14	5107	c.4879G>T	c.(4879-4881)Gat>Tat	p.D1627Y	BCOR_ENST00000378463.1_Missense_Mutation_p.D470Y|BCOR_ENST00000397354.3_Missense_Mutation_p.D1593Y|BCOR_ENST00000342274.4_Missense_Mutation_p.D1593Y|BCOR_ENST00000378455.4_Missense_Mutation_p.D1575Y	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1627	Poly-Asp.				heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCATCATCATCCTGGTCTTCT	0.448			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															uc004den.3		NA		Rec	yes		X	Xp11.4	54880		BCL6 corepressor	yes							0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(4879-4881)GAT>TAT		BCL-6 interacting corepressor isoform c							70.0	54.0	59.0					X																	39913236		2202	4300	6502	SO:0001583	missense	54880				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:39913236C>A	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4879G>T	X.37:g.39913236C>A	ENSP00000367705:p.Asp1627Tyr		Somatic				BCOR_uc004dep.3_Missense_Mutation_p.D1593Y|BCOR_uc004deo.3_Missense_Mutation_p.D1575Y|BCOR_uc010nhb.2_Missense_Mutation_p.D335Y|BCOR_uc004dem.3_Missense_Mutation_p.D1593Y	p.D1627Y	NM_001123385	NP_001116857	WXS	Illumina HiSeq	Unspecified	Q6W2J9	BCOR_HUMAN			14	5171	-			1627			Poly-Asp.		D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	37	c.4879G>T	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096905	0.56075	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	T;T;T;T;T;T;T	0.70869	-0.52;0.88;0.95;0.93;0.93;0.93;-0.43	5.3	4.43	0.53597	.	.	.	.	.	T	0.73481	0.3592	L	0.47716	1.5	0.27155	N	0.961319	P;P;P	0.43542	0.81;0.668;0.81	P;B;P	0.51742	0.678;0.401;0.678	T	0.66284	-0.5962	9	0.87932	D	0	-11.0488	11.0063	0.47635	0.0:0.8167:0.1833:0.0	.	1575;1627;1593	Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;BCOR_HUMAN;.	Y	497;470;1575;1593;1627;1593;300	ENSP00000408006:D497Y;ENSP00000367724:D470Y;ENSP00000367716:D1575Y;ENSP00000380512:D1593Y;ENSP00000367705:D1627Y;ENSP00000345923:D1593Y;ENSP00000387552:D300Y	ENSP00000345923:D1593Y	D	-	1	0	BCOR	39798180	1.000000	0.71417	0.091000	0.20842	0.934000	0.57294	2.171000	0.42453	1.009000	0.39289	0.600000	0.82982	GAT		0.448	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		5	21	1	0	5.94e-07	7.17e-07	5	21				
BCOR	54880	broad.mit.edu	37	X	39913587	39913587	+	Splice_Site	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:39913587C>T	ENST00000378444.4	-	13	4970		c.e13-1		BCOR_ENST00000378463.1_Splice_Site|BCOR_ENST00000397354.3_Splice_Site|BCOR_ENST00000342274.4_Splice_Site|BCOR_ENST00000378455.4_Splice_Site	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor						heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TTTAAATAATCTGGAGGGAGA	0.423			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															uc004den.3		NA		Rec	yes		X	Xp11.4	54880		BCL6 corepressor	yes							0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.e13-1		BCL-6 interacting corepressor isoform c							39.0	35.0	37.0					X																	39913587		2202	4300	6502	SO:0001630	splice_region_variant	54880				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:39913587C>T	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4742-1G>A	X.37:g.39913587C>T			Somatic				BCOR_uc004dep.3_Splice_Site_p.D1547_splice|BCOR_uc004deo.3_Splice_Site_p.D1529_splice|BCOR_uc010nhb.2_Splice_Site_p.D289_splice|BCOR_uc004dem.3_Splice_Site_p.D1547_splice	p.D1581_splice	NM_001123385	NP_001116857	WXS	Illumina HiSeq	Unspecified	Q6W2J9	BCOR_HUMAN			13	5034	-								D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Splice_Site	SNP	ENST00000378444.4	37	c.4742_splice	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663512	0.67700	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4233	0.90598	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BCOR	39798531	1.000000	0.71417	0.998000	0.56505	0.635000	0.38103	7.433000	0.80362	2.290000	0.77057	0.600000	0.82982	.		0.423	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	Intron	5	15	0	0	0	0	5	15				
BCOR	54880	broad.mit.edu	37	X	39933796	39933796	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:39933796G>T	ENST00000378444.4	-	4	1031	c.803C>A	c.(802-804)tCg>tAg	p.S268*	BCOR_ENST00000397354.3_Nonsense_Mutation_p.S268*|BCOR_ENST00000342274.4_Nonsense_Mutation_p.S268*|BCOR_ENST00000378455.4_Nonsense_Mutation_p.S268*	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	268					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CGAAGGTGTCGAGAGCCTCAT	0.612			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															uc004den.3		NA		Rec	yes		X	Xp11.4	54880		BCL6 corepressor	yes							0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(802-804)TCG>TAG		BCL-6 interacting corepressor isoform c							39.0	26.0	31.0					X																	39933796		2201	4300	6501	SO:0001587	stop_gained	54880				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:39933796G>T	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.803C>A	X.37:g.39933796G>T	ENSP00000367705:p.Ser268*		Somatic				BCOR_uc004dep.3_Nonsense_Mutation_p.S268*|BCOR_uc004deo.3_Nonsense_Mutation_p.S268*|BCOR_uc004dem.3_Nonsense_Mutation_p.S268*|BCOR_uc004deq.3_Nonsense_Mutation_p.S268*	p.S268*	NM_001123385	NP_001116857	WXS	Illumina HiSeq	Unspecified	Q6W2J9	BCOR_HUMAN			4	1095	-			268					D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Nonsense_Mutation	SNP	ENST00000378444.4	37	c.803C>A	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	38	6.775761	0.97829	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.8026	18.5854	0.91187	0.0:0.0:1.0:0.0	.	.	.	.	X	268	.	ENSP00000345923:S268X	S	-	2	0	BCOR	39818740	1.000000	0.71417	0.911000	0.35937	0.835000	0.47333	9.476000	0.97823	2.331000	0.79229	0.600000	0.82982	TCG		0.612	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		5	16	1	0	0.000602214	0.000659927	5	16				
PORCN	64840	broad.mit.edu	37	X	48374170	48374170	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:48374170G>A	ENST00000326194.6	+	10	1055	c.1012G>A	c.(1012-1014)Gcc>Acc	p.A338T	PORCN_ENST00000361988.3_Missense_Mutation_p.A327T|PORCN_ENST00000359882.4_Missense_Mutation_p.A332T|PORCN_ENST00000355092.3_Missense_Mutation_p.A332T|PORCN_ENST00000537758.1_Missense_Mutation_p.A338T|PORCN_ENST00000355961.4_Missense_Mutation_p.A333T|PORCN_ENST00000367574.4_Missense_Mutation_p.A256T	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	338					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGCAGCCAGCGCCCTCCTACA	0.567																																						uc010nie.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1012-1014)GCC>ACC		porcupine isoform D							49.0	46.0	47.0					X																	48374170		2203	4300	6503	SO:0001583	missense	64840				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity	g.chrX:48374170G>A	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.1012G>A	X.37:g.48374170G>A	ENSP00000322304:p.Ala338Thr		Somatic				PORCN_uc004djr.1_Missense_Mutation_p.A333T|PORCN_uc004djs.1_Missense_Mutation_p.A327T|PORCN_uc004djt.1_Missense_Mutation_p.A256T|PORCN_uc011mlx.1_Missense_Mutation_p.A256T|PORCN_uc004dju.1_Missense_Mutation_p.A196T|PORCN_uc004djv.1_Missense_Mutation_p.A338T|PORCN_uc004djw.1_Missense_Mutation_p.A332T	p.A338T	NM_203475	NP_982301	WXS	Illumina HiSeq	Unspecified	Q9H237	PORCN_HUMAN			11	1170	+			338			Helical; (Potential).		B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	ENST00000326194.6	37	c.1012G>A	CCDS14299.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654539	0.88056	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	D;D;D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.89808	0.6822	M	0.76002	2.32	0.58432	D	0.999996	D;D;D;D;D	0.76494	0.998;0.995;0.999;0.998;0.998	P;D;D;P;P	0.65874	0.871;0.939;0.934;0.871;0.871	D	0.91207	0.4996	10	0.87932	D	0	-5.3567	14.6939	0.69107	0.0:0.0:1.0:0.0	.	332;338;256;327;333	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	T	332;338;256;333;327;338;332	ENSP00000352946:A332T;ENSP00000446401:A338T;ENSP00000356546:A256T;ENSP00000348233:A333T;ENSP00000354978:A327T;ENSP00000322304:A338T;ENSP00000347207:A332T	ENSP00000322304:A338T	A	+	1	0	PORCN	48259114	1.000000	0.71417	0.994000	0.49952	0.958000	0.62258	5.876000	0.69667	2.051000	0.60960	0.483000	0.47432	GCC		0.567	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825		11	40	0	0	0	0	11	40				
CLCN5	1184	broad.mit.edu	37	X	49853388	49853388	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:49853388G>A	ENST00000307367.2	+	9	1672	c.1381G>A	c.(1381-1383)Gtt>Att	p.V461I	CLCN5_ENST00000376091.3_Missense_Mutation_p.V531I|CLCN5_ENST00000376088.3_Missense_Mutation_p.V531I|CLCN5_ENST00000376108.3_Missense_Mutation_p.V461I			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	461					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TAGCATGGCTGTTGGTGCTAT	0.483																																						uc004dos.1		NA																	0				ovary(2)|lung(1)|central_nervous_system(1)	4						c.(1381-1383)GTT>ATT		chloride channel 5 isoform b							204.0	194.0	198.0					X																	49853388		2203	4300	6503	SO:0001583	missense	1184				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding	g.chrX:49853388G>A	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1381G>A	X.37:g.49853388G>A	ENSP00000304257:p.Val461Ile		Somatic				CLCN5_uc004dor.1_Missense_Mutation_p.V531I|CLCN5_uc004doq.1_Missense_Mutation_p.V531I|CLCN5_uc004dot.1_Missense_Mutation_p.V461I	p.V461I	NM_000084	NP_000075	WXS	Illumina HiSeq	Unspecified	P51795	CLCN5_HUMAN			9	1629	+	Ovarian(276;0.236)		461			Helical; (By similarity).		A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	c.1381G>A	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533730	0.27387	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18	5.54	5.54	0.83059	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.89608	0.6764	N	0.04787	-0.16	0.58432	D	0.999996	B;D	0.61697	0.04;0.99	B;D	0.73380	0.074;0.98	D	0.85336	0.1093	10	0.05620	T	0.96	-11.4058	11.0646	0.47968	0.0885:0.0:0.9115:0.0	.	461;531	P51795;P51795-2	CLCN5_HUMAN;.	I	531;363;531;461;461	ENSP00000365256:V531I;ENSP00000365259:V531I;ENSP00000365276:V461I;ENSP00000304257:V461I	ENSP00000304257:V461I	V	+	1	0	CLCN5	49740128	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.870000	0.56070	2.480000	0.83734	0.523000	0.50628	GTT		0.483	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1			39	121	0	0	0	0	39	121				
HUWE1	10075	broad.mit.edu	37	X	53619397	53619397	+	Silent	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:53619397G>A	ENST00000342160.3	-	32	4390	c.3933C>T	c.(3931-3933)tcC>tcT	p.S1311S	HUWE1_ENST00000218328.8_Silent_p.S1311S|HUWE1_ENST00000262854.6_Silent_p.S1311S			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1311					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GTTCCCGGCGGGAGCCACCTT	0.557																																						uc004dsp.2		NA																	0				ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						c.(3931-3933)TCC>TCT		HECT, UBA and WWE domain containing 1							238.0	191.0	207.0					X																	53619397		2203	4300	6503	SO:0001819	synonymous_variant	10075				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity	g.chrX:53619397G>A	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3933C>T	X.37:g.53619397G>A			Somatic				HUWE1_uc004dsn.2_Silent_p.S136S	p.S1311S	NM_031407	NP_113584	WXS	Illumina HiSeq	Unspecified	Q7Z6Z7	HUWE1_HUMAN			33	4335	-			1311					O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	c.3933C>T	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	7.295	0.611926	0.14066	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.88	-8.43	0.00953	.	.	.	.	.	T	0.46249	0.1383	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53265	-0.8463	4	.	.	.	.	7.4548	0.27258	0.5273:0.0:0.2207:0.252	.	.	.	.	S	345	.	.	P	-	1	0	HUWE1	53636122	0.855000	0.29742	0.021000	0.16686	0.859000	0.49053	-0.201000	0.09464	-2.540000	0.00486	-1.203000	0.01651	CCG		0.557	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		28	75	0	0	0	0	28	75				
FGD1	2245	broad.mit.edu	37	X	54472832	54472832	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:54472832G>C	ENST00000375135.3	-	18	3329	c.2596C>G	c.(2596-2598)Cgc>Ggc	p.R866G		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	866	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GGCAGGCTGCGCTGGGCTTTC	0.632																																						uc004dtg.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(2596-2598)CGC>GGC		faciogenital dysplasia protein							24.0	21.0	22.0					X																	54472832		2202	4300	6502	SO:0001583	missense	2245				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chrX:54472832G>C	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2596C>G	X.37:g.54472832G>C	ENSP00000364277:p.Arg866Gly		Somatic					p.R866G	NM_004463	NP_004454	WXS	Illumina HiSeq	Unspecified	P98174	FGD1_HUMAN			18	3330	-			866			PH 2.		Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	c.2596C>G	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722482	0.68959	.	.	ENSG00000102302	ENST00000375135	T	0.05649	3.41	5.79	5.79	0.91817	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.53938	D	0.000046	T	0.12135	0.0295	N	0.21324	0.655	0.47584	D	0.999463	P	0.44260	0.83	P	0.54965	0.765	T	0.18023	-1.0350	10	0.35671	T	0.21	-15.4332	17.6058	0.88037	0.0:0.0:1.0:0.0	.	866	P98174	FGD1_HUMAN	G	866	ENSP00000364277:R866G	ENSP00000364277:R866G	R	-	1	0	FGD1	54489557	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.561000	0.67339	2.429000	0.82318	0.513000	0.50165	CGC		0.632	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		10	24	0	0	0	0	10	24				
FGD1	2245	broad.mit.edu	37	X	54482960	54482960	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:54482960A>T	ENST00000375135.3	-	9	2410	c.1677T>A	c.(1675-1677)aaT>aaA	p.N559K		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	559	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GGATGGCAGCATTCGAGTGCT	0.607																																						uc004dtg.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1675-1677)AAT>AAA		faciogenital dysplasia protein							61.0	47.0	52.0					X																	54482960		2203	4300	6503	SO:0001583	missense	2245				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chrX:54482960A>T	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1677T>A	X.37:g.54482960A>T	ENSP00000364277:p.Asn559Lys		Somatic				FGD1_uc011moi.1_Missense_Mutation_p.N317K	p.N559K	NM_004463	NP_004454	WXS	Illumina HiSeq	Unspecified	P98174	FGD1_HUMAN			9	2411	-			559			DH.		Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	c.1677T>A	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.390999	0.62066	.	.	ENSG00000102302	ENST00000375135	T	0.75589	-0.95	4.51	0.723	0.18231	Dbl homology (DH) domain (5);	0.000000	0.52532	D	0.000070	D	0.87442	0.6178	H	0.95780	3.72	0.40733	D	0.982768	D;D	0.71674	0.998;0.996	D;D	0.75484	0.986;0.983	D	0.85480	0.1178	10	0.87932	D	0	-7.8149	7.641	0.28294	0.7246:0.0:0.2754:0.0	.	317;559	B4DS99;P98174	.;FGD1_HUMAN	K	559	ENSP00000364277:N559K	ENSP00000364277:N559K	N	-	3	2	FGD1	54499685	0.987000	0.35691	0.999000	0.59377	0.992000	0.81027	0.313000	0.19415	-0.056000	0.13221	0.417000	0.27973	AAT		0.607	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		3	28	0	0	0	0	3	28				
PFKFB1	5207	broad.mit.edu	37	X	54985328	54985328	+	Silent	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:54985328G>T	ENST00000375006.3	-	5	485	c.415C>A	c.(415-417)Cga>Aga	p.R139R	PFKFB1_ENST00000545676.1_Silent_p.R74R|PFKFB1_ENST00000374992.2_Silent_p.R117R	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	139	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						AGTGACCGTCGTTCTCTGGTA	0.453																																						uc004dty.1		NA																	0				ovary(1)	1						c.(415-417)CGA>AGA		6-phosphofructo-2-kinase/fructose-2,							251.0	207.0	222.0					X																	54985328		2203	4300	6503	SO:0001819	synonymous_variant	5207				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding	g.chrX:54985328G>T		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.415C>A	X.37:g.54985328G>T			Somatic				PFKFB1_uc010nkd.1_Silent_p.R125R|PFKFB1_uc011mol.1_Silent_p.R74R	p.R139R	NM_002625	NP_002616	WXS	Illumina HiSeq	Unspecified	P16118	F261_HUMAN			5	486	-			139			6-phosphofructo-2-kinase.		B2RA88|B4DUN5|Q5JXS5|Q99951	Silent	SNP	ENST00000375006.3	37	c.415C>A	CCDS14364.1																																																																																				0.453	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1			32	98	1	0	1.27e-14	1.73e-14	32	98				
KIAA2022	340533	broad.mit.edu	37	X	73962022	73962022	+	Silent	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:73962022C>A	ENST00000055682.6	-	3	2981	c.2370G>T	c.(2368-2370)acG>acT	p.T790T		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	790					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AAGAGCATGTCGTTGGTAGAA	0.403																																						uc004eby.2		NA																	0				ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(2368-2370)ACG>ACT		hypothetical protein LOC340533							106.0	98.0	101.0					X																	73962022		2203	4300	6503	SO:0001819	synonymous_variant	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73962022C>A		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2370G>T	X.37:g.73962022C>A			Somatic					p.T790T	NM_001008537	NP_001008537	WXS	Illumina HiSeq	Unspecified	Q5QGS0	K2022_HUMAN			3	2987	-			790					A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	c.2370G>T	CCDS35337.1																																																																																				0.403	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		4	67	1	0	1.24e-05	1.45e-05	4	67				
ATRX	546	broad.mit.edu	37	X	76938250	76938250	+	Missense_Mutation	SNP	G	G	T	rs182402019		TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:76938250G>T	ENST00000373344.5	-	9	2712	c.2498C>A	c.(2497-2499)gCt>gAt	p.A833D	ATRX_ENST00000395603.3_Missense_Mutation_p.A795D|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	833					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GGTTCTGGcagcaccaatttt	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(2497-2499)GCT>GAT		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						124.0	134.0	131.0					X																	76938250		2202	4291	6493	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76938250G>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2498C>A	X.37:g.76938250G>T	ENSP00000362441:p.Ala833Asp		Somatic				ATRX_uc004ecq.3_Missense_Mutation_p.A795D|ATRX_uc004eco.3_Missense_Mutation_p.A618D|ATRX_uc004ecr.2_Missense_Mutation_p.A765D|ATRX_uc010nlx.1_Missense_Mutation_p.A804D|ATRX_uc010nly.1_Missense_Mutation_p.A778D	p.A833D	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			9	2730	-			833					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.2498C>A	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	1.280	-0.610603	0.03690	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.92545	-3.03;-3.06	5.73	3.96	0.45880	.	0.382533	0.26563	N	0.023675	D	0.88032	0.6328	L	0.40543	1.245	0.29200	N	0.875255	B;B;B;B	0.31548	0.181;0.328;0.277;0.181	B;B;B;B	0.35470	0.102;0.203;0.146;0.102	T	0.79396	-0.1821	10	0.29301	T	0.29	-1.0784	11.6885	0.51501	0.1473:0.0:0.8527:0.0	.	833;765;795;833	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	D	833;795;760	ENSP00000362441:A833D;ENSP00000378967:A795D	ENSP00000362441:A833D	A	-	2	0	ATRX	76824906	0.997000	0.39634	0.745000	0.31077	0.580000	0.36256	2.629000	0.46485	0.574000	0.29417	0.466000	0.42574	GCT		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		22	154	1	0	2.38e-13	3.19e-13	22	154				
GLA	2717	broad.mit.edu	37	X	100656686	100656686	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:100656686C>T	ENST00000218516.3	-	3	502	c.481G>A	c.(481-483)Gac>Aac	p.D161N	RPL36A-HNRNPH2_ENST00000409170.3_Intron|GLA_ENST00000479445.1_5'UTR	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	161					glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						ACTCCCCAGTCAGCAAAGGTC	0.433																																					Colon(193;776 2816 31189 44474)	uc004ehl.1		NA																	0					0						c.(481-483)GAC>AAC		alpha-galactosidase A precursor	Agalsidase beta(DB00103)						152.0	135.0	140.0					X																	100656686		2203	4300	6503	SO:0001583	missense	2717				glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding	g.chrX:100656686C>T	X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.481G>A	X.37:g.100656686C>T	ENSP00000218516:p.Asp161Asn		Somatic				GLA_uc011mrj.1_Missense_Mutation_p.D161N	p.D161N	NM_000169	NP_000160	WXS	Illumina HiSeq	Unspecified	P06280	AGAL_HUMAN			3	591	-			161					Q6LER7	Missense_Mutation	SNP	ENST00000218516.3	37	c.481G>A	CCDS14484.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385205	0.61956	.	.	ENSG00000102393	ENST00000218516	D	0.99937	-8.33	6.06	5.2	0.72013	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.230456	0.50627	D	0.000117	D	0.99616	0.9860	.	.	.	0.47547	D	0.999454	B;B	0.13145	0.001;0.007	B;B	0.14578	0.006;0.011	D	0.99976	1.2182	9	0.45353	T	0.12	-9.8851	6.9966	0.24786	0.1507:0.6969:0.0:0.1524	.	161;161	B4DLT5;P06280	.;AGAL_HUMAN	N	161	ENSP00000218516:D161N	ENSP00000218516:D161N	D	-	1	0	GLA	100543342	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.329000	0.52060	1.310000	0.45006	0.600000	0.82982	GAC		0.433	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1			52	85	0	0	0	0	52	85				
NRK	203447	broad.mit.edu	37	X	105153085	105153085	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:105153085G>T	ENST00000243300.9	+	13	1755	c.1452G>T	c.(1450-1452)caG>caT	p.Q484H	NRK_ENST00000428173.2_Missense_Mutation_p.Q485H	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	484	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TACAGGCACAGGTTAGGGCAC	0.542										HNSCC(51;0.14)																												uc004emd.2		NA																	0				breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						c.(1450-1452)CAG>CAT		Nik related kinase							49.0	50.0	49.0					X																	105153085		2036	4179	6215	SO:0001583	missense	203447						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chrX:105153085G>T	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1452G>T	X.37:g.105153085G>T	ENSP00000434830:p.Gln484His	HNSCC(51;0.14)	Somatic				NRK_uc010npc.1_Missense_Mutation_p.Q152H	p.Q484H	NM_198465	NP_940867	WXS	Illumina HiSeq	Unspecified	Q7Z2Y5	NRK_HUMAN			13	1755	+			484			Gln-rich.		Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37	c.1452G>T		.	.	.	.	.	.	.	.	.	.	G	11.51	1.658851	0.29515	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.25085	1.82;1.82	4.49	3.6	0.41247	.	0.000000	0.47455	D	0.000225	T	0.22666	0.0547	L	0.61218	1.895	0.58432	D	0.999999	P;B	0.34639	0.461;0.115	B;B	0.34873	0.191;0.026	T	0.03818	-1.1001	10	0.31617	T	0.26	.	5.2866	0.15704	0.111:0.2054:0.6836:0.0	.	152;484	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	H	484;485	ENSP00000434830:Q484H;ENSP00000438378:Q485H	ENSP00000434830:Q484H	Q	+	3	2	NRK	105039741	1.000000	0.71417	0.508000	0.27688	0.241000	0.25554	2.359000	0.44142	1.210000	0.43336	0.600000	0.82982	CAG		0.542	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465		5	39	1	0	1.02e-07	1.26e-07	5	39				
PLS3	5358	broad.mit.edu	37	X	114869295	114869295	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:114869295G>A	ENST00000420625.2	+	7	819	c.685G>A	c.(685-687)Gga>Aga	p.G229R	PLS3_ENST00000355899.3_Missense_Mutation_p.G229R|PLS3_ENST00000537301.1_Missense_Mutation_p.G207R|PLS3_ENST00000289290.3_Missense_Mutation_p.G184R|PLS3_ENST00000539310.1_Missense_Mutation_p.G184R	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	229	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						TCTGGTTTTGGGACTGCTTTG	0.438																																					Colon(160;1047 1864 8490 12969 29601)	uc004eqd.2		NA																	0				lung(1)|breast(1)	2						c.(685-687)GGA>AGA		plastin 3							256.0	212.0	227.0					X																	114869295		2203	4300	6503	SO:0001583	missense	5358					cytoplasm	actin binding|calcium ion binding	g.chrX:114869295G>A	L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.685G>A	X.37:g.114869295G>A	ENSP00000398945:p.Gly229Arg		Somatic				PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Missense_Mutation_p.G207R|PLS3_uc004eqe.2_Missense_Mutation_p.G229R|PLS3_uc011mtg.1_Missense_Mutation_p.G202R|PLS3_uc011mth.1_Missense_Mutation_p.G184R	p.G229R	NM_005032	NP_005023	WXS	Illumina HiSeq	Unspecified	P13797	PLST_HUMAN			7	1075	+			229			Actin-binding 1.|CH 1.		A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	ENST00000420625.2	37	c.685G>A	CCDS14568.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238053	0.79800	.	.	ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310	D;D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61;-3.61	4.99	4.11	0.48088	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98086	0.9369	H	0.96604	3.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	D	0.98389	1.0562	10	0.87932	D	0	-13.6744	13.1097	0.59267	0.0:0.1584:0.8416:0.0	.	202;207;229	B4DPW9;B4DGB4;P13797	.;.;PLST_HUMAN	R	229;207;184;229;184	ENSP00000348163:G229R;ENSP00000445105:G207R;ENSP00000289290:G184R;ENSP00000398945:G229R;ENSP00000445339:G184R	ENSP00000289290:G184R	G	+	1	0	PLS3	114775551	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	0.858000	0.35431	0.506000	0.49869	GGA		0.438	PLS3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057976.2			11	112	0	0	0	0	11	112				
SLC25A14	9016	broad.mit.edu	37	X	129484680	129484680	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:129484680T>C	ENST00000218197.5	+	5	700	c.473T>C	c.(472-474)aTa>aCa	p.I158T	SLC25A14_ENST00000543953.1_Missense_Mutation_p.I123T|SLC25A14_ENST00000339231.3_Missense_Mutation_p.I155T|SLC25A14_ENST00000545805.1_Missense_Mutation_p.I158T|SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000361980.5_Missense_Mutation_p.I155T	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	158					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TCTTCCACTATAGCCAATCCC	0.383																																						uc004evn.1		NA																	0				ovary(1)	1						c.(472-474)ATA>ACA		solute carrier family 25, member 14 isoform							92.0	74.0	80.0					X																	129484680		2203	4300	6503	SO:0001583	missense	9016				aerobic respiration|mitochondrial transport	integral to plasma membrane|mitochondrial inner membrane	binding	g.chrX:129484680T>C	AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.473T>C	X.37:g.129484680T>C	ENSP00000218197:p.Ile158Thr		Somatic				SLC25A14_uc011mut.1_Intron|SLC25A14_uc011muu.1_Missense_Mutation_p.I158T|SLC25A14_uc010nrg.2_Missense_Mutation_p.I155T|SLC25A14_uc004evo.1_Intron|SLC25A14_uc004evp.1_Missense_Mutation_p.I158T|SLC25A14_uc004evq.1_Missense_Mutation_p.I155T|SLC25A14_uc004evr.1_Missense_Mutation_p.I155T	p.I158T	NM_003951	NP_003942	WXS	Illumina HiSeq	Unspecified	O95258	UCP5_HUMAN			6	686	+			158			Solcar 2.|Helical; Name=3; (Potential).		D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	ENST00000218197.5	37	c.473T>C	CCDS14623.1	.	.	.	.	.	.	.	.	.	.	T	18.73	3.686114	0.68157	.	.	ENSG00000102078	ENST00000424447;ENST00000545805;ENST00000543953;ENST00000218197;ENST00000361980;ENST00000339231	T;T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35;-1.35	5.08	3.9	0.45041	Mitochondrial carrier domain (2);	0.058691	0.64402	D	0.000002	D	0.88607	0.6482	M	0.88704	2.975	0.42943	D	0.994355	P;P;D	0.53885	0.913;0.954;0.963	P;P;P	0.60068	0.772;0.791;0.868	D	0.88787	0.3275	10	0.87932	D	0	-16.4352	9.5794	0.39479	0.1594:0.0:0.0:0.8406	.	155;155;158	O95258-3;O95258-2;O95258	.;.;UCP5_HUMAN	T	158;158;123;158;155;155	ENSP00000402578:I158T;ENSP00000444642:I158T;ENSP00000445225:I123T;ENSP00000218197:I158T;ENSP00000354455:I155T;ENSP00000342797:I155T	ENSP00000218197:I158T	I	+	2	0	SLC25A14	129312361	1.000000	0.71417	0.990000	0.47175	0.991000	0.79684	7.042000	0.76565	0.747000	0.32809	0.441000	0.28932	ATA		0.383	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951		6	58	0	0	0	0	6	58				
GPR101	83550	broad.mit.edu	37	X	136112567	136112567	+	Missense_Mutation	SNP	C	C	T	rs143030995	byFrequency	TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:136112567C>T	ENST00000298110.1	-	1	1266	c.1267G>A	c.(1267-1269)Gtg>Atg	p.V423M		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	423						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.V423M(2)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					TCCACCCACACGGCCAGGACT	0.517																																						uc011mwh.1		NA																	2	Substitution - Missense(2)		endometrium(2)	ovary(3)|lung(1)|skin(1)	5						c.(1267-1269)GTG>ATG		G protein-coupled receptor 101		C	MET/VAL	0,3835		0,0,0,1632,571	84.0	74.0	77.0		1267	-1.5	0.6	X	dbSNP_134	77	2,6726		0,0,2,2428,1870	no	missense	GPR101	NM_054021.1	21	0,0,2,4060,2441	TT,TC,T,CC,C		0.0297,0.0,0.0189	possibly-damaging	423/509	136112567	2,10561	2203	4300	6503	SO:0001583	missense	83550					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:136112567C>T	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1267G>A	X.37:g.136112567C>T	ENSP00000298110:p.Val423Met		Somatic					p.V423M	NM_054021	NP_473362	WXS	Illumina HiSeq	Unspecified	Q96P66	GP101_HUMAN			1	1267	-	Acute lymphoblastic leukemia(192;0.000127)		423			Extracellular (Potential).		Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	c.1267G>A	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	5.801	0.332028	0.10956	0.0	2.97E-4	ENSG00000165370	ENST00000298110	T	0.38401	1.14	5.46	-1.54	0.08584	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30920	N	0.008604	T	0.15739	0.0379	L	0.36672	1.1	0.09310	N	0.999996	P	0.37176	0.586	B	0.25140	0.058	T	0.13710	-1.0499	10	0.51188	T	0.08	-6.5238	0.2141	0.00160	0.248:0.2552:0.2412:0.2556	.	423	Q96P66	GP101_HUMAN	M	423	ENSP00000298110:V423M	ENSP00000298110:V423M	V	-	1	0	GPR101	135940233	0.394000	0.25246	0.639000	0.29394	0.028000	0.11728	-0.029000	0.12329	-0.121000	0.11787	-0.312000	0.09012	GTG		0.517	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			8	57	0	0	0	0	8	57				
SLC6A8	6535	broad.mit.edu	37	X	152960179	152960179	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:152960179C>G	ENST00000253122.5	+	12	2078	c.1602C>G	c.(1600-1602)atC>atG	p.I534M	SLC6A8_ENST00000485324.1_3'UTR|SLC6A8_ENST00000430077.2_Missense_Mutation_p.I419M	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	534					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CGTAGGGCATCTTCATCTTCA	0.642																																						uc004fib.3		NA																	0				pancreas(1)	1						c.(1600-1602)ATC>ATG		solute carrier family 6 member 8 isoform 1	Creatine(DB00148)						69.0	56.0	61.0					X																	152960179		2203	4300	6503	SO:0001583	missense	6535				creatine metabolic process|muscle contraction	integral to plasma membrane	creatine:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chrX:152960179C>G		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1602C>G	X.37:g.152960179C>G	ENSP00000253122:p.Ile534Met		Somatic				SLC6A8_uc004fic.3_Missense_Mutation_p.I524M|SLC6A8_uc011myx.1_Missense_Mutation_p.I419M|SLC6A8_uc010nuj.2_RNA	p.I534M	NM_005629	NP_005620	WXS	Illumina HiSeq	Unspecified	P48029	SC6A8_HUMAN			12	1880	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		534			Helical; (Potential).		B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	37	c.1602C>G	CCDS14726.1	.	.	.	.	.	.	.	.	.	.	c	9.145	1.014844	0.19355	.	.	ENSG00000130821	ENST00000253122;ENST00000430077;ENST00000328897	T;T	0.76186	-1.0;-1.0	4.8	3.94	0.45596	.	0.000000	0.64402	U	0.000001	T	0.73528	0.3598	M	0.72353	2.195	0.54753	D	0.999985	P;P	0.48998	0.918;0.763	B;P	0.46208	0.439;0.507	T	0.73603	-0.3930	10	0.72032	D	0.01	.	6.8009	0.23750	0.1731:0.7317:0.0:0.0953	.	543;534	Q59EV7;P48029	.;SC6A8_HUMAN	M	534;419;628	ENSP00000253122:I534M;ENSP00000403041:I419M	ENSP00000253122:I534M	I	+	3	3	SLC6A8	152613373	1.000000	0.71417	1.000000	0.80357	0.112000	0.19704	0.995000	0.29706	0.814000	0.34374	-0.344000	0.07964	ATC		0.642	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1			10	30	0	0	0	0	10	30				
NAA10	8260	broad.mit.edu	37	X	153195468	153195468	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chrX:153195468C>A	ENST00000464845.1	-	8	998	c.680G>T	c.(679-681)aGc>aTc	p.S227I	NAA10_ENST00000393712.3_3'UTR|NAA10_ENST00000393710.3_5'Flank|NAA10_ENST00000370009.1_Missense_Mutation_p.S212I|NAA10_ENST00000370015.4_3'UTR	NM_001256120.1|NM_003491.3	NP_001243049.1|NP_003482.1	P41227	NAA10_HUMAN	N(alpha)-acetyltransferase 10, NatA catalytic subunit	227					DNA packaging (GO:0006323)|internal protein amino acid acetylation (GO:0006475)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleolus (GO:0005730)|nucleus (GO:0005634)	N-acetyltransferase activity (GO:0008080)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(3)|kidney(1)|lung(3)|ovary(1)|prostate(1)	10						GGCCTCTGAGCTGTCCTTGAC	0.602																																					Ovarian(94;1099 1433 38814 45882 51063)	uc004fjm.1		NA																	0				ovary(1)	1						c.(679-681)AGC>ATC		alpha-N-acetyltransferase 1A							100.0	87.0	91.0					X																	153195468		2203	4300	6503	SO:0001583	missense	8260				DNA packaging|internal protein amino acid acetylation|N-terminal protein amino acid acetylation	cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding	g.chrX:153195468C>A	BC000308	CCDS14737.1, CCDS59179.1	Xq28	2010-05-07	2010-01-14	2010-01-14	ENSG00000102030	ENSG00000102030	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	18704	protein-coding gene	gene with protein product		300013	"""ARD1 homolog, N-acetyltransferase (S. cerevisiae)"", ""ARD1 homolog A, N-acetyltransferase (S. cerevisiae)"""	ARD1, ARD1A		7981673, 19660095	Standard	NM_003491		Approved	DXS707, TE2	uc004fjm.2	P41227	OTTHUMG00000024225	ENST00000464845.1:c.680G>T	X.37:g.153195468C>A	ENSP00000417763:p.Ser227Ile		Somatic				NAA10_uc004fjn.1_Missense_Mutation_p.S212I	p.S227I	NM_003491	NP_003482	WXS	Illumina HiSeq	Unspecified	P41227	NAA10_HUMAN			8	791	-			227					A6NM98	Missense_Mutation	SNP	ENST00000464845.1	37	c.680G>T	CCDS14737.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716461	0.68844	.	.	ENSG00000102030	ENST00000464845;ENST00000370009	T;T	0.63255	-0.03;0.05	5.29	5.29	0.74685	.	0.211332	0.48767	D	0.000162	T	0.72187	0.3429	L	0.48642	1.525	0.52501	D	0.999954	D;D	0.67145	0.988;0.996	P;P	0.61940	0.737;0.896	T	0.75502	-0.3295	10	0.87932	D	0	-9.2173	16.6995	0.85345	0.0:1.0:0.0:0.0	.	212;227	A6NM98;P41227	.;NAA10_HUMAN	I	227;212	ENSP00000417763:S227I;ENSP00000359026:S212I	ENSP00000359026:S212I	S	-	2	0	NAA10	152848662	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.580000	0.67464	2.202000	0.70862	0.594000	0.82650	AGC		0.602	NAA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061108.2	NM_003491		5	62	1	0	0.00116845	0.00125943	5	62				
BRINP3	339479	broad.mit.edu	37	1	190067913	190067913	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr1:190067913delG	ENST00000367462.3	-	8	1767	c.1536delC	c.(1534-1536)gccfs	p.A512fs	BRINP3_ENST00000534846.1_Frame_Shift_Del_p.A410fs	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	512					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.A512A(1)									TGATAAAAATGGCATGGACTT	0.463																																						uc001gse.1		NA																	1	Substitution - coding silent(1)		lung(1)	lung(2)|ovary(1)|kidney(1)|skin(1)	5						c.(1534-1536)GCCfs		family with sequence similarity 5, member C							153.0	146.0	148.0					1																	190067913		2203	4300	6503	SO:0001589	frameshift_variant	339479					extracellular region		g.chr1:190067913delG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1536delC	1.37:g.190067913delG	ENSP00000356432:p.Ala512fs		Somatic				FAM5C_uc010pot.1_Frame_Shift_Del_p.A410fs	p.A512fs	NM_199051	NP_950252	WXS	Illumina HiSeq	Unspecified	Q76B58	FAM5C_HUMAN			8	1768	-	Prostate(682;0.198)		512					B3KVP1|B7Z260|O95726|Q2M330	Frame_Shift_Del	DEL	ENST00000367462.3	37	c.1536delC	CCDS1373.1																																																																																				0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051		18	100	NA	NA	NA	NA	18	100	---	---	---	---
CLDND2	125875	broad.mit.edu	37	19	51871727	51871729	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr19:51871727_51871729delTTG	ENST00000291715.1	-	1	528_530	c.103_105delCAA	c.(103-105)caadel	p.Q35del	ETFB_ENST00000309244.4_5'Flank|CLDND2_ENST00000601435.1_In_Frame_Del_p.Q35del|CTD-2616J11.11_ENST00000600067.1_5'Flank|CTD-2616J11.10_ENST00000595500.1_RNA	NM_152353.2	NP_689566.1	Q8NHS1	CLDN2_HUMAN	claudin domain containing 2	35						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)	4		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TGTGGCCCTCTTGTTGGCGGGTC	0.64																																						uc002pwi.1		NA																	0					0						c.(103-105)CAAdel		claudin domain containing 2																																				SO:0001651	inframe_deletion	125875					integral to membrane		g.chr19:51871727_51871729delTTG	BC029518	CCDS12829.1	19q13.41	2008-02-05				ENSG00000160318			28511	protein-coding gene	gene with protein product						12477932	Standard	NM_152353		Approved	MGC33839	uc002pwi.1	Q8NHS1		ENST00000291715.1:c.103_105delCAA	19.37:g.51871730_51871732delTTG	ENSP00000291715:p.Gln35del		Somatic				ETFB_uc002pwh.2_5'Flank	p.Q35del	NM_152353	NP_689566	WXS	Illumina HiSeq	Unspecified	Q8NHS1	CLDN2_HUMAN		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	1	529_531	-		all_neural(266;0.0199)	35						In_Frame_Del	DEL	ENST00000291715.1	37	c.103_105delCAA	CCDS12829.1																																																																																				0.640	CLDND2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464268.1	NM_152353		23	66	NA	NA	NA	NA	23	66	---	---	---	---
IP6K2	51447	broad.mit.edu	37	3	48725981	48725982	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr3:48725981_48725982insA	ENST00000328631.5	-	6	1228_1229	c.1005_1006insT	c.(1003-1008)tatgatfs	p.D336fs	NCKIPSD_ENST00000416649.2_5'Flank|NCKIPSD_ENST00000294129.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	336					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						TCCTTGCCATCATAAATGACCA	0.554																																						uc003cup.2		NA																	0					0						c.(1003-1008)TATGATfs		inositol hexaphosphate kinase 2 isoform a																																				SO:0001589	frameshift_variant	51447				negative regulation of cell growth|phosphatidylinositol phosphorylation|positive regulation of apoptosis|type I interferon-mediated signaling pathway	intermediate filament cytoskeleton|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity	g.chr3:48725981_48725982insA	AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.1006dupT	3.37:g.48725982_48725982dupA	ENSP00000331103:p.Asp336fs		Somatic				NCKIPSD_uc003cum.2_5'Flank|NCKIPSD_uc003cun.2_5'Flank|NCKIPSD_uc010hkh.1_5'Flank|IP6K2_uc003cuq.2_Frame_Shift_Ins_p.Y335fs	p.Y335fs	NM_001005909	NP_001005909	WXS	Illumina HiSeq	Unspecified	Q9UHH9	IP6K2_HUMAN			6	1249_1250	-			335_336					A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Frame_Shift_Ins	INS	ENST00000328631.5	37	c.1005_1006insT	CCDS2777.1																																																																																				0.554	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291		30	49	NA	NA	NA	NA	30	49	---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101747722	101747723	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr7:101747722_101747723insT	ENST00000292535.7	+	6	551_552	c.513_514insT	c.(514-516)tttfs	p.F172fs	CUX1_ENST00000393824.3_Frame_Shift_Ins_p.F146fs|CUX1_ENST00000360264.3_Frame_Shift_Ins_p.F183fs|CUX1_ENST00000292538.4_Frame_Shift_Ins_p.F183fs|CUX1_ENST00000549414.2_Frame_Shift_Ins_p.F172fs|CUX1_ENST00000437600.4_Frame_Shift_Ins_p.F183fs|CUX1_ENST00000547394.2_Frame_Shift_Ins_p.F167fs|CUX1_ENST00000425244.2_Frame_Shift_Ins_p.F137fs|CUX1_ENST00000546411.2_Frame_Shift_Ins_p.F172fs|CUX1_ENST00000550008.2_Frame_Shift_Ins_p.F172fs|CUX1_ENST00000556210.1_Frame_Shift_Ins_p.F172fs|CUX1_ENST00000560541.1_3'UTR	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	172					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TACAGAATGACTTTGCAGAAAA	0.421																																						uc003uyx.3		NA																	0				ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(511-516)GACTTTfs		cut-like homeobox 1 isoform a																																				SO:0001589	frameshift_variant	1523				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:101747722_101747723insT	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.516dupT	7.37:g.101747725_101747725dupT	ENSP00000292535:p.Phe172fs		Somatic				CUX1_uc003uys.3_Frame_Shift_Ins_p.D182fs|CUX1_uc003uyt.2_Frame_Shift_Ins_p.D182fs|CUX1_uc011kkn.1_Frame_Shift_Ins_p.D145fs|CUX1_uc003uyw.2_Frame_Shift_Ins_p.D136fs|CUX1_uc003uyv.2_Frame_Shift_Ins_p.D166fs|CUX1_uc003uyu.2_Frame_Shift_Ins_p.D182fs	p.D171fs	NM_181552	NP_853530	WXS	Illumina HiSeq	Unspecified	P39880	CUX1_HUMAN			6	551_552	+			171_172			Potential.		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Frame_Shift_Ins	INS	ENST00000292535.7	37	c.513_514insT	CCDS5721.1																																																																																				0.421	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		22	131	NA	NA	NA	NA	22	131	---	---	---	---
KIF27	55582	broad.mit.edu	37	9	86506407	86506407	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CV-5978-01A-11D-1683-08	TCGA-CV-5978-11A-01D-1683-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	791d4f3f-90e0-4fa5-9671-9b5f04ed3eca	341f596e-2ef6-46bb-a500-80ce88e51f36	g.chr9:86506407delT	ENST00000297814.2	-	6	1755	c.1612delA	c.(1612-1614)atafs	p.I539fs	KIF27_ENST00000376347.1_5'Flank|KIF27_ENST00000413982.1_Frame_Shift_Del_p.I539fs|KIF27_ENST00000334204.2_Frame_Shift_Del_p.I539fs	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	539					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TGTTCTATTATTTTTTCATTC	0.303																																						uc004ana.2		NA																	0				lung(4)|skin(1)	5						c.(1612-1614)ATAfs		kinesin family member 27							43.0	39.0	41.0					9																	86506407		2203	4296	6499	SO:0001589	frameshift_variant	55582				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:86506407delT	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1612delA	9.37:g.86506407delT	ENSP00000297814:p.Ile539fs		Somatic				KIF27_uc010mpw.2_Frame_Shift_Del_p.I538fs|KIF27_uc010mpx.2_Frame_Shift_Del_p.I538fs	p.I538fs	NM_017576	NP_060046	WXS	Illumina HiSeq	Unspecified	Q86VH2	KIF27_HUMAN			6	1756	-			538			Potential.		B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Frame_Shift_Del	DEL	ENST00000297814.2	37	c.1612delA	CCDS6665.1																																																																																				0.303	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576		7	30	NA	NA	NA	NA	7	30	---	---	---	---
