#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
SKI	6497	broad.mit.edu	37	1	2160913	2160913	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:2160913C>T	ENST00000378536.4	+	1	780	c.708C>T	c.(706-708)ctC>ctT	p.L236L		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	236					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		TGCCCGAGCTCTACAGCAGCC	0.682																																					Ovarian(177;144 1678 13697 20086 27838 40755)	uc001aja.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(706-708)CTC>CTT		v-ski sarcoma viral oncogene homolog							16.0	20.0	18.0					1																	2160913		2185	4280	6465	SO:0001819	synonymous_variant	6497				anterior/posterior axis specification|BMP signaling pathway|bone morphogenesis|cell motility|cell proliferation|embryonic limb morphogenesis|face morphogenesis|lens morphogenesis in camera-type eye|myelination in peripheral nervous system|myotube differentiation|negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of fibroblast proliferation|negative regulation of osteoblast differentiation|negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|neural tube closure|nose morphogenesis|olfactory bulb development|palate development|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein homotrimerization|regulation of apoptosis|retina development in camera-type eye|skeletal muscle fiber development|SMAD protein signal transduction|somatic stem cell maintenance|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|PML body|transcription factor complex|transcriptional repressor complex	histone deacetylase inhibitor activity|nucleotide binding|protein domain specific binding|protein kinase binding|repressing transcription factor binding|SMAD binding|transcription corepressor activity|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr1:2160913C>T	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.708C>T	1.37:g.2160913C>T			Somatic					p.L236L	NM_003036	NP_003027	WXS	Illumina HiSeq	Unspecified	P12755	SKI_HUMAN		Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)	1	780	+	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)		236					Q5SYT7	Silent	SNP	ENST00000378536.4	37	c.708C>T	CCDS39.1																																																																																				0.682	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036		10	17	0	0	0	0	10	17				
KIF1B	23095	broad.mit.edu	37	1	10384836	10384836	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:10384836G>A	ENST00000377086.1	+	26	2760	c.2558G>A	c.(2557-2559)cGa>cAa	p.R853Q	KIF1B_ENST00000263934.6_Missense_Mutation_p.R807Q|KIF1B_ENST00000377081.1_Missense_Mutation_p.R853Q			O60333	KIF1B_HUMAN	kinesin family member 1B	853					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GATTTGATGCGAGAGATGTAT	0.463																																						uc001aqx.3		NA																	0		p.C853F(1)		ovary(2)|upper_aerodigestive_tract(1)	3						c.(2557-2559)CGA>CAA		kinesin family member 1B isoform b							157.0	152.0	154.0					1																	10384836		2203	4300	6503	SO:0001583	missense	23095				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding	g.chr1:10384836G>A	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2558G>A	1.37:g.10384836G>A	ENSP00000366290:p.Arg853Gln		Somatic				KIF1B_uc001aqw.3_Missense_Mutation_p.R807Q|KIF1B_uc001aqy.2_Missense_Mutation_p.R827Q|KIF1B_uc001aqz.2_Missense_Mutation_p.R853Q|KIF1B_uc001ara.2_Missense_Mutation_p.R813Q|KIF1B_uc001arb.2_Missense_Mutation_p.R839Q	p.R853Q	NM_015074	NP_055889	WXS	Illumina HiSeq	Unspecified	O60333	KIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	26	2760	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	853			Potential.		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37	c.2558G>A		.	.	.	.	.	.	.	.	.	.	G	36	5.936636	0.97122	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	D;D;D	0.85339	-1.97;-1.97;-1.97	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.91998	0.7465	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.996	D;D;D;D;D;P	0.91635	0.999;0.992;0.99;0.997;0.99;0.748	D	0.92143	0.5722	10	0.72032	D	0.01	.	19.4313	0.94768	0.0:0.0:1.0:0.0	.	839;813;853;827;853;807	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	Q	853;807;853;853	ENSP00000263934:R807Q;ENSP00000366290:R853Q;ENSP00000366284:R853Q	ENSP00000263934:R807Q	R	+	2	0	KIF1B	10307423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.012000	0.88631	2.688000	0.91661	0.650000	0.86243	CGA		0.463	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			20	53	0	0	0	0	20	53				
FAM46B	115572	broad.mit.edu	37	1	27332876	27332876	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:27332876G>A	ENST00000289166.5	-	2	1002	c.837C>T	c.(835-837)ctC>ctT	p.L279L		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	279										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		AGTACTTGAGGAGGCCACCAC	0.677																																						uc010ofj.1		NA																	0				central_nervous_system(1)	1						c.(835-837)CTC>CTT		hypothetical protein LOC115572							21.0	23.0	22.0					1																	27332876		2202	4296	6498	SO:0001819	synonymous_variant	115572							g.chr1:27332876G>A	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.837C>T	1.37:g.27332876G>A			Somatic					p.L279L	NM_052943	NP_443175	WXS	Illumina HiSeq	Unspecified	Q96A09	FA46B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)	2	1009	-		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)	279						Silent	SNP	ENST00000289166.5	37	c.837C>T	CCDS294.2																																																																																				0.677	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943		9	18	0	0	0	0	9	18				
NCDN	23154	broad.mit.edu	37	1	36031042	36031042	+	Silent	SNP	C	C	T	rs543753358		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:36031042C>T	ENST00000373243.2	+	7	2351	c.1968C>T	c.(1966-1968)ccC>ccT	p.P656P	NCDN_ENST00000373253.3_Silent_p.P639P|NCDN_ENST00000356090.4_Silent_p.P656P	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	656					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGCTGGCCCCCGCTGCCCTGC	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		14100	0.001		0.0	False		,,,				2504	0.0					uc001bza.2		NA																	0				large_intestine(2)|pancreas(1)	3						c.(1966-1968)CCC>CCT		neurochondrin isoform 1																																				SO:0001819	synonymous_variant	23154				neuron projection development	cytosol|dendrite|neuronal cell body		g.chr1:36031042C>T	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.1968C>T	1.37:g.36031042C>T			Somatic				NCDN_uc001bzb.2_Silent_p.P656P|NCDN_uc001bzc.2_Silent_p.P639P	p.P656P	NM_001014839	NP_001014839	WXS	Illumina HiSeq	Unspecified	Q9UBB6	NCDN_HUMAN			8	2095	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	656					D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Silent	SNP	ENST00000373243.2	37	c.1968C>T	CCDS392.1																																																																																				0.682	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284		11	20	0	0	0	0	11	20				
ELAVL4	1996	broad.mit.edu	37	1	50610702	50610702	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:50610702A>G	ENST00000371823.4	+	2	307	c.83A>G	c.(82-84)aAc>aGc	p.N28S	ELAVL4_ENST00000357083.4_Missense_Mutation_p.N45S|ELAVL4_ENST00000371819.1_Missense_Mutation_p.N33S|ELAVL4_ENST00000371824.1_Missense_Mutation_p.N28S|ELAVL4_ENST00000448907.2_Missense_Mutation_p.N31S|ELAVL4_ENST00000371827.1_Missense_Mutation_p.N28S|ELAVL4_ENST00000492299.1_3'UTR|ELAVL4_ENST00000371821.1_Missense_Mutation_p.N33S	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	28					mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						TCCAGCAACAACAGAAACTGT	0.418																																						uc001csb.2		NA																	0				ovary(1)|pancreas(1)	2						c.(82-84)AAC>AGC		ELAV-like 4 isoform 1							97.0	85.0	89.0					1																	50610702		2203	4300	6503	SO:0001583	missense	1996				mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding	g.chr1:50610702A>G	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.83A>G	1.37:g.50610702A>G	ENSP00000360888:p.Asn28Ser		Somatic				ELAVL4_uc001cry.3_Missense_Mutation_p.N31S|ELAVL4_uc001crz.3_Missense_Mutation_p.N28S|ELAVL4_uc001csa.3_Missense_Mutation_p.N45S|ELAVL4_uc001csc.3_Missense_Mutation_p.N28S|ELAVL4_uc009vyu.2_Missense_Mutation_p.N33S|ELAVL4_uc010omz.1_Missense_Mutation_p.N33S	p.N28S	NM_021952	NP_068771	WXS	Illumina HiSeq	Unspecified	P26378	ELAV4_HUMAN			2	351	+			28					B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Missense_Mutation	SNP	ENST00000371823.4	37	c.83A>G	CCDS553.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.621687	0.28889	.	.	ENSG00000162374	ENST00000448907;ENST00000371827;ENST00000357083;ENST00000371824;ENST00000371823;ENST00000371821;ENST00000371819	T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31	6.16	3.83	0.44106	Nucleotide-binding, alpha-beta plait (1);	0.117133	0.85682	D	0.000000	T	0.16854	0.0405	N	0.12182	0.205	0.41997	D	0.990879	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0;0.001;0.0	B;B;B;B;B;B;B	0.08055	0.001;0.001;0.002;0.0;0.001;0.003;0.001	T	0.07712	-1.0758	10	0.22706	T	0.39	.	4.6399	0.12543	0.593:0.0:0.407:0.0	.	33;33;28;28;45;28;31	B1APY9;B1APY8;P26378-2;P26378;P26378-3;P26378-4;B7Z4G7	.;.;.;ELAV4_HUMAN;.;.;.	S	31;28;45;28;28;33;33	ENSP00000399939:N31S;ENSP00000360892:N28S;ENSP00000349594:N45S;ENSP00000360889:N28S;ENSP00000360888:N28S;ENSP00000360886:N33S;ENSP00000360884:N33S	ENSP00000349594:N45S	N	+	2	0	ELAVL4	50383289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.843000	0.48238	1.141000	0.42275	0.528000	0.53228	AAC		0.418	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952		12	25	0	0	0	0	12	25				
FGGY	55277	broad.mit.edu	37	1	59812064	59812064	+	Silent	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:59812064G>C	ENST00000303721.7	+	4	633	c.459G>C	c.(457-459)ctG>ctC	p.L153L	FGGY_ENST00000371212.1_Intron|FGGY_ENST00000371218.4_Silent_p.L153L|FGGY_ENST00000474476.1_3'UTR	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	153					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					TTCTGTGGCTGAAAGAGGTGA	0.498																																						uc001czi.3		NA																	0				ovary(1)	1						c.(457-459)CTG>CTC		FGGY carbohydrate kinase domain containing							106.0	82.0	90.0					1																	59812064		2203	4300	6503	SO:0001819	synonymous_variant	55277				carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor	g.chr1:59812064G>C		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.459G>C	1.37:g.59812064G>C			Somatic				FGGY_uc001czg.2_Silent_p.L41L|FGGY_uc001czh.2_RNA|FGGY_uc009wac.2_Silent_p.L153L|FGGY_uc001czj.3_Silent_p.L153L|FGGY_uc001czk.3_Silent_p.L41L|FGGY_uc001czl.3_Intron	p.L153L	NM_018291	NP_060761	WXS	Illumina HiSeq	Unspecified	Q96C11	FGGY_HUMAN			4	671	+	all_cancers(7;7.36e-05)		153					B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Silent	SNP	ENST00000303721.7	37	c.459G>C	CCDS611.2																																																																																				0.498	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411		9	19	0	0	0	0	9	19				
LEPR	3953	broad.mit.edu	37	1	66101886	66101886	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:66101886G>C	ENST00000349533.6	+	20	2871	c.2686G>C	c.(2686-2688)Gag>Cag	p.E896Q	LEPR_ENST00000406510.3_5'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGAAACGTTTGAGCATCTTTT	0.348																																						uc001dci.2		NA																	0				skin(1)	1						c.(2686-2688)GAG>CAG		leptin receptor isoform 1							128.0	132.0	131.0					1																	66101886		2203	4299	6502	SO:0001583	missense	3953				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity	g.chr1:66101886G>C	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2686G>C	1.37:g.66101886G>C	ENSP00000330393:p.Glu896Gln		Somatic				LEPR_uc009waq.2_Missense_Mutation_p.L169F	p.E896Q	NM_002303	NP_002294	WXS	Illumina HiSeq	Unspecified	P48357	LEPR_HUMAN		OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)	20	2888	+			896			Cytoplasmic (Potential).|Required for JAK2 activation (By similarity).		Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	c.2686G>C	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500788	0.85176	.	.	ENSG00000116678	ENST00000349533	T	0.62498	0.02	5.79	5.79	0.91817	.	0.045699	0.85682	D	0.000000	T	0.64034	0.2562	L	0.57536	1.79	0.80722	D	1	D	0.54601	0.967	P	0.50537	0.643	T	0.67573	-0.5636	10	0.72032	D	0.01	-18.647	20.0281	0.97530	0.0:0.0:1.0:0.0	.	896	P48357	LEPR_HUMAN	Q	896	ENSP00000330393:E896Q	ENSP00000330393:E896Q	E	+	1	0	LEPR	65874474	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.681000	0.74523	2.727000	0.93392	0.655000	0.94253	GAG		0.348	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303		29	95	0	0	0	0	29	95				
HSD3B1	3283	broad.mit.edu	37	1	120057080	120057080	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:120057080C>T	ENST00000369413.3	+	4	1079	c.934C>T	c.(934-936)Cga>Tga	p.R312*	HSD3B1_ENST00000235547.6_Nonsense_Mutation_p.R314*|HSD3B1_ENST00000528909.1_Nonsense_Mutation_p.R312*			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	312					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	TTACACCTATCGACCGCCCTT	0.473																																						uc001ehv.1		NA																	0				ovary(2)	2						c.(934-936)CGA>TGA		3 beta-hydroxysteroid dehydrogenase 1	NADH(DB00157)|Trilostane(DB01108)						109.0	108.0	108.0					1																	120057080		2203	4300	6503	SO:0001587	stop_gained	3283				androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity	g.chr1:120057080C>T	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.934C>T	1.37:g.120057080C>T	ENSP00000358421:p.Arg312*		Somatic				HSD3B1_uc001ehw.2_Nonsense_Mutation_p.R314*	p.R312*	NM_000862	NP_000853	WXS	Illumina HiSeq	Unspecified	P14060	3BHS1_HUMAN		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	4	1079	+	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)	312					A8K691|Q14545|Q8IV65	Nonsense_Mutation	SNP	ENST00000369413.3	37	c.934C>T	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900367	0.33535	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	.	.	.	3.26	-0.455	0.12193	.	1.460970	0.04411	N	0.366031	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-16.5012	5.1421	0.14965	0.3712:0.3138:0.315:0.0	.	.	.	.	X	312;314;312	.	ENSP00000235547:R314X	R	+	1	2	HSD3B1	119858603	0.000000	0.05858	0.002000	0.10522	0.065000	0.16274	-0.605000	0.05661	0.133000	0.18654	0.313000	0.20887	CGA		0.473	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862		40	118	0	0	0	0	40	118				
ZNF697	90874	broad.mit.edu	37	1	120165638	120165638	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:120165638C>T	ENST00000421812.2	-	3	1447	c.1328G>A	c.(1327-1329)gGg>gAg	p.G443E		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	443					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GAAGCCCTTCCCGCACTCGCG	0.667																																						uc001ehy.1		NA																	0				ovary(1)	1						c.(1327-1329)GGG>GAG		zinc finger protein 697							17.0	19.0	18.0					1																	120165638		2186	4291	6477	SO:0001583	missense	90874				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:120165638C>T	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1328G>A	1.37:g.120165638C>T	ENSP00000396857:p.Gly443Glu		Somatic					p.G443E	NM_001080470	NP_001073939	WXS	Illumina HiSeq	Unspecified	Q5TEC3	ZN697_HUMAN		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)	3	1442	-	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)	443			C2H2-type 8.		Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	c.1328G>A	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371816	0.42003	.	.	ENSG00000143067	ENST00000421812	T	0.07114	3.22	4.98	4.07	0.47477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.215010	0.23710	N	0.045327	T	0.17066	0.0410	M	0.76328	2.33	0.35991	D	0.83668	D	0.89917	1.0	D	0.97110	1.0	T	0.01688	-1.1295	10	0.62326	D	0.03	-23.7528	11.4513	0.50154	0.0:0.911:0.0:0.089	.	443	Q5TEC3	ZN697_HUMAN	E	443	ENSP00000396857:G443E	ENSP00000396857:G443E	G	-	2	0	ZNF697	119967161	1.000000	0.71417	0.998000	0.56505	0.015000	0.08874	4.784000	0.62411	1.256000	0.44068	-0.251000	0.11542	GGG		0.667	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286		3	6	0	0	0	0	3	6				
SETDB1	9869	broad.mit.edu	37	1	150900253	150900253	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:150900253G>A	ENST00000271640.5	+	2	253	c.63G>A	c.(61-63)gaG>gaA	p.E21E	SETDB1_ENST00000459773.1_3'UTR|SETDB1_ENST00000368969.4_Silent_p.E21E|SETDB1_ENST00000368963.1_Silent_p.E21E|SETDB1_ENST00000368962.2_Silent_p.E21E	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	21					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGTCTGAAGAGATTGCAGAGC	0.463																																						uc001evu.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(61-63)GAG>GAA		SET domain, bifurcated 1 isoform 1							141.0	135.0	137.0					1																	150900253		2203	4300	6503	SO:0001819	synonymous_variant	9869				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding	g.chr1:150900253G>A	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.63G>A	1.37:g.150900253G>A			Somatic				SETDB1_uc009wmf.2_Silent_p.E21E|SETDB1_uc001evv.2_Silent_p.E21E|SETDB1_uc001evw.3_Silent_p.E21E|SETDB1_uc009wmg.1_Silent_p.E21E	p.E21E	NM_001145415	NP_001138887	WXS	Illumina HiSeq	Unspecified	Q15047	SETB1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)		2	253	+	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		21			Potential.		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Silent	SNP	ENST00000271640.5	37	c.63G>A	CCDS44217.1																																																																																				0.463	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2			17	92	0	0	0	0	17	92				
FLG	2312	broad.mit.edu	37	1	152279854	152279854	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:152279854G>A	ENST00000368799.1	-	3	7543	c.7508C>T	c.(7507-7509)gCc>gTc	p.A2503V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2503	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCATGGGAGGCATCAGACCT	0.547									Ichthyosis																													uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(7507-7509)GCC>GTC		filaggrin							340.0	326.0	331.0					1																	152279854		2203	4299	6502	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152279854G>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7508C>T	1.37:g.152279854G>A	ENSP00000357789:p.Ala2503Val		Somatic					p.A2503V	NM_002016	NP_002007	WXS	Illumina HiSeq	Unspecified	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	7544	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2503			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.7508C>T	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.332	1.060894	0.19987	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	2.34	1.39	0.22231	.	.	.	.	.	T	0.00784	0.0026	M	0.81802	2.56	0.09310	N	1	P	0.41232	0.743	B	0.31390	0.129	T	0.47674	-0.9099	9	0.27082	T	0.32	.	4.7738	0.13169	0.1941:0.0:0.8059:0.0	.	2503	P20930	FILA_HUMAN	V	2503	ENSP00000357789:A2503V	ENSP00000357789:A2503V	A	-	2	0	FLG	150546478	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.116000	0.15561	0.310000	0.22990	0.306000	0.20318	GCC		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		183	353	0	0	0	0	183	353				
OR10R2	343406	broad.mit.edu	37	1	158450344	158450344	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:158450344T>C	ENST00000368152.1	+	1	677	c.677T>C	c.(676-678)gTa>gCa	p.V226A	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					GGAGTTCTTGTACTTGTGGTT	0.413																																						uc010pik.1		NA																	0				pancreas(2)|skin(1)	3						c.(676-678)GTA>GCA		olfactory receptor, family 10, subfamily R,							150.0	136.0	140.0					1																	158450344		2203	4300	6503	SO:0001583	missense	343406				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158450344T>C	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.677T>C	1.37:g.158450344T>C	ENSP00000357134:p.Val226Ala		Somatic				uc001fso.1_RNA	p.V226A	NM_001004472	NP_001004472	WXS	Illumina HiSeq	Unspecified	Q8NGX6	O10R2_HUMAN			1	677	+	all_hematologic(112;0.0378)		226			Helical; Name=5; (Potential).		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	37	c.677T>C	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	t	11.01	1.513163	0.27123	.	.	ENSG00000198965	ENST00000368152	T	0.00152	8.66	4.48	2.06	0.26882	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	L	0.35414	1.06	0.09310	N	1	B	0.31581	0.329	B	0.36766	0.232	T	0.00783	-1.1568	9	0.45353	T	0.12	.	6.2663	0.20928	0.0:0.0872:0.1606:0.7522	.	226	Q8NGX6	O10R2_HUMAN	A	226	ENSP00000357134:V226A	ENSP00000357134:V226A	V	+	2	0	OR10R2	156716968	0.000000	0.05858	0.113000	0.21522	0.997000	0.91878	0.139000	0.16036	0.214000	0.20742	0.533000	0.62120	GTA		0.413	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472		26	87	0	0	0	0	26	87				
PAPPA2	60676	broad.mit.edu	37	1	176564443	176564443	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:176564443G>A	ENST00000367662.3	+	3	2867	c.1703G>A	c.(1702-1704)aGc>aAc	p.S568N	PAPPA2_ENST00000367661.3_Missense_Mutation_p.S568N	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	568	Metalloprotease.			S -> N (in Ref. 2; AAL17780). {ECO:0000305}.	bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGGCAGCTGAGCGTCCACCAG	0.567																																						uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(1702-1704)AGC>AAC		pappalysin 2 isoform 1							83.0	86.0	85.0					1																	176564443		2139	4238	6377	SO:0001583	missense	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176564443G>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1703G>A	1.37:g.176564443G>A	ENSP00000356634:p.Ser568Asn		Somatic				PAPPA2_uc001gky.1_Missense_Mutation_p.S568N|PAPPA2_uc009www.2_RNA	p.S568N	NM_020318	NP_064714	WXS	Illumina HiSeq	Unspecified	Q9BXP8	PAPP2_HUMAN			3	2867	+			568	S -> N (in Ref. 2; AAL17780).		Metalloprotease.		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	c.1703G>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722369	0.30503	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.47177	0.85;0.85	5.11	4.2	0.49525	.	0.247626	0.45606	D	0.000349	T	0.35278	0.0926	L	0.38175	1.15	0.31076	N	0.712453	B;B	0.16166	0.002;0.016	B;B	0.16722	0.009;0.016	T	0.33137	-0.9880	10	0.36615	T	0.2	-6.2429	8.3345	0.32206	0.2408:0.0:0.7592:0.0	.	568;568	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	N	568	ENSP00000356634:S568N;ENSP00000356633:S568N	ENSP00000356633:S568N	S	+	2	0	PAPPA2	174831066	0.006000	0.16342	0.783000	0.31826	0.865000	0.49528	0.365000	0.20348	1.148000	0.42385	0.557000	0.71058	AGC		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			21	81	0	0	0	0	21	81				
CEP350	9857	broad.mit.edu	37	1	179989427	179989427	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:179989427G>C	ENST00000367607.3	+	12	2936	c.2518G>C	c.(2518-2520)Gaa>Caa	p.E840Q		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	840					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CAGCAGAATTGAAAGTGAAGC	0.448																																						uc001gnt.2		NA																	0				ovary(4)	4						c.(2518-2520)GAA>CAA		centrosome-associated protein 350							135.0	140.0	139.0					1																	179989427		2203	4300	6503	SO:0001583	missense	9857					centrosome|nucleus|spindle		g.chr1:179989427G>C	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2518G>C	1.37:g.179989427G>C	ENSP00000356579:p.Glu840Gln		Somatic				CEP350_uc009wxl.2_Missense_Mutation_p.E839Q|CEP350_uc001gnu.2_Missense_Mutation_p.E674Q	p.E840Q	NM_014810	NP_055625	WXS	Illumina HiSeq	Unspecified	Q5VT06	CE350_HUMAN			12	2901	+			840					O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	c.2518G>C	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628118	0.87560	.	.	ENSG00000135837	ENST00000367607	T	0.48522	0.81	6.02	6.02	0.97574	.	0.000000	0.50627	D	0.000116	T	0.61739	0.2371	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.54036	-0.8353	9	.	.	.	.	20.1358	0.98028	0.0:0.0:1.0:0.0	.	840;840	E7EU22;Q5VT06	.;CE350_HUMAN	Q	840	ENSP00000356579:E840Q	.	E	+	1	0	CEP350	178256050	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.148000	0.94652	2.865000	0.98341	0.655000	0.94253	GAA		0.448	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		57	169	0	0	0	0	57	169				
ACBD6	84320	broad.mit.edu	37	1	180471273	180471273	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:180471273G>A	ENST00000367595.3	-	1	816	c.129C>T	c.(127-129)gcC>gcT	p.A43A		NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6	43	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.					cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						CAAACAGCTCGGCCAGGCAAC	0.612																																						uc001gog.2		NA																	0				ovary(1)	1						c.(127-129)GCC>GCT		acyl-coenzyme A binding domain containing 6							39.0	40.0	39.0					1																	180471273		2203	4300	6503	SO:0001819	synonymous_variant	84320					cytoplasm|nucleus	fatty-acyl-CoA binding	g.chr1:180471273G>A	BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.129C>T	1.37:g.180471273G>A			Somatic					p.A43A	NM_032360	NP_115736	WXS	Illumina HiSeq	Unspecified	Q9BR61	ACBD6_HUMAN			1	750	-			43			ACB.			Silent	SNP	ENST00000367595.3	37	c.129C>T	CCDS1339.1																																																																																				0.612	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084998.1	NM_032360		9	33	0	0	0	0	9	33				
COLGALT2	23127	broad.mit.edu	37	1	183938459	183938459	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:183938459T>G	ENST00000361927.4	-	5	1147	c.776A>C	c.(775-777)gAc>gCc	p.D259A	COLGALT2_ENST00000546159.1_Missense_Mutation_p.D259A	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	259					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										CCAGGTGTAGTCCTGGTGTGG	0.537																																						uc001gqr.2		NA																	0				ovary(1)|breast(1)	2						c.(775-777)GAC>GCC		glycosyltransferase 25 domain containing 2							133.0	118.0	123.0					1																	183938459		2203	4300	6503	SO:0001583	missense	23127				lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity	g.chr1:183938459T>G	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.776A>C	1.37:g.183938459T>G	ENSP00000354960:p.Asp259Ala		Somatic				GLT25D2_uc010poj.1_Missense_Mutation_p.D259A|GLT25D2_uc001gqs.2_Missense_Mutation_p.D139A	p.D259A	NM_015101	NP_055916	WXS	Illumina HiSeq	Unspecified	Q8IYK4	GT252_HUMAN			5	1148	-			259					O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	c.776A>C	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440898	0.83993	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.19532	2.14;2.14	5.45	4.33	0.51752	.	0.093718	0.64402	D	0.000001	T	0.41604	0.1166	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.999;0.994	D;P	0.66351	0.943;0.905	T	0.18272	-1.0342	10	0.35671	T	0.21	-19.6249	10.9148	0.47129	0.0:0.0735:0.0:0.9265	.	259;259	F5H3T5;Q8IYK4	.;GT252_HUMAN	A	259	ENSP00000439112:D259A;ENSP00000354960:D259A	ENSP00000354960:D259A	D	-	2	0	GLT25D2	182205082	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.699000	0.84547	0.919000	0.36945	0.482000	0.46254	GAC		0.537	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101		24	71	0	0	0	0	24	71				
F13B	2165	broad.mit.edu	37	1	197024886	197024886	+	Missense_Mutation	SNP	C	C	T	rs192220037		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:197024886C>T	ENST00000367412.1	-	8	1356	c.1313G>A	c.(1312-1314)cGt>cAt	p.R438H		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	438	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)		p.R438H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TTGTTCGCAACGAGATATTTT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		16038	0.001		0.0	False		,,,				2504	0.0					uc001gtt.1		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(1312-1314)CGT>CAT		coagulation factor XIII B subunit precursor							137.0	132.0	134.0					1																	197024886		2203	4300	6503	SO:0001583	missense	2165				blood coagulation	extracellular region		g.chr1:197024886C>T	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1313G>A	1.37:g.197024886C>T	ENSP00000356382:p.Arg438His		Somatic					p.R438H	NM_001994	NP_001985	WXS	Illumina HiSeq	Unspecified	P05160	F13B_HUMAN			8	1357	-			438			Sushi 7.		A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	37	c.1313G>A	CCDS1388.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	1.468	-0.560719	0.03939	.	.	ENSG00000143278	ENST00000367412	T	0.64438	-0.1	5.84	-2.74	0.05932	Complement control module (2);Sushi/SCR/CCP (3);	0.812933	0.10027	N	0.725233	T	0.30916	0.0780	N	0.05574	-0.02	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.18524	-1.0334	10	0.13108	T	0.6	.	3.4685	0.07558	0.3708:0.2214:0.0:0.4078	.	438	P05160	F13B_HUMAN	H	438	ENSP00000356382:R438H	ENSP00000356382:R438H	R	-	2	0	F13B	195291509	0.003000	0.15002	0.015000	0.15790	0.032000	0.12392	-0.152000	0.10159	-0.376000	0.07943	-0.469000	0.05056	CGT		0.413	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994		11	53	0	0	0	0	11	53				
CNTN2	6900	broad.mit.edu	37	1	205039107	205039107	+	Silent	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:205039107C>A	ENST00000331830.4	+	18	2633	c.2349C>A	c.(2347-2349)ccC>ccA	p.P783P		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	783	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCTACACGCCCTTTGAGGTCA	0.667																																					Melanoma(183;2548 2817 37099 41192)	uc001hbr.2		NA																	0				ovary(1)	1						c.(2347-2349)CCC>CCA		contactin 2 precursor							47.0	53.0	51.0					1																	205039107		2203	4300	6503	SO:0001819	synonymous_variant	6900				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding	g.chr1:205039107C>A	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2349C>A	1.37:g.205039107C>A			Somatic				CNTN2_uc001hbq.1_Silent_p.P674P|CNTN2_uc001hbs.2_Silent_p.P571P	p.P783P	NM_005076	NP_005067	WXS	Illumina HiSeq	Unspecified	Q02246	CNTN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		18	2618	+	all_cancers(21;0.144)|Breast(84;0.0437)		783			Fibronectin type-III 2.		P78432|Q5T054	Silent	SNP	ENST00000331830.4	37	c.2349C>A	CCDS1449.1																																																																																				0.667	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076		21	82	1	0	1.5e-11	1.69e-11	21	82				
RPS6KC1	26750	broad.mit.edu	37	1	213277818	213277818	+	Silent	SNP	C	C	A	rs56056039	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:213277818C>A	ENST00000366960.3	+	4	435	c.285C>A	c.(283-285)atC>atA	p.I95I	RPS6KC1_ENST00000366959.3_Silent_p.I83I|RPS6KC1_ENST00000543470.1_5'UTR|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543354.1_5'UTR	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	95	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		AAACTGTTATCGAAGAGAGAA	0.373													C|||	6	0.00119808	0.0	0.0058	5008	,	,		15385	0.0		0.002	False		,,,				2504	0.0					uc010ptr.1		NA																	0				lung(4)|ovary(3)|breast(1)	8						c.(283-285)ATC>ATA		ribosomal protein S6 kinase, 52kDa, polypeptide		C	,	0,4406		0,0,2203	179.0	170.0	173.0		249,285	-0.3	0.9	1	dbSNP_129	173	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous,coding-synonymous	RPS6KC1	NM_001136138.1,NM_012424.3	,	0,12,6491	AA,AC,CC		0.1395,0.0,0.0923	,	83/1055,95/1067	213277818	12,12994	2203	4300	6503	SO:0001819	synonymous_variant	26750				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity	g.chr1:213277818C>A	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.285C>A	1.37:g.213277818C>A			Somatic				RPS6KC1_uc001hkd.2_Silent_p.I83I|RPS6KC1_uc010pts.1_5'UTR|RPS6KC1_uc010ptt.1_5'UTR|RPS6KC1_uc010ptu.1_5'UTR|RPS6KC1_uc010ptv.1_5'UTR|RPS6KC1_uc001hke.2_5'UTR	p.I95I	NM_012424	NP_036556	WXS	Illumina HiSeq	Unspecified	Q96S38	KS6C1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)	4	444	+			95			PX.		B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Silent	SNP	ENST00000366960.3	37	c.285C>A	CCDS1513.1																																																																																				0.373	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424		8	50	1	0	3.1e-07	3.45e-07	8	50				
LIN9	286826	broad.mit.edu	37	1	226421074	226421074	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:226421074T>C	ENST00000328205.5	-	13	1989	c.1444A>G	c.(1444-1446)Agg>Ggg	p.R482G	LIN9_ENST00000481685.1_Missense_Mutation_p.R447G|LIN9_ENST00000366801.1_Missense_Mutation_p.R431G	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	466					DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		GCTGTAAGCCTGGAAATTAAG	0.368																																					Ovarian(197;1696 2974 11248 14117)	uc001hqa.2		NA																	0					0						c.(1444-1446)AGG>GGG		lin-9 homolog							117.0	120.0	119.0					1																	226421074		2203	4300	6503	SO:0001583	missense	286826				cell cycle|DNA replication	nucleoplasm		g.chr1:226421074T>C	AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.1444A>G	1.37:g.226421074T>C	ENSP00000329102:p.Arg482Gly		Somatic				LIN9_uc001hqb.2_Missense_Mutation_p.R447G|LIN9_uc001hqc.2_Missense_Mutation_p.R414G|LIN9_uc009xel.1_Missense_Mutation_p.R447G	p.R482G	NM_173083	NP_775106	WXS	Illumina HiSeq	Unspecified	Q5TKA1	LIN9_HUMAN		GBM - Glioblastoma multiforme(131;0.131)	13	1754	-	Breast(184;0.158)		466					Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Missense_Mutation	SNP	ENST00000328205.5	37	c.1444A>G	CCDS1553.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.469404	0.26423	.	.	ENSG00000183814	ENST00000460719;ENST00000328205;ENST00000366808;ENST00000366801;ENST00000481685	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.58793	0.2147	N	0.17474	0.49	0.80722	D	1	B;B;D	0.57899	0.001;0.002;0.981	B;B;D	0.69824	0.001;0.002;0.966	T	0.54105	-0.8343	9	0.11182	T	0.66	.	15.8367	0.78805	0.0:0.0:0.0:1.0	.	447;466;616	C9J5J4;Q5TKA1;B1ANK3	.;LIN9_HUMAN;.	G	442;482;537;431;447	.	ENSP00000329102:R482G	R	-	1	2	LIN9	224487697	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.810000	0.69179	2.142000	0.66516	0.533000	0.62120	AGG		0.368	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091523.2	NM_173083		3	146	0	0	0	0	3	146				
OBSCN	84033	broad.mit.edu	37	1	228495827	228495827	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:228495827T>C	ENST00000422127.1	+	47	12526	c.12482T>C	c.(12481-12483)aTt>aCt	p.I4161T	OBSCN_ENST00000366707.4_Missense_Mutation_p.I1795T|OBSCN_ENST00000284548.11_Missense_Mutation_p.I4161T|OBSCN_ENST00000570156.2_Missense_Mutation_p.I5118T|OBSCN_ENST00000366709.4_Missense_Mutation_p.I1280T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4161					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGGTGACCATTGTACGGGGG	0.612																																						uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(12481-12483)ATT>ACT		obscurin, cytoskeletal calmodulin and							79.0	89.0	85.0					1																	228495827		2111	4226	6337	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228495827T>C	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12482T>C	1.37:g.228495827T>C	ENSP00000409493:p.Ile4161Thr		Somatic				OBSCN_uc001hsn.2_Missense_Mutation_p.I4161T	p.I4161T	NM_001098623	NP_001092093	WXS	Illumina HiSeq	Unspecified	Q5VST9	OBSCN_HUMAN			47	12526	+		Prostate(94;0.0405)	4161					Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.12482T>C	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.281214	0.80692	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	6.04	6.04	0.98038	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.87059	0.6083	M	0.92604	3.325	0.46499	D	0.999073	D;D	0.89917	0.997;1.0	D;D	0.74023	0.932;0.982	D	0.87271	0.2286	10	0.29301	T	0.29	.	16.25	0.82478	0.0:0.0:0.0:1.0	.	4161;4161	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	T	4161;4161;1795;1280	ENSP00000284548:I4161T;ENSP00000409493:I4161T;ENSP00000355668:I1795T;ENSP00000355670:I1280T	ENSP00000284548:I4161T	I	+	2	0	OBSCN	226562450	0.998000	0.40836	0.940000	0.37924	0.536000	0.34869	2.952000	0.49097	2.317000	0.78254	0.460000	0.39030	ATT		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		14	68	0	0	0	0	14	68				
PCNXL2	80003	broad.mit.edu	37	1	233394516	233394516	+	Silent	SNP	G	G	A	rs371787723		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:233394516G>A	ENST00000258229.9	-	5	1326	c.1092C>T	c.(1090-1092)ccC>ccT	p.P364P	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	364						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GTGGGTCTCCGGGTTGAGAAG	0.517																																						uc001hvl.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(1090-1092)CCC>CCT		pecanex-like 2		G		0,3954		0,0,1977	90.0	91.0	91.0		1092	-5.1	0.2	1		91	1,8333		0,1,4166	no	coding-synonymous	PCNXL2	NM_014801.3		0,1,6143	AA,AG,GG		0.012,0.0,0.0081		364/2138	233394516	1,12287	1977	4167	6144	SO:0001819	synonymous_variant	80003					integral to membrane		g.chr1:233394516G>A	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.1092C>T	1.37:g.233394516G>A			Somatic				PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	p.P364P	NM_014801	NP_055616	WXS	Illumina HiSeq	Unspecified	A6NKB5	PCX2_HUMAN			5	1327	-		all_cancers(173;0.0347)|Prostate(94;0.137)	364					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	c.1092C>T	CCDS44335.1																																																																																				0.517	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		29	119	0	0	0	0	29	119				
IRF2BP2	359948	broad.mit.edu	37	1	234745081	234745081	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:234745081C>A	ENST00000366609.3	-	1	190	c.160G>T	c.(160-162)Gag>Tag	p.E54*	IRF2BP2_ENST00000366610.3_Nonsense_Mutation_p.E54*|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'Flank	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	54					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CGCGCCGTCTCGATGACGAAC	0.746																																						uc001hwg.2		NA																	0					0						c.(160-162)GAG>TAG		interferon regulatory factor 2 binding protein 2							7.0	7.0	7.0					1																	234745081		2112	4182	6294	SO:0001587	stop_gained	359948				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr1:234745081C>A	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.160G>T	1.37:g.234745081C>A	ENSP00000355568:p.Glu54*		Somatic				IRF2BP2_uc009xfw.2_5'Flank|IRF2BP2_uc001hwf.2_Nonsense_Mutation_p.E54*	p.E54*	NM_182972	NP_892017	WXS	Illumina HiSeq	Unspecified	Q7Z5L9	I2BP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)		1	191	-	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	54					B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Nonsense_Mutation	SNP	ENST00000366609.3	37	c.160G>T	CCDS1602.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231862	0.39399	.	.	ENSG00000168264	ENST00000366610;ENST00000366609	.	.	.	2.5	1.55	0.23275	.	0.473696	0.20520	U	0.090706	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.886	0.41262	0.0:0.7876:0.2124:0.0	.	.	.	.	X	54	.	ENSP00000355568:E54X	E	-	1	0	IRF2BP2	232811704	1.000000	0.71417	0.843000	0.33291	0.008000	0.06430	6.123000	0.71614	0.235000	0.21160	-1.445000	0.01065	GAG		0.746	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972		4	5	1	0	0.00116845	0.00125847	4	5				
RBM34	23029	broad.mit.edu	37	1	235295270	235295270	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:235295270C>G	ENST00000408888.3	-	11	1281	c.1051G>C	c.(1051-1053)Gaa>Caa	p.E351Q	RBM34_ENST00000495224.1_5'UTR|RBM34_ENST00000366606.3_Missense_Mutation_p.E346Q			P42696	RBM34_HUMAN	RNA binding motif protein 34	351	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CCCATGAGTTCAGAATTATTT	0.318																																						uc001hwn.2		NA																	0				central_nervous_system(1)	1						c.(1051-1053)GAA>CAA		RNA binding motif protein 34 isoform 1							70.0	64.0	66.0					1																	235295270		1805	4070	5875	SO:0001583	missense	23029					nucleolus	nucleotide binding|RNA binding	g.chr1:235295270C>G		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.1051G>C	1.37:g.235295270C>G	ENSP00000386226:p.Glu351Gln		Somatic				RBM34_uc001hwo.2_RNA|ARID4B_uc001hwp.2_RNA	p.E351Q	NM_015014	NP_055829	WXS	Illumina HiSeq	Unspecified	P42696	RBM34_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)		11	1081	-	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	351			RRM 2.		A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	c.1051G>C	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018198	0.75275	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000447801	T;T;T	0.17054	2.3;2.3;2.3	5.64	5.64	0.86602	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.141330	0.64402	D	0.000006	T	0.20740	0.0499	L	0.45352	1.415	0.80722	D	1	P	0.37423	0.594	B	0.41412	0.356	T	0.01800	-1.1271	10	0.21540	T	0.41	-33.4987	17.8898	0.88867	0.0:1.0:0.0:0.0	.	351	P42696	RBM34_HUMAN	Q	351;346;329	ENSP00000386226:E351Q;ENSP00000355565:E346Q;ENSP00000400000:E329Q	ENSP00000355565:E346Q	E	-	1	0	RBM34	233361893	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.609000	0.54117	2.660000	0.90430	0.563000	0.77884	GAA		0.318	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014		12	43	0	0	0	0	12	43				
KIF26B	55083	broad.mit.edu	37	1	245772637	245772637	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr1:245772637C>G	ENST00000407071.2	+	8	2161	c.1721C>G	c.(1720-1722)tCt>tGt	p.S574C	KIF26B_ENST00000366518.4_Missense_Mutation_p.S193C	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	574	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TGTGCCATCTCTTGGCTCTTC	0.537																																						uc001ibf.1		NA																	0				ovary(3)	3						c.(1720-1722)TCT>TGT		kinesin family member 26B							40.0	40.0	40.0					1																	245772637		1924	4130	6054	SO:0001583	missense	55083				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:245772637C>G	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1721C>G	1.37:g.245772637C>G	ENSP00000385545:p.Ser574Cys		Somatic				KIF26B_uc010pyq.1_Missense_Mutation_p.S574C|KIF26B_uc001ibg.1_Missense_Mutation_p.S192C	p.S574C	NM_018012	NP_060482	WXS	Illumina HiSeq	Unspecified	Q2KJY2	KI26B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.022)		8	2161	+	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		574			Kinesin-motor.		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	c.1721C>G	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675000	0.67928	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.76060	-0.99;-0.99	5.07	5.07	0.68467	Kinesin, motor domain (4);	.	.	.	.	D	0.86468	0.5940	M	0.73430	2.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.87966	0.2733	9	0.87932	D	0	.	18.8152	0.92075	0.0:1.0:0.0:0.0	.	193;574	B7WPD9;Q2KJY2	.;KI26B_HUMAN	C	574;193;190	ENSP00000385545:S574C;ENSP00000355475:S193C	ENSP00000355475:S193C	S	+	2	0	KIF26B	243839260	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.776000	0.85560	2.520000	0.84964	0.650000	0.86243	TCT		0.537	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354		5	12	0	0	0	0	5	12				
PFKP	5214	broad.mit.edu	37	10	3178029	3178029	+	Splice_Site	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:3178029G>C	ENST00000381125.4	+	21	2300	c.2224G>C	c.(2224-2226)Gag>Cag	p.E742Q	PITRM1_ENST00000464395.1_5'Flank|PFKP_ENST00000381075.2_Splice_Site_p.E734Q|PFKP_ENST00000381072.1_Splice_Site_p.E160Q	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	742	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		AACGGATTTTGAGTAAGTTGG	0.453																																						uc001igp.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						c.(2224-2226)GAG>CAG		phosphofructokinase, platelet							66.0	65.0	65.0					10																	3178029		2203	4300	6503	SO:0001630	splice_region_variant	5214				glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding	g.chr10:3178029G>C	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.2225+1G>C	10.37:g.3178029G>C			Somatic				PFKP_uc001igq.2_Missense_Mutation_p.E734Q|PFKP_uc009xhr.2_Missense_Mutation_p.E704Q|PFKP_uc009xht.2_Missense_Mutation_p.E480Q|PFKP_uc009xhu.2_Missense_Mutation_p.E248Q	p.E742Q	NM_002627	NP_002618	WXS	Illumina HiSeq	Unspecified	Q01813	K6PP_HUMAN		GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)	21	2260	+			742					B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	c.2224G>C	CCDS7059.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.35|13.35	2.211047|2.211047	0.39102|0.39102	.|.	.|.	ENSG00000067057|ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000381072|ENST00000433193	D;D;D|.	0.81579|.	-1.51;-1.51;-1.51|.	4.92|4.92	4.02|4.02	0.46733|0.46733	Phosphofructokinase domain (1);|.	0.222293|.	0.37136|.	N|.	0.002223|.	T|T	0.63414|0.63414	0.2509|0.2509	M|M	0.69358|0.69358	2.11|2.11	0.35144|0.35144	D|D	0.769131|0.769131	B;B;B|.	0.15473|.	0.013;0.013;0.009|.	B;B;B|.	0.14023|.	0.01;0.01;0.004|.	T|T	0.70385|0.70385	-0.4886|-0.4886	10|5	0.51188|.	T|.	0.08|.	.|.	9.3559|9.3559	0.38166|0.38166	0.1624:0.0:0.8376:0.0|0.1624:0.0:0.8376:0.0	.|.	734;734;742|.	B3KS15;Q5VSR7;Q01813|.	.;.;K6PP_HUMAN|.	Q|F	742;731;734;160|94	ENSP00000370517:E742Q;ENSP00000370465:E734Q;ENSP00000370462:E160Q|.	ENSP00000370462:E160Q|.	E|L	+|+	1|3	0|2	PFKP|PFKP	3168029|3168029	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.764000|0.764000	0.43329|0.43329	6.503000|6.503000	0.73699|0.73699	1.067000|1.067000	0.40740|0.40740	0.462000|0.462000	0.41574|0.41574	GAG|TTG		0.453	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	Missense_Mutation	6	23	0	0	0	0	6	23				
YME1L1	10730	broad.mit.edu	37	10	27423860	27423860	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:27423860G>A	ENST00000326799.3	-	7	910	c.762C>T	c.(760-762)ctC>ctT	p.L254L	YME1L1_ENST00000463270.1_5'UTR|YME1L1_ENST00000375972.3_Silent_p.L164L|YME1L1_ENST00000376016.3_Silent_p.L197L	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	254					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TGGTTTTCATGAGTTTGTCCA	0.393																																						uc001iti.2		NA																	0				ovary(1)	1						c.(760-762)CTC>CTT		YME1-like 1 isoform 1							109.0	103.0	105.0					10																	27423860		2203	4300	6503	SO:0001819	synonymous_variant	10730				protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity	g.chr10:27423860G>A	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.762C>T	10.37:g.27423860G>A			Somatic				YME1L1_uc001itj.2_Silent_p.L197L|YME1L1_uc010qdl.1_Silent_p.L164L|YME1L1_uc009xkv.2_RNA	p.L254L	NM_139312	NP_647473	WXS	Illumina HiSeq	Unspecified	Q96TA2	YMEL1_HUMAN			7	944	-			254					B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Silent	SNP	ENST00000326799.3	37	c.762C>T	CCDS7152.1																																																																																				0.393	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312		14	37	0	0	0	0	14	37				
NRG3	10718	broad.mit.edu	37	10	84745207	84745207	+	Missense_Mutation	SNP	G	G	T	rs150401464	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:84745207G>T	ENST00000404547.1	+	10	2009	c.2009G>T	c.(2008-2010)cGg>cTg	p.R670L	NRG3_ENST00000372141.2_Missense_Mutation_p.R646L|NRG3_ENST00000372142.2_Missense_Mutation_p.R449L|NRG3_ENST00000404576.2_Missense_Mutation_p.R450L|NRG3_ENST00000556918.1_Missense_Mutation_p.R476L|NRG3_ENST00000537893.1_Missense_Mutation_p.R296L|NRG3_ENST00000545131.1_Missense_Mutation_p.R296L			P56975	NRG3_HUMAN	neuregulin 3	670					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		GATGCCAGACGGTCAGAAGAC	0.483																																						uc001kco.2		NA																	0				lung(5)|breast(1)	6						c.(1936-1938)CGG>CTG		neuregulin 3 isoform 1							72.0	69.0	70.0					10																	84745207		2203	4300	6503	SO:0001583	missense	10718				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity	g.chr10:84745207G>T	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.2009G>T	10.37:g.84745207G>T	ENSP00000384796:p.Arg670Leu		Somatic				NRG3_uc010qlz.1_Missense_Mutation_p.R645L|NRG3_uc001kcp.2_Missense_Mutation_p.R449L|NRG3_uc001kcq.2_Missense_Mutation_p.R296L|NRG3_uc001kcr.2_Missense_Mutation_p.R320L	p.R646L	NM_001010848	NP_001010848	WXS	Illumina HiSeq	Unspecified	P56975	NRG3_HUMAN		GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)	9	1964	+			670			Cytoplasmic (Potential).		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	c.1937G>T	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190993	0.58017	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.68903	0.27;0.44;0.5;-0.36;0.21;-0.18;-0.18	5.54	4.63	0.57726	.	0.071482	0.52532	D	0.000073	T	0.75874	0.3909	L	0.53249	1.67	0.53688	D	0.999976	B;D;P;D	0.71674	0.364;0.997;0.841;0.998	B;D;B;D	0.65987	0.168;0.919;0.358;0.94	T	0.78127	-0.2325	10	0.87932	D	0	-32.1113	12.5326	0.56124	0.0814:0.0:0.9186:0.0	.	645;670;449;646	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	L	646;670;645;449;450;476;296;296	ENSP00000361214:R646L;ENSP00000384796:R670L;ENSP00000361215:R449L;ENSP00000385804:R450L;ENSP00000451376:R476L;ENSP00000441201:R296L;ENSP00000440377:R296L	ENSP00000361214:R646L	R	+	2	0	NRG3	84735187	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.005000	0.63972	1.334000	0.45468	0.655000	0.94253	CGG		0.483	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086		15	29	1	0	2.32e-09	2.61e-09	15	29				
PLCE1	51196	broad.mit.edu	37	10	95791019	95791019	+	Silent	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:95791019T>C	ENST00000371380.3	+	1	451	c.216T>C	c.(214-216)atT>atC	p.I72I	PLCE1_ENST00000260766.3_Silent_p.I72I			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	72					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TGCCAAAGATTCTCTCAATAG	0.393																																						uc001kjk.2		NA																	0				ovary(2)|skin(1)	3						c.(214-216)ATT>ATC		phospholipase C, epsilon 1 isoform 1							69.0	64.0	66.0					10																	95791019		1868	4103	5971	SO:0001819	synonymous_variant	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95791019T>C		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.216T>C	10.37:g.95791019T>C			Somatic				PLCE1_uc010qnx.1_Silent_p.I72I	p.I72I	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			2	850	+		Colorectal(252;0.0458)	72					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	c.216T>C	CCDS41552.1																																																																																				0.393	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		14	29	0	0	0	0	14	29				
PLCE1	51196	broad.mit.edu	37	10	95791437	95791437	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:95791437G>T	ENST00000371380.3	+	1	869	c.634G>T	c.(634-636)Gat>Tat	p.D212Y	PLCE1_ENST00000260766.3_Missense_Mutation_p.D212Y			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	212					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)	p.D212N(1)		liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				AATTTTAGACGATTGTGGAAA	0.388																																						uc001kjk.2		NA																	1	Substitution - Missense(1)		NS(1)	ovary(2)|skin(1)	3						c.(634-636)GAT>TAT		phospholipase C, epsilon 1 isoform 1							84.0	80.0	81.0					10																	95791437		1879	4102	5981	SO:0001583	missense	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95791437G>T		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.634G>T	10.37:g.95791437G>T	ENSP00000360431:p.Asp212Tyr		Somatic				PLCE1_uc010qnx.1_Missense_Mutation_p.D212Y	p.D212Y	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			2	1268	+		Colorectal(252;0.0458)	212					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	c.634G>T	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	9.882	1.201795	0.22121	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.73469	-0.75;-0.75	4.98	4.03	0.46877	.	0.451574	0.18550	N	0.137934	T	0.73265	0.3565	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61800	0.894;0.894	T	0.74250	-0.3726	10	0.87932	D	0	.	9.2375	0.37475	0.1735:0.0:0.8265:0.0	.	212;212	B7ZM61;Q9P212	.;PLCE1_HUMAN	Y	212	ENSP00000260766:D212Y;ENSP00000360431:D212Y	ENSP00000260766:D212Y	D	+	1	0	PLCE1	95781427	1.000000	0.71417	0.995000	0.50966	0.032000	0.12392	2.783000	0.47766	1.144000	0.42321	-0.345000	0.07892	GAT		0.388	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		16	45	1	0	1.63e-17	1.86e-17	16	45				
PLCE1	51196	broad.mit.edu	37	10	95791784	95791784	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:95791784G>C	ENST00000371380.3	+	1	1216	c.981G>C	c.(979-981)agG>agC	p.R327S	PLCE1_ENST00000260766.3_Missense_Mutation_p.R327S			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	327					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TGTTAGTCAGGAGATTCTGTA	0.403																																						uc001kjk.2		NA																	0				ovary(2)|skin(1)	3						c.(979-981)AGG>AGC		phospholipase C, epsilon 1 isoform 1							99.0	99.0	99.0					10																	95791784		1845	4095	5940	SO:0001583	missense	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95791784G>C		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.981G>C	10.37:g.95791784G>C	ENSP00000360431:p.Arg327Ser		Somatic				PLCE1_uc010qnx.1_Missense_Mutation_p.R327S	p.R327S	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			2	1615	+		Colorectal(252;0.0458)	327					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	c.981G>C	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227421	0.58668	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.71698	-0.59;-0.59	5.14	-0.8	0.10897	Ras guanine nucleotide exchange factor, domain (1);	0.188267	0.30723	N	0.009001	T	0.71195	0.3311	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.69450	-0.5142	10	0.87932	D	0	.	11.5623	0.50785	0.8408:0.0:0.1592:0.0	.	327;327	B7ZM61;Q9P212	.;PLCE1_HUMAN	S	327	ENSP00000260766:R327S;ENSP00000360431:R327S	ENSP00000260766:R327S	R	+	3	2	PLCE1	95781774	0.972000	0.33761	0.985000	0.45067	0.983000	0.72400	0.072000	0.14617	-0.387000	0.07809	-0.137000	0.14449	AGG		0.403	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		13	60	0	0	0	0	13	60				
PLCE1	51196	broad.mit.edu	37	10	95791831	95791831	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr10:95791831G>C	ENST00000371380.3	+	1	1263	c.1028G>C	c.(1027-1029)gGa>gCa	p.G343A	PLCE1_ENST00000260766.3_Missense_Mutation_p.G343A			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	343					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GTGTATACTGGAACAAGAGCA	0.423																																						uc001kjk.2		NA																	0				ovary(2)|skin(1)	3						c.(1027-1029)GGA>GCA		phospholipase C, epsilon 1 isoform 1							76.0	78.0	78.0					10																	95791831		1907	4124	6031	SO:0001583	missense	51196				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity	g.chr10:95791831G>C		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1028G>C	10.37:g.95791831G>C	ENSP00000360431:p.Gly343Ala		Somatic				PLCE1_uc010qnx.1_Missense_Mutation_p.G343A	p.G343A	NM_016341	NP_057425	WXS	Illumina HiSeq	Unspecified	Q9P212	PLCE1_HUMAN			2	1662	+		Colorectal(252;0.0458)	343					A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	c.1028G>C	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631390	0.67015	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.71103	-0.54;-0.54	5.14	5.14	0.70334	Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.53938	D	0.000059	T	0.77356	0.4118	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.80788	-0.1226	10	0.87932	D	0	.	18.626	0.91338	0.0:0.0:1.0:0.0	.	343;343	B7ZM61;Q9P212	.;PLCE1_HUMAN	A	343	ENSP00000260766:G343A;ENSP00000360431:G343A	ENSP00000260766:G343A	G	+	2	0	PLCE1	95781821	1.000000	0.71417	0.998000	0.56505	0.741000	0.42261	7.539000	0.82063	2.398000	0.81561	0.655000	0.94253	GGA		0.423	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341		9	39	0	0	0	0	9	39				
APBB1	322	broad.mit.edu	37	11	6431880	6431880	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:6431880G>C	ENST00000609360.1	-	2	797	c.698C>G	c.(697-699)tCc>tGc	p.S233C	APBB1_ENST00000389906.2_Missense_Mutation_p.S233C|APBB1_ENST00000299402.6_Missense_Mutation_p.S233C|APBB1_ENST00000311051.3_Missense_Mutation_p.S233C	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	233					apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GGAGCCATAGGAGGGGCTGCC	0.592																																					GBM(147;1810 2556 5672 39622)	uc001mdb.1		NA																	0				breast(2)	2						c.(697-699)TCC>TGC		amyloid beta A4 precursor protein-binding,							55.0	55.0	55.0					11																	6431880		2201	4296	6497	SO:0001583	missense	322				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding	g.chr11:6431880G>C	L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.698C>G	11.37:g.6431880G>C	ENSP00000477213:p.Ser233Cys		Somatic				APBB1_uc001mdc.1_Missense_Mutation_p.S233C|APBB1_uc010rah.1_Intron	p.S233C	NM_001164	NP_001155	WXS	Illumina HiSeq	Unspecified	O00213	APBB1_HUMAN		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)	2	798	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)	233					A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	ENST00000609360.1	37	c.698C>G		.	.	.	.	.	.	.	.	.	.	G	19.41	3.822339	0.71028	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758	T;T;T	0.26518	1.73;1.73;1.74	5.23	5.23	0.72850	.	0.253842	0.33005	N	0.005384	T	0.45236	0.1332	L	0.46157	1.445	0.32208	N	0.576908	D	0.89917	1.0	D	0.79784	0.993	T	0.53781	-0.8390	10	0.72032	D	0.01	-16.941	16.3499	0.83199	0.0:0.0:1.0:0.0	.	233	O00213-2	.	C	233;233;233;82	ENSP00000299402:S233C;ENSP00000311912:S233C;ENSP00000374556:S233C	ENSP00000299402:S233C	S	-	2	0	APBB1	6388456	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.418000	0.66429	2.451000	0.82905	0.393000	0.25936	TCC		0.592	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164		11	50	0	0	0	0	11	50				
ST5	6764	broad.mit.edu	37	11	8736175	8736175	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:8736175C>T	ENST00000534127.1	-	10	2309	c.1924G>A	c.(1924-1926)Gaa>Aaa	p.E642K	ST5_ENST00000526757.1_Missense_Mutation_p.E222K|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000526099.1_Missense_Mutation_p.E155K|ST5_ENST00000530438.1_Missense_Mutation_p.E222K|ST5_ENST00000530991.1_Missense_Mutation_p.E114K|ST5_ENST00000357665.1_Missense_Mutation_p.E642K|ST5_ENST00000313726.6_Missense_Mutation_p.E642K	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	642					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		GATGCTGTTTCAATGCTGGAC	0.468																																						uc001mgt.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1924-1926)GAA>AAA		suppression of tumorigenicity 5 isoform 1							234.0	211.0	219.0					11																	8736175		2201	4296	6497	SO:0001583	missense	6764				positive regulation of ERK1 and ERK2 cascade		protein binding	g.chr11:8736175C>T	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.1924G>A	11.37:g.8736175C>T	ENSP00000433528:p.Glu642Lys		Somatic				ST5_uc009yfr.2_Missense_Mutation_p.E222K|ST5_uc001mgu.2_Missense_Mutation_p.E222K|ST5_uc001mgv.2_Missense_Mutation_p.E642K|ST5_uc010rbq.1_RNA|ST5_uc010rbp.1_Missense_Mutation_p.E155K	p.E642K	NM_213618	NP_998783	WXS	Illumina HiSeq	Unspecified	P78524	ST5_HUMAN		Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)	7	2110	-			642					B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	c.1924G>A	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135416	0.77662	.	.	ENSG00000166444	ENST00000526757;ENST00000534127;ENST00000313726;ENST00000530991;ENST00000357665;ENST00000526099;ENST00000530438;ENST00000533020;ENST00000447053;ENST00000530593;ENST00000528527	T;T;T;T;T;T;T;T;T;T	0.09723	2.95;2.95;2.95;2.95;2.95;2.95;2.95;2.95;2.95;2.95	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.23171	0.0560	L	0.40543	1.245	0.80722	D	1	D;B;B	0.58620	0.983;0.066;0.001	P;B;B	0.60949	0.881;0.059;0.007	T	0.00123	-1.2026	10	0.44086	T	0.13	-18.1457	17.7409	0.88406	0.0:1.0:0.0:0.0	.	155;222;642	B4DDL8;P78524-2;P78524	.;.;ST5_HUMAN	K	222;642;642;114;642;155;222;114;252;114;114	ENSP00000435097:E222K;ENSP00000433528:E642K;ENSP00000319678:E642K;ENSP00000432887:E114K;ENSP00000350294:E642K;ENSP00000436808:E155K;ENSP00000436802:E222K;ENSP00000433588:E114K;ENSP00000437096:E114K;ENSP00000431580:E114K	ENSP00000319678:E642K	E	-	1	0	ST5	8692751	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.938000	0.75904	2.637000	0.89404	0.650000	0.86243	GAA		0.468	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418		6	27	0	0	0	0	6	27				
ABCC8	6833	broad.mit.edu	37	11	17418492	17418492	+	Missense_Mutation	SNP	C	C	G	rs138642224	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:17418492C>G	ENST00000389817.3	-	33	4158	c.4090G>C	c.(4090-4092)Gtc>Ctc	p.V1364L	ABCC8_ENST00000302539.4_Missense_Mutation_p.V1365L			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1364	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	AGGGCATTGACGTGCTTCAGC	0.612																																						uc001mnc.2		NA																	0				ovary(1)	1						c.(4090-4092)GTC>CTC		ATP-binding cassette, sub-family C, member 8	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)						121.0	93.0	102.0					11																	17418492		2200	4293	6493	SO:0001583	missense	6833				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity	g.chr11:17418492C>G	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4090G>C	11.37:g.17418492C>G	ENSP00000374467:p.Val1364Leu		Somatic					p.V1364L	NM_000352	NP_000343	WXS	Illumina HiSeq	Unspecified	Q09428	ABCC8_HUMAN		READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	33	4216	-			1364			Cytoplasmic (By similarity).|ABC transporter 2.		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	c.4090G>C	CCDS31437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.99|12.99	2.104279|2.104279	0.37145|0.37145	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000528374|ENST00000389817;ENST00000302539	.|D;D	.|0.94330	.|-3.4;-3.4	4.83|4.83	4.83|4.83	0.62350|0.62350	.|ABC transporter-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85057|0.85057	0.5610|0.5610	N|N	0.04387|0.04387	-0.21|-0.21	0.80722|0.80722	D|D	1|1	.|B	.|0.22080	.|0.064	.|B	.|0.26969	.|0.075	T|T	0.80679|0.80679	-0.1275|-0.1275	5|10	.|0.13470	.|T	.|0.59	.|.	18.2867|18.2867	0.90117|0.90117	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1364	.|Q09428	.|ABCC8_HUMAN	P|L	191|1364;1365	.|ENSP00000374467:V1364L;ENSP00000303960:V1365L	.|ENSP00000303960:V1365L	R|V	-|-	2|1	0|0	ABCC8|ABCC8	17375068|17375068	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.022000|0.022000	0.10575|0.10575	4.794000|4.794000	0.62482|0.62482	2.386000|2.386000	0.81285|0.81285	0.555000|0.555000	0.69702|0.69702	CGT|GTC		0.612	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352		11	46	0	0	0	0	11	46				
LDHC	3948	broad.mit.edu	37	11	18456337	18456337	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:18456337C>T	ENST00000541669.1	+	5	580	c.469C>T	c.(469-471)Cgt>Tgt	p.R157C	LDHC_ENST00000535809.1_Missense_Mutation_p.R157C|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000544105.1_Missense_Mutation_p.R157C|LDHC_ENST00000280704.4_Missense_Mutation_p.R157C|LDHC_ENST00000536880.1_Missense_Mutation_p.R143C|LDHC_ENST00000546146.1_Missense_Mutation_p.R99C			P07864	LDHC_HUMAN	lactate dehydrogenase C	157					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACCTGTAACTCGTGTAATTGG	0.368																																						uc001mon.3		NA																	0					0						c.(469-471)CGT>TGT		L-lactate dehydrogenase C	NADH(DB00157)						179.0	178.0	178.0					11																	18456337		2199	4293	6492	SO:0001583	missense	3948				glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity	g.chr11:18456337C>T	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.469C>T	11.37:g.18456337C>T	ENSP00000437783:p.Arg157Cys		Somatic				LDHC_uc001mom.3_Missense_Mutation_p.R157C|LDHC_uc009yhp.2_Missense_Mutation_p.R157C|LDHC_uc001moo.3_Missense_Mutation_p.R41C|LDHC_uc009yhq.2_RNA|LDHC_uc009yhr.2_Missense_Mutation_p.R41C	p.R157C	NM_017448	NP_059144	WXS	Illumina HiSeq	Unspecified	P07864	LDHC_HUMAN			5	581	+			157					D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	ENST00000541669.1	37	c.469C>T	CCDS7840.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.527764	0.27299	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000546146;ENST00000536880;ENST00000544105;ENST00000535809	D;D;D;D;D;D	0.92299	-2.73;-2.73;-3.01;-2.73;-2.73;-2.73	4.67	1.72	0.24424	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.179564	0.50627	D	0.000104	D	0.93090	0.7800	H	0.98256	4.185	0.80722	D	1	B;P;P	0.49559	0.036;0.925;0.688	B;B;B	0.36534	0.002;0.227;0.097	D	0.90728	0.4640	10	0.62326	D	0.03	-6.3129	8.7069	0.34360	0.2674:0.6608:0.0:0.0718	.	157;157;157	F5H155;G3XAP5;P07864	.;.;LDHC_HUMAN	C	157;157;99;143;157;157	ENSP00000437783:R157C;ENSP00000280704:R157C;ENSP00000443414:R99C;ENSP00000439555:R143C;ENSP00000439060:R157C;ENSP00000443997:R157C	ENSP00000280704:R157C	R	+	1	0	LDHC	18412913	0.998000	0.40836	0.423000	0.26634	0.463000	0.32649	3.121000	0.50438	0.195000	0.20347	-0.899000	0.02877	CGT		0.368	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448		40	75	0	0	0	0	40	75				
BDNF	627	broad.mit.edu	37	11	27679532	27679532	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:27679532C>T	ENST00000525528.1	-	1	1673	c.580G>A	c.(580-582)Gaa>Aaa	p.E194K	BDNF_ENST00000438929.1_Missense_Mutation_p.E276K|BDNF_ENST00000418212.1_Missense_Mutation_p.E194K|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000532997.1_Missense_Mutation_p.E194K|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395983.3_Missense_Mutation_p.E194K|BDNF_ENST00000420794.1_Missense_Mutation_p.E194K|BDNF_ENST00000356660.4_Missense_Mutation_p.E194K|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000314915.6_Missense_Mutation_p.E202K|BDNF_ENST00000395980.2_Missense_Mutation_p.E194K|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000533246.1_Missense_Mutation_p.E194K|BDNF_ENST00000533131.1_Missense_Mutation_p.E194K|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000395978.3_Missense_Mutation_p.E194K|BDNF_ENST00000530861.1_Missense_Mutation_p.E194K|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000525950.1_Missense_Mutation_p.E194K|BDNF_ENST00000395986.2_Missense_Mutation_p.E209K|BDNF_ENST00000395981.3_Missense_Mutation_p.E194K|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000439476.2_Missense_Mutation_p.E194K	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	194					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						CTGCAGCCTTCTTTTGTGTAA	0.512																																						uc010rdu.1		NA																	0					0						c.(580-582)GAA>AAA		brain-derived neurotrophic factor isoform a							184.0	182.0	183.0					11																	27679532		2202	4299	6501	SO:0001583	missense	627					extracellular region	growth factor activity	g.chr11:27679532C>T	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.580G>A	11.37:g.27679532C>T	ENSP00000437138:p.Glu194Lys		Somatic				BDNFOS_uc001mrm.2_Intron|BDNFOS_uc009yij.2_Intron|BDNFOS_uc009yik.2_Intron|BDNFOS_uc009yil.2_Intron|BDNFOS_uc001mrp.2_Intron|BDNFOS_uc009yim.2_Intron|BDNFOS_uc009yin.2_Intron|BDNFOS_uc009yio.2_Intron|BDNFOS_uc009yip.2_Intron|BDNFOS_uc001mrn.2_Intron|BDNFOS_uc009yiq.2_Intron|BDNFOS_uc001mro.2_Intron|BDNFOS_uc009yir.2_Intron|BDNFOS_uc009yis.2_Intron|BDNFOS_uc009yit.2_Intron|BDNFOS_uc009yiu.2_Intron|BDNFOS_uc009yiv.2_Intron|BDNFOS_uc009yiw.2_Intron|BDNFOS_uc009yix.2_Intron|BDNFOS_uc009yiy.2_Intron|BDNFOS_uc009yiz.2_Intron|BDNFOS_uc001mrq.3_Intron|BDNFOS_uc001mrr.3_Intron|BDNFOS_uc009yja.2_Intron|BDNFOS_uc009yjb.2_Intron|BDNF_uc010rdv.1_Missense_Mutation_p.E194K|BDNF_uc001mrt.2_Missense_Mutation_p.E209K|BDNF_uc010rdw.1_Missense_Mutation_p.E194K|BDNF_uc009yjd.2_Missense_Mutation_p.E194K|BDNF_uc001mru.2_Missense_Mutation_p.E194K|BDNF_uc010rdx.1_Missense_Mutation_p.E194K|BDNF_uc010rdy.1_Missense_Mutation_p.E194K|BDNF_uc009yjg.2_Missense_Mutation_p.E194K|BDNF_uc009yje.2_Missense_Mutation_p.E276K|BDNF_uc009yjf.2_Missense_Mutation_p.E223K|BDNF_uc001mrv.2_Missense_Mutation_p.E194K|BDNF_uc001mrw.3_Missense_Mutation_p.E194K|BDNF_uc001mrx.2_Missense_Mutation_p.E194K|BDNF_uc001mry.3_Missense_Mutation_p.E194K|BDNF_uc001mrz.3_Missense_Mutation_p.E194K|BDNF_uc001msa.2_Missense_Mutation_p.E202K	p.E194K	NM_001143816	NP_001137288	WXS	Illumina HiSeq	Unspecified	P23560	BDNF_HUMAN			2	1431	-			194					A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	ENST00000525528.1	37	c.580G>A	CCDS7866.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604775	0.46423	.	.	ENSG00000176697	ENST00000439476;ENST00000525528;ENST00000395986;ENST00000533131;ENST00000356660;ENST00000418212;ENST00000533246;ENST00000530861;ENST00000395983;ENST00000438929;ENST00000395980;ENST00000532997;ENST00000395981;ENST00000395978;ENST00000525950;ENST00000314915;ENST00000420794	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	6.08	6.08	0.98989	Nerve growth factor-related (4);	0.156078	0.56097	D	0.000034	T	0.72961	0.3526	N	0.24115	0.695	0.80722	D	1	P;P;P;B;P	0.48640	0.726;0.908;0.913;0.358;0.913	P;P;P;B;P	0.61533	0.569;0.527;0.89;0.082;0.89	T	0.74639	-0.3598	10	0.87932	D	0	-13.6562	20.6721	0.99693	0.0:1.0:0.0:0.0	.	223;276;202;194;209	P23560-5;P23560-4;P23560-2;P23560;P23560-3	.;.;.;BDNF_HUMAN;.	K	194;194;209;194;194;194;194;194;194;276;194;194;194;194;194;202;194	ENSP00000389345:E194K;ENSP00000437138:E194K;ENSP00000379309:E209K;ENSP00000432727:E194K;ENSP00000349084:E194K;ENSP00000400502:E194K;ENSP00000432376:E194K;ENSP00000435564:E194K;ENSP00000379307:E194K;ENSP00000414303:E276K;ENSP00000379304:E194K;ENSP00000435805:E194K;ENSP00000379305:E194K;ENSP00000379302:E194K;ENSP00000432035:E194K;ENSP00000320002:E202K;ENSP00000389564:E194K	ENSP00000320002:E202K	E	-	1	0	BDNF	27636108	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GAA		0.512	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735		38	108	0	0	0	0	38	108				
ELP4	26610	broad.mit.edu	37	11	31531473	31531473	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:31531473T>C	ENST00000350638.5	+	1	177	c.142T>C	c.(142-144)Tcc>Ccc	p.S48P	ELP4_ENST00000395934.2_Missense_Mutation_p.S48P|IMMP1L_ENST00000534812.1_5'Flank|IMMP1L_ENST00000278200.1_5'Flank|ELP4_ENST00000379163.5_Missense_Mutation_p.S48P|IMMP1L_ENST00000526776.1_5'Flank|IMMP1L_ENST00000532287.1_5'Flank|IMMP1L_ENST00000528161.1_5'Flank|IMMP1L_ENST00000533642.1_5'Flank	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	48					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					TCGACTGGTGTCCATTGCGGG	0.627																																						uc001mtb.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3						c.(142-144)TCC>CCC		elongation protein 4 homolog							58.0	63.0	61.0					11																	31531473		2022	4172	6194	SO:0001583	missense	26610				histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding	g.chr11:31531473T>C	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.142T>C	11.37:g.31531473T>C	ENSP00000298937:p.Ser48Pro		Somatic				IMMP1L_uc001msy.1_5'Flank|IMMP1L_uc001msz.1_5'Flank|ELP4_uc001mta.1_RNA|ELP4_uc001mtc.2_Missense_Mutation_p.S48P|ELP4_uc010rdz.1_Missense_Mutation_p.S48P|IMMP1L_uc009yjo.2_5'Flank|IMMP1L_uc009yjp.2_5'Flank	p.S48P	NM_019040	NP_061913	WXS	Illumina HiSeq	Unspecified	Q96EB1	ELP4_HUMAN			1	177	+	Lung SC(675;0.225)		48					B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	37	c.142T>C	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.884524	0.91814	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.43688	0.94;0.94;0.94	5.51	5.51	0.81932	.	0.225077	0.47093	D	0.000242	T	0.41789	0.1174	N	0.16066	0.365	0.33492	D	0.588801	D;D;D	0.71674	0.998;0.998;0.988	D;P;P	0.63488	0.915;0.905;0.796	T	0.52087	-0.8622	10	0.28530	T	0.3	-1.0315	11.0988	0.48161	0.0:0.0:0.1542:0.8458	.	48;48;48	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	P	48	ENSP00000298937:S48P;ENSP00000368461:S48P;ENSP00000379267:S48P	ENSP00000298937:S48P	S	+	1	0	ELP4	31488049	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.839000	0.39220	2.213000	0.71641	0.454000	0.30748	TCC		0.627	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040		27	59	0	0	0	0	27	59				
PRR5L	79899	broad.mit.edu	37	11	36472865	36472865	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:36472865C>G	ENST00000378867.3	+	9	1047	c.692C>G	c.(691-693)tCa>tGa	p.S231*	PRR5L_ENST00000527487.1_Intron|PRR5L_ENST00000311599.5_Nonsense_Mutation_p.S158*|PRR5L_ENST00000530639.1_Nonsense_Mutation_p.S231*|PRR5L_ENST00000389693.3_3'UTR	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	231					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						CGTAGCTTCTCAGGCCCCACG	0.537																																						uc001mwo.3		NA																	0				ovary(1)	1						c.(691-693)TCA>TGA		protor-2 isoform a							119.0	95.0	103.0					11																	36472865		2202	4298	6500	SO:0001587	stop_gained	79899							g.chr11:36472865C>G		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.692C>G	11.37:g.36472865C>G	ENSP00000368144:p.Ser231*		Somatic				PRR5L_uc001mwp.2_Nonsense_Mutation_p.S231*|PRR5L_uc009ykk.2_Nonsense_Mutation_p.S103*|PRR5L_uc010rfc.1_Intron	p.S231*	NM_001160167	NP_001153639	WXS	Illumina HiSeq	Unspecified	Q6MZQ0	PRR5L_HUMAN			8	1081	+			231					A4QN22|E9PKY1|Q96H46|Q9H7V4	Nonsense_Mutation	SNP	ENST00000378867.3	37	c.692C>G	CCDS31463.1	.	.	.	.	.	.	.	.	.	.	C	37	6.206409	0.97376	.	.	ENSG00000135362	ENST00000530639;ENST00000311599;ENST00000378867	.	.	.	5.16	5.16	0.70880	.	0.772655	0.11964	N	0.512458	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-10.1831	16.4084	0.83698	0.0:1.0:0.0:0.0	.	.	.	.	X	231;158;231	.	ENSP00000310103:S158X	S	+	2	0	PRR5L	36429441	0.035000	0.19736	0.835000	0.33067	0.208000	0.24298	3.014000	0.49590	2.417000	0.82017	0.313000	0.20887	TCA		0.537	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389209.1	NM_024841		13	37	0	0	0	0	13	37				
MAPK8IP1	9479	broad.mit.edu	37	11	45926322	45926322	+	Silent	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:45926322C>G	ENST00000241014.2	+	9	2000	c.1830C>G	c.(1828-1830)gtC>gtG	p.V610V	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Silent_p.V600V	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	610	Interaction with VRK2.|PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		CCAGCTGTGTCCTGGAGATCA	0.607																																						uc001nbr.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1828-1830)GTC>GTG		mitogen-activated protein kinase 8 interacting							81.0	86.0	85.0					11																	45926322		2203	4299	6502	SO:0001819	synonymous_variant	9479				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity	g.chr11:45926322C>G		CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1830C>G	11.37:g.45926322C>G			Somatic					p.V610V	NM_005456	NP_005447	WXS	Illumina HiSeq	Unspecified	Q9UQF2	JIP1_HUMAN		GBM - Glioblastoma multiforme(35;0.231)	9	2000	+			610			PID.		D3DQP4|O43407	Silent	SNP	ENST00000241014.2	37	c.1830C>G	CCDS7916.1																																																																																				0.607	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1	NM_005456		28	86	0	0	0	0	28	86				
FOLH1	2346	broad.mit.edu	37	11	49229949	49229949	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:49229949G>A	ENST00000256999.2	-	1	273	c.13C>T	c.(13-15)Ctt>Ttt	p.L5F	FOLH1_ENST00000356696.3_Missense_Mutation_p.L5F|FOLH1_ENST00000533034.1_5'Flank|FOLH1_ENST00000340334.7_5'UTR|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	5					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GTTTCGTGAAGGAGATTCCAC	0.701																																						uc001ngy.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(13-15)CTT>TTT		folate hydrolase 1 isoform 1	Capromab(DB00089)|L-Glutamic Acid(DB00142)						9.0	12.0	11.0					11																	49229949		2183	4260	6443	SO:0001583	missense	2346				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:49229949G>A	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.13C>T	11.37:g.49229949G>A	ENSP00000256999:p.Leu5Phe		Somatic				FOLH1_uc001ngz.2_Missense_Mutation_p.L5F|FOLH1_uc009yly.2_5'UTR|FOLH1_uc009ylz.2_5'UTR|FOLH1_uc009yma.2_5'UTR|FOLH1_uc001nha.2_5'UTR	p.L5F	NM_004476	NP_004467	WXS	Illumina HiSeq	Unspecified	Q04609	FOLH1_HUMAN			1	274	-			5			Cytoplasmic (Probable).		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	c.13C>T	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125207	0.56721	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000389724	T;T	0.39592	1.07;1.1	4.19	2.27	0.28462	.	1.397640	0.05374	U	0.536016	T	0.35393	0.0930	N	0.08118	0	0.18873	N	0.999987	P;D	0.57257	0.946;0.979	P;P	0.55222	0.649;0.771	T	0.26710	-1.0095	10	0.46703	T	0.11	.	5.0821	0.14663	0.1078:0.0:0.6867:0.2055	.	5;5	Q04609-8;Q04609	.;FOLH1_HUMAN	F	5	ENSP00000256999:L5F;ENSP00000349129:L5F	ENSP00000256999:L5F	L	-	1	0	FOLH1	49186525	0.032000	0.19561	0.001000	0.08648	0.001000	0.01503	1.761000	0.38440	0.518000	0.28383	-0.218000	0.12543	CTT		0.701	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476		3	9	0	0	0	0	3	9				
TCN1	6947	broad.mit.edu	37	11	59631479	59631479	+	Missense_Mutation	SNP	C	C	T	rs200856109	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:59631479C>T	ENST00000257264.3	-	2	264	c.160G>A	c.(160-162)Gct>Act	p.A54T	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	54	Globular N-terminal alpha domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACATTGACAGCGCTGGTTCCC	0.418													C|||	3	0.000599042	0.0	0.0	5008	,	,		18913	0.002		0.0	False		,,,				2504	0.001					uc001noj.2		NA																	0				ovary(2)	2						c.(160-162)GCT>ACT		transcobalamin I precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						248.0	238.0	242.0					11																	59631479		2201	4294	6495	SO:0001583	missense	6947				cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding	g.chr11:59631479C>T	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.160G>A	11.37:g.59631479C>T	ENSP00000257264:p.Ala54Thr		Somatic					p.A54T	NM_001062	NP_001053	WXS	Illumina HiSeq	Unspecified	P20061	TCO1_HUMAN			2	258	-		all_epithelial(135;0.198)	54					A8KAC5|Q8WV77	Missense_Mutation	SNP	ENST00000257264.3	37	c.160G>A	CCDS7978.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	8.185	0.794717	0.16327	.	.	ENSG00000134827	ENST00000257264	T	0.36157	1.27	4.54	-2.35	0.06684	.	0.787698	0.11134	N	0.595985	T	0.14570	0.0352	N	0.16478	0.41	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.32903	-0.9889	10	0.05436	T	0.98	.	4.3538	0.11169	0.2936:0.36:0.0:0.3464	.	54	P20061	TCO1_HUMAN	T	54	ENSP00000257264:A54T	ENSP00000257264:A54T	A	-	1	0	TCN1	59388055	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.968000	0.03817	-0.651000	0.05415	-1.966000	0.00469	GCT		0.418	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062		45	150	0	0	0	0	45	150				
CPSF7	79869	broad.mit.edu	37	11	61188974	61188974	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:61188974G>C	ENST00000394888.4	-	3	333	c.161C>G	c.(160-162)cCt>cGt	p.P54R	CPSF7_ENST00000448745.1_Missense_Mutation_p.P54R|CPSF7_ENST00000541963.1_Missense_Mutation_p.P54R|CPSF7_ENST00000340437.4_Missense_Mutation_p.P97R|CPSF7_ENST00000439958.3_Missense_Mutation_p.P54R	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	54	Poly-Pro.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						CTGGCGAACAGGAGGAGGTGG	0.522																																						uc001nrq.2		NA																	0				central_nervous_system(1)	1						c.(160-162)CCT>CGT		pre-mRNA cleavage factor I, 59 kDa subunit							221.0	189.0	200.0					11																	61188974		2202	4299	6501	SO:0001583	missense	79869				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding	g.chr11:61188974G>C		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.161C>G	11.37:g.61188974G>C	ENSP00000378352:p.Pro54Arg		Somatic				CPSF7_uc001nro.2_Missense_Mutation_p.P54R|CPSF7_uc001nrp.2_Missense_Mutation_p.P97R|CPSF7_uc001nrr.2_Missense_Mutation_p.P54R|CPSF7_uc001nrs.1_5'UTR|CPSF7_uc009ynp.2_Missense_Mutation_p.P54R	p.P54R	NM_001136040	NP_001129512	WXS	Illumina HiSeq	Unspecified	Q8N684	CPSF7_HUMAN			3	295	-			54			Poly-Pro.		B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	ENST00000394888.4	37	c.161C>G	CCDS44619.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844738	0.32606	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000477890;ENST00000539952;ENST00000544585;ENST00000413232;ENST00000541963;ENST00000450000;ENST00000449811;ENST00000413184	T;T;T	0.40756	1.02;1.02;1.02	5.68	4.77	0.60923	Nucleotide-binding, alpha-beta plait (1);	0.415041	0.26331	N	0.024982	T	0.35451	0.0932	L	0.50333	1.59	0.38813	D	0.95545	P;B;B;B	0.48016	0.904;0.148;0.343;0.235	B;B;B;B	0.42625	0.393;0.018;0.112;0.101	T	0.18777	-1.0326	10	0.19590	T	0.45	.	9.2385	0.37481	0.0756:0.0:0.744:0.1804	.	54;54;97;54	F5H1W4;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	R	97;54;54;54;54;54;54;54;54;54;54;54	ENSP00000391359:P54R;ENSP00000392400:P54R;ENSP00000414295:P54R	ENSP00000345412:P97R	P	-	2	0	CPSF7	60945550	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.498000	0.66931	1.397000	0.46682	0.650000	0.86243	CCT		0.522	CPSF7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347835.2	NM_024811		19	79	0	0	0	0	19	79				
VEGFB	7423	broad.mit.edu	37	11	64005048	64005048	+	Silent	SNP	A	A	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:64005048A>C	ENST00000309422.2	+	6	863	c.567A>C	c.(565-567)ggA>ggC	p.G189G	VEGFB_ENST00000426086.2_Missense_Mutation_p.T156P	NM_001243733.1|NM_003377.4	NP_001230662.1|NP_003368.1	P49765	VEGFB_HUMAN	vascular endothelial growth factor B	189					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|coronary vasculature development (GO:0060976)|induction of positive chemotaxis (GO:0050930)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular wound healing (GO:0035470)|protein O-linked glycosylation (GO:0006493)|response to drug (GO:0042493)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|heparin binding (GO:0008201)|vascular endothelial growth factor receptor 1 binding (GO:0043183)			endometrium(2)|large_intestine(2)|prostate(1)|stomach(1)	6					Aflibercept(DB08885)	TGACCCCCGGACCTGCCGCTG	0.711																																						uc001nyw.2		NA																	0					0						c.(565-567)GGA>GGC		vascular endothelial growth factor B precursor							7.0	8.0	8.0					11																	64005048		2097	4151	6248	SO:0001819	synonymous_variant	7423				anti-apoptosis|induction of positive chemotaxis|negative regulation of gene expression|negative regulation of neuron apoptosis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of endothelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of mast cell chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of vascular endothelial growth factor receptor signaling pathway|positive regulation of vascular wound healing|vascular endothelial growth factor receptor signaling pathway	extracellular region|extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|heparin binding|vascular endothelial growth factor receptor 1 binding	g.chr11:64005048A>C	BC008818	CCDS8062.1, CCDS58144.1	11q13	2005-09-29				ENSG00000173511			12681	protein-coding gene	gene with protein product		601398		VRF		8637916, 8919691	Standard	NM_001243733		Approved	VEGFL	uc001nyw.3	P49765		ENST00000309422.2:c.567A>C	11.37:g.64005048A>C			Somatic				VEGFB_uc001nyx.2_Missense_Mutation_p.T156P	p.G189G	NM_003377	NP_003368	WXS	Illumina HiSeq	Unspecified	P49765	VEGFB_HUMAN			6	607	+			189					Q16528	Silent	SNP	ENST00000309422.2	37	c.567A>C	CCDS8062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.54|15.54	2.863730|2.863730	0.51482|0.51482	.|.	.|.	ENSG00000173511|ENSG00000173511	ENST00000541681|ENST00000426086	.|.	.|.	.|.	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	.|.	.|.	.|.	.|.	T|T	0.58666|0.58666	0.2138|0.2138	.|.	.|.	.|.	0.19775|0.19775	N|N	0.99995|0.99995	.|D	.|0.71674	.|0.998	.|D	.|0.68943	.|0.961	T|T	0.51718|0.51718	-0.8670|-0.8670	4|7	.|0.87932	.|D	.|0	-0.3664|-0.3664	8.2815|8.2815	0.31902|0.31902	0.8235:0.0:0.0:0.1765|0.8235:0.0:0.0:0.1765	.|.	.|156	.|P49765-2	.|.	A|P	14|156	.|.	.|ENSP00000401550:T156P	D|T	+|+	2|1	0|0	VEGFB|VEGFB	63761624|63761624	0.973000|0.973000	0.33851|0.33851	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	1.485000|1.485000	0.35519|0.35519	1.973000|1.973000	0.57446|0.57446	0.459000|0.459000	0.35465|0.35465	GAC|ACC		0.711	VEGFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396393.2	NM_003377		5	6	0	0	0	0	5	6				
PYGM	5837	broad.mit.edu	37	11	64525340	64525340	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:64525340C>G	ENST00000164139.3	-	5	969	c.571G>C	c.(571-573)Gag>Cag	p.E191Q	PYGM_ENST00000377432.3_Missense_Mutation_p.E103Q	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	191					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGGGCCTTCTCCCAGGGGTTG	0.607																																						uc001oax.3		NA																	0				ovary(2)	2						c.(571-573)GAG>CAG		muscle glycogen phosphorylase isoform 1	Pyridoxal Phosphate(DB00114)						72.0	63.0	66.0					11																	64525340		2201	4297	6498	SO:0001583	missense	5837				glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding	g.chr11:64525340C>G		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.571G>C	11.37:g.64525340C>G	ENSP00000164139:p.Glu191Gln		Somatic				PYGM_uc001oay.3_Missense_Mutation_p.E103Q	p.E191Q	NM_005609	NP_005600	WXS	Illumina HiSeq	Unspecified	P11217	PYGM_HUMAN			5	1388	-			191					A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	c.571G>C	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	C	34	5.385695	0.95967	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.94376	-3.41;-3.41	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000011	D	0.97228	0.9094	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.97718	1.0195	10	0.87932	D	0	-39.374	17.3277	0.87253	0.0:1.0:0.0:0.0	.	103;191	A6NDY6;P11217	.;PYGM_HUMAN	Q	103;191;172	ENSP00000366650:E103Q;ENSP00000164139:E191Q	ENSP00000164139:E191Q	E	-	1	0	PYGM	64281916	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.700000	0.92200	0.563000	0.77884	GAG		0.607	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609		18	25	0	0	0	0	18	25				
SPTBN2	6712	broad.mit.edu	37	11	66488701	66488701	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:66488701G>A	ENST00000533211.1	-	3	342	c.11C>T	c.(10-12)aCg>aTg	p.T4M	SPTBN2_ENST00000309996.2_Missense_Mutation_p.T4M|SPTBN2_ENST00000529997.1_Missense_Mutation_p.T4M			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	4	Actin-binding.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GGGTGACAGCGTGCTGCTCAT	0.602																																						uc001ojd.2		NA																	0				large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(10-12)ACG>ATG		spectrin, beta, non-erythrocytic 2							195.0	154.0	168.0					11																	66488701		2200	4295	6495	SO:0001583	missense	6712				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton	g.chr11:66488701G>A	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.11C>T	11.37:g.66488701G>A	ENSP00000432568:p.Thr4Met		Somatic					p.T4M	NM_006946	NP_008877	WXS	Illumina HiSeq	Unspecified	O15020	SPTN2_HUMAN			2	83	-			4			Actin-binding.		O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	c.11C>T	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088683	0.76756	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262;ENST00000527010	T;T;T;T	0.77620	-0.57;-0.57;-0.59;-1.11	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	N	0.00347	-1.61	0.48185	D	0.999601	P	0.42078	0.77	B	0.24394	0.053	T	0.56860	-0.7909	10	0.22109	T	0.4	.	14.6826	0.69028	0.0:0.0:1.0:0.0	.	4	O15020	SPTN2_HUMAN	M	4	ENSP00000432568:T4M;ENSP00000311489:T4M;ENSP00000433593:T4M;ENSP00000433631:T4M	ENSP00000311489:T4M	T	-	2	0	SPTBN2	66245277	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.286000	0.58995	2.278000	0.76064	0.561000	0.74099	ACG		0.602	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946		20	125	0	0	0	0	20	125				
SSH3	54961	broad.mit.edu	37	11	67077772	67077772	+	Nonsense_Mutation	SNP	G	G	T	rs148598265		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:67077772G>T	ENST00000308127.4	+	13	1823	c.1645G>T	c.(1645-1647)Gag>Tag	p.E549*	SSH3_ENST00000308298.7_Intron|SSH3_ENST00000376757.5_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	549					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GCCCTCCTTGGAGCTGGAGAG	0.632																																						uc001okj.2		NA																	0				ovary(1)	1						c.(1645-1647)GAG>TAG		slingshot homolog 3							54.0	59.0	57.0					11																	67077772		2200	4295	6495	SO:0001587	stop_gained	54961				regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton|nucleus	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr11:67077772G>T	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.1645G>T	11.37:g.67077772G>T	ENSP00000312081:p.Glu549*		Somatic				SSH3_uc001okk.2_RNA|SSH3_uc001okl.2_Nonsense_Mutation_p.E403*	p.E549*	NM_017857	NP_060327	WXS	Illumina HiSeq	Unspecified	Q8TE77	SSH3_HUMAN	BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		13	1823	+			549					Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Nonsense_Mutation	SNP	ENST00000308127.4	37	c.1645G>T	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	G	37	6.506505	0.97620	.	.	ENSG00000172830	ENST00000308127	.	.	.	3.93	3.93	0.45458	.	0.474047	0.15329	N	0.268121	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-23.2918	11.677	0.51436	0.0:0.0:1.0:0.0	.	.	.	.	X	549	.	ENSP00000312081:E549X	E	+	1	0	SSH3	66834348	0.671000	0.27521	0.626000	0.29213	0.709000	0.40893	4.538000	0.60650	2.225000	0.72522	0.555000	0.69702	GAG		0.632	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276		13	188	1	0	4.38e-07	4.87e-07	13	188				
PITPNM1	9600	broad.mit.edu	37	11	67267280	67267280	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:67267280T>C	ENST00000534749.1	-	7	1273	c.1085A>G	c.(1084-1086)gAg>gGg	p.E362G	PITPNM1_ENST00000436757.2_Missense_Mutation_p.E362G|PITPNM1_ENST00000356404.3_Missense_Mutation_p.E362G			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	362					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GGGGAAGACCTCCTCACTGTC	0.592																																					GBM(28;144 709 4607 5525)	uc001olx.2		NA																	0				lung(2)|central_nervous_system(1)	3						c.(1084-1086)GAG>GGG		phosphatidylinositol transfer protein,							104.0	99.0	101.0					11																	67267280		2196	4286	6482	SO:0001583	missense	9600				brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity	g.chr11:67267280T>C	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1085A>G	11.37:g.67267280T>C	ENSP00000437286:p.Glu362Gly		Somatic				PITPNM1_uc001olw.2_5'Flank|PITPNM1_uc001oly.2_Missense_Mutation_p.E362G|PITPNM1_uc001olz.2_Missense_Mutation_p.E362G	p.E362G	NM_004910	NP_004901	WXS	Illumina HiSeq	Unspecified	O00562	PITM1_HUMAN			7	1274	-			362					A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	c.1085A>G	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	t	16.34	3.096695	0.56075	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.48836	0.8;0.8;0.8	3.8	3.8	0.43715	.	0.000000	0.56097	D	0.000037	T	0.55673	0.1935	L	0.49126	1.545	0.47819	D	0.999529	P;P	0.48640	0.913;0.859	P;P	0.57548	0.823;0.67	T	0.55016	-0.8206	10	0.41790	T	0.15	-29.5997	12.4015	0.55416	0.0:0.0:0.0:1.0	.	362;362	O00562-2;O00562	.;PITM1_HUMAN	G	362	ENSP00000437286:E362G;ENSP00000398787:E362G;ENSP00000348772:E362G	ENSP00000348772:E362G	E	-	2	0	PITPNM1	67023856	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.681000	0.84073	1.960000	0.56953	0.524000	0.50904	GAG		0.592	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910		10	121	0	0	0	0	10	121				
TCIRG1	10312	broad.mit.edu	37	11	67816564	67816564	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:67816564C>T	ENST00000265686.3	+	15	1798	c.1690C>T	c.(1690-1692)Cac>Tac	p.H564Y	RP11-802E16.3_ENST00000526897.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000532635.1_Missense_Mutation_p.H348Y	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	564					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TGGCCAGAGGCACCGGCTGCT	0.657																																						uc001one.2		NA																	0				ovary(1)	1						c.(1690-1692)CAC>TAC		T-cell, immune regulator 1 isoform a							82.0	82.0	82.0					11																	67816564		2200	4294	6494	SO:0001583	missense	10312				ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity	g.chr11:67816564C>T	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1690C>T	11.37:g.67816564C>T	ENSP00000265686:p.His564Tyr		Somatic				TCIRG1_uc001ong.2_Missense_Mutation_p.H348Y|TCIRG1_uc001onh.2_Missense_Mutation_p.H266Y|TCIRG1_uc001oni.2_Missense_Mutation_p.H68Y|TCIRG1_uc009ysd.2_5'Flank	p.H564Y	NM_006019	NP_006010	WXS	Illumina HiSeq	Unspecified	Q13488	VPP3_HUMAN			15	1798	+			564			Cytoplasmic (Potential).		O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	c.1690C>T	CCDS8177.1	.	.	.	.	.	.	.	.	.	.	C	8.053	0.766324	0.15983	.	.	ENSG00000110719	ENST00000265686;ENST00000532635	D;D	0.85702	-2.02;-2.02	4.32	2.46	0.29980	.	0.273076	0.41823	N	0.000807	T	0.67306	0.2879	N	0.05031	-0.125	0.29530	N	0.852882	B	0.09022	0.002	B	0.15484	0.013	T	0.58370	-0.7648	10	0.31617	T	0.26	-25.8434	9.2036	0.37275	0.0:0.8196:0.0:0.1804	.	564	Q13488	VPP3_HUMAN	Y	564;348	ENSP00000265686:H564Y;ENSP00000434407:H348Y	ENSP00000265686:H564Y	H	+	1	0	TCIRG1	67573140	0.660000	0.27420	0.681000	0.30009	0.991000	0.79684	1.283000	0.33237	0.476000	0.27440	0.555000	0.69702	CAC		0.657	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019		23	238	0	0	0	0	23	238				
NCAPD3	23310	broad.mit.edu	37	11	134072795	134072795	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr11:134072795A>G	ENST00000534548.2	-	13	1595	c.1531T>C	c.(1531-1533)Tcc>Ccc	p.S511P		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	511					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTTTGGTAGGAAAAAGCTTTA	0.348																																						uc001qhd.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5						c.(1531-1533)TCC>CCC		non-SMC condensin II complex, subunit D3							102.0	98.0	99.0					11																	134072795		2201	4297	6498	SO:0001583	missense	23310				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding	g.chr11:134072795A>G	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1531T>C	11.37:g.134072795A>G	ENSP00000433681:p.Ser511Pro		Somatic				NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	p.S511P	NM_015261	NP_056076	WXS	Illumina HiSeq	Unspecified	P42695	CNDD3_HUMAN		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)	13	2137	-	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	511					A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	c.1531T>C	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	A	9.775	1.173722	0.21704	.	.	ENSG00000151503	ENST00000534548	T	0.62941	-0.01	4.78	2.4	0.29515	Armadillo-type fold (1);	0.816905	0.11540	N	0.553859	T	0.46698	0.1406	L	0.33485	1.01	0.38862	D	0.956512	B	0.06786	0.001	B	0.06405	0.002	T	0.37291	-0.9712	10	0.46703	T	0.11	0.5553	4.2398	0.10642	0.7258:0.0:0.0977:0.1765	.	511	P42695	CNDD3_HUMAN	P	511	ENSP00000433681:S511P	ENSP00000431612:S511P	S	-	1	0	NCAPD3	133578005	1.000000	0.71417	0.087000	0.20705	0.009000	0.06853	1.256000	0.32921	0.263000	0.21812	0.528000	0.53228	TCC		0.348	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261		16	16	0	0	0	0	16	16				
GDF3	9573	broad.mit.edu	37	12	7842822	7842822	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:7842822C>G	ENST00000329913.3	-	2	794	c.747G>C	c.(745-747)agG>agC	p.R249S		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	249					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TGGCTGCTCTCCTTTTCCGAG	0.537																																						uc001qte.2		NA																	0				skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						c.(745-747)AGG>AGC		growth differentiation factor 3 precursor							97.0	88.0	91.0					12																	7842822		2203	4300	6503	SO:0001583	missense	9573				eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity	g.chr12:7842822C>G	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.747G>C	12.37:g.7842822C>G	ENSP00000331745:p.Arg249Ser		Somatic					p.R249S	NM_020634	NP_065685	WXS	Illumina HiSeq	Unspecified	Q9NR23	GDF3_HUMAN			2	783	-			249					Q8NEJ4	Missense_Mutation	SNP	ENST00000329913.3	37	c.747G>C	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	C	9.769	1.172264	0.21704	.	.	ENSG00000184344	ENST00000329913	D	0.85013	-1.93	4.61	2.72	0.32119	Transforming growth factor-beta, C-terminal (1);	0.240498	0.47852	N	0.000210	D	0.89687	0.6787	M	0.82433	2.59	0.44927	D	0.997947	D	0.62365	0.991	P	0.61800	0.894	D	0.88060	0.2793	10	0.46703	T	0.11	.	7.5534	0.27810	0.0:0.7337:0.1714:0.0949	.	249	Q9NR23	GDF3_HUMAN	S	249	ENSP00000331745:R249S	ENSP00000331745:R249S	R	-	3	2	GDF3	7734089	0.927000	0.31430	0.994000	0.49952	0.123000	0.20343	1.805000	0.38883	1.044000	0.40200	0.561000	0.74099	AGG		0.537	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1			20	59	0	0	0	0	20	59				
SLC2A14	144195	broad.mit.edu	37	12	7980270	7980270	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:7980270G>A	ENST00000543909.1	-	12	1513	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W	SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000431042.2_Missense_Mutation_p.R229W|SLC2A14_ENST00000535295.1_Missense_Mutation_p.R143W|SLC2A14_ENST00000542546.1_Missense_Mutation_p.R143W|SLC2A14_ENST00000396589.2_Missense_Mutation_p.R252W|SLC2A14_ENST00000539924.1_Missense_Mutation_p.R267W|SLC2A14_ENST00000340749.5_Missense_Mutation_p.R229W			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	252					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CCCCACAACCGCTGGAGGACT	0.507																																						uc001qtk.2		NA																	0				ovary(1)	1						c.(754-756)CGG>TGG		glucose transporter 14							18.0	21.0	20.0					12																	7980270		2189	4280	6469	SO:0001583	missense	144195				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity	g.chr12:7980270G>A	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.754C>T	12.37:g.7980270G>A	ENSP00000440480:p.Arg252Trp		Somatic				SLC2A14_uc001qtl.2_Missense_Mutation_p.R229W|SLC2A14_uc001qtm.2_Missense_Mutation_p.R229W|SLC2A14_uc010sgg.1_Missense_Mutation_p.R143W|SLC2A14_uc001qtn.2_Missense_Mutation_p.R252W|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Missense_Mutation_p.R267W	p.R252W	NM_153449	NP_703150	WXS	Illumina HiSeq	Unspecified	Q8TDB8	GTR14_HUMAN		Kidney(36;0.0883)	12	1547	-			252			Cytoplasmic (Potential).		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	c.754C>T	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	G	3.603	-0.081240	0.07141	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	3.58	-2.18	0.07037	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.530384	0.19316	N	0.117273	T	0.61751	0.2372	L	0.46885	1.475	0.09310	N	0.999991	B;B;B;B	0.33266	0.205;0.072;0.012;0.404	B;B;B;B	0.33196	0.11;0.077;0.013;0.159	T	0.50311	-0.8843	10	0.33141	T	0.24	.	2.7326	0.05231	0.1043:0.1253:0.3822:0.3882	.	267;143;229;252	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	W	229;252;229;252;143;143;267	ENSP00000340450:R229W;ENSP00000440480:R252W;ENSP00000407287:R229W;ENSP00000379834:R252W;ENSP00000440492:R143W;ENSP00000443903:R143W;ENSP00000445929:R267W	ENSP00000340450:R229W	R	-	1	2	SLC2A14	7871537	0.039000	0.19947	0.082000	0.20525	0.784000	0.44337	0.340000	0.19892	-0.252000	0.09528	-0.916000	0.02749	CGG		0.507	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		7	46	0	0	0	0	7	46				
SLC2A3	6515	broad.mit.edu	37	12	8082459	8082459	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:8082459G>A	ENST00000075120.7	-	6	922	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	228					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		CCCCACAACCGCTGGAGGACT	0.498																																					Colon(96;424 1461 14416 20933 23688)	uc001qtr.2		NA																	0				ovary(3)|pancreas(1)	4						c.(682-684)CGG>TGG		solute carrier family 2 (facilitated glucose							89.0	89.0	89.0					12																	8082459		2203	4300	6503	SO:0001583	missense	6515				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity	g.chr12:8082459G>A	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.682C>T	12.37:g.8082459G>A	ENSP00000075120:p.Arg228Trp		Somatic				SLC2A3_uc001qts.2_3'UTR	p.R228W	NM_006931	NP_008862	WXS	Illumina HiSeq	Unspecified	P11169	GTR3_HUMAN		Kidney(36;0.0866)	6	944	-			228			Cytoplasmic (Potential).		B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	c.682C>T	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014143	0.19277	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	T	0.76448	-1.02	4.34	-1.51	0.08664	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.432149	0.23492	N	0.047591	T	0.64349	0.2590	L	0.40543	1.245	0.42564	D	0.993155	B	0.23128	0.08	B	0.27170	0.077	T	0.49908	-0.8889	10	0.35671	T	0.21	.	7.7012	0.28623	0.0892:0.0:0.2567:0.6542	.	228	P11169	GTR3_HUMAN	W	228;154	ENSP00000075120:R228W	ENSP00000075120:R228W	R	-	1	2	SLC2A3	7973726	0.042000	0.20092	0.015000	0.15790	0.885000	0.51271	1.144000	0.31565	-0.070000	0.12908	0.407000	0.27541	CGG		0.498	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931		12	89	0	0	0	0	12	89				
TAS2R20	259295	broad.mit.edu	37	12	11150362	11150362	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:11150362C>T	ENST00000538986.1	-	1	112	c.113G>A	c.(112-114)aGa>aAa	p.R38K	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	38					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						GATCTTTTGTCTCTTGACCCA	0.378																																						uc001qzm.2		NA																	0					0						c.(112-114)AGA>AAA		taste receptor, type 2, member 20							41.0	46.0	44.0					12																	11150362		2203	4300	6503	SO:0001583	missense	259295				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11150362C>T	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.113G>A	12.37:g.11150362C>T	ENSP00000441624:p.Arg38Lys		Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.R38K	NM_176889	NP_795370	WXS	Illumina HiSeq	Unspecified	P59543	T2R20_HUMAN			1	113	-			38			Cytoplasmic (Potential).		P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	37	c.113G>A	CCDS8639.1	.	.	.	.	.	.	.	.	.	.	C	1.313	-0.601536	0.03744	.	.	ENSG00000255837	ENST00000538986	T	0.36520	1.25	2.77	0.615	0.17608	.	0.161017	0.38436	N	0.001685	T	0.22322	0.0538	L	0.35414	1.06	0.09310	N	0.999992	B	0.29531	0.247	B	0.33960	0.173	T	0.14254	-1.0479	10	0.19590	T	0.45	.	5.4381	0.16492	0.0:0.6554:0.2082:0.1364	.	38	P59543	T2R20_HUMAN	K	38	ENSP00000441624:R38K	ENSP00000441624:R38K	R	-	2	0	TAS2R20	11041629	0.001000	0.12720	0.058000	0.19502	0.002000	0.02628	-0.322000	0.08007	0.505000	0.28104	-0.218000	0.12543	AGA		0.378	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889		23	46	0	0	0	0	23	46				
TAS2R31	259290	broad.mit.edu	37	12	11183044	11183044	+	Silent	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:11183044C>G	ENST00000390675.2	-	1	962	c.891G>C	c.(889-891)gtG>gtC	p.V297V	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	297					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						CCCAGTACCTCACTTGCCGCA	0.428																																						uc001qzo.1		NA																	0					0						c.(889-891)GTG>GTC		taste receptor, type 2, member 31							201.0	203.0	202.0					12																	11183044		1969	4186	6155	SO:0001819	synonymous_variant	259290				sensory perception of taste	integral to membrane	G-protein coupled receptor activity	g.chr12:11183044C>G	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.891G>C	12.37:g.11183044C>G			Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.V297V	NM_176885	NP_795366	WXS	Illumina HiSeq	Unspecified	P59538	T2R31_HUMAN			1	963	-			297			Cytoplasmic (Potential).		P59547|Q17R84|Q645X5	Silent	SNP	ENST00000390675.2	37	c.891G>C	CCDS53747.1																																																																																				0.428	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885		48	182	0	0	0	0	48	182				
CAPZA3	93661	broad.mit.edu	37	12	18889205	18889205	+	5'Flank	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:18889205C>G	ENST00000317658.3	+	0	0				PLCZ1_ENST00000447925.2_Missense_Mutation_p.E27Q|PLCZ1_ENST00000435379.1_Missense_Mutation_p.E27Q|PLCZ1_ENST00000266505.7_Missense_Mutation_p.E29Q|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_Missense_Mutation_p.E29Q	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				TCTAATTTTTCAAGTAACCTC	0.353																																						uc010sid.1		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(85-87)GAA>CAA		phospholipase C, zeta 1							88.0	89.0	89.0					12																	18889205		2203	4300	6503	SO:0001631	upstream_gene_variant	89869				intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr12:18889205C>G	AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001		12.37:g.18889205C>G	Exception_encountered		Somatic				PLCZ1_uc001rdv.3_5'UTR|PLCZ1_uc001rdw.3_5'UTR|CAPZA3_uc001rdy.2_5'Flank	p.E29Q	NM_033123	NP_149114	WXS	Illumina HiSeq	Unspecified	Q86YW0	PLCZ1_HUMAN			3	276	-	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)		29					Q969J0	Missense_Mutation	SNP	ENST00000317658.3	37	c.85G>C	CCDS8681.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.280413	0.59758	.	.	ENSG00000139151	ENST00000266505;ENST00000447925;ENST00000435379;ENST00000539875;ENST00000539072	T;T;T;T;T	0.43294	0.95;0.95;1.74;1.73;0.95	5.5	5.5	0.81552	EF-hand-like domain (1);	0.095817	0.45606	D	0.000350	T	0.55593	0.1930	L	0.61218	1.895	0.80722	D	1	D	0.63880	0.993	P	0.56343	0.796	T	0.51108	-0.8747	10	0.33940	T	0.23	.	16.1156	0.81304	0.0:1.0:0.0:0.0	.	29	Q86YW0	PLCZ1_HUMAN	Q	29;27;27;29;49	ENSP00000266505:E29Q;ENSP00000402358:E27Q;ENSP00000400504:E27Q;ENSP00000445026:E29Q;ENSP00000438629:E49Q	ENSP00000266505:E29Q	E	-	1	0	PLCZ1	18780472	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	0.780000	0.26760	2.591000	0.87537	0.313000	0.20887	GAA		0.353	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	NM_033328		8	26	0	0	0	0	8	26				
SENP1	29843	broad.mit.edu	37	12	48477537	48477537	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:48477537G>C	ENST00000004980.5	-	6	867	c.389C>G	c.(388-390)tCa>tGa	p.S130*	RNU6-1203P_ENST00000410703.1_RNA|SENP1_ENST00000547886.1_5'UTR|SENP1_ENST00000549595.1_Nonsense_Mutation_p.S130*|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000549518.1_Nonsense_Mutation_p.S130*|SENP1_ENST00000551330.1_Nonsense_Mutation_p.S130*|SENP1_ENST00000448372.1_Nonsense_Mutation_p.S130*			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	130	Ser-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				AAAACTGTTTGATAATCCACT	0.313																																						uc001rqx.2		NA																	0				pancreas(2)|lung(1)	3						c.(388-390)TCA>TGA		sentrin/SUMO-specific protease 1							86.0	82.0	83.0					12																	48477537		1820	4081	5901	SO:0001587	stop_gained	29843				activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity	g.chr12:48477537G>C	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.389C>G	12.37:g.48477537G>C	ENSP00000004980:p.Ser130*		Somatic				SENP1_uc001rqw.2_Nonsense_Mutation_p.S130*|SENP1_uc001rqy.2_Translation_Start_Site|SENP1_uc001rqz.2_Translation_Start_Site|SENP1_uc009zkx.2_Nonsense_Mutation_p.S130*	p.S130*	NM_014554	NP_055369	WXS	Illumina HiSeq	Unspecified	Q9P0U3	SENP1_HUMAN			6	835	-		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)	130			Ser-rich.		A8K7P5|Q86XC8	Nonsense_Mutation	SNP	ENST00000004980.5	37	c.389C>G	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157197	0.38119	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518;ENST00000551798	.	.	.	4.67	3.78	0.43462	.	0.244492	0.28748	N	0.014275	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.3998	9.2683	0.37654	0.1661:0.0:0.8339:0.0	.	.	.	.	X	130;130;130;130;130;123	.	ENSP00000004980:S130X	S	-	2	0	SENP1	46763804	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	3.291000	0.51764	1.354000	0.45846	-0.136000	0.14681	TCA		0.313	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554		10	37	0	0	0	0	10	37				
PPP1R1A	5502	broad.mit.edu	37	12	54975892	54975892	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:54975892G>A	ENST00000257905.8	-	5	441	c.271C>T	c.(271-273)Cac>Tac	p.H91Y	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	91					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						TGCCCCAGGTGATGTTCAACC	0.592																																						uc001sgg.2		NA																	0					0						c.(271-273)CAC>TAC		protein phosphatase 1, regulatory (inhibitor)							37.0	40.0	39.0					12																	54975892		1924	4135	6059	SO:0001583	missense	5502				glycogen metabolic process|signal transduction		protein binding|protein serine/threonine phosphatase inhibitor activity	g.chr12:54975892G>A	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.271C>T	12.37:g.54975892G>A	ENSP00000257905:p.His91Tyr		Somatic					p.H91Y	NM_006741	NP_006732	WXS	Illumina HiSeq	Unspecified	Q13522	PPR1A_HUMAN			5	442	-			91					Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	ENST00000257905.8	37	c.271C>T	CCDS44912.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343559	0.82022	.	.	ENSG00000135447	ENST00000257905	T	0.59502	0.26	5.54	5.54	0.83059	.	0.067262	0.64402	D	0.000014	T	0.72716	0.3495	M	0.68317	2.08	0.42513	D	0.992971	D	0.61080	0.989	D	0.64595	0.927	T	0.75218	-0.3395	10	0.87932	D	0	.	15.3582	0.74443	0.0:0.0:1.0:0.0	.	91	Q13522	PPR1A_HUMAN	Y	91	ENSP00000257905:H91Y	ENSP00000257905:H91Y	H	-	1	0	PPP1R1A	53262159	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.623000	0.67757	2.778000	0.95560	0.655000	0.94253	CAC		0.592	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406604.1	NM_006741		12	27	0	0	0	0	12	27				
LRP1	4035	broad.mit.edu	37	12	57538855	57538855	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:57538855G>A	ENST00000243077.3	+	5	1015	c.549G>A	c.(547-549)ccG>ccA	p.P183P	RP11-545N8.3_ENST00000554476.1_RNA|LRP1_ENST00000338962.4_Silent_p.P183P|RP11-545N8.3_ENST00000555461.1_RNA|LRP1_ENST00000553277.1_Silent_p.P183P|LRP1_ENST00000554174.1_Silent_p.P183P	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	183	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCCTGCAGCCGGATAACCGCT	0.572																																						uc001snd.2		NA																	0				ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22						c.(547-549)CCG>CCA		low density lipoprotein-related protein 1	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						63.0	54.0	57.0					12																	57538855		2203	4300	6503	SO:0001819	synonymous_variant	4035				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity	g.chr12:57538855G>A	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.549G>A	12.37:g.57538855G>A			Somatic				LRP1_uc010sre.1_Silent_p.P183P|LRP1_uc001snb.2_Silent_p.P183P|LRP1_uc001snc.1_Silent_p.P183P	p.P183P	NM_002332	NP_002323	WXS	Illumina HiSeq	Unspecified	Q07954	LRP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0103)	5	1015	+			183			EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).		Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	c.549G>A	CCDS8932.1																																																																																				0.572	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		17	31	0	0	0	0	17	31				
GRIP1	23426	broad.mit.edu	37	12	66990676	66990676	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:66990676C>T	ENST00000398016.3	-	2	155	c.87G>A	c.(85-87)caG>caA	p.Q29Q	GRIP1_ENST00000286445.7_Silent_p.Q29Q|GRIP1_ENST00000359742.4_Silent_p.Q29Q	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GCGGCTTTGTCTGGCTGGCGG	0.448																																						uc001stk.2		NA																	0				ovary(2)	2						c.(85-87)CAG>CAA		glutamate receptor interacting protein 1							106.0	110.0	108.0					12																	66990676		1901	4121	6022	SO:0001819	synonymous_variant	23426				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity	g.chr12:66990676C>T	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.87G>A	12.37:g.66990676C>T			Somatic				GRIP1_uc010sta.1_Intron|GRIP1_uc001stm.2_Silent_p.Q29Q	p.Q29Q	NM_021150	NP_066973	WXS	Illumina HiSeq	Unspecified	Q9Y3R0	GRIP1_HUMAN	GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)	2	328	-			29					B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	ENST00000398016.3	37	c.87G>A	CCDS41807.1																																																																																				0.448	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2			19	62	0	0	0	0	19	62				
TMCC3	57458	broad.mit.edu	37	12	94975422	94975422	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:94975422T>A	ENST00000261226.4	-	2	1102	c.971A>T	c.(970-972)cAg>cTg	p.Q324L	TMCC3_ENST00000551457.1_Missense_Mutation_p.Q293L	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	324						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						TTGCAGGGTCTGAGAAATAAA	0.353																																						uc001tdj.2		NA																	0				ovary(1)|skin(1)	2						c.(970-972)CAG>CTG		transmembrane and coiled-coil domain family 3							57.0	57.0	57.0					12																	94975422		2203	4300	6503	SO:0001583	missense	57458					integral to membrane		g.chr12:94975422T>A	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.971A>T	12.37:g.94975422T>A	ENSP00000261226:p.Gln324Leu		Somatic				TMCC3_uc001tdi.2_Missense_Mutation_p.Q293L	p.Q324L	NM_020698	NP_065749	WXS	Illumina HiSeq	Unspecified	Q9ULS5	TMCC3_HUMAN			2	1089	-			324			Potential.		Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	37	c.971A>T	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894734	0.72639	.	.	ENSG00000057704	ENST00000261226;ENST00000551457	T;T	0.48201	0.82;0.82	5.93	5.93	0.95920	.	0.048468	0.85682	D	0.000000	T	0.67202	0.2868	M	0.76574	2.34	0.80722	D	1	D	0.63880	0.993	D	0.63381	0.914	T	0.68973	-0.5268	10	0.51188	T	0.08	-39.7552	16.3829	0.83481	0.0:0.0:0.0:1.0	.	324	Q9ULS5	TMCC3_HUMAN	L	324;293	ENSP00000261226:Q324L;ENSP00000449888:Q293L	ENSP00000261226:Q324L	Q	-	2	0	TMCC3	93499553	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	6.263000	0.72521	2.271000	0.75665	0.459000	0.35465	CAG		0.353	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698		15	50	0	0	0	0	15	50				
ACACB	32	broad.mit.edu	37	12	109673414	109673414	+	Missense_Mutation	SNP	G	G	C	rs374477026		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:109673414G>C	ENST00000338432.7	+	33	4527	c.4408G>C	c.(4408-4410)Gaa>Caa	p.E1470Q	ACACB_ENST00000377854.5_Missense_Mutation_p.E1400Q|ACACB_ENST00000377848.3_Missense_Mutation_p.E1470Q|ACACB_ENST00000543201.1_Missense_Mutation_p.E136Q			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1470					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TTTGCAGAAAGAATTTCCCAA	0.328																																						uc001tob.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8						c.(4408-4410)GAA>CAA		acetyl-Coenzyme A carboxylase beta	Biotin(DB00121)						137.0	125.0	129.0					12																	109673414		2203	4300	6503	SO:0001583	missense	32				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding	g.chr12:109673414G>C	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4408G>C	12.37:g.109673414G>C	ENSP00000341044:p.Glu1470Gln		Somatic				ACACB_uc001toc.2_Missense_Mutation_p.E1470Q|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.E136Q	p.E1470Q	NM_001093	NP_001084	WXS	Illumina HiSeq	Unspecified	O00763	ACACB_HUMAN			33	4527	+			1470					A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	c.4408G>C	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059777	0.55325	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.09	5.09	0.68999	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	L	0.37561	1.115	0.58432	D	0.999999	D	0.76494	0.999	D	0.75484	0.986	T	0.33979	-0.9847	10	0.06625	T	0.88	.	18.8809	0.92356	0.0:0.0:1.0:0.0	.	1470	O00763	ACACB_HUMAN	Q	1470;1470;1400;701;136	ENSP00000341044:E1470Q;ENSP00000367079:E1470Q;ENSP00000367085:E1400Q;ENSP00000444075:E136Q	ENSP00000341044:E1470Q	E	+	1	0	ACACB	108157797	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.772000	0.98984	2.546000	0.85860	0.609000	0.83330	GAA		0.328	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		12	20	0	0	0	0	12	20				
DTX1	1840	broad.mit.edu	37	12	113496163	113496163	+	Missense_Mutation	SNP	G	G	A	rs200220437		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:113496163G>A	ENST00000257600.3	+	1	669	c.166G>A	c.(166-168)Gct>Act	p.A56T		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	56	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						GAAGGAGGACGCTCGCGGTTC	0.647																																						uc001tuk.1		NA																	0				lung(2)|ovary(1)|central_nervous_system(1)	4						c.(166-168)GCT>ACT		deltex homolog 1							125.0	110.0	115.0					12																	113496163		2203	4300	6503	SO:0001583	missense	1840				negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding	g.chr12:113496163G>A	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.166G>A	12.37:g.113496163G>A	ENSP00000257600:p.Ala56Thr		Somatic					p.A56T	NM_004416	NP_004407	WXS	Illumina HiSeq	Unspecified	Q86Y01	DTX1_HUMAN			1	502	+			56			WWE 1.		O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	c.166G>A	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490500	0.64074	.	.	ENSG00000135144	ENST00000257600	T	0.42131	0.98	3.9	3.9	0.45041	WWE domain (2);WWE domain, subgroup (1);	0.077372	0.50627	U	0.000117	T	0.33352	0.0860	L	0.40543	1.245	0.36731	D	0.881706	P	0.51653	0.947	B	0.40702	0.338	T	0.38222	-0.9671	10	0.23891	T	0.37	-12.5667	14.8783	0.70513	0.0:0.0:1.0:0.0	.	56	Q86Y01	DTX1_HUMAN	T	56	ENSP00000257600:A56T	ENSP00000257600:A56T	A	+	1	0	DTX1	111980546	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.515000	0.45512	2.021000	0.59480	0.555000	0.69702	GCT		0.647	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2			35	89	0	0	0	0	35	89				
MAP1LC3B2	643246	broad.mit.edu	37	12	117013807	117013807	+	Silent	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:117013807C>G	ENST00000556529.1	+	1	152	c.60C>G	c.(58-60)gtC>gtG	p.V20V	MAP1LC3B2_ENST00000306985.4_Silent_p.V20V			A6NCE7	MP3B2_HUMAN	microtubule-associated protein 1 light chain 3 beta 2	20					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|microtubule (GO:0005874)				breast(1)|large_intestine(2)|lung(3)	6						TAGAAGATGTCCGACTTATTC	0.537																																						uc009zwk.1		NA																	0					0						c.(58-60)GTC>GTG		microtubule-associated protein 1 light chain 3							126.0	121.0	123.0					12																	117013807		2203	4300	6503	SO:0001819	synonymous_variant	643246				autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule		g.chr12:117013807C>G		CCDS41841.1	12q24.22	2014-02-12			ENSG00000171471	ENSG00000171471			34390	protein-coding gene	gene with protein product							Standard	NM_001085481		Approved	ATG8G	uc009zwk.1	A6NCE7		ENST00000556529.1:c.60C>G	12.37:g.117013807C>G			Somatic					p.V20V	NM_001085481	NP_001078950	WXS	Illumina HiSeq	Unspecified	A6NCE7	MP3B2_HUMAN			2	214	+			20						Silent	SNP	ENST00000556529.1	37	c.60C>G	CCDS41841.1																																																																																				0.537	MAP1LC3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413900.1	NM_001085481		17	96	0	0	0	0	17	96				
DNAH10	196385	broad.mit.edu	37	12	124333280	124333280	+	Missense_Mutation	SNP	G	G	A	rs368019409		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:124333280G>A	ENST00000409039.3	+	33	5624	c.5599G>A	c.(5599-5601)Gtg>Atg	p.V1867M		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1867	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTCCTAGGCCGTGGGGAAGAT	0.443																																						uc001uft.3		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(5599-5601)GTG>ATG		dynein, axonemal, heavy chain 10		G	MET/VAL	0,4140		0,0,2070	84.0	87.0	86.0		5599	3.9	0.1	12		86	2,8458		0,2,4228	no	missense	DNAH10	NM_207437.3	21	0,2,6298	AA,AG,GG		0.0236,0.0,0.0159	benign	1867/4472	124333280	2,12598	2070	4230	6300	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124333280G>A	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5599G>A	12.37:g.124333280G>A	ENSP00000386770:p.Val1867Met		Somatic					p.V1867M	NM_207437	NP_997320	WXS	Illumina HiSeq	Unspecified	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	33	5624	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		1867			AAA 1 (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.5599G>A	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	0.185	-1.058910	0.01950	0.0	2.36E-4	ENSG00000197653	ENST00000409039	T	0.10005	2.92	5.84	3.92	0.45320	ATPase, AAA+ type, core (1);	0.489978	0.19355	N	0.116292	T	0.02193	0.0068	N	0.00214	-1.84	0.39389	D	0.966384	B	0.32245	0.361	B	0.33890	0.172	T	0.42766	-0.9432	10	0.02654	T	1	.	10.4745	0.44657	0.2295:0.0:0.7705:0.0	.	1867	Q8IVF4	DYH10_HUMAN	M	1867	ENSP00000386770:V1867M	ENSP00000386770:V1867M	V	+	1	0	DNAH10	122899233	0.988000	0.35896	0.072000	0.20136	0.665000	0.39181	2.013000	0.40942	0.713000	0.32060	0.561000	0.74099	GTG		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			4	25	0	0	0	0	4	25				
SACS	26278	broad.mit.edu	37	13	23913048	23913048	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr13:23913048A>C	ENST00000382292.3	-	9	5240	c.4967T>G	c.(4966-4968)gTg>gGg	p.V1656G	SACS_ENST00000402364.1_Missense_Mutation_p.V906G|SACS_ENST00000382298.3_Missense_Mutation_p.V1656G			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1656					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AACTTCACTCACTTTTGCTTC	0.398																																						uc001uon.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(4966-4968)GTG>GGG		sacsin							135.0	126.0	129.0					13																	23913048		2203	4299	6502	SO:0001583	missense	26278				cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding	g.chr13:23913048A>C	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4967T>G	13.37:g.23913048A>C	ENSP00000371729:p.Val1656Gly		Somatic				SACS_uc001uoo.2_Missense_Mutation_p.V1509G|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	p.V1656G	NM_014363	NP_055178	WXS	Illumina HiSeq	Unspecified	Q9NZJ4	SACS_HUMAN		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	10	5556	-		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	1656					O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	c.4967T>G	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	A	0.660	-0.806046	0.02819	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93426	-3.22;-3.22;-3.22	5.84	5.84	0.93424	ATPase-like, ATP-binding domain (1);	0.432547	0.23286	N	0.049843	D	0.87362	0.6158	N	0.17082	0.46	0.47094	D	0.999314	B	0.12013	0.005	B	0.11329	0.006	T	0.82820	-0.0268	10	0.20046	T	0.44	.	16.2302	0.82332	1.0:0.0:0.0:0.0	.	1656	Q9NZJ4	SACS_HUMAN	G	1656;906;1656	ENSP00000371729:V1656G;ENSP00000385844:V906G;ENSP00000371735:V1656G	ENSP00000371729:V1656G	V	-	2	0	SACS	22811048	0.975000	0.34042	1.000000	0.80357	0.031000	0.12232	2.553000	0.45837	2.228000	0.72767	0.533000	0.62120	GTG		0.398	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		16	41	0	0	0	0	16	41				
KL	9365	broad.mit.edu	37	13	33590903	33590903	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr13:33590903C>G	ENST00000380099.3	+	1	333	c.325C>G	c.(325-327)Ctg>Gtg	p.L109V	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_Intron	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	109	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		GAACGCCAGTCTGCCGTTGGG	0.711																																						uc001uus.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(325-327)CTG>GTG		klotho precursor							11.0	14.0	13.0					13																	33590903		2152	4200	6352	SO:0001583	missense	9365				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding	g.chr13:33590903C>G	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.325C>G	13.37:g.33590903C>G	ENSP00000369442:p.Leu109Val		Somatic				KL_uc001uur.1_Intron	p.L109V	NM_004795	NP_004786	WXS	Illumina HiSeq	Unspecified	Q9UEF7	KLOT_HUMAN		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)	1	333	+	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)	109			Glycosyl hydrolase-1 1.|Extracellular (Potential).		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	c.325C>G	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.959393	0.00465	.	.	ENSG00000133116	ENST00000380099	T	0.21734	1.99	4.1	-2.21	0.06973	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	3.655870	0.01239	N	0.008566	T	0.13200	0.0320	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.21484	-1.0244	10	0.11182	T	0.66	2.4939	6.2747	0.20973	0.0:0.4537:0.2382:0.3081	.	109	Q9UEF7	KLOT_HUMAN	V	109	ENSP00000369442:L109V	ENSP00000369442:L109V	L	+	1	2	KL	32488903	0.949000	0.32298	0.000000	0.03702	0.001000	0.01503	0.000000	0.12993	-1.382000	0.02109	-1.943000	0.00494	CTG		0.711	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1			4	23	0	0	0	0	4	23				
FARP1	10160	broad.mit.edu	37	13	99092944	99092944	+	Missense_Mutation	SNP	G	G	A	rs145597966	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr13:99092944G>A	ENST00000319562.6	+	24	2915	c.2650G>A	c.(2650-2652)Gcg>Acg	p.A884T	FARP1_ENST00000376586.2_Missense_Mutation_p.A915T|FARP1_ENST00000595437.1_Missense_Mutation_p.A915T	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	884					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TGAAGCCACCGCGGCTGACCA	0.627													G|||	7	0.00139776	0.0053	0.0	5008	,	,		19065	0.0		0.0	False		,,,				2504	0.0					uc001vnj.2		NA																	0				breast(2)	2						c.(2650-2652)GCG>ACG		FERM, RhoGEF, and pleckstrin domain protein 1		G	THR/ALA	7,4399	12.9+/-30.5	0,7,2196	46.0	46.0	46.0		2650	-1.1	0.0	13	dbSNP_134	46	0,8600		0,0,4300	yes	missense	FARP1	NM_005766.2	58	0,7,6496	AA,AG,GG		0.0,0.1589,0.0538	benign	884/1046	99092944	7,12999	2203	4300	6503	SO:0001583	missense	10160				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr13:99092944G>A	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2650G>A	13.37:g.99092944G>A	ENSP00000322926:p.Ala884Thr		Somatic				FARP1_uc001vnh.2_Missense_Mutation_p.A915T	p.A884T	NM_005766	NP_005757	WXS	Illumina HiSeq	Unspecified	Q9Y4F1	FARP1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.233)		24	2986	+	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		884					Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	c.2650G>A	CCDS9487.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	6.594	0.478021	0.12521	0.001589	0.0	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.11821	2.74;2.74	4.68	-1.09	0.09904	.	1.399260	0.04204	N	0.330604	T	0.06462	0.0166	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.32534	-0.9903	10	0.14656	T	0.56	.	2.2114	0.03949	0.4204:0.1199:0.3367:0.123	.	884;915	Q9Y4F1;C9JME2	FARP1_HUMAN;.	T	915;884	ENSP00000365771:A915T;ENSP00000322926:A884T	ENSP00000322926:A884T	A	+	1	0	FARP1	97890945	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.117000	0.10708	-0.396000	0.07703	-1.707000	0.00718	GCG		0.627	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766		7	64	0	0	0	0	7	64				
METTL21C	196541	broad.mit.edu	37	13	103338495	103338495	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr13:103338495G>A	ENST00000267273.6	-	4	686	c.681C>T	c.(679-681)ttC>ttT	p.F227F		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	227					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						AGTCGGTGCTGAACCTGAATT	0.443																																						uc001vpj.2		NA																	0					0						c.(679-681)TTC>TTT		hypothetical protein LOC196541							82.0	75.0	77.0					13																	103338495		2203	4300	6503	SO:0001819	synonymous_variant	196541						methyltransferase activity	g.chr13:103338495G>A		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.681C>T	13.37:g.103338495G>A			Somatic				C13orf39_uc001vpk.2_Silent_p.F227F	p.F227F	NM_001010977	NP_001010977	WXS	Illumina HiSeq	Unspecified	Q5VZV1	MT21C_HUMAN			4	687	-			227						Silent	SNP	ENST00000267273.6	37	c.681C>T	CCDS32003.1																																																																																				0.443	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977		12	42	0	0	0	0	12	42				
COCH	1690	broad.mit.edu	37	14	31348691	31348691	+	Splice_Site	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr14:31348691G>C	ENST00000396618.3	+	6	492	c.436G>C	c.(436-438)Ggt>Cgt	p.G146R	RP11-829H16.3_ENST00000555108.1_RNA|COCH_ENST00000460581.2_Splice_Site_p.G34R|COCH_ENST00000216361.4_Splice_Site_p.G146R|COCH_ENST00000382493.4_5'Flank|COCH_ENST00000475087.1_Splice_Site_p.G146R	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	146					defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TCCACCAACAGGTATGAACTA	0.383																																						uc001wqr.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(436-438)GGT>CGT		cochlin precursor							96.0	89.0	91.0					14																	31348691		2203	4300	6503	SO:0001630	splice_region_variant	1690				sensory perception of sound	proteinaceous extracellular matrix		g.chr14:31348691G>C		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.436+1G>C	14.37:g.31348691G>C			Somatic				COCH_uc001wqp.2_Missense_Mutation_p.G146R|COCH_uc001wqq.3_Missense_Mutation_p.G146R|uc001wqs.2_Intron|COCH_uc001wqt.1_5'Flank	p.G146R	NM_004086	NP_004077	WXS	Illumina HiSeq	Unspecified	O43405	COCH_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)	6	516	+	Hepatocellular(127;0.0877)|Breast(36;0.148)		146					A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	ENST00000396618.3	37	c.436G>C	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477832	0.84640	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000556908;ENST00000460581;ENST00000542225	T;T;T;T;T	0.78126	-0.09;-0.09;-0.12;-1.15;0.08	5.74	5.74	0.90152	.	0.311125	0.36740	N	0.002439	T	0.81555	0.4847	L	0.27053	0.805	0.80722	D	1	D;P	0.89917	1.0;0.937	D;B	0.87578	0.998;0.403	T	0.79125	-0.1932	10	0.30078	T	0.28	-18.1856	17.6917	0.88270	0.0:0.0:1.0:0.0	.	146;146	Q96IU6;O43405	.;COCH_HUMAN	R	146;146;146;130;34;34	ENSP00000216361:G146R;ENSP00000379862:G146R;ENSP00000451528:G146R;ENSP00000452541:G130R;ENSP00000451713:G34R	ENSP00000216361:G146R	G	+	1	0	COCH	30418442	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.874000	0.69652	2.702000	0.92279	0.591000	0.81541	GGT		0.383	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	Missense_Mutation	9	58	0	0	0	0	9	58				
NIN	51199	broad.mit.edu	37	14	51224285	51224285	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr14:51224285G>A	ENST00000382041.3	-	18	3653	c.3463C>T	c.(3463-3465)Ctg>Ttg	p.L1155L	NIN_ENST00000382043.4_Intron|NIN_ENST00000245441.5_Silent_p.L1155L|NIN_ENST00000453196.1_Silent_p.L1155L|NIN_ENST00000324330.9_Silent_p.L1155L|NIN_ENST00000389868.3_Intron|NIN_ENST00000530997.2_Silent_p.L1155L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1155					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					GTACTTCCCAGGTCCCGGACC	0.478			T	PDGFRB	MPD																																	uc001wym.2		NA		Dom	yes		14	14q24	51199	T	ninein (GSK3B interacting protein)			L	PDGFRB		MPD		0				skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6						c.(3463-3465)CTG>TTG		ninein isoform 5							137.0	136.0	136.0					14																	51224285		2203	4300	6503	SO:0001819	synonymous_variant	51199				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding	g.chr14:51224285G>A	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.3463C>T	14.37:g.51224285G>A			Somatic				NIN_uc001wyi.2_Silent_p.L1155L|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Silent_p.L1161L|NIN_uc001wyo.2_Silent_p.L1155L	p.L1155L	NM_182946	NP_891991	WXS	Illumina HiSeq	Unspecified	Q8N4C6	NIN_HUMAN			18	3654	-	all_epithelial(31;0.00244)|Breast(41;0.127)		1155					A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	ENST00000382041.3	37	c.3463C>T	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.586833	0.00872	.	.	ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853	.	.	.	5.78	2.59	0.31030	.	.	.	.	.	T	0.32675	0.0837	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20773	-1.0265	4	.	.	.	0.1681	6.6411	0.22909	0.0717:0.2563:0.5547:0.1173	.	.	.	.	L	645	.	.	P	-	2	0	NIN	50294035	0.002000	0.14202	0.001000	0.08648	0.160000	0.22226	0.518000	0.22847	0.713000	0.32060	0.563000	0.77884	CCT		0.478	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		23	208	0	0	0	0	23	208				
SIX6	4990	broad.mit.edu	37	14	60976681	60976681	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr14:60976681A>T	ENST00000327720.5	+	1	1013	c.565A>T	c.(565-567)Aag>Tag	p.K189*		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	189					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		GGCTGCAGCCAAGAACAGGTC	0.647																																						uc001xfa.3		NA																	0					0						c.(565-567)AAG>TAG		SIX homeobox 6							12.0	13.0	13.0					14																	60976681		2196	4291	6487	SO:0001587	stop_gained	4990				organ morphogenesis|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr14:60976681A>T	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.565A>T	14.37:g.60976681A>T	ENSP00000328596:p.Lys189*		Somatic					p.K189*	NM_007374	NP_031400	WXS	Illumina HiSeq	Unspecified	O95475	SIX6_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.088)	1	744	+			189					Q6NT42|Q9P1X8	Nonsense_Mutation	SNP	ENST00000327720.5	37	c.565A>T	CCDS9747.1	.	.	.	.	.	.	.	.	.	.	A	41	8.846025	0.98976	.	.	ENSG00000184302	ENST00000327720	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9764	0.71277	1.0:0.0:0.0:0.0	.	.	.	.	X	189	.	ENSP00000328596:K189X	K	+	1	0	SIX6	60046434	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.139000	0.94554	2.317000	0.78254	0.460000	0.39030	AAG		0.647	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2			6	12	0	0	0	0	6	12				
SIPA1L1	26037	broad.mit.edu	37	14	72055505	72055505	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr14:72055505G>C	ENST00000555818.1	+	2	1264	c.916G>C	c.(916-918)Gaa>Caa	p.E306Q	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.E306Q|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.E306Q	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	306					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CAAAGGTGAAGAACTTGGGAA	0.433																																						uc001xms.2		NA																	0				ovary(3)|breast(1)	4						c.(916-918)GAA>CAA		signal-induced proliferation-associated 1 like							67.0	71.0	69.0					14																	72055505		2203	4300	6503	SO:0001583	missense	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72055505G>C	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.916G>C	14.37:g.72055505G>C	ENSP00000450832:p.Glu306Gln		Somatic				SIPA1L1_uc001xmt.2_Missense_Mutation_p.E306Q|SIPA1L1_uc001xmu.2_Missense_Mutation_p.E306Q|SIPA1L1_uc001xmv.2_Missense_Mutation_p.E306Q	p.E306Q	NM_015556	NP_056371	WXS	Illumina HiSeq	Unspecified	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	2	1264	+			306					J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	c.916G>C	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517645	0.44763	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.43294	0.95;0.95;0.95	6.07	6.07	0.98685	.	0.195423	0.56097	D	0.000038	T	0.56247	0.1972	L	0.42245	1.32	0.80722	D	1	P;D;D	0.55172	0.946;0.97;0.963	B;D;B	0.63703	0.418;0.917;0.444	T	0.32561	-0.9902	10	0.19147	T	0.46	-20.8382	20.6593	0.99626	0.0:0.0:1.0:0.0	.	306;306;306	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	Q	306	ENSP00000370630:E306Q;ENSP00000450832:E306Q;ENSP00000351352:E306Q	ENSP00000351352:E306Q	E	+	1	0	SIPA1L1	71125258	1.000000	0.71417	0.991000	0.47740	0.193000	0.23685	7.733000	0.84916	2.885000	0.99019	0.655000	0.94253	GAA		0.433	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		13	47	0	0	0	0	13	47				
TRIP11	9321	broad.mit.edu	37	14	92461767	92461767	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr14:92461767G>A	ENST00000267622.4	-	14	5358	c.4985C>T	c.(4984-4986)tCt>tTt	p.S1662F		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1662				QLSVSQEQ -> RFCLSGT (in Ref. 1; AAD09135). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TTGTTCCTGAGAGACAGAAAG	0.458			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	uc001xzy.2		NA		Dom	yes		14	14q31-q32	9321	T	thyroid hormone receptor interactor 11			L	PDGFRB		AML		0				ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13						c.(4984-4986)TCT>TTT		thyroid hormone receptor interactor 11							121.0	102.0	109.0					14																	92461767		2203	4300	6503	SO:0001583	missense	9321				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity	g.chr14:92461767G>A	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.4985C>T	14.37:g.92461767G>A	ENSP00000267622:p.Ser1662Phe		Somatic				TRIP11_uc010auf.1_Missense_Mutation_p.S1398F	p.S1662F	NM_004239	NP_004230	WXS	Illumina HiSeq	Unspecified	Q15643	TRIPB_HUMAN		COAD - Colon adenocarcinoma(157;0.223)	14	5773	-			1662	QLSVSQEQ -> RFCLSGT (in Ref. 1; AAD09135).		Potential.		B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	c.4985C>T	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063501	0.76187	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.04862	3.54	5.82	5.82	0.92795	.	0.115069	0.64402	D	0.000010	T	0.25901	0.0631	M	0.70275	2.135	0.58432	D	0.999998	D;D	0.89917	1.0;0.997	D;D	0.76575	0.988;0.975	T	0.00124	-1.2023	10	0.31617	T	0.26	.	20.0951	0.97834	0.0:0.0:1.0:0.0	.	1398;1662	F5H1Z0;Q15643	.;TRIPB_HUMAN	F	1662;1398	ENSP00000267622:S1662F	ENSP00000267622:S1662F	S	-	2	0	TRIP11	91531520	1.000000	0.71417	0.438000	0.26821	0.682000	0.39822	9.644000	0.98468	2.766000	0.95052	0.650000	0.86243	TCT		0.458	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1			24	23	0	0	0	0	24	23				
DLK1	8788	broad.mit.edu	37	14	101201194	101201194	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr14:101201194G>A	ENST00000341267.4	+	5	1355	c.1113G>A	c.(1111-1113)atG>atA	p.M371I	RP11-566J3.4_ENST00000608876.1_lincRNA|DLK1_ENST00000331224.6_Missense_Mutation_p.M298I	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	371					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				AGATCGACATGACCACCTTCA	0.562																																						uc001yhs.3		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1111-1113)ATG>ATA		delta-like 1 homolog precursor							95.0	94.0	95.0					14																	101201194		2203	4300	6503	SO:0001583	missense	8788				multicellular organismal development	extracellular space|integral to membrane|soluble fraction		g.chr14:101201194G>A	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.1113G>A	14.37:g.101201194G>A	ENSP00000340292:p.Met371Ile		Somatic				DLK1_uc001yhu.3_Missense_Mutation_p.M298I	p.M371I	NM_003836	NP_003827	WXS	Illumina HiSeq	Unspecified	P80370	DLK1_HUMAN			5	1266	+		Melanoma(154;0.155)	371			Cytoplasmic (Potential).		P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	c.1113G>A	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418540	0.42918	.	.	ENSG00000185559	ENST00000341267;ENST00000331224	D;D	0.86366	-2.11;-2.04	4.61	4.61	0.57282	.	0.173227	0.37012	N	0.002297	D	0.84211	0.5422	N	0.14661	0.345	0.80722	D	1	P;B	0.44281	0.831;0.07	P;B	0.54664	0.758;0.01	D	0.85537	0.1213	10	0.54805	T	0.06	.	11.6698	0.51395	0.0:0.0:0.823:0.177	.	298;371	P80370-2;P80370	.;DLK1_HUMAN	I	371;298	ENSP00000340292:M371I;ENSP00000331081:M298I	ENSP00000331081:M298I	M	+	3	0	DLK1	100270947	1.000000	0.71417	0.931000	0.37212	0.017000	0.09413	2.992000	0.49417	2.113000	0.64589	0.491000	0.48974	ATG		0.562	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1			35	97	0	0	0	0	35	97				
NDN	4692	broad.mit.edu	37	15	23932088	23932088	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:23932088G>A	ENST00000331837.4	-	1	362	c.277C>T	c.(277-279)Cca>Tca	p.P93S		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	93					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GCCGGGGCTGGCGGTGCCGGG	0.697									Prader-Willi syndrome																													uc001ywk.2		NA																	0					0						c.(277-279)CCA>TCA		necdin							22.0	23.0	22.0					15																	23932088		2202	4293	6495	SO:0001583	missense	4692	Prader-Willi_syndrome	Familial Cancer Database	Prader-Labhart-Willi syndrome	negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding	g.chr15:23932088G>A	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.277C>T	15.37:g.23932088G>A	ENSP00000332643:p.Pro93Ser		Somatic					p.P93S	NM_002487	NP_002478	WXS	Illumina HiSeq	Unspecified	Q99608	NECD_HUMAN		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)	1	363	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)	93					B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	37	c.277C>T	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541488	0.27563	.	.	ENSG00000182636	ENST00000331837	T	0.02067	4.47	3.63	3.63	0.41609	.	0.497191	0.19284	N	0.118084	T	0.01061	0.0035	N	0.08118	0	0.09310	N	1	P	0.37781	0.608	B	0.27500	0.08	T	0.46803	-0.9165	10	0.07175	T	0.84	.	11.5379	0.50648	0.0:0.0:1.0:0.0	.	93	Q99608	NECD_HUMAN	S	93	ENSP00000332643:P93S	ENSP00000332643:P93S	P	-	1	0	NDN	21483181	0.968000	0.33430	0.064000	0.19789	0.011000	0.07611	1.452000	0.35156	1.963000	0.57068	0.655000	0.94253	CCA		0.697	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487		8	31	0	0	0	0	8	31				
NUTM1	256646	broad.mit.edu	37	15	34649168	34649168	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:34649168G>T	ENST00000333756.4	+	7	3030	c.2875G>T	c.(2875-2877)Ggg>Tgg	p.G959W	NUTM1_ENST00000438749.3_Missense_Mutation_p.G977W|NUTM1_ENST00000537011.1_Missense_Mutation_p.G987W	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	959						cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTACACAACTGGGACTCCCAA	0.483																																						uc001zif.2		NA								T					BRD3|BRD4		lethal midline carcinoma	BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	0				midline_organs(25)|ovary(2)|lung(2)|skin(1)	30						c.(2875-2877)GGG>TGG		nuclear protein in testis							56.0	52.0	54.0					15																	34649168		2201	4298	6499	SO:0001583	missense	256646					cytoplasm|nucleus		g.chr15:34649168G>T	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2875G>T	15.37:g.34649168G>T	ENSP00000329448:p.Gly959Trp		Somatic				C15orf55_uc010ucc.1_Missense_Mutation_p.G987W|C15orf55_uc010ucd.1_Missense_Mutation_p.G977W	p.G959W	NM_175741	NP_786883	WXS	Illumina HiSeq	Unspecified	Q86Y26	NUT_HUMAN		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)	7	3030	+		all_lung(180;2.78e-08)	959					B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	ENST00000333756.4	37	c.2875G>T	CCDS32190.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.766125	0.31228	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.08634	3.09;3.07;3.09	5.3	0.076	0.14401	.	1.246570	0.05472	N	0.553338	T	0.19167	0.0460	L	0.55481	1.735	0.09310	N	1	B;P;D	0.63046	0.397;0.532;0.992	B;B;P	0.58577	0.194;0.356;0.841	T	0.27905	-1.0060	10	0.66056	D	0.02	.	8.0834	0.30758	0.4352:0.0:0.5648:0.0	.	977;987;959	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	W	987;977;959	ENSP00000444896:G987W;ENSP00000407031:G977W;ENSP00000329448:G959W	ENSP00000329448:G959W	G	+	1	0	C15orf55	32436460	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.077000	0.11394	0.093000	0.17368	0.655000	0.94253	GGG		0.483	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741		15	26	1	0	4.93e-13	5.58e-13	15	26				
USP8	9101	broad.mit.edu	37	15	50774167	50774167	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:50774167G>C	ENST00000396444.3	+	11	2046	c.1708G>C	c.(1708-1710)Gat>Cat	p.D570H	USP8_ENST00000307179.4_Missense_Mutation_p.D570H|USP8_ENST00000433963.1_Missense_Mutation_p.D570H|USP8_ENST00000425032.3_Missense_Mutation_p.D493H	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	570					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		ATCTGTAGAAGATAGGGGGAA	0.418																																						uc001zym.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(1708-1710)GAT>CAT		ubiquitin specific peptidase 8							51.0	51.0	51.0					15																	50774167		2196	4294	6490	SO:0001583	missense	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50774167G>C	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.1708G>C	15.37:g.50774167G>C	ENSP00000379721:p.Asp570His		Somatic				USP8_uc001zyk.1_Missense_Mutation_p.D271H|USP8_uc001zyl.3_Missense_Mutation_p.D570H|USP8_uc001zyn.3_Missense_Mutation_p.D570H|USP8_uc010ufh.1_Missense_Mutation_p.D493H|USP8_uc010bev.1_Missense_Mutation_p.D199H	p.D570H	NM_001128611	NP_001122083	WXS	Illumina HiSeq	Unspecified	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	12	2208	+			570					B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	37	c.1708G>C	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.430619	0.43122	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.77	4.77	0.60923	.	0.306106	0.28796	N	0.014110	T	0.45637	0.1352	L	0.27053	0.805	0.35301	D	0.783044	D;D;D	0.67145	0.996;0.996;0.996	P;P;P	0.56700	0.804;0.804;0.804	T	0.57568	-0.7789	10	0.46703	T	0.11	-9.5826	15.5808	0.76439	0.0:0.0:1.0:0.0	.	493;570;570	B4DKA8;P40818;A8K8N5	.;UBP8_HUMAN;.	H	570;570;570;493	ENSP00000379721:D570H;ENSP00000405537:D570H;ENSP00000302239:D570H;ENSP00000412682:D493H	ENSP00000302239:D570H	D	+	1	0	USP8	48561459	1.000000	0.71417	0.889000	0.34880	0.093000	0.18481	3.899000	0.56288	2.185000	0.69588	0.557000	0.71058	GAT		0.418	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		10	29	0	0	0	0	10	29				
USP8	9101	broad.mit.edu	37	15	50791262	50791262	+	Nonsense_Mutation	SNP	C	C	T	rs142928952		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:50791262C>T	ENST00000396444.3	+	20	3672	c.3334C>T	c.(3334-3336)Cga>Tga	p.R1112*	RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000307179.4_Nonsense_Mutation_p.R1112*|USP8_ENST00000433963.1_Nonsense_Mutation_p.R1112*|USP8_ENST00000425032.3_Nonsense_Mutation_p.R1006*|USP50_ENST00000530218.1_5'Flank|RP11-562A8.4_ENST00000560380.1_RNA	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	1112					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		ATTGGGACCACGAGTAACTGA	0.368																																						uc001zym.3		NA																	0				lung(1)|central_nervous_system(1)	2						c.(3334-3336)CGA>TGA		ubiquitin specific peptidase 8							59.0	58.0	58.0					15																	50791262		2195	4292	6487	SO:0001587	stop_gained	9101				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr15:50791262C>T	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.3334C>T	15.37:g.50791262C>T	ENSP00000379721:p.Arg1112*		Somatic				USP8_uc001zyl.3_Nonsense_Mutation_p.R1112*|USP8_uc001zyn.3_Nonsense_Mutation_p.R1112*|USP8_uc010ufh.1_Nonsense_Mutation_p.R1006*|USP8_uc001zyp.3_Nonsense_Mutation_p.R279*	p.R1112*	NM_001128611	NP_001122083	WXS	Illumina HiSeq	Unspecified	P40818	UBP8_HUMAN		all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)	21	3834	+			1112					B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Nonsense_Mutation	SNP	ENST00000396444.3	37	c.3334C>T	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	C	43	10.294480	0.99377	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032;ENST00000419830;ENST00000396440	.	.	.	5.44	4.5	0.54988	.	0.099633	0.43260	D	0.000595	.	.	.	.	.	.	0.44042	D	0.996773	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3812	14.7671	0.69648	0.2618:0.7382:0.0:0.0	.	.	.	.	X	1112;1112;1112;1006;330;325	.	ENSP00000302239:R1112X	R	+	1	2	USP8	48578554	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	1.626000	0.37039	1.367000	0.46095	0.585000	0.79938	CGA		0.368	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154		12	33	0	0	0	0	12	33				
UNC13C	440279	broad.mit.edu	37	15	54916087	54916087	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:54916087G>T	ENST00000260323.11	+	31	6294	c.6294G>T	c.(6292-6294)aaG>aaT	p.K2098N	UNC13C_ENST00000545554.1_Missense_Mutation_p.K2098N|UNC13C_ENST00000539562.2_Missense_Mutation_p.K19N|UNC13C_ENST00000537900.1_Missense_Mutation_p.K2096N	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2098	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAGACAAGAAGAGAAAACAAG	0.403																																						uc002ack.2		NA																	0				ovary(5)|pancreas(2)	7						c.(6292-6294)AAG>AAT		unc-13 homolog C							120.0	115.0	116.0					15																	54916087		1868	4097	5965	SO:0001583	missense	440279				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding	g.chr15:54916087G>T	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6294G>T	15.37:g.54916087G>T	ENSP00000260323:p.Lys2098Asn		Somatic				UNC13C_uc002acm.2_Missense_Mutation_p.K19N	p.K2098N	NM_001080534	NP_001074003	WXS	Illumina HiSeq	Unspecified	Q8NB66	UN13C_HUMAN		GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)	30	6294	+			2098			C2 2.		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	c.6294G>T	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.630019	0.46944	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900;ENST00000539562	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-0.53	5.72	3.52	0.40303	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.097896	0.64402	D	0.000002	D	0.86100	0.5852	H	0.95043	3.615	0.47547	D	0.999455	P	0.45672	0.864	P	0.51079	0.658	D	0.86340	0.1704	10	0.49607	T	0.09	.	7.0773	0.25211	0.3208:0.0:0.6792:0.0	.	2098	Q8NB66	UN13C_HUMAN	N	2098;2098;2096;19	ENSP00000260323:K2098N;ENSP00000438156:K2098N;ENSP00000442569:K2096N;ENSP00000443886:K19N	ENSP00000260323:K2098N	K	+	3	2	UNC13C	52703379	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	1.427000	0.34881	1.418000	0.47098	0.563000	0.77884	AAG		0.403	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		19	45	1	0	8.28e-16	9.42e-16	19	45				
NEDD4	4734	broad.mit.edu	37	15	56207863	56207863	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:56207863G>A	ENST00000508342.1	-	1	1466	c.1167C>T	c.(1165-1167)gaC>gaT	p.D389D	NEDD4_ENST00000338963.2_Silent_p.D389D|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Silent_p.D389D	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	389					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TTGTTTCACAGTCTAATGTAG	0.363																																						uc002adj.2		NA																	0				skin(2)|ovary(1)|breast(1)	4						c.(1165-1167)GAC>GAT		neural precursor cell expressed, developmentally							54.0	52.0	53.0					15																	56207863		2193	4291	6484	SO:0001819	synonymous_variant	4734				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity	g.chr15:56207863G>A	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1167C>T	15.37:g.56207863G>A			Somatic				NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Silent_p.D389D|NEDD4_uc010ugj.1_Silent_p.D389D|NEDD4_uc010bfm.2_Silent_p.D389D|NEDD4_uc002adk.2_RNA	p.D389D	NM_198400	NP_006145	WXS	Illumina HiSeq	Unspecified	P46934	NEDD4_HUMAN		all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)	1	1467	-			389					A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Silent	SNP	ENST00000508342.1	37	c.1167C>T																																																																																					0.363	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400		17	38	0	0	0	0	17	38				
CCDC33	80125	broad.mit.edu	37	15	74559050	74559050	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:74559050G>A	ENST00000398814.3	+	4	782	c.351G>A	c.(349-351)aaG>aaA	p.K117K	CCDC33_ENST00000321288.5_Silent_p.K320K	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	320										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						ACAACAGAAAGAAACAGGAGT	0.473																																						uc002axo.2		NA																	0				ovary(3)|skin(2)	5						c.(349-351)AAG>AAA		coiled-coil domain containing 33 isoform 1							162.0	157.0	158.0					15																	74559050		1912	4130	6042	SO:0001819	synonymous_variant	80125						protein binding	g.chr15:74559050G>A	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.351G>A	15.37:g.74559050G>A			Somatic				CCDC33_uc002axp.2_5'UTR	p.K117K	NM_025055	NP_079331	WXS	Illumina HiSeq	Unspecified	Q8N5R6	CCD33_HUMAN			4	745	+			320			C2.		A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	ENST00000398814.3	37	c.351G>A	CCDS42058.1																																																																																				0.473	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791		29	107	0	0	0	0	29	107				
C15orf27	123591	broad.mit.edu	37	15	76467994	76467994	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:76467994G>A	ENST00000388942.3	+	8	1023	c.747G>A	c.(745-747)acG>acA	p.T249T	RP11-593F23.1_ENST00000558424.1_RNA	NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	249					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						AGAGGCTGACGCAGATCTGTC	0.562																																						uc002bbq.2		NA																	0					0						c.(745-747)ACG>ACA		hypothetical protein LOC123591							115.0	94.0	101.0					15																	76467994		2197	4294	6491	SO:0001819	synonymous_variant	123591					integral to membrane		g.chr15:76467994G>A	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.747G>A	15.37:g.76467994G>A			Somatic				C15orf27_uc010bkp.2_Silent_p.T65T|C15orf27_uc002bbr.2_Silent_p.T65T	p.T249T	NM_152335	NP_689548	WXS	Illumina HiSeq	Unspecified	Q2M3C6	CO027_HUMAN			8	902	+			249			Potential.		Q8N993|Q96LL5	Silent	SNP	ENST00000388942.3	37	c.747G>A	CCDS10289.2																																																																																				0.562	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335		14	55	0	0	0	0	14	55				
ADAMTS7	11173	broad.mit.edu	37	15	79067056	79067056	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:79067056G>A	ENST00000388820.4	-	12	1996	c.1786C>T	c.(1786-1788)Cgc>Tgc	p.R596C	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	596	Cys-rich.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						AAGGAGGGGCGGCCAGCAGGG	0.632																																						uc002bej.3		NA																	0					0						c.(1786-1788)CGC>TGC		ADAM metallopeptidase with thrombospondin type 1							47.0	54.0	51.0					15																	79067056		2196	4291	6487	SO:0001583	missense	11173				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr15:79067056G>A	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1786C>T	15.37:g.79067056G>A	ENSP00000373472:p.Arg596Cys		Somatic				ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Missense_Mutation_p.R596C	p.R596C	NM_014272	NP_055087	WXS	Illumina HiSeq	Unspecified	Q9UKP4	ATS7_HUMAN			12	1997	-			596			Cys-rich.		Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	c.1786C>T	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.783918	0.31593	.	.	ENSG00000136378	ENST00000388820	T	0.00441	7.41	3.51	2.55	0.30701	.	1.548120	0.03595	N	0.232532	T	0.00637	0.0021	M	0.70275	2.135	0.09310	N	1	D;D	0.69078	0.96;0.997	P;P	0.46452	0.513;0.517	T	0.55250	-0.8170	10	0.54805	T	0.06	.	9.2505	0.37551	0.0:0.0:0.4741:0.5258	.	596;596	A8MQ00;Q9UKP4	.;ATS7_HUMAN	C	596	ENSP00000373472:R596C	ENSP00000373472:R596C	R	-	1	0	ADAMTS7	76854111	0.950000	0.32346	0.012000	0.15200	0.724000	0.41520	1.818000	0.39012	0.785000	0.33685	0.289000	0.19496	CGC		0.632	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272		10	39	0	0	0	0	10	39				
AP3B2	8120	broad.mit.edu	37	15	83335612	83335612	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:83335612C>T	ENST00000261722.3	-	15	1946	c.1739G>A	c.(1738-1740)cGc>cAc	p.R580H	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Missense_Mutation_p.R548H|AP3B2_ENST00000535359.1_Missense_Mutation_p.R580H	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	580					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCGGGTGAAGCGCGCCCGGTC	0.597																																						uc010uoh.1		NA																	0				ovary(3)|breast(1)|pancreas(1)	5						c.(1738-1740)CGC>CAC		adaptor-related protein complex 3, beta 2							64.0	72.0	69.0					15																	83335612		1954	4131	6085	SO:0001583	missense	8120				endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity	g.chr15:83335612C>T	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.1739G>A	15.37:g.83335612C>T	ENSP00000261722:p.Arg580His		Somatic				AP3B2_uc010uoi.1_Missense_Mutation_p.R580H|AP3B2_uc010uoj.1_Missense_Mutation_p.R548H|AP3B2_uc010uog.1_Missense_Mutation_p.R216H	p.R580H	NM_004644	NP_004635	WXS	Illumina HiSeq	Unspecified	Q13367	AP3B2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.229)		15	1916	-			580					A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	c.1739G>A	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	33	5.222526	0.95139	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.27890	1.64;1.64;1.64	5.84	4.92	0.64577	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63022	0.2476	M	0.90252	3.1	0.80722	D	1	B;D;D	0.89917	0.302;1.0;1.0	B;D;D	0.97110	0.066;1.0;0.999	T	0.71866	-0.4463	10	0.62326	D	0.03	-16.9405	15.1021	0.72288	0.0:0.932:0.0:0.068	.	548;580;580	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	H	580;548;580	ENSP00000261722:R580H;ENSP00000438721:R548H;ENSP00000440984:R580H	ENSP00000261722:R580H	R	-	2	0	AP3B2	81132667	1.000000	0.71417	0.996000	0.52242	0.892000	0.51952	7.794000	0.85869	1.475000	0.48197	0.655000	0.94253	CGC		0.597	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			17	66	0	0	0	0	17	66				
TPSD1	23430	broad.mit.edu	37	16	1306640	1306640	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:1306640C>T	ENST00000211076.3	+	2	354	c.206C>T	c.(205-207)tCc>tTc	p.S69F	RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Missense_Mutation_p.S62F	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	69	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				TGCGGGGGCTCCCTCATCCAC	0.687																																						uc002clb.1		NA																	0					0						c.(205-207)TCC>TTC		tryptase delta 1 precursor							55.0	66.0	62.0					16																	1306640		2199	4300	6499	SO:0001583	missense	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1306640C>T	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.206C>T	16.37:g.1306640C>T	ENSP00000211076:p.Ser69Phe		Somatic				TPSD1_uc010brm.1_Missense_Mutation_p.S7F	p.S69F	NM_012217	NP_036349	WXS	Illumina HiSeq	Unspecified	Q9BZJ3	TRYD_HUMAN			2	215	+		Hepatocellular(780;0.00369)	69			Peptidase S1.		O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	37	c.206C>T	CCDS10432.1	.	.	.	.	.	.	.	.	.	.	-	14.55	2.567589	0.45694	.	.	ENSG00000095917	ENST00000397534;ENST00000211076	D;D	0.84070	-1.8;-1.8	3.0	3.0	0.34707	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.47455	D	0.000232	D	0.90789	0.7108	M	0.87328	2.875	0.49213	D	0.99976	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.91740	0.5403	10	0.66056	D	0.02	.	11.7565	0.51878	0.0:1.0:0.0:0.0	.	62;69	C9JJL5;Q9BZJ3	.;TRYD_HUMAN	F	62;69	ENSP00000380668:S62F;ENSP00000211076:S69F	ENSP00000211076:S69F	S	+	2	0	TPSD1	1246641	0.295000	0.24389	0.996000	0.52242	0.142000	0.21351	4.198000	0.58419	1.642000	0.50584	0.185000	0.17295	TCC		0.687	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2			22	57	0	0	0	0	22	57				
MAPK8IP3	23162	broad.mit.edu	37	16	1812845	1812845	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:1812845G>A	ENST00000250894.4	+	16	1890	c.1733G>A	c.(1732-1734)cGc>cAc	p.R578H	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.R572H	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	578					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						AGCTTCAGCCGCCTCTTCAGC	0.677																																						uc002cmk.2		NA																	0				breast(2)|central_nervous_system(1)	3						c.(1732-1734)CGC>CAC		mitogen-activated protein kinase 8 interacting							48.0	64.0	59.0					16																	1812845		2005	4155	6160	SO:0001583	missense	23162				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding	g.chr16:1812845G>A	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1733G>A	16.37:g.1812845G>A	ENSP00000250894:p.Arg578His		Somatic				MAPK8IP3_uc002cml.2_Missense_Mutation_p.R572H|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.R579H	p.R578H	NM_015133	NP_055948	WXS	Illumina HiSeq	Unspecified	Q9UPT6	JIP3_HUMAN			16	1853	+			578					A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	ENST00000250894.4	37	c.1733G>A	CCDS10442.2	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885336	0.91814	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	D;D	0.88664	-2.41;-2.41	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.93772	0.8009	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.943;0.925;0.996	D	0.92926	0.6359	10	0.40728	T	0.16	-25.8058	18.7182	0.91684	0.0:0.0:1.0:0.0	.	579;572;578	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	H	578;572	ENSP00000250894:R578H;ENSP00000348290:R572H	ENSP00000250894:R578H	R	+	2	0	MAPK8IP3	1752846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.898000	0.87363	2.513000	0.84729	0.561000	0.74099	CGC		0.677	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439		28	66	0	0	0	0	28	66				
CREBBP	1387	broad.mit.edu	37	16	3777767	3777767	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:3777767G>A	ENST00000262367.5	-	31	8090	c.7281C>T	c.(7279-7281)gtC>gtT	p.V2427V	CREBBP_ENST00000382070.3_Silent_p.V2389V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2427					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGGTGTCCCCGACCAGGGACA	0.562			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															uc002cvv.2		NA		Dom/Rec	yes		16	16p13.3	1387	T|N|F|Mis|O	CREB binding protein (CBP)	yes	Rubinstein-Taybi syndrome	L	MLL|MORF|RUNXBP2		ALL|AML|DLBCL|B-NHL 		0				haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127						c.(7279-7281)GTC>GTT		CREB binding protein isoform a							100.0	102.0	101.0					16																	3777767		2197	4300	6497	SO:0001819	synonymous_variant	1387	Rubinstein-Taybi_syndrome			cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	g.chr16:3777767G>A	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.7281C>T	16.37:g.3777767G>A			Somatic				CREBBP_uc002cvw.2_Silent_p.V2389V	p.V2427V	NM_004380	NP_004371	WXS	Illumina HiSeq	Unspecified	Q92793	CBP_HUMAN		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)	31	7485	-		Ovarian(90;0.0266)	2427					D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	c.7281C>T	CCDS10509.1																																																																																				0.562	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		36	131	0	0	0	0	36	131				
GRIN2A	2903	broad.mit.edu	37	16	9857127	9857127	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:9857127G>C	ENST00000396573.2	-	14	4583	c.4274C>G	c.(4273-4275)tCg>tGg	p.S1425W	GRIN2A_ENST00000404927.2_3'UTR|GRIN2A_ENST00000535259.1_3'UTR|GRIN2A_ENST00000562109.1_3'UTR|GRIN2A_ENST00000396575.2_Missense_Mutation_p.S1425W|GRIN2A_ENST00000330684.3_Missense_Mutation_p.S1425W	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1425			S -> L (found in a cutaneous malignant melanoma sample; somatic mutation). {ECO:0000269|PubMed:21499247}.		directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.S1425L(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AACATGCTCCGAAATATACAC	0.473																																						uc002czo.3		NA																	1	Substitution - Missense(1)	p.S1425L(1)	skin(1)	skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45						c.(4273-4275)TCG>TGG		N-methyl-D-aspartate receptor subunit 2A isoform	Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						79.0	72.0	74.0					16																	9857127		2197	4300	6497	SO:0001583	missense	2903				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr16:9857127G>C		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.4274C>G	16.37:g.9857127G>C	ENSP00000379818:p.Ser1425Trp		Somatic				GRIN2A_uc010uym.1_Missense_Mutation_p.S1425W|GRIN2A_uc010uyn.1_3'UTR|GRIN2A_uc002czr.3_3'UTR	p.S1425W	NM_001134407	NP_001127879	WXS	Illumina HiSeq	Unspecified	Q12879	NMDE1_HUMAN			13	4822	-			1425			Cytoplasmic (Potential).		O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	c.4274C>G	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290399	0.40494	.	.	ENSG00000183454	ENST00000396573;ENST00000330684;ENST00000396575	T;T;T	0.12255	2.7;2.7;2.7	5.79	4.83	0.62350	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.334636	0.32593	N	0.005891	T	0.28962	0.0719	L	0.60455	1.87	0.80722	D	1	D	0.61697	0.99	P	0.58266	0.836	T	0.01432	-1.1356	9	.	.	.	.	15.2816	0.73790	0.0:0.0:0.8589:0.1411	.	1425	Q12879	NMDE1_HUMAN	W	1425	ENSP00000379818:S1425W;ENSP00000332549:S1425W;ENSP00000379820:S1425W	.	S	-	2	0	GRIN2A	9764628	1.000000	0.71417	0.315000	0.25238	0.931000	0.56810	5.852000	0.69488	1.425000	0.47237	0.655000	0.94253	TCG		0.473	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			17	34	0	0	0	0	17	34				
MYH11	4629	broad.mit.edu	37	16	15832485	15832485	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:15832485C>T	ENST00000300036.5	-	24	3167	c.3058G>A	c.(3058-3060)Gaa>Aaa	p.E1020K	MYH11_ENST00000396324.3_Missense_Mutation_p.E1027K|AF001548.6_ENST00000577048.1_RNA|MYH11_ENST00000576790.2_Missense_Mutation_p.E1020K|MYH11_ENST00000452625.2_Missense_Mutation_p.E1027K	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1020					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TTGGCCTTTTCTTCCTCTTCT	0.358			T	CBFB	AML																																	uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		0				ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(3058-3060)GAA>AAA		smooth muscle myosin heavy chain 11 isoform							165.0	153.0	157.0					16																	15832485		2197	4300	6497	SO:0001583	missense	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15832485C>T	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3058G>A	16.37:g.15832485C>T	ENSP00000300036:p.Glu1020Lys		Somatic				MYH11_uc002ddv.2_Missense_Mutation_p.E1027K|MYH11_uc002ddw.2_Missense_Mutation_p.E1020K|MYH11_uc002ddx.2_Missense_Mutation_p.E1027K|MYH11_uc010bvg.2_Missense_Mutation_p.E852K	p.E1020K	NM_002474	NP_002465	WXS	Illumina HiSeq	Unspecified	P35749	MYH11_HUMAN			24	3165	-			1020			Potential.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	c.3058G>A	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863339	0.91511	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	4.3	4.3	0.51218	.	0.124722	0.53938	D	0.000050	D	0.92257	0.7544	M	0.79926	2.475	0.80722	D	1	P;B;B;B;B	0.41643	0.758;0.082;0.082;0.082;0.198	P;B;B;B;B	0.49451	0.611;0.26;0.26;0.26;0.362	D	0.93769	0.7073	10	0.87932	D	0	.	16.1203	0.81346	0.0:1.0:0.0:0.0	.	1027;1020;1027;1020;1027	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	K	1020;1020;1027;1027;1027	ENSP00000300036:E1020K;ENSP00000345136:E1020K;ENSP00000379616:E1027K;ENSP00000407821:E1027K	ENSP00000300036:E1020K	E	-	1	0	MYH11	15739986	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.117000	0.64856	0.555000	0.69702	GAA		0.358	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		12	71	0	0	0	0	12	71				
DNAH3	55567	broad.mit.edu	37	16	20981224	20981224	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:20981224G>A	ENST00000261383.3	-	52	8347	c.8348C>T	c.(8347-8349)tCg>tTg	p.S2783L	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2783	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTTCACCAGCGAGATGTCGGC	0.592																																						uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(8347-8349)TCG>TTG		dynein, axonemal, heavy chain 3							138.0	118.0	124.0					16																	20981224		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20981224G>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8348C>T	16.37:g.20981224G>A	ENSP00000261383:p.Ser2783Leu		Somatic				DNAH3_uc010vbd.1_Missense_Mutation_p.S218L	p.S2783L	NM_017539	NP_060009	WXS	Illumina HiSeq	Unspecified	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	52	8348	-			2783			Stalk (By similarity).		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.8348C>T	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678781	0.47886	.	.	ENSG00000158486	ENST00000261383	T	0.74421	-0.84	5.97	5.97	0.96955	Dynein heavy chain, coiled coil stalk (1);	0.399095	0.22606	N	0.057896	T	0.81498	0.4835	M	0.88512	2.96	0.80722	D	1	P	0.48089	0.905	B	0.41571	0.36	D	0.85374	0.1115	10	0.72032	D	0.01	.	20.5014	0.99208	0.0:0.0:1.0:0.0	.	2783	Q8TD57	DYH3_HUMAN	L	2783	ENSP00000261383:S2783L	ENSP00000261383:S2783L	S	-	2	0	DNAH3	20888725	1.000000	0.71417	0.941000	0.38009	0.004000	0.04260	6.533000	0.73829	2.856000	0.98102	0.644000	0.83932	TCG		0.592	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		35	86	0	0	0	0	35	86				
CD19	930	broad.mit.edu	37	16	28948971	28948971	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:28948971G>A	ENST00000324662.3	+	11	1443	c.1399G>A	c.(1399-1401)Gag>Aag	p.E467K	CD19_ENST00000538922.1_Missense_Mutation_p.E467K|CD19_ENST00000567541.1_Missense_Mutation_p.E467K			P15391	CD19_HUMAN	CD19 molecule	467					B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						CGAGGATGAAGAGCTGACCCA	0.567																																						uc002drs.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1399-1401)GAG>AAG		CD19 antigen precursor							73.0	75.0	75.0					16																	28948971		2197	4300	6497	SO:0001583	missense	930				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity	g.chr16:28948971G>A		CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.1399G>A	16.37:g.28948971G>A	ENSP00000313419:p.Glu467Lys		Somatic				uc010vct.1_Intron|CD19_uc010byo.1_Missense_Mutation_p.E467K	p.E467K	NM_001770	NP_001761	WXS	Illumina HiSeq	Unspecified	P15391	CD19_HUMAN			11	1461	+			467			Cytoplasmic (Potential).		A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	ENST00000324662.3	37	c.1399G>A	CCDS10644.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556156	0.86231	.	.	ENSG00000177455	ENST00000538922;ENST00000380673;ENST00000324662;ENST00000537306	T;T	0.54279	0.58;0.58	4.48	4.48	0.54585	.	0.000000	0.45361	D	0.000362	T	0.59197	0.2176	L	0.29908	0.895	0.36497	D	0.868809	D;D	0.64830	0.994;0.99	D;D	0.68621	0.959;0.912	T	0.68746	-0.5327	10	0.87932	D	0	-9.8008	13.0284	0.58829	0.0:0.0:1.0:0.0	.	467;467	F5H635;P15391	.;CD19_HUMAN	K	467;274;467;316	ENSP00000437940:E467K;ENSP00000313419:E467K	ENSP00000313419:E467K	E	+	1	0	CD19	28856472	0.998000	0.40836	1.000000	0.80357	0.959000	0.62525	4.321000	0.59209	2.208000	0.71279	0.462000	0.41574	GAG		0.567	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214152.2			19	35	0	0	0	0	19	35				
KCTD13	253980	broad.mit.edu	37	16	29918300	29918300	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:29918300C>T	ENST00000568000.1	-	6	1884	c.883G>A	c.(883-885)Ggg>Agg	p.G295R		NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13	295					cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						TCATCCTCCCCGCGGCCAGCC	0.637																																						uc002duv.2		NA																	0					0						c.(883-885)GGG>AGG		potassium channel tetramerisation domain							81.0	79.0	79.0					16																	29918300		2197	4300	6497	SO:0001583	missense	253980				cell migration|DNA replication|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity	g.chr16:29918300C>T	AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.883G>A	16.37:g.29918300C>T	ENSP00000455785:p.Gly295Arg		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|ASPHD1_uc002duu.3_Intron|ASPHD1_uc010bzi.2_Intron|KCTD13_uc010vee.1_RNA	p.G295R	NM_178863	NP_849194	WXS	Illumina HiSeq	Unspecified	Q8WZ19	BACD1_HUMAN			6	1074	-			295					A8K0R5|Q96P93|Q96SA1	Missense_Mutation	SNP	ENST00000568000.1	37	c.883G>A	CCDS10661.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947328	0.53186	.	.	ENSG00000174943	ENST00000308768	T	0.50548	0.74	4.46	4.46	0.54185	.	0.152498	0.31335	N	0.007833	T	0.36717	0.0977	N	0.14661	0.345	0.80722	D	1	D	0.67145	0.996	P	0.49597	0.616	T	0.21861	-1.0233	10	0.52906	T	0.07	-1.1233	9.7777	0.40630	0.0:0.9035:0.0:0.0965	.	295	Q8WZ19	BACD1_HUMAN	R	295	ENSP00000311202:G295R	ENSP00000311202:G295R	G	-	1	0	KCTD13	29825801	0.000000	0.05858	1.000000	0.80357	0.436000	0.31835	0.446000	0.21694	2.310000	0.77875	0.460000	0.39030	GGG		0.637	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255162.2	NM_178863		33	80	0	0	0	0	33	80				
SALL1	6299	broad.mit.edu	37	16	51174819	51174819	+	Silent	SNP	C	C	T	rs556441449		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:51174819C>T	ENST00000251020.4	-	2	1347	c.1314G>A	c.(1312-1314)gcG>gcA	p.A438A	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.A341A	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	438					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A438A(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AAGTACTTTTCGCTTCAAAGG	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21436	0.0		0.0	False		,,,				2504	0.0				GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	skin(5)|ovary(3)	8						c.(1312-1314)GCG>GCA		sal-like 1 isoform a							109.0	103.0	105.0					16																	51174819		2198	4300	6498	SO:0001819	synonymous_variant	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51174819C>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1314G>A	16.37:g.51174819C>T			Somatic				SALL1_uc010vgr.1_Silent_p.A341A|SALL1_uc010cbv.2_Intron	p.A438A	NM_002968	NP_002959	WXS	Illumina HiSeq	Unspecified	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	1345	-		all_cancers(37;0.0322)	438					Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	c.1314G>A	CCDS10747.1																																																																																				0.488	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		33	95	0	0	0	0	33	95				
CKLF	51192	broad.mit.edu	37	16	66597116	66597116	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:66597116G>A	ENST00000264001.4	+	3	478	c.329G>A	c.(328-330)gGa>gAa	p.G110E	CKLF_ENST00000563092.1_3'UTR|CKLF_ENST00000345436.4_Intron|CKLF_ENST00000351137.4_Missense_Mutation_p.G57E|CKLF_ENST00000362093.4_Intron|CKLF_ENST00000417030.2_Missense_Mutation_p.G110E|CKLF-CMTM1_ENST00000527729.1_Intron|CKLF-CMTM1_ENST00000532838.1_Missense_Mutation_p.G57E	NM_016951.3	NP_058647.1	Q9UBR5	CKLF_HUMAN	chemokine-like factor	110	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell proliferation (GO:0008283)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|secretion by cell (GO:0032940)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chemokine activity (GO:0008009)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)		ACAGTTGGTGGAGGGGTAAGT	0.368																																						uc002eow.2		NA																	0					0						c.(328-330)GGA>GAA		chemokine-like factor isoform a							151.0	125.0	134.0					16																	66597116		2201	4300	6501	SO:0001583	missense	51192				cell proliferation|lymphocyte chemotaxis|macrophage chemotaxis|neutrophil chemotaxis|secretion by cell	extracellular space|integral to membrane	chemokine activity	g.chr16:66597116G>A	AF096895	CCDS10806.1, CCDS10807.1, CCDS10808.1, CCDS10809.1, CCDS45502.1	16q22.1-q22.3	2008-02-05	2003-02-28	2003-03-07	ENSG00000217555	ENSG00000217555			13253	protein-coding gene	gene with protein product			"""chemokine-like factor 1"""	CKLF1		11042152, 11415443	Standard	NM_016326		Approved	UCK-1, CKLF3, CKLF4, HSPC224, C32		Q9UBR5	OTTHUMG00000137504	ENST00000264001.4:c.329G>A	16.37:g.66597116G>A	ENSP00000264001:p.Gly110Glu		Somatic				CKLF_uc002eox.1_Missense_Mutation_p.G110E|CKLF_uc002eot.2_Intron|CKLF_uc002eou.2_Missense_Mutation_p.G57E|CKLF_uc002eov.2_Intron	p.G110E	NM_016951	NP_058647	WXS	Illumina HiSeq	Unspecified	Q9UBR5	CKLF_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)	3	476	+		Ovarian(137;0.0563)	110			Helical; (Potential).|MARVEL.		C9JE38|Q9UHM7|Q9UHN8|Q9UI41	Missense_Mutation	SNP	ENST00000264001.4	37	c.329G>A	CCDS10807.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.418895	0.62622	.	.	ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000254788	ENST00000264001;ENST00000351137;ENST00000361141;ENST00000417030;ENST00000532838;ENST00000529718	T;T	0.72615	0.4;-0.67	5.02	5.02	0.67125	Marvel (1);	.	.	.	.	T	0.77805	0.4185	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.974;1.0	T	0.72050	-0.4407	9	0.07030	T	0.85	-29.1038	13.7178	0.62708	0.0:0.0:1.0:0.0	.	110;110;57	Q9UBR5-5;Q9UBR5;Q5BJH6	.;CKLF_HUMAN;.	E	110;57;110;110;57;29	ENSP00000264001:G110E;ENSP00000416678:G110E	ENSP00000433503:G29E	G	+	2	0	CKLF;CKLF-CMTM1	65154617	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	3.034000	0.49751	2.608000	0.88229	0.650000	0.86243	GGA		0.368	CKLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268816.2	NM_016326		8	35	0	0	0	0	8	35				
DYNC1LI2	1783	broad.mit.edu	37	16	66766353	66766353	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:66766353G>C	ENST00000258198.2	-	7	1024	c.818C>G	c.(817-819)tCa>tGa	p.S273*	DYNC1LI2_ENST00000440564.2_Nonsense_Mutation_p.S234*|DYNC1LI2_ENST00000379482.2_Intron|DYNC1LI2_ENST00000570201.1_5'Flank|DYNC1LI2_ENST00000443351.2_Nonsense_Mutation_p.S196*|RP11-63M22.2_ENST00000569274.1_RNA	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	273					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TTCTTTCACTGATGTGTAAAT	0.378																																						uc002eqb.1		NA																	0				central_nervous_system(3)|skin(1)	4						c.(817-819)TCA>TGA		dynein, cytoplasmic, light intermediate							95.0	90.0	92.0					16																	66766353		2200	4300	6500	SO:0001587	stop_gained	1783				transport	centrosome|cytoplasmic dynein complex|microtubule	ATP binding|motor activity	g.chr16:66766353G>C	AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.818C>G	16.37:g.66766353G>C	ENSP00000258198:p.Ser273*		Somatic				DYNC1LI2_uc010vis.1_Nonsense_Mutation_p.S196*|DYNC1LI2_uc010vit.1_Nonsense_Mutation_p.S273*|DYNC1LI2_uc010viu.1_Nonsense_Mutation_p.S234*	p.S273*	NM_006141	NP_006132	WXS	Illumina HiSeq	Unspecified	O43237	DC1L2_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)	7	849	-		Ovarian(137;0.0563)	273					A8K6V1|B4DZP4|Q8TAT3	Nonsense_Mutation	SNP	ENST00000258198.2	37	c.818C>G	CCDS10818.1	.	.	.	.	.	.	.	.	.	.	G	38	7.015740	0.98002	.	.	ENSG00000135720	ENST00000258198;ENST00000443351;ENST00000440564	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.9987	19.1741	0.93597	0.0:0.0:1.0:0.0	.	.	.	.	X	273;196;234	.	ENSP00000258198:S273X	S	-	2	0	DYNC1LI2	65323854	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.559000	0.98135	2.759000	0.94783	0.563000	0.77884	TCA		0.378	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268846.1	NM_006141		11	17	0	0	0	0	11	17				
SLC12A4	6560	broad.mit.edu	37	16	67979293	67979293	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:67979293C>G	ENST00000316341.3	-	22	3151	c.3011G>C	c.(3010-3012)cGg>cCg	p.R1004P	SLC12A4_ENST00000537830.2_Missense_Mutation_p.R998P|SLC12A4_ENST00000422611.2_Missense_Mutation_p.R1006P|SLC12A4_ENST00000576616.1_Missense_Mutation_p.R1004P|SLC12A4_ENST00000338335.3_3'UTR|SLC12A4_ENST00000572037.1_Missense_Mutation_p.R956P|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000541864.2_Missense_Mutation_p.R973P|LCAT_ENST00000264005.5_5'Flank	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	1004					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CACCAGCTCCCGGAAATTGTC	0.572																																						uc002euz.2		NA																	0				ovary(1)	1						c.(3010-3012)CGG>CCG		solute carrier family 12, member 4 isoform a	Bumetanide(DB00887)|Potassium Chloride(DB00761)						91.0	87.0	88.0					16																	67979293		2198	4300	6498	SO:0001583	missense	6560				cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity	g.chr16:67979293C>G		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.3011G>C	16.37:g.67979293C>G	ENSP00000318557:p.Arg1004Pro		Somatic				LCAT_uc002euy.1_5'Flank|SLC12A4_uc010ceu.2_Missense_Mutation_p.R998P|SLC12A4_uc010vkh.1_Missense_Mutation_p.R973P|SLC12A4_uc010vki.1_Missense_Mutation_p.R998P|SLC12A4_uc010vkj.1_Missense_Mutation_p.R1006P|SLC12A4_uc002eva.2_Missense_Mutation_p.R1004P	p.R1004P	NM_005072	NP_005063	WXS	Illumina HiSeq	Unspecified	Q9UP95	S12A4_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	22	3152	-		Ovarian(137;0.192)	1004			Cytoplasmic (Potential).		B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	c.3011G>C	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695853	0.88830	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000316341	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.56093	0.1962	L	0.52573	1.65	0.80722	D	1	B;B;D;B;B;B	0.61080	0.011;0.003;0.989;0.002;0.002;0.003	B;B;P;B;B;B	0.60286	0.013;0.006;0.872;0.013;0.013;0.01	T	0.46498	-0.9187	10	0.27082	T	0.32	.	19.2529	0.93932	0.0:1.0:0.0:0.0	.	1006;998;973;998;1004;1004	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	P	1006;973;998;1004	ENSP00000395983:R1006P;ENSP00000438334:R973P;ENSP00000445962:R998P;ENSP00000318557:R1004P	ENSP00000318557:R1004P	R	-	2	0	SLC12A4	66536794	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.817000	0.55668	2.557000	0.86248	0.557000	0.71058	CGG		0.572	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072		28	58	0	0	0	0	28	58				
SLC7A6OS	84138	broad.mit.edu	37	16	68344297	68344297	+	Silent	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr16:68344297A>G	ENST00000263997.6	-	2	430	c.412T>C	c.(412-414)Ttg>Ctg	p.L138L	PRMT7_ENST00000449359.3_5'Flank|PRMT7_ENST00000348497.4_5'Flank|PRMT7_ENST00000339507.5_5'Flank|snoU13_ENST00000458872.1_RNA|PRMT7_ENST00000441236.1_5'Flank	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand	138					hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		AGGTCTAACAACTGAAAGCCC	0.627																																						uc002evw.1		NA																	0				ovary(1)	1						c.(412-414)TTG>CTG		solute carrier family 7, member 6 opposite							21.0	21.0	21.0					16																	68344297		2198	4300	6498	SO:0001819	synonymous_variant	84138				protein transport	cytoplasm|nucleus		g.chr16:68344297A>G		CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558	ENST00000263997.6:c.412T>C	16.37:g.68344297A>G			Somatic				PRMT7_uc002evx.1_5'Flank|PRMT7_uc002evy.1_5'Flank|PRMT7_uc010vlg.1_5'Flank	p.L138L	NM_032178	NP_115554	WXS	Illumina HiSeq	Unspecified	Q96CW6	S7A6O_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)	2	431	-		Ovarian(137;0.192)	138					Q8TCZ3|Q9H8R8	Silent	SNP	ENST00000263997.6	37	c.412T>C	CCDS10865.1																																																																																				0.627	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268894.3	NM_032178		10	12	0	0	0	0	10	12				
YWHAE	7531	broad.mit.edu	37	17	1303386	1303386	+	Missense_Mutation	SNP	G	G	C	rs11552915		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:1303386G>C	ENST00000264335.8	-	1	286	c.19C>G	c.(19-21)Ctg>Gtg	p.L7V	YWHAE_ENST00000571732.1_De_novo_Start_OutOfFrame|YWHAE_ENST00000573026.1_Missense_Mutation_p.L7V|YWHAE_ENST00000498643.1_5'UTR|YWHAE_ENST00000575977.1_Missense_Mutation_p.L7V	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon	7					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		TGGTACACCAGATCCTCTCGA	0.662			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome																															uc002fsj.2		NA		Dom	yes		17	17p13.3	7531		"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes		M					0				lung(2)|ovary(1)	3						c.(19-21)CTG>GTG		tyrosine 3/tryptophan 5 -monooxygenase							66.0	64.0	65.0					17																	1303386		2203	4300	6503	SO:0001583	missense	7531				apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding	g.chr17:1303386G>C	U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.19C>G	17.37:g.1303386G>C	ENSP00000264335:p.Leu7Val		Somatic				YWHAE_uc002fsk.2_Translation_Start_Site|YWHAE_uc010vqh.1_RNA|YWHAE_uc010vqi.1_RNA	p.L7V	NM_006761	NP_006752	WXS	Illumina HiSeq	Unspecified	P62258	1433E_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)	1	171	-			7					B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Missense_Mutation	SNP	ENST00000264335.8	37	c.19C>G	CCDS11001.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965798	0.34659	.	.	ENSG00000108953	ENST00000264335	T	0.50548	0.74	4.66	4.66	0.58398	14-3-3 domain (4);	0.209023	0.28252	U	0.016034	T	0.47801	0.1465	M	0.73430	2.235	0.44123	D	0.996908	B	0.09022	0.002	B	0.12156	0.007	T	0.43893	-0.9363	10	0.17369	T	0.5	1.7206	15.0746	0.72066	0.0:0.0:1.0:0.0	rs11552915;rs11552915	7	P62258	1433E_HUMAN	V	7	ENSP00000264335:L7V	ENSP00000264335:L7V	L	-	1	2	YWHAE	1250136	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.169000	0.58223	2.426000	0.82243	0.484000	0.47621	CTG		0.662	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259354.3	NM_006761		19	99	0	0	0	0	19	99				
MNT	4335	broad.mit.edu	37	17	2298449	2298449	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:2298449C>T	ENST00000174618.4	-	2	778	c.373G>A	c.(373-375)Ggc>Agc	p.G125S	MNT_ENST00000575394.1_Intron	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	125					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		CCGGGGGCGCCAACCAGGGCC	0.721																																						uc002fur.2		NA																	0				skin(1)	1						c.(373-375)GGC>AGC		MAX binding protein							7.0	7.0	7.0					17																	2298449		2062	4070	6132	SO:0001583	missense	4335				multicellular organismal development|negative regulation of cell proliferation|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr17:2298449C>T	Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.373G>A	17.37:g.2298449C>T	ENSP00000174618:p.Gly125Ser		Somatic					p.G125S	NM_020310	NP_064706	WXS	Illumina HiSeq	Unspecified	Q99583	MNT_HUMAN		Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)	2	625	-			125					A8K6D1|D3DTI7|Q1ED38	Missense_Mutation	SNP	ENST00000174618.4	37	c.373G>A	CCDS11018.1	.	.	.	.	.	.	.	.	.	.	T	0.781	-0.762399	0.02996	.	.	ENSG00000070444	ENST00000174618;ENST00000404961	T	0.79352	-1.26	4.59	0.964	0.19655	.	0.759054	0.12037	N	0.505378	T	0.36908	0.0984	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41662	-0.9496	10	0.02654	T	1	-2.3134	4.5663	0.12187	0.1336:0.2349:0.0:0.6315	.	125	Q99583	MNT_HUMAN	S	125	ENSP00000174618:G125S	ENSP00000174618:G125S	G	-	1	0	MNT	2245199	0.677000	0.27577	0.498000	0.27564	0.515000	0.34225	0.556000	0.23438	-0.065000	0.13021	-0.254000	0.11334	GGC		0.721	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207158.1	NM_020310		4	7	0	0	0	0	4	7				
ASPA	443	broad.mit.edu	37	17	3385074	3385074	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:3385074G>C	ENST00000263080.2	+	2	572	c.414G>C	c.(412-414)caG>caC	p.Q138H	ASPA_ENST00000456349.2_Missense_Mutation_p.Q138H|SPATA22_ENST00000541913.1_Intron	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	138					aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	TTTTAATTCAGATGTTTCATT	0.318																																						uc010ckg.2		NA																	0					0						c.(412-414)CAG>CAC		aspartoacylase	L-Aspartic Acid(DB00128)						55.0	52.0	53.0					17																	3385074		2203	4299	6502	SO:0001583	missense	443				aspartate catabolic process	cytoplasm|nucleus	aminoacylase activity|aspartoacylase activity|hydrolase activity, acting on ester bonds|metal ion binding	g.chr17:3385074G>C	S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.414G>C	17.37:g.3385074G>C	ENSP00000263080:p.Gln138His		Somatic				SPATA22_uc010vrg.1_Intron|ASPA_uc002fvq.2_Missense_Mutation_p.Q138H	p.Q138H	NM_001128085	NP_001121557	WXS	Illumina HiSeq	Unspecified	P45381	ACY2_HUMAN			3	505	+			138						Missense_Mutation	SNP	ENST00000263080.2	37	c.414G>C	CCDS11028.1	.	.	.	.	.	.	.	.	.	.	g	6.871	0.530148	0.13127	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	D;D	0.97731	-4.51;-4.51	5.61	2.49	0.30216	.	0.000000	0.85682	D	0.000000	D	0.94961	0.8370	L	0.41573	1.285	0.80722	D	1	P	0.47762	0.9	P	0.47573	0.55	D	0.90909	0.4774	10	0.13108	T	0.6	-11.0963	8.4731	0.32997	0.3522:0.0:0.6478:0.0	.	138	P45381	ACY2_HUMAN	H	138	ENSP00000409976:Q138H;ENSP00000263080:Q138H	ENSP00000263080:Q138H	Q	+	3	2	ASPA	3331824	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.188000	0.32102	0.375000	0.24679	0.557000	0.71058	CAG		0.318	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207315.1	NM_000049		3	22	0	0	0	0	3	22				
PITPNM3	83394	broad.mit.edu	37	17	6373604	6373604	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:6373604G>A	ENST00000262483.8	-	13	1836	c.1749C>T	c.(1747-1749)gaC>gaT	p.D583D	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Silent_p.D547D	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	583	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		AGGCCACCACGTCTGTGGACT	0.652																																						uc002gdd.3		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1747-1749)GAC>GAT		PITPNM family member 3 isoform 1							92.0	65.0	74.0					17																	6373604		2203	4300	6503	SO:0001819	synonymous_variant	83394				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding	g.chr17:6373604G>A	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1749C>T	17.37:g.6373604G>A			Somatic				PITPNM3_uc010cln.2_Silent_p.D547D|PITPNM3_uc010clm.2_Silent_p.D66D|PITPNM3_uc002gdc.3_Silent_p.D174D	p.D583D	NM_031220	NP_112497	WXS	Illumina HiSeq	Unspecified	Q9BZ71	PITM3_HUMAN		Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)	13	1900	-			583			DDHD.		A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	c.1749C>T	CCDS11076.1																																																																																				0.652	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		5	16	0	0	0	0	5	16				
C17orf74	201243	broad.mit.edu	37	17	7329885	7329885	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:7329885C>T	ENST00000333870.3	+	3	649	c.575C>T	c.(574-576)cCc>cTc	p.P192L	RP11-104H15.7_ENST00000575310.1_RNA|C17orf74_ENST00000574034.1_Silent_p.A79A	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	192						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				GACAACCTGCCCTTCCCGTAT	0.597																																						uc002ggw.2		NA																	0					0						c.(574-576)CCC>CTC		hypothetical protein LOC201243							126.0	131.0	129.0					17																	7329885		1990	4147	6137	SO:0001583	missense	201243					integral to membrane		g.chr17:7329885C>T	BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.575C>T	17.37:g.7329885C>T	ENSP00000328061:p.Pro192Leu		Somatic				FGF11_uc010vtw.1_Intron	p.P192L	NM_175734	NP_783861	WXS	Illumina HiSeq	Unspecified	Q0P670	CQ074_HUMAN			3	648	+		Prostate(122;0.157)	192						Missense_Mutation	SNP	ENST00000333870.3	37	c.575C>T	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	C	9.819	1.185268	0.21870	.	.	ENSG00000184560	ENST00000333870	T	0.30448	1.53	3.94	1.68	0.24146	.	1.914000	0.02945	N	0.140952	T	0.20251	0.0487	N	0.14661	0.345	0.09310	N	1	B	0.24721	0.11	B	0.22601	0.04	T	0.22103	-1.0226	10	0.48119	T	0.1	-19.3749	6.064	0.19854	0.2188:0.5688:0.2124:0.0	.	192	Q0P670	CQ074_HUMAN	L	192	ENSP00000328061:P192L	ENSP00000328061:P192L	P	+	2	0	C17orf74	7270609	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	1.048000	0.30379	0.957000	0.37930	0.491000	0.48974	CCC		0.597	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2	NM_175734		33	157	0	0	0	0	33	157				
C17orf74	201243	broad.mit.edu	37	17	7330746	7330746	+	Missense_Mutation	SNP	C	C	T	rs200505211		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:7330746C>T	ENST00000333870.3	+	3	1510	c.1436C>T	c.(1435-1437)tCa>tTa	p.S479L	RP11-104H15.7_ENST00000575310.1_RNA|C17orf74_ENST00000574034.1_3'UTR	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	479						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				AGGTCCAGCTCACTGCCACCG	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16405	0.0		0.0	False		,,,				2504	0.0					uc002ggw.2		NA																	0					0						c.(1435-1437)TCA>TTA		hypothetical protein LOC201243							24.0	28.0	27.0					17																	7330746		2104	4217	6321	SO:0001583	missense	201243					integral to membrane		g.chr17:7330746C>T	BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.1436C>T	17.37:g.7330746C>T	ENSP00000328061:p.Ser479Leu		Somatic				FGF11_uc010vtw.1_Intron	p.S479L	NM_175734	NP_783861	WXS	Illumina HiSeq	Unspecified	Q0P670	CQ074_HUMAN			3	1509	+		Prostate(122;0.157)	479						Missense_Mutation	SNP	ENST00000333870.3	37	c.1436C>T	CCDS42255.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	15.70	2.912273	0.52439	.	.	ENSG00000184560	ENST00000333870	T	0.36157	1.27	4.33	4.33	0.51752	.	0.000000	0.28700	U	0.014436	T	0.46946	0.1419	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.47195	-0.9136	10	0.87932	D	0	-9.6112	12.5035	0.55968	0.0:1.0:0.0:0.0	.	479	Q0P670	CQ074_HUMAN	L	479	ENSP00000328061:S479L	ENSP00000328061:S479L	S	+	2	0	C17orf74	7271470	0.546000	0.26457	0.446000	0.26920	0.370000	0.29829	3.526000	0.53509	2.403000	0.81681	0.313000	0.20887	TCA		0.632	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2	NM_175734		13	32	0	0	0	0	13	32				
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	p.R196*(125)|p.R196P(12)|p.0?(7)|p.R196R(5)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.R196Q(3)|p.K164_P219del(1)|p.R196L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.R64*(1)|p.I195fs*12(1)|p.R103*(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM941329	TP53	M		c.(586-588)CGA>TGA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578263G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.2_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*|TP53_uc010vug.1_Nonsense_Mutation_p.R157*	p.R196*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	780	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	196		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.586C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		12	44	0	0	0	0	12	44				
DNAH2	146754	broad.mit.edu	37	17	7696466	7696466	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:7696466C>T	ENST00000572933.1	+	48	8972	c.7512C>T	c.(7510-7512)ctC>ctT	p.L2504L	DNAH2_ENST00000389173.2_Silent_p.L2504L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2504	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGATCCGCCTCTGGATTGACT	0.517																																						uc002giu.1		NA																	0				ovary(6)|skin(6)|central_nervous_system(1)	13						c.(7510-7512)CTC>CTT		dynein heavy chain domain 3							96.0	87.0	90.0					17																	7696466		2203	4300	6503	SO:0001819	synonymous_variant	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7696466C>T	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7512C>T	17.37:g.7696466C>T			Somatic					p.L2504L	NM_020877	NP_065928	WXS	Illumina HiSeq	Unspecified	Q9P225	DYH2_HUMAN			47	7526	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	2504			AAA 3 (By similarity).		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	c.7512C>T	CCDS32551.1																																																																																				0.517	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		22	84	0	0	0	0	22	84				
ALOXE3	59344	broad.mit.edu	37	17	8021162	8021162	+	Splice_Site	SNP	C	C	T	rs199913948		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:8021162C>T	ENST00000448843.2	-	2	487	c.147G>A	c.(145-147)tcG>tcA	p.S49S	ALOXE3_ENST00000380149.1_Splice_Site_p.S205S|ALOXE3_ENST00000318227.3_Splice_Site_p.S181S	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	49	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						TTGTACTCACCGATCCAGGGG	0.612																																						uc010cnr.2		NA																	0				skin(3)|lung(1)|central_nervous_system(1)	5						c.(145-147)TCG>TCA		arachidonate lipoxygenase 3 isoform 2							45.0	33.0	37.0					17																	8021162		2203	4300	6503	SO:0001630	splice_region_variant	59344				leukotriene biosynthetic process		iron ion binding|lipoxygenase activity	g.chr17:8021162C>T	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.147+1G>A	17.37:g.8021162C>T			Somatic				ALOXE3_uc002gka.2_Silent_p.S205S|ALOXE3_uc010vuo.1_Silent_p.S181S|ALOXE3_uc010vup.1_RNA	p.S49S	NM_021628	NP_067641	WXS	Illumina HiSeq	Unspecified	Q9BYJ1	LOXE3_HUMAN			2	517	-			49			PLAT.		B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Silent	SNP	ENST00000448843.2	37	c.147G>A	CCDS11130.1																																																																																				0.612	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1		Silent	4	24	0	0	0	0	4	24				
WDR16	146845	broad.mit.edu	37	17	9545105	9545105	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:9545105C>G	ENST00000352665.5	+	13	1709	c.1640C>G	c.(1639-1641)tCg>tGg	p.S547W	WDR16_ENST00000299764.5_Missense_Mutation_p.S557W|RP11-55L4.2_ENST00000584676.1_RNA|WDR16_ENST00000396219.3_Missense_Mutation_p.S479W	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CTGTCTGGGTCGATAAATGGC	0.458																																						uc002gly.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(1639-1641)TCG>TGG		WD40-repeat protein upregulated in HCC isoform							119.0	117.0	118.0					17																	9545105		2203	4300	6503	SO:0001583	missense	146845					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr17:9545105C>G	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.1640C>G	17.37:g.9545105C>G	ENSP00000339449:p.Ser547Trp		Somatic				WDR16_uc002glz.2_Missense_Mutation_p.S479W|WDR16_uc010coc.2_Missense_Mutation_p.S557W	p.S547W	NM_145054	NP_659491	WXS	Illumina HiSeq	Unspecified	Q8N1V2	WDR16_HUMAN			13	1709	+			547			WD 10.			Missense_Mutation	SNP	ENST00000352665.5	37	c.1640C>G	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098255	0.76870	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;T;T	0.61158	0.13;0.13;0.13	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.227324	0.47093	D	0.000258	T	0.75324	0.3834	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.994	D;D;P	0.71870	0.931;0.975;0.868	T	0.75062	-0.3450	10	0.48119	T	0.1	-4.1529	18.3834	0.90457	0.0:1.0:0.0:0.0	.	557;479;547	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	W	547;479;557	ENSP00000339449:S547W;ENSP00000379521:S479W;ENSP00000299764:S557W	ENSP00000299764:S557W	S	+	2	0	WDR16	9485830	0.808000	0.29022	0.818000	0.32626	0.841000	0.47740	4.316000	0.59178	2.648000	0.89879	0.563000	0.77884	TCG		0.458	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054		20	71	0	0	0	0	20	71				
MYH3	4621	broad.mit.edu	37	17	10547749	10547749	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:10547749G>A	ENST00000583535.1	-	14	1416	c.1329C>T	c.(1327-1329)cgC>cgT	p.R443R	MYH3_ENST00000226209.7_Silent_p.R443R	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	443	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GCTGGTTAATGCGAGTGACCA	0.398																																						uc002gmq.1		NA																	0				ovary(4)|central_nervous_system(2)|pancreas(1)	7						c.(1327-1329)CGC>CGT		myosin, heavy chain 3, skeletal muscle,							145.0	141.0	142.0					17																	10547749		2203	4300	6503	SO:0001819	synonymous_variant	4621				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10547749G>A		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.1329C>T	17.37:g.10547749G>A			Somatic					p.R443R	NM_002470	NP_002461	WXS	Illumina HiSeq	Unspecified	P11055	MYH3_HUMAN			13	1406	-			443			Myosin head-like.		Q15492	Silent	SNP	ENST00000583535.1	37	c.1329C>T	CCDS11157.1																																																																																				0.398	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470		22	68	0	0	0	0	22	68				
MYOCD	93649	broad.mit.edu	37	17	12642624	12642624	+	Silent	SNP	A	A	T	rs370115389		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:12642624A>T	ENST00000343344.4	+	7	696	c.696A>T	c.(694-696)atA>atT	p.I232I	MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Silent_p.I136I|MYOCD_ENST00000425538.1_Silent_p.I232I			Q8IZQ8	MYCD_HUMAN	myocardin	232					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GCACCCCCATAGCCGTGCATG	0.587																																						uc002gnn.2		NA																	0				central_nervous_system(2)|skin(2)|ovary(1)	5						c.(694-696)ATA>ATT		myocardin isoform 2		A	,,	0,4406		0,0,2203	50.0	45.0	47.0		696,408,696	-5.2	0.0	17		47	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	MYOCD	NM_001146312.1,NM_001146313.1,NM_153604.2	,,	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	,,	232/987,136/685,232/939	12642624	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	93649				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding	g.chr17:12642624A>T	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.696A>T	17.37:g.12642624A>T			Somatic				MYOCD_uc002gno.2_Silent_p.I232I|MYOCD_uc002gnp.1_Silent_p.I136I	p.I232I	NM_153604	NP_705832	WXS	Illumina HiSeq	Unspecified	Q8IZQ8	MYCD_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)	7	995	+			232					Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	37	c.696A>T	CCDS11163.1																																																																																				0.587	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604		32	39	0	0	0	0	32	39				
KCNJ12	3768	broad.mit.edu	37	17	21318895	21318895	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:21318895C>T	ENST00000583088.1	+	3	1136	c.241C>T	c.(241-243)Cgg>Tgg	p.R81W	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R81W	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	81					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.R81G(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CATCCGCTGGCGGTACATGCT	0.577										Prostate(3;0.18)																												uc002gyv.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(1)	4						c.(241-243)CGG>TGG		potassium inwardly-rectifying channel, subfamily	Dofetilide(DB00204)						205.0	126.0	153.0					17																	21318895		2203	4300	6503	SO:0001583	missense	3768				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity	g.chr17:21318895C>T	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.241C>T	17.37:g.21318895C>T	ENSP00000463778:p.Arg81Trp	Prostate(3;0.18)	Somatic					p.R81W	NM_021012	NP_066292	WXS	Illumina HiSeq	Unspecified	Q14500	IRK12_HUMAN		Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	3	946	+			81			Helical; Name=M1; (By similarity).		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	c.241C>T	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843005	0.71488	.	.	ENSG00000184185	ENST00000331718	D	0.96011	-3.88	5.33	4.31	0.51392	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	H	0.95043	3.615	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98223	1.0479	10	0.87932	D	0	.	10.7711	0.46323	0.4271:0.5729:0.0:0.0	.	81	Q14500	IRK12_HUMAN	W	81	ENSP00000328150:R81W	ENSP00000328150:R81W	R	+	1	2	KCNJ12	21259488	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.669000	0.46825	2.506000	0.84524	0.591000	0.81541	CGG		0.577	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		9	89	0	0	0	0	9	89				
WSB1	26118	broad.mit.edu	37	17	25628934	25628934	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:25628934G>T	ENST00000262394.2	+	2	477	c.161G>T	c.(160-162)gGa>gTa	p.G54V	WSB1_ENST00000427287.2_Missense_Mutation_p.G23V|WSB1_ENST00000581185.1_Missense_Mutation_p.G54V|WSB1_ENST00000348811.2_Intron|WSB1_ENST00000579733.1_Intron|WSB1_ENST00000578312.1_3'UTR|WSB1_ENST00000583193.1_Intron	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	54					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TGGTCACAAGGACATCGCACA	0.413																																						uc002gzd.1		NA																	0					0						c.(160-162)GGA>GTA		WD repeat and SOCS box-containing 1 isoform 1							343.0	310.0	321.0					17																	25628934		2203	4300	6503	SO:0001583	missense	26118				intracellular signal transduction	intracellular	protein binding	g.chr17:25628934G>T	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.161G>T	17.37:g.25628934G>T	ENSP00000262394:p.Gly54Val		Somatic				WSB1_uc010vzy.1_Missense_Mutation_p.G54V|WSB1_uc010vzz.1_Missense_Mutation_p.G23V|WSB1_uc010crf.1_Intron|WSB1_uc002gze.1_Intron|WSB1_uc002gzf.1_RNA	p.G54V	NM_015626	NP_056441	WXS	Illumina HiSeq	Unspecified	Q9Y6I7	WSB1_HUMAN	BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	2	477	+	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		54			WD 1.		Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Missense_Mutation	SNP	ENST00000262394.2	37	c.161G>T	CCDS11220.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242600	0.22796	.	.	ENSG00000109046	ENST00000262394;ENST00000427287	T;T	0.59906	0.23;0.23	5.81	4.83	0.62350	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.076548	0.53938	D	0.000044	T	0.69708	0.3141	L	0.54323	1.7	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.071	D;D;B	0.91635	0.998;0.999;0.039	T	0.65833	-0.6072	10	0.19147	T	0.46	-12.1882	15.3579	0.74443	0.0:0.0:0.8594:0.1405	.	23;54;54	B4DGB8;B4DTL1;Q9Y6I7	.;.;WSB1_HUMAN	V	54;23	ENSP00000262394:G54V;ENSP00000416112:G23V	ENSP00000262394:G54V	G	+	2	0	WSB1	22653061	1.000000	0.71417	1.000000	0.80357	0.282000	0.26991	9.240000	0.95396	1.437000	0.47472	-0.182000	0.12963	GGA		0.413	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626		35	201	1	0	3.76e-14	4.27e-14	35	201				
TMEM99	147184	broad.mit.edu	37	17	38991082	38991082	+	Missense_Mutation	SNP	C	C	T	rs201820044		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:38991082C>T	ENST00000301665.3	+	3	618	c.314C>T	c.(313-315)tCg>tTg	p.S105L		NM_001195386.1|NM_001195387.1|NM_145274.3	NP_001182315.1|NP_001182316.1|NP_660317.2	Q8N816	TMM99_HUMAN	transmembrane protein 99	105						integral component of membrane (GO:0016021)				cervix(1)|large_intestine(1)|lung(5)|skin(2)|urinary_tract(1)	10		Breast(137;0.000301)				GGTGTTGGCTCGTGGTTGCTC	0.468																																						uc002hvj.1		NA																	0				skin(1)	1						c.(313-315)TCG>TTG		transmembrane protein 99 precursor		G	LEU/SER,LEU/SER,LEU/SER	0,3862		0,0,1931	158.0	156.0	157.0		314,314,314	-0.5	0.0	17		157	1,8287		0,1,4143	yes	missense,missense,missense	TMEM99	NM_001195386.1,NM_001195387.1,NM_145274.3	145,145,145	0,1,6074	TT,TC,CC		0.0121,0.0,0.0082	benign,benign,benign	105/259,105/259,105/259	38991082	1,12149	1931	4144	6075	SO:0001583	missense	147184					integral to membrane		g.chr17:38991082C>T	AK097454	CCDS42319.1	17q21.2	2008-11-06			ENSG00000167920	ENSG00000167920			28305	protein-coding gene	gene with protein product						12477932	Standard	NM_001195386		Approved	MGC21518	uc021txc.1	Q8N816	OTTHUMG00000133579	ENST00000301665.3:c.314C>T	17.37:g.38991082C>T	ENSP00000301665:p.Ser105Leu		Somatic					p.S105L	NM_145274	NP_660317	WXS	Illumina HiSeq	Unspecified	Q8N816	TMM99_HUMAN			3	621	+		Breast(137;0.000301)	105			Helical; (Potential).		B4DQ34|Q96BP9	Missense_Mutation	SNP	ENST00000301665.3	37	c.314C>T	CCDS42319.1	.	.	.	.	.	.	.	.	.	.	G	8.020	0.759521	0.15846	0.0	1.21E-4	ENSG00000167920	ENST00000436612;ENST00000301665	T;T	0.29142	1.58;1.58	0.235	-0.47	0.12131	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25745	-1.0123	8	0.87932	D	0	.	.	.	.	.	105	Q8N816	TMM99_HUMAN	L	105	ENSP00000390036:S105L;ENSP00000301665:S105L	ENSP00000301665:S105L	S	+	2	0	TMEM99	36244608	0.005000	0.15991	0.003000	0.11579	0.003000	0.03518	-1.587000	0.02108	-1.775000	0.01287	-1.751000	0.00678	TCG		0.468	TMEM99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257681.1	NM_145274		62	129	0	0	0	0	62	129				
KCTD2	23510	broad.mit.edu	37	17	73049121	73049121	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:73049121A>T	ENST00000322444.6	+	3	467	c.461A>T	c.(460-462)gAa>gTa	p.E154V	KCTD2_ENST00000581589.1_De_novo_Start_OutOfFrame	NM_015353.1	NP_056168.1	Q14681	KCTD2_HUMAN	potassium channel tetramerization domain containing 2	154	BTB.				protein homooligomerization (GO:0051260)		protein complex binding (GO:0032403)			kidney(1)|lung(2)	3	all_lung(278;0.226)					GTGCTGGAGGAAGCGGAGTTT	0.463																																						uc002jmp.2		NA																	0					0						c.(460-462)GAA>GTA		potassium channel tetramerisation domain							126.0	107.0	113.0					17																	73049121		2203	4300	6503	SO:0001583	missense	23510					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr17:73049121A>T	BC033329	CCDS32728.1	17q25.2	2013-06-20	2013-06-20			ENSG00000180901			21294	protein-coding gene	gene with protein product		613422	"""potassium channel tetramerisation domain containing 2"""			12620391	Standard	XR_248405		Approved	KIAA0176	uc002jmp.3	Q14681		ENST00000322444.6:c.461A>T	17.37:g.73049121A>T	ENSP00000312814:p.Glu154Val		Somatic				KCTD2_uc010dfz.2_RNA|KCTD2_uc002jmq.2_RNA	p.E154V	NM_015353	NP_056168	WXS	Illumina HiSeq	Unspecified	Q14681	KCTD2_HUMAN			3	528	+	all_lung(278;0.226)		154			BTB.			Missense_Mutation	SNP	ENST00000322444.6	37	c.461A>T	CCDS32728.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.661191	0.88154	.	.	ENSG00000180901	ENST00000322444;ENST00000375286	D	0.87179	-2.22	5.61	5.61	0.85477	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.105146	0.64402	D	0.000005	D	0.94778	0.8314	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95592	0.8655	10	0.62326	D	0.03	.	15.7934	0.78384	1.0:0.0:0.0:0.0	.	154	Q14681	KCTD2_HUMAN	V	154;136	ENSP00000312814:E154V	ENSP00000312814:E154V	E	+	2	0	KCTD2	70560716	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.228000	0.95250	2.127000	0.65507	0.533000	0.62120	GAA		0.463	KCTD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445538.1			20	21	0	0	0	0	20	21				
CANT1	124583	broad.mit.edu	37	17	76991155	76991155	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:76991155C>T	ENST00000302345.2	-	3	1274	c.780G>A	c.(778-780)gaG>gaA	p.E260E	CANT1_ENST00000392446.5_Silent_p.E260E|CANT1_ENST00000591773.1_Silent_p.E260E	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	260					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)		CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			ACACCCAGTTCTCGTGGTCCA	0.652			T	ETV4	prostate																																	uc002jwn.2		NA		Dom	yes		17	17q25	124583	T	calcium activated nucleotidase 1			E	ETV4		prostate		0					0						c.(778-780)GAG>GAA		calcium activated nucleotidase 1							71.0	58.0	62.0					17																	76991155		2203	4300	6503	SO:0001819	synonymous_variant	124583				positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity	g.chr17:76991155C>T	AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.780G>A	17.37:g.76991155C>T			Somatic				CANT1_uc002jwk.2_Silent_p.E260E|CANT1_uc002jwj.2_Silent_p.E260E|CANT1_uc002jwl.2_Intron|CANT1_uc002jwm.1_RNA	p.E260E	NM_001159772	NP_001153244	WXS	Illumina HiSeq	Unspecified	Q8WVQ1	CANT1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)		5	1219	-			260			Lumenal (Potential).		B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Silent	SNP	ENST00000302345.2	37	c.780G>A	CCDS11760.1																																																																																				0.652	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437723.2	NM_138793		6	13	0	0	0	0	6	13				
MRPL12	6182	broad.mit.edu	37	17	79673961	79673961	+	Missense_Mutation	SNP	C	C	T	rs368964351		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:79673961C>T	ENST00000333676.3	+	4	516	c.371C>T	c.(370-372)gCg>gTg	p.A124V	SLC25A10_ENST00000571730.1_Missense_Mutation_p.A124V|SLC25A10_ENST00000541223.1_Missense_Mutation_p.A124V	NM_002949.3	NP_002940.2	P52815	RM12_HUMAN	mitochondrial ribosomal protein L12	124					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|lung(2)|urinary_tract(1)	4	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			ATCCCCATAGCGAAAGAACGG	0.562																																						uc010wut.1		NA																	0					0						c.(370-372)GCG>GTG		solute carrier family 25 (mitochondrial carrier;	Succinic acid(DB00139)	C	VAL/ALA	0,4406		0,0,2203	80.0	64.0	70.0		371	-2.4	0.0	17		70	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRPL12	NM_002949.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		124/199	79673961	1,13005	2203	4300	6503	SO:0001583	missense	1468				gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding	g.chr17:79673961C>T	X79865	CCDS11785.1	17q25	2012-11-14			ENSG00000262814	ENSG00000262814		"""Mitochondrial ribosomal proteins / large subunits"""	10378	protein-coding gene	gene with protein product		602375		RPML12		8626705, 9169145	Standard	NM_002949		Approved	MRPL7/L12, MRPL7		P52815	OTTHUMG00000178171	ENST00000333676.3:c.371C>T	17.37:g.79673961C>T	ENSP00000333837:p.Ala124Val		Somatic				MRPL12_uc002kbh.1_Missense_Mutation_p.A124V	p.A124V	NM_012140	NP_036272	WXS	Illumina HiSeq	Unspecified	Q9UBX3	DIC_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		4	496	+	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		Error:Variant_position_missing_in_Q9UBX3_after_alignment					Q969U0|Q9HCA2|Q9UQJ3	Missense_Mutation	SNP	ENST00000333676.3	37	c.371C>T	CCDS11785.1	.	.	.	.	.	.	.	.	.	.	C	9.383	1.073408	0.20147	0.0	1.16E-4	ENSG00000183048	ENST00000541223;ENST00000333676;ENST00000332396	D;T	0.81908	-1.55;0.74	4.24	-2.38	0.06622	.	0.309092	0.34025	N	0.004337	T	0.59432	0.2193	N	0.21194	0.64	0.80722	D	1	B;B	0.34061	0.063;0.436	B;B	0.18561	0.011;0.022	T	0.31586	-0.9938	10	0.31617	T	0.26	-13.6047	4.0184	0.09654	0.4242:0.385:0.071:0.1198	.	124;124	B4DLN1;P52815	.;RM12_HUMAN	V	124	ENSP00000439565:A124V;ENSP00000333837:A124V	ENSP00000330017:A124V	A	+	2	0	SLC25A10	77284366	1.000000	0.71417	0.014000	0.15608	0.023000	0.10783	2.265000	0.43311	-0.780000	0.04553	-1.072000	0.02254	GCG		0.562	MRPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440812.1	NM_002949		17	13	0	0	0	0	17	13				
COLEC12	81035	broad.mit.edu	37	18	335145	335145	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr18:335145C>A	ENST00000400256.3	-	6	1620	c.1413G>T	c.(1411-1413)gaG>gaT	p.E471D		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	471	Collagen-like 1.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GCTCCCCCTTCTCTCCTTTCT	0.632																																						uc002kkm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1411-1413)GAG>GAT		collectin sub-family member 12							32.0	34.0	34.0					18																	335145		2196	4293	6489	SO:0001583	missense	81035				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity	g.chr18:335145C>A	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1413G>T	18.37:g.335145C>A	ENSP00000383115:p.Glu471Asp		Somatic					p.E471D	NM_130386	NP_569057	WXS	Illumina HiSeq	Unspecified	Q5KU26	COL12_HUMAN			6	1628	-		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)	471			Collagen-like 1.|Extracellular (Potential).		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	37	c.1413G>T	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	C	7.177	0.588721	0.13812	.	.	ENSG00000158270	ENST00000400256	T	0.16897	2.31	5.66	1.9	0.25705	.	0.000000	0.85682	D	0.000000	T	0.06690	0.0171	N	0.16066	0.365	0.49687	D	0.999811	B	0.13594	0.008	B	0.20184	0.028	T	0.27434	-1.0074	10	0.10111	T	0.7	-28.2131	1.6388	0.02748	0.197:0.4416:0.1023:0.2591	.	471	Q5KU26	COL12_HUMAN	D	471	ENSP00000383115:E471D	ENSP00000383115:E471D	E	-	3	2	COLEC12	325145	0.029000	0.19370	0.996000	0.52242	0.994000	0.84299	-1.123000	0.03263	0.338000	0.23692	0.655000	0.94253	GAG		0.632	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1			14	42	1	0	0.00185496	0.00199474	14	42				
ZNF521	25925	broad.mit.edu	37	18	22806343	22806343	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr18:22806343G>C	ENST00000361524.3	-	4	1687	c.1539C>G	c.(1537-1539)ttC>ttG	p.F513L	ZNF521_ENST00000584787.1_Missense_Mutation_p.F293L|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.F513L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	513					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGGGACAAAAGAATGCATTAC	0.458			T	PAX5	ALL																																	uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(1537-1539)TTC>TTG		zinc finger protein 521							81.0	85.0	84.0					18																	22806343		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22806343G>C	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1539C>G	18.37:g.22806343G>C	ENSP00000354794:p.Phe513Leu		Somatic				ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.F513L|ZNF521_uc002kvl.2_Missense_Mutation_p.F293L	p.F513L	NM_015461	NP_056276	WXS	Illumina HiSeq	Unspecified	Q96K83	ZN521_HUMAN			4	1786	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		513			C2H2-type 12.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.1539C>G	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	8.268	0.812606	0.16537	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.30981	1.51;1.51	5.87	4.1	0.47936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.42040	0.1185	L	0.34521	1.04	0.34795	D	0.736073	D	0.76494	0.999	D	0.85130	0.997	T	0.54866	-0.8229	10	0.72032	D	0.01	-25.4693	10.3523	0.43943	0.2012:0.0:0.7988:0.0	.	513	Q96K83	ZN521_HUMAN	L	513;547;513	ENSP00000354794:F513L;ENSP00000382352:F513L	ENSP00000354794:F513L	F	-	3	2	ZNF521	21060341	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	4.570000	0.60872	0.833000	0.34828	-0.127000	0.14921	TTC		0.458	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		21	51	0	0	0	0	21	51				
CXXC1	30827	broad.mit.edu	37	18	47810844	47810844	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr18:47810844G>A	ENST00000285106.6	-	9	1823	c.1109C>T	c.(1108-1110)gCg>gTg	p.A370V	MBD1_ENST00000339998.6_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.A370V|MBD1_ENST00000347968.3_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.A374V|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	370					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						GGGCAGTGACGCAGGGTCCTT	0.597																																						uc002leq.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1108-1110)GCG>GTG		CXXC finger 1 (PHD domain) isoform 2																																				SO:0001583	missense	30827				histone H3-K4 methylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|Set1C/COMPASS complex	protein binding|unmethylated CpG binding|zinc ion binding	g.chr18:47810844G>A	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1109C>T	18.37:g.47810844G>A	ENSP00000285106:p.Ala370Val		Somatic				MBD1_uc002leg.2_5'Flank|MBD1_uc010dow.1_5'Flank|MBD1_uc002leh.3_5'Flank|MBD1_uc002len.2_5'Flank|MBD1_uc002lei.3_5'Flank|MBD1_uc002lej.3_5'Flank|MBD1_uc002lek.3_5'Flank|MBD1_uc002lel.3_5'Flank|MBD1_uc002lem.3_5'Flank|MBD1_uc010xdj.1_5'Flank|MBD1_uc010xdk.1_5'Flank|MBD1_uc002leo.2_5'Flank|CXXC1_uc002lep.3_Missense_Mutation_p.A227V|CXXC1_uc002ler.3_Missense_Mutation_p.A374V|CXXC1_uc010doy.2_Missense_Mutation_p.A370V|CXXC1_uc002les.2_Missense_Mutation_p.A370V	p.A370V	NM_014593	NP_055408	WXS	Illumina HiSeq	Unspecified	Q9P0U4	CXXC1_HUMAN			9	1842	-			370					B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	c.1109C>T	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	G	9.969	1.224983	0.22457	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.23950	1.89;1.88	3.9	3.9	0.45041	.	0.616851	0.15965	U	0.236046	T	0.11324	0.0276	N	0.03608	-0.345	0.09310	N	0.999996	B;B;B;B	0.29253	0.154;0.239;0.154;0.04	B;B;B;B	0.15870	0.004;0.014;0.004;0.003	T	0.15093	-1.0449	10	0.31617	T	0.26	-6.7102	13.7315	0.62789	0.0:0.0:1.0:0.0	.	370;374;370;237	B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;CXXC1_HUMAN;.	V	370;374	ENSP00000285106:A370V;ENSP00000390475:A374V	ENSP00000285106:A370V	A	-	2	0	CXXC1	46064842	0.546000	0.26457	0.882000	0.34594	0.730000	0.41778	4.221000	0.58574	1.896000	0.54893	0.297000	0.19635	GCG		0.597	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593		13	120	0	0	0	0	13	120				
ME2	4200	broad.mit.edu	37	18	48447048	48447048	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr18:48447048C>G	ENST00000321341.5	+	9	1134	c.862C>G	c.(862-864)Cta>Gta	p.L288V	ME2_ENST00000382927.3_Missense_Mutation_p.L288V	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	288					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		TGCAGTAGCTCTAGCAGGTCT	0.348																																						uc002ley.2		NA																	0					0						c.(862-864)CTA>GTA		malic enzyme 2, NAD(+)-dependent, mitochondrial	NADH(DB00157)						61.0	64.0	63.0					18																	48447048		2203	4296	6499	SO:0001583	missense	4200				malate metabolic process	mitochondrial matrix	electron carrier activity|malate dehydrogenase (decarboxylating) activity|malate dehydrogenase (oxaloacetate-decarboxylating) activity|metal ion binding|NAD binding	g.chr18:48447048C>G	M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.862C>G	18.37:g.48447048C>G	ENSP00000321070:p.Leu288Val		Somatic				ME2_uc010dpd.2_Missense_Mutation_p.L288V	p.L288V	NM_002396	NP_002387	WXS	Illumina HiSeq	Unspecified	P23368	MAOM_HUMAN		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)	9	1118	+		Colorectal(6;0.0273)|all_epithelial(6;0.118)	288					B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Missense_Mutation	SNP	ENST00000321341.5	37	c.862C>G	CCDS11948.1	.	.	.	.	.	.	.	.	.	.	C	4.720	0.133958	0.09032	.	.	ENSG00000082212	ENST00000321341;ENST00000382927	T;T	0.34472	1.36;1.36	5.73	1.9	0.25705	Malic enzyme, conserved site (1);Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	L	0.33137	0.985	0.48288	D	0.999626	B;B	0.14012	0.003;0.009	B;B	0.25405	0.06;0.03	T	0.16897	-1.0387	10	0.02654	T	1	-15.6398	9.7916	0.40708	0.0:0.6438:0.0:0.3562	.	288;288	Q9BWL6;P23368	.;MAOM_HUMAN	V	288	ENSP00000321070:L288V;ENSP00000372384:L288V	ENSP00000321070:L288V	L	+	1	2	ME2	46701046	0.003000	0.15002	0.791000	0.31998	0.904000	0.53231	0.072000	0.14617	0.061000	0.16311	0.637000	0.83480	CTA		0.348	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255991.1	NM_002396		40	50	0	0	0	0	40	50				
ONECUT2	9480	broad.mit.edu	37	18	55143901	55143901	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr18:55143901C>T	ENST00000491143.2	+	2	1493	c.1461C>T	c.(1459-1461)gaC>gaT	p.D487D		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	487					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		AGTGGCAAGACGATCTGAGCA	0.572																																						uc002lgo.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1459-1461)GAC>GAT		one cut domain, family member 2							35.0	39.0	38.0					18																	55143901		2073	4228	6301	SO:0001819	synonymous_variant	9480				organ morphogenesis	nucleus	sequence-specific DNA binding	g.chr18:55143901C>T	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1461C>T	18.37:g.55143901C>T			Somatic					p.D487D	NM_004852	NP_004843	WXS	Illumina HiSeq	Unspecified	O95948	ONEC2_HUMAN		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)	2	1493	+		Colorectal(73;0.234)	487						Silent	SNP	ENST00000491143.2	37	c.1461C>T	CCDS42440.1	.	.	.	.	.	.	.	.	.	.	C	3.529	-0.096191	0.07010	.	.	ENSG00000119547	ENST00000481727	.	.	.	5.9	-3.78	0.04333	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-25.3136	10.2545	0.43388	0.0924:0.2908:0.0:0.6168	.	.	.	.	X	116	.	.	R	+	1	2	ONECUT2	53294899	0.000000	0.05858	0.759000	0.31340	0.666000	0.39218	-2.348000	0.01094	-1.253000	0.02488	-1.899000	0.00529	CGA		0.572	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3			7	35	0	0	0	0	7	35				
DOK6	220164	broad.mit.edu	37	18	67365664	67365664	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr18:67365664C>G	ENST00000382713.5	+	5	624	c.434C>G	c.(433-435)cCt>cGt	p.P145R	DOK6_ENST00000584435.1_3'UTR	NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	145	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.									central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				TATCTTATGCCTACACCAAAC	0.398																																						uc002lkl.2		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						c.(433-435)CCT>CGT		docking protein 6							124.0	110.0	114.0					18																	67365664		2203	4300	6503	SO:0001583	missense	220164						insulin receptor binding	g.chr18:67365664C>G	AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.434C>G	18.37:g.67365664C>G	ENSP00000372160:p.Pro145Arg		Somatic					p.P145R	NM_152721	NP_689934	WXS	Illumina HiSeq	Unspecified	Q6PKX4	DOK6_HUMAN			5	624	+		Colorectal(73;0.083)|Esophageal squamous(42;0.131)	145			IRS-type PTB.		A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Missense_Mutation	SNP	ENST00000382713.5	37	c.434C>G	CCDS32841.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902062	0.52227	.	.	ENSG00000206052	ENST00000382713	D	0.83419	-1.72	5.89	5.89	0.94794	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.88952	0.6577	L	0.56199	1.76	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.84968	0.0881	10	0.22109	T	0.4	-26.9366	19.2242	0.93812	0.0:1.0:0.0:0.0	.	145	Q6PKX4	DOK6_HUMAN	R	145	ENSP00000372160:P145R	ENSP00000372160:P145R	P	+	2	0	DOK6	65516644	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.706000	0.84615	2.791000	0.96007	0.591000	0.81541	CCT		0.398	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721		11	37	0	0	0	0	11	37				
DUS3L	56931	broad.mit.edu	37	19	5785684	5785684	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:5785684A>T	ENST00000309061.7	-	11	1777	c.1681T>A	c.(1681-1683)Tgg>Agg	p.W561R	DUS3L_ENST00000320699.8_Missense_Mutation_p.W319R|PRR22_ENST00000419421.2_5'Flank|CTB-54O9.9_ENST00000586012.1_5'Flank	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	561							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						TCCGAGCCCCAGTGCTCCAGG	0.677																																						uc002mdc.2		NA																	0					0						c.(1681-1683)TGG>AGG		dihydrouridine synthase 3-like isoform 1							31.0	32.0	32.0					19																	5785684		2202	4296	6498	SO:0001583	missense	56931				tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding	g.chr19:5785684A>T		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.1681T>A	19.37:g.5785684A>T	ENSP00000311977:p.Trp561Arg		Somatic				PRR22_uc002mdb.1_5'Flank|PRR22_uc010xiv.1_5'Flank|DUS3L_uc002mdd.2_Missense_Mutation_p.W319R|DUS3L_uc010duk.2_Missense_Mutation_p.W226R	p.W561R	NM_020175	NP_064560	WXS	Illumina HiSeq	Unspecified	Q96G46	DUS3L_HUMAN			11	1778	-			561					Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	37	c.1681T>A	CCDS32880.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.400096	0.83120	.	.	ENSG00000141994	ENST00000309061;ENST00000320699	T;T	0.28454	1.61;1.61	4.45	4.45	0.53987	.	0.062125	0.64402	D	0.000001	T	0.55784	0.1942	M	0.79693	2.465	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.61744	-0.7000	10	0.87932	D	0	-21.6883	11.6902	0.51510	1.0:0.0:0.0:0.0	.	319;561	Q96G46-3;Q96G46	.;DUS3L_HUMAN	R	561;319	ENSP00000311977:W561R;ENSP00000315558:W319R	ENSP00000311977:W561R	W	-	1	0	DUS3L	5736684	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.840000	0.92125	1.667000	0.50832	0.454000	0.30748	TGG		0.677	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175		6	18	0	0	0	0	6	18				
TUBB4A	10382	broad.mit.edu	37	19	6495873	6495873	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:6495873G>A	ENST00000264071.2	-	4	1008	c.637C>T	c.(637-639)Cgc>Tgc	p.R213C	TUBB4A_ENST00000540257.1_Missense_Mutation_p.R213C|CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	213					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										TTGAGGGTGCGGAAACAGATG	0.627																																						uc002mfg.1		NA																	0				ovary(2)	2						c.(637-639)CGC>TGC		tubulin, beta 4							211.0	148.0	169.0					19																	6495873		2203	4300	6503	SO:0001583	missense	10382				'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr19:6495873G>A	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.637C>T	19.37:g.6495873G>A	ENSP00000264071:p.Arg213Cys		Somatic				TUBB4_uc002mff.1_Missense_Mutation_p.R141C|MIR220B_hsa-mir-220b|MI0005529_5'Flank	p.R213C	NM_006087	NP_006078	WXS	Illumina HiSeq	Unspecified	P04350	TBB4_HUMAN		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)	4	744	-		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)	213					B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	c.637C>T	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012353	0.54468	.	.	ENSG00000104833	ENST00000264071;ENST00000540257	T;T	0.70282	-0.47;-0.47	3.98	3.98	0.46160	.	0.000000	0.64402	D	0.000004	D	0.87289	0.6140	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.91095	0.4910	10	0.87932	D	0	.	14.999	0.71455	0.0:0.0:1.0:0.0	.	213	P04350	TBB4A_HUMAN	C	213	ENSP00000264071:R213C;ENSP00000443590:R213C	ENSP00000264071:R213C	R	-	1	0	TUBB4	6446873	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.708000	0.84633	1.795000	0.52594	0.549000	0.68633	CGC		0.627	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087		31	105	0	0	0	0	31	105				
STXBP2	6813	broad.mit.edu	37	19	7708073	7708073	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:7708073C>G	ENST00000221283.5	+	13	1080	c.1049C>G	c.(1048-1050)gCa>gGa	p.A350G	STXBP2_ENST00000414284.2_Missense_Mutation_p.A347G|STXBP2_ENST00000602355.1_5'Flank|STXBP2_ENST00000441779.2_Missense_Mutation_p.A361G	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	350					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						CTGCATCTAGCAGATGATTGT	0.587																																						uc002mha.3		NA																	0				central_nervous_system(1)	1						c.(1048-1050)GCA>GGA		syntaxin binding protein 2 isoform a							91.0	74.0	80.0					19																	7708073		2203	4300	6503	SO:0001583	missense	6813				leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding	g.chr19:7708073C>G	U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.1049C>G	19.37:g.7708073C>G	ENSP00000221283:p.Ala350Gly		Somatic				STXBP2_uc002mhb.3_Missense_Mutation_p.A347G|STXBP2_uc010dvj.2_Intron|STXBP2_uc010xjr.1_Missense_Mutation_p.A361G|STXBP2_uc010dvk.2_Missense_Mutation_p.A318G|STXBP2_uc002mhc.3_Missense_Mutation_p.A118G|STXBP2_uc002mhe.1_5'Flank	p.A350G	NM_006949	NP_008880	WXS	Illumina HiSeq	Unspecified	Q15833	STXB2_HUMAN			13	1094	+			350					B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	ENST00000221283.5	37	c.1049C>G	CCDS12181.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880317	0.51801	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.80653	-1.4;-1.4;-1.4	5.22	4.17	0.49024	.	0.123968	0.52532	D	0.000068	D	0.90686	0.7078	M	0.92026	3.265	0.80722	D	1	D;P;D;D	0.89917	1.0;0.956;1.0;1.0	D;D;D;D	0.87578	0.998;0.958;0.996;0.998	D	0.92037	0.5638	10	0.87932	D	0	-10.264	11.9174	0.52774	0.0:0.9127:0.0:0.0873	.	361;316;347;350	E7EQD5;B4DY46;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	G	350;347;361;350	ENSP00000221283:A350G;ENSP00000409471:A347G;ENSP00000413606:A361G	ENSP00000221283:A350G	A	+	2	0	STXBP2	7614073	1.000000	0.71417	0.076000	0.20297	0.003000	0.03518	7.608000	0.82898	2.443000	0.82685	0.491000	0.48974	GCA		0.587	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1	NM_006949		9	37	0	0	0	0	9	37				
ZNF443	10224	broad.mit.edu	37	19	12541320	12541320	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:12541320C>T	ENST00000301547.5	-	4	1863	c.1666G>A	c.(1666-1668)Gga>Aga	p.G556R	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	556					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GGCTTCTCTCCAGAGTGAATT	0.388																																						uc002mtu.2		NA																	0				pancreas(1)	1						c.(1666-1668)GGA>AGA		zinc finger protein 443							98.0	97.0	97.0					19																	12541320		2203	4300	6503	SO:0001583	missense	10224				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12541320C>T	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1666G>A	19.37:g.12541320C>T	ENSP00000301547:p.Gly556Arg		Somatic					p.G556R	NM_005815	NP_005806	WXS	Illumina HiSeq	Unspecified	Q9Y2A4	ZN443_HUMAN			4	1864	-			556						Missense_Mutation	SNP	ENST00000301547.5	37	c.1666G>A	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010009	0.54361	.	.	ENSG00000180855	ENST00000301547	T	0.26223	1.75	1.37	0.295	0.15752	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37758	0.1015	L	0.48260	1.515	0.33253	D	0.558797	D	0.89917	1.0	D	0.83275	0.996	T	0.48714	-0.9011	9	0.66056	D	0.02	.	6.9386	0.24481	0.0:0.8319:0.0:0.1681	.	556	Q9Y2A4	ZN443_HUMAN	R	556	ENSP00000301547:G556R	ENSP00000301547:G556R	G	-	1	0	ZNF443	12402320	0.903000	0.30736	0.175000	0.22980	0.350000	0.29205	3.457000	0.53007	0.155000	0.19261	0.461000	0.40582	GGA		0.388	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815		11	49	0	0	0	0	11	49				
DCAF15	90379	broad.mit.edu	37	19	14070284	14070284	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:14070284G>A	ENST00000254337.6	+	7	1233	c.1212G>A	c.(1210-1212)ccG>ccA	p.P404P		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	404					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						GGACGGAGCCGGAGGATGGTG	0.687																																						uc002mxt.2		NA																	0				central_nervous_system(1)	1						c.(1210-1212)CCG>CCA		DDB1 and CUL4 associated factor 15							27.0	34.0	31.0					19																	14070284		2197	4285	6482	SO:0001819	synonymous_variant	90379							g.chr19:14070284G>A	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1212G>A	19.37:g.14070284G>A			Somatic				DCAF15_uc002mxu.2_5'Flank	p.P404P	NM_138353	NP_612362	WXS	Illumina HiSeq	Unspecified	Q66K64	DCA15_HUMAN			7	1218	+			404					B3KS86|Q96DW0|Q9BU31	Silent	SNP	ENST00000254337.6	37	c.1212G>A	CCDS32926.1																																																																																				0.687	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353		25	49	0	0	0	0	25	49				
NOTCH3	4854	broad.mit.edu	37	19	15276316	15276316	+	Missense_Mutation	SNP	C	C	T	rs372834264		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:15276316C>T	ENST00000263388.2	-	31	5753	c.5678G>A	c.(5677-5679)cGa>cAa	p.R1893Q		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1893					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGAGCGGTTTCGGATGAGAAT	0.592																																						uc002nan.2		NA																	0				lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21						c.(5677-5679)CGA>CAA		Notch homolog 3 precursor		C	GLN/ARG	0,4406		0,0,2203	53.0	52.0	52.0		5678	4.9	1.0	19		52	1,8599	1.2+/-3.3	0,1,4299	no	missense	NOTCH3	NM_000435.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1893/2322	15276316	1,13005	2203	4300	6503	SO:0001583	missense	4854				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr19:15276316C>T	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5678G>A	19.37:g.15276316C>T	ENSP00000263388:p.Arg1893Gln		Somatic					p.R1893Q	NM_000435	NP_000426	WXS	Illumina HiSeq	Unspecified	Q9UM47	NOTC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)		31	5754	-			1893			ANK 2.|Cytoplasmic (Potential).		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	c.5678G>A	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470380	0.84533	0.0	1.16E-4	ENSG00000074181	ENST00000263388	T	0.63744	-0.06	4.9	4.9	0.64082	Ankyrin repeat-containing domain (4);	0.000000	0.30201	N	0.010173	T	0.67040	0.2851	N	0.17594	0.5	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.71777	-0.4490	10	0.59425	D	0.04	.	17.02	0.86431	0.0:1.0:0.0:0.0	.	1893	Q9UM47	NOTC3_HUMAN	Q	1893	ENSP00000263388:R1893Q	ENSP00000263388:R1893Q	R	-	2	0	NOTCH3	15137316	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	7.176000	0.77643	2.560000	0.86352	0.561000	0.74099	CGA		0.592	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435		6	22	0	0	0	0	6	22				
CEBPG	1054	broad.mit.edu	37	19	33870422	33870422	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:33870422A>T	ENST00000284000.4	+	2	939	c.277A>T	c.(277-279)Aga>Tga	p.R93*	CEBPG_ENST00000585933.2_Nonsense_Mutation_p.R93*	NM_001806.3	NP_001797.1	P53567	CEBPG_HUMAN	CCAAT/enhancer binding protein (C/EBP), gamma	93	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				B cell differentiation (GO:0030183)|enucleate erythrocyte differentiation (GO:0043353)|immune response (GO:0006955)|liver development (GO:0001889)|mRNA metabolic process (GO:0016071)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of DNA binding (GO:0043388)|positive regulation of DNA repair (GO:0045739)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	7	Esophageal squamous(110;0.137)					CACACTGCAGAGAGTCAATCA	0.438																																						uc002nup.2		NA																	0					0						c.(277-279)AGA>TGA		CCAAT/enhancer binding protein gamma							102.0	90.0	94.0					19																	33870422		2203	4300	6503	SO:0001587	stop_gained	1054				B cell differentiation|enucleate erythrocyte differentiation|liver development|natural killer cell mediated cytotoxicity|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of DNA binding|positive regulation of DNA repair|positive regulation of interferon-gamma biosynthetic process|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr19:33870422A>T	U20240	CCDS12432.1	19q13.2	2013-01-10				ENSG00000153879		"""basic leucine zipper proteins"""	1837	protein-coding gene	gene with protein product		138972				1884998	Standard	NM_001806		Approved	GPE1BP, IG/EBP-1	uc021usd.1	P53567		ENST00000284000.4:c.277A>T	19.37:g.33870422A>T	ENSP00000284000:p.Arg93*		Somatic					p.R93*	NM_001806	NP_001797	WXS	Illumina HiSeq	Unspecified	P53567	CEBPG_HUMAN			2	566	+	Esophageal squamous(110;0.137)		93					B2R946|Q5U052	Nonsense_Mutation	SNP	ENST00000284000.4	37	c.277A>T	CCDS12432.1	.	.	.	.	.	.	.	.	.	.	A	37	6.176761	0.97348	.	.	ENSG00000153879	ENST00000284000	.	.	.	5.87	2.37	0.29283	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-34.0188	12.9724	0.58520	0.6163:0.3837:0.0:0.0	.	.	.	.	X	93	.	ENSP00000284000:R93X	R	+	1	2	CEBPG	38562262	1.000000	0.71417	0.987000	0.45799	0.826000	0.46750	4.307000	0.59123	0.517000	0.28361	0.533000	0.62120	AGA		0.438	CEBPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451427.2	NM_001806		9	12	0	0	0	0	9	12				
SIPA1L3	23094	broad.mit.edu	37	19	38591744	38591744	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:38591744C>G	ENST00000222345.6	+	6	2416	c.1907C>G	c.(1906-1908)tCc>tGc	p.S636C		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	636	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GGCCAGAGCTCCGAGGAGGAG	0.607																																						uc002ohk.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1906-1908)TCC>TGC		signal-induced proliferation-associated 1 like							42.0	41.0	42.0					19																	38591744		2203	4300	6503	SO:0001583	missense	23094				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr19:38591744C>G	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.1907C>G	19.37:g.38591744C>G	ENSP00000222345:p.Ser636Cys		Somatic					p.S636C	NM_015073	NP_055888	WXS	Illumina HiSeq	Unspecified	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		6	2416	+			636			Rap-GAP.		Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	c.1907C>G	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041966	0.93685	.	.	ENSG00000105738	ENST00000222345	D	0.94537	-3.45	5.11	5.11	0.69529	Rap/ran-GAP (1);	0.058891	0.64402	D	0.000001	D	0.97371	0.9140	M	0.90650	3.135	0.48830	D	0.999716	D	0.54772	0.968	P	0.59889	0.865	D	0.97929	1.0319	10	0.87932	D	0	-26.18	17.8292	0.88676	0.0:1.0:0.0:0.0	.	636	O60292	SI1L3_HUMAN	C	636	ENSP00000222345:S636C	ENSP00000222345:S636C	S	+	2	0	SIPA1L3	43283584	1.000000	0.71417	0.991000	0.47740	0.919000	0.55068	4.393000	0.59665	2.816000	0.96949	0.561000	0.74099	TCC		0.607	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278		8	28	0	0	0	0	8	28				
LIPE	3991	broad.mit.edu	37	19	42912238	42912238	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:42912238A>G	ENST00000244289.4	-	4	1822	c.1546T>C	c.(1546-1548)Ttt>Ctt	p.F516L	LIPE-AS1_ENST00000594624.2_RNA|LIPE_ENST00000602000.1_5'UTR|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	516					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				TCGATGGCAAAGCGGCCGCTG	0.627																																						uc002otr.2		NA																	0				ovary(1)|breast(1)	2						c.(1546-1548)TTT>CTT		hormone-sensitive lipase							75.0	77.0	77.0					19																	42912238		2203	4300	6503	SO:0001583	missense	3991				cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding	g.chr19:42912238A>G	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1546T>C	19.37:g.42912238A>G	ENSP00000244289:p.Phe516Leu		Somatic				uc010eif.1_Intron|LIPE_uc002ots.1_Missense_Mutation_p.F261L	p.F516L	NM_005357	NP_005348	WXS	Illumina HiSeq	Unspecified	Q05469	LIPS_HUMAN			4	1823	-		Prostate(69;0.00682)	516					Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	c.1546T>C	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699442	0.68501	.	.	ENSG00000079435	ENST00000244289	T	0.34072	1.38	4.3	4.3	0.51218	Hormone-sensitive lipase, N-terminal (1);	0.261873	0.32204	N	0.006427	T	0.45637	0.1352	L	0.27053	0.805	0.43930	D	0.99658	B;D	0.63046	0.279;0.992	B;D	0.76071	0.115;0.987	T	0.48352	-0.9043	10	0.72032	D	0.01	-9.3274	12.725	0.57166	1.0:0.0:0.0:0.0	.	516;516	A8K8W7;Q05469	.;LIPS_HUMAN	L	516	ENSP00000244289:F516L	ENSP00000244289:F516L	F	-	1	0	LIPE	47604078	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	5.869000	0.69613	1.723000	0.51488	0.459000	0.35465	TTT		0.627	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357		14	74	0	0	0	0	14	74				
PPFIA3	8541	broad.mit.edu	37	19	49636571	49636571	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:49636571G>A	ENST00000334186.4	+	9	1453	c.1104G>A	c.(1102-1104)gcG>gcA	p.A368A	PPFIA3_ENST00000602351.1_Silent_p.A368A	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	368					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGCAGAAAGCGGAGACCTTGC	0.677																																						uc002pmr.2		NA																	0				lung(1)	1						c.(1102-1104)GCG>GCA		PTPRF interacting protein alpha 3							28.0	31.0	30.0					19																	49636571		2196	4286	6482	SO:0001819	synonymous_variant	8541					cell surface|cytoplasm	protein binding	g.chr19:49636571G>A	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1104G>A	19.37:g.49636571G>A			Somatic				PPFIA3_uc010yai.1_RNA|PPFIA3_uc010emt.2_Silent_p.A292A|PPFIA3_uc010yaj.1_RNA|PPFIA3_uc002pms.2_Silent_p.A236A	p.A368A	NM_003660	NP_003651	WXS	Illumina HiSeq	Unspecified	O75145	LIPA3_HUMAN		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)	9	1436	+		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	368			Potential.		A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	ENST00000334186.4	37	c.1104G>A	CCDS12758.1																																																																																				0.677	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660		8	44	0	0	0	0	8	44				
SPIB	6689	broad.mit.edu	37	19	50925756	50925756	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:50925756G>A	ENST00000595883.1	+	3	103	c.78G>A	c.(76-78)ctG>ctA	p.L26L	CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.G161R|SPIB_ENST00000596074.1_Silent_p.L26L|SPIB_ENST00000270632.7_Silent_p.L26L|SPIB_ENST00000439922.2_Nonsense_Mutation_p.W7*|SPIB_ENST00000597855.1_Silent_p.L26L	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	26	TAD1 (Acidic).				cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TCTATGACCTGGACAGCTGCA	0.612																																						uc002psd.2		NA																	0				lung(1)|kidney(1)	2						c.(76-78)CTG>CTA		Spi-B transcription factor (Spi-1/PU.1 related)							57.0	50.0	52.0					19																	50925756		2203	4300	6503	SO:0001819	synonymous_variant	6689				regulation of transcription from RNA polymerase II promoter	cytoplasm|microtubule cytoskeleton|nucleus	sequence-specific DNA binding	g.chr19:50925756G>A		CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.78G>A	19.37:g.50925756G>A			Somatic				SPIB_uc002pse.2_Silent_p.L26L|SPIB_uc010ycc.1_Nonsense_Mutation_p.W7*	p.L26L	NM_003121	NP_003112	WXS	Illumina HiSeq	Unspecified	Q01892	SPIB_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)	3	103	+		all_neural(266;0.131)	26			TAD1 (Acidic).		A8K9C9|B4DUG6|Q15359	Silent	SNP	ENST00000595883.1	37	c.78G>A	CCDS33080.1	.	.	.	.	.	.	.	.	.	.	G	35	5.521152	0.96416	.	.	ENSG00000142539	ENST00000439922	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	12.7358	14.7444	0.69480	0.0:0.0:1.0:0.0	.	.	.	.	X	7	.	ENSP00000391877:W7X	W	+	2	0	SPIB	55617568	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.289000	0.43523	2.409000	0.81822	0.591000	0.81541	TGG		0.612	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464744.1	NM_003121		16	21	0	0	0	0	16	21				
SIGLEC12	89858	broad.mit.edu	37	19	51994964	51994964	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:51994964C>T	ENST00000291707.3	-	8	1774	c.1719G>A	c.(1717-1719)gcG>gcA	p.A573A	SIGLEC12_ENST00000598614.1_Silent_p.A455A	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	573					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		ACTGAGGCCTCGCTTTGTGGA	0.597																																						uc002pwx.1		NA																	0				ovary(3)|skin(2)	5						c.(1717-1719)GCG>GCA		sialic acid binding immunoglobulin-like							111.0	96.0	101.0					19																	51994964		2203	4300	6503	SO:0001819	synonymous_variant	89858				cell adhesion	integral to membrane	sugar binding	g.chr19:51994964C>T	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1719G>A	19.37:g.51994964C>T			Somatic				SIGLEC12_uc002pww.1_Silent_p.A455A|SIGLEC12_uc010eoy.1_Silent_p.A300A	p.A573A	NM_053003	NP_443729	WXS	Illumina HiSeq	Unspecified	Q96PQ1	SIG12_HUMAN		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)	8	1775	-		all_neural(266;0.0199)	573			Cytoplasmic (Potential).		Q8IYH7	Silent	SNP	ENST00000291707.3	37	c.1719G>A	CCDS12833.1																																																																																				0.597	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003		16	159	0	0	0	0	16	159				
ZNF615	284370	broad.mit.edu	37	19	52497522	52497522	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:52497522G>A	ENST00000602063.1	-	6	1156	c.807C>T	c.(805-807)ttC>ttT	p.F269F	ZNF615_ENST00000594083.1_Silent_p.F280F|ZNF615_ENST00000376716.5_Silent_p.F269F|ZNF615_ENST00000598071.1_Silent_p.F280F|ZNF615_ENST00000391795.3_Silent_p.F274F			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	269					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		ATTTCTTGAGGAAGGTTTTGT	0.413																																						uc002pye.1		NA																	0				ovary(4)|skin(1)	5						c.(805-807)TTC>TTT		zinc finger protein 615							168.0	153.0	158.0					19																	52497522		2203	4300	6503	SO:0001819	synonymous_variant	284370				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52497522G>A	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.807C>T	19.37:g.52497522G>A			Somatic				ZNF615_uc002pyf.1_Silent_p.F280F|ZNF615_uc002pyg.1_Silent_p.F161F|ZNF615_uc002pyh.1_Silent_p.F280F|ZNF615_uc010epi.1_Silent_p.F276F|ZNF615_uc010ydg.1_Silent_p.F274F	p.F269F	NM_198480	NP_940882	WXS	Illumina HiSeq	Unspecified	Q8N8J6	ZN615_HUMAN		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)	6	1099	-		all_neural(266;0.117)	269			C2H2-type 3.		B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	37	c.807C>T	CCDS12846.1																																																																																				0.413	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480		24	220	0	0	0	0	24	220				
ZNF28	7576	broad.mit.edu	37	19	53303120	53303120	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:53303120C>G	ENST00000457749.2	-	4	2097	c.1978G>C	c.(1978-1980)Gag>Cag	p.E660Q	ZNF28_ENST00000438150.2_Missense_Mutation_p.E607Q|ZNF28_ENST00000414252.2_Missense_Mutation_p.E607Q|ZNF28_ENST00000360272.4_Missense_Mutation_p.E607Q	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	660					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TAAGGTTTCTCTCCACTATGA	0.423																																						uc002qad.2		NA																	0				skin(1)	1						c.(1978-1980)GAG>CAG		zinc finger protein 28							170.0	160.0	163.0					19																	53303120		2203	4300	6503	SO:0001583	missense	7576				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53303120C>G	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1978G>C	19.37:g.53303120C>G	ENSP00000397693:p.Glu660Gln		Somatic				ZNF28_uc002qac.2_Missense_Mutation_p.E607Q|ZNF28_uc010eqe.2_Missense_Mutation_p.E606Q	p.E660Q	NM_006969	NP_008900	WXS	Illumina HiSeq	Unspecified	P17035	ZNF28_HUMAN		GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)	4	2098	-			660					A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	c.1978G>C	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	16.88	3.244264	0.59103	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	1.81	1.81	0.25067	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26919	0.0659	L	0.45744	1.44	0.25326	N	0.98908	P	0.45902	0.868	P	0.44623	0.455	T	0.12116	-1.0560	9	0.72032	D	0.01	.	10.6341	0.45554	0.0:1.0:0.0:0.0	.	660	P17035	ZNF28_HUMAN	Q	607;660;607;607	ENSP00000412143:E607Q;ENSP00000397693:E660Q;ENSP00000353410:E607Q;ENSP00000444965:E607Q	ENSP00000353410:E607Q	E	-	1	0	ZNF28	57994932	0.009000	0.17119	0.286000	0.24833	0.064000	0.16182	2.414000	0.44627	0.995000	0.38917	0.298000	0.19748	GAG		0.423	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969		26	231	0	0	0	0	26	231				
ZNF415	55786	broad.mit.edu	37	19	53612314	53612314	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:53612314G>T	ENST00000500065.4	-	4	1317	c.984C>A	c.(982-984)taC>taA	p.Y328*	ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000243643.4_Nonsense_Mutation_p.Y328*|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000448501.1_Nonsense_Mutation_p.Y376*|ZNF415_ENST00000601493.1_Nonsense_Mutation_p.Y98*|ZNF415_ENST00000455735.2_Nonsense_Mutation_p.Y376*|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000440291.1_Nonsense_Mutation_p.Y315*|ZNF415_ENST00000421033.1_Nonsense_Mutation_p.Y340*	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CTTTACATGTGTAAGGTTTCT	0.398																																						uc002qax.2		NA																	0				ovary(1)	1						c.(1126-1128)TAC>TAA		RecName: Full=Zinc finger protein 415;							82.0	76.0	78.0					19																	53612314		2203	4300	6503	SO:0001587	stop_gained	55786				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding	g.chr19:53612314G>T	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.984C>A	19.37:g.53612314G>T	ENSP00000439435:p.Tyr328*		Somatic				ZNF415_uc002qat.2_Nonsense_Mutation_p.Y340*|ZNF415_uc002qaw.2_Nonsense_Mutation_p.Y328*|ZNF415_uc010yds.1_Nonsense_Mutation_p.Y328*|ZNF415_uc010ydt.1_Nonsense_Mutation_p.Y328*|ZNF415_uc002qau.2_Nonsense_Mutation_p.Y315*|ZNF415_uc002qav.2_Nonsense_Mutation_p.Y340*|ZNF415_uc002qba.2_Nonsense_Mutation_p.Y98*|ZNF415_uc002qay.2_Nonsense_Mutation_p.Y315*|ZNF415_uc002qaz.2_Nonsense_Mutation_p.Y376*	p.Y376*	NR_028343		WXS	Illumina HiSeq	Unspecified	Q09FC8	ZN415_HUMAN		GBM - Glioblastoma multiforme(134;0.0191)	7	1477	-			376			C2H2-type 5.		F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Nonsense_Mutation	SNP	ENST00000500065.4	37	c.1128C>A	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981671	0.74474	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	.	.	.	2.78	-0.648	0.11464	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7644	0.23558	0.4696:0.0:0.5304:0.0	.	.	.	.	X	328;328;376;340;376;315	.	ENSP00000243643:Y328X	Y	-	3	2	ZNF415	58304126	0.000000	0.05858	0.007000	0.13788	0.097000	0.18754	-0.656000	0.05342	0.079000	0.16929	0.491000	0.48974	TAC		0.398	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355		40	41	1	0	5.72e-15	6.5e-15	40	41				
ZNF765	91661	broad.mit.edu	37	19	53912281	53912281	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr19:53912281G>A	ENST00000396408.3	+	4	1590	c.1473G>A	c.(1471-1473)caG>caA	p.Q491Q	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		ATACTGGACAGAAACCTTACA	0.378																																						uc010ydx.1		NA																	0					0						c.(1471-1473)CAG>CAA		zinc finger protein 765							65.0	69.0	68.0					19																	53912281		2201	4300	6501	SO:0001819	synonymous_variant	91661				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53912281G>A	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.1473G>A	19.37:g.53912281G>A			Somatic				ZNF765_uc002qbm.2_Silent_p.Q491Q|ZNF765_uc002qbn.2_Intron	p.Q491Q	NM_001040185	NP_001035275	WXS	Illumina HiSeq	Unspecified	Q7L2R6	ZN765_HUMAN		GBM - Glioblastoma multiforme(134;0.00379)	6	1800	+			491					A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Silent	SNP	ENST00000396408.3	37	c.1473G>A	CCDS46171.1																																																																																				0.378	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372		13	98	0	0	0	0	13	98				
ALLC	55821	broad.mit.edu	37	2	3749215	3749215	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:3749215C>T	ENST00000252505.3	+	11	1126	c.964C>T	c.(964-966)Cca>Tca	p.P322S	AC010907.5_ENST00000441632.1_RNA|ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	341					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		ACCACTGCTTCCAGTGACCAA	0.488										HNSCC(21;0.051)																												uc010ewt.2		NA																	0				central_nervous_system(1)	1						c.(964-966)CCA>TCA		allantoicase isoform a							65.0	64.0	64.0					2																	3749215		1949	4150	6099	SO:0001583	missense	55821						allantoicase activity	g.chr2:3749215C>T	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.964C>T	2.37:g.3749215C>T	ENSP00000252505:p.Pro322Ser	HNSCC(21;0.051)	Somatic				ALLC_uc002qyf.2_Missense_Mutation_p.P93S	p.P322S	NM_018436	NP_060906	WXS	Illumina HiSeq	Unspecified	Q8N6M5	ALLC_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)	11	1125	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)	341					Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	c.964C>T	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	C	7.149	0.583357	0.13749	.	.	ENSG00000151360	ENST00000252505	.	.	.	4.53	3.37	0.38596	Allantoicase domain (1);Galactose-binding domain-like (1);	0.117653	0.64402	D	0.000014	T	0.42131	0.1189	L	0.58510	1.815	0.33921	D	0.640918	B	0.30763	0.294	B	0.28305	0.088	T	0.54938	-0.8218	9	0.45353	T	0.12	-12.8194	4.6151	0.12422	0.0:0.7172:0.0:0.2828	.	341	Q8N6M5	ALLC_HUMAN	S	322	.	ENSP00000252505:P322S	P	+	1	0	ALLC	3727090	0.720000	0.27996	0.216000	0.23742	0.004000	0.04260	2.314000	0.43743	2.218000	0.71995	0.655000	0.94253	CCA		0.488	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1			6	13	0	0	0	0	6	13				
ZNF513	130557	broad.mit.edu	37	2	27601470	27601470	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:27601470C>T	ENST00000323703.6	-	3	861	c.663G>A	c.(661-663)ctG>ctA	p.L221L	ZNF513_ENST00000407879.1_Silent_p.L159L|ZNF513_ENST00000491924.1_5'UTR	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	221					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATGCCGCCTCAGGTTGCCCA	0.682																																						uc002rkk.2		NA																	0				ovary(1)	1						c.(661-663)CTG>CTA		zinc finger protein 513							91.0	79.0	83.0					2																	27601470		2203	4300	6503	SO:0001819	synonymous_variant	130557				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding	g.chr2:27601470C>T	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.663G>A	2.37:g.27601470C>T			Somatic				ZNF513_uc002rkj.2_Silent_p.L159L	p.L221L	NM_144631	NP_653232	WXS	Illumina HiSeq	Unspecified	Q8N8E2	ZN513_HUMAN			3	863	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		221			C2H2-type 3.		A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Silent	SNP	ENST00000323703.6	37	c.663G>A	CCDS1751.1																																																																																				0.682	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	NM_144631		15	46	0	0	0	0	15	46				
BIRC6	57448	broad.mit.edu	37	2	32724766	32724766	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:32724766C>G	ENST00000421745.2	+	46	8755	c.8621C>G	c.(8620-8622)tCa>tGa	p.S2874*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2874					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ATCACTTGCTCAGACAAAGTA	0.433																																					Pancreas(94;175 1509 16028 18060 45422)	uc010ezu.2		NA																	0				ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14						c.(8620-8622)TCA>TGA		baculoviral IAP repeat-containing 6							205.0	204.0	205.0					2																	32724766		2203	4300	6503	SO:0001587	stop_gained	57448				anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding	g.chr2:32724766C>G	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8621C>G	2.37:g.32724766C>G	ENSP00000393596:p.Ser2874*		Somatic					p.S2874*	NM_016252	NP_057336	WXS	Illumina HiSeq	Unspecified	Q9NR09	BIRC6_HUMAN			46	8755	+	Acute lymphoblastic leukemia(172;0.155)		2874					Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	c.8621C>G	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	51	17.606523	0.99890	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.6002	0.95559	0.0:1.0:0.0:0.0	.	.	.	.	X	2874	.	ENSP00000393596:S2874X	S	+	2	0	BIRC6	32578270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.691000	0.91804	0.655000	0.94253	TCA		0.433	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		44	123	0	0	0	0	44	123				
FANCL	55120	broad.mit.edu	37	2	58388764	58388764	+	Missense_Mutation	SNP	T	T	C	rs553742734	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:58388764T>C	ENST00000233741.4	-	12	949	c.913A>G	c.(913-915)Atg>Gtg	p.M305V	FANCL_ENST00000403295.3_Missense_Mutation_p.M277V|FANCL_ENST00000403676.1_Missense_Mutation_p.M188V|FANCL_ENST00000402135.3_Missense_Mutation_p.M310V	NM_018062.3	NP_060532.2	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	305					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|gamete generation (GO:0007276)|protein monoubiquitination (GO:0006513)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8						CCACAATCCATAGTAAAATCC	0.333								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc002rzw.3		NA																	0				ovary(2)	2						c.(913-915)ATG>GTG	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group L isoform							77.0	77.0	77.0					2																	58388764		2202	4299	6501	SO:0001583	missense	55120	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:58388764T>C	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392		"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9			Standard	NM_018062		Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000233741.4:c.913A>G	2.37:g.58388764T>C	ENSP00000233741:p.Met305Val		Somatic				FANCL_uc002rzx.3_Missense_Mutation_p.M310V|FANCL_uc010fce.2_Missense_Mutation_p.M277V|FANCL_uc010fcf.1_Missense_Mutation_p.M246V	p.M305V	NM_018062	NP_060532	WXS	Illumina HiSeq	Unspecified	Q9NW38	FANCL_HUMAN			12	980	-			305					Q6GU60	Missense_Mutation	SNP	ENST00000233741.4	37	c.913A>G	CCDS1860.1	.	.	.	.	.	.	.	.	.	.	T	6.129	0.392123	0.11581	.	.	ENSG00000115392	ENST00000403295;ENST00000233741;ENST00000402135;ENST00000403676;ENST00000449070;ENST00000446381	T;T;T;T;T	0.39229	1.09;1.1;1.1;1.09;1.1	5.91	3.55	0.40652	Zinc finger, RING/FYVE/PHD-type (1);	0.375973	0.37136	N	0.002228	T	0.20373	0.0490	N	0.05351	-0.065	0.80722	D	1	B;B;B;B	0.15141	0.002;0.001;0.012;0.004	B;B;B;B	0.15484	0.009;0.005;0.01;0.013	T	0.05037	-1.0910	10	0.12103	T	0.63	-11.8427	10.3064	0.43683	0.0:0.1329:0.0:0.8671	.	246;277;310;305	C9JZA9;B5MC31;Q9NW38-2;Q9NW38	.;.;.;FANCL_HUMAN	V	277;305;310;188;246;157	ENSP00000386097:M277V;ENSP00000233741:M305V;ENSP00000385021:M310V;ENSP00000384046:M188V;ENSP00000401280:M246V	ENSP00000233741:M305V	M	-	1	0	FANCL	58242268	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.327000	0.43858	0.500000	0.27991	-0.256000	0.11100	ATG		0.333	FANCL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251497.1	NM_018062		2	19	0	0	0	0	2	19				
POLR1A	25885	broad.mit.edu	37	2	86267597	86267597	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:86267597C>T	ENST00000263857.6	-	25	4036	c.3658G>A	c.(3658-3660)Gga>Aga	p.G1220R	POLR1A_ENST00000409681.1_Missense_Mutation_p.G1220R			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1220					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GAGGGCTCTCCGATGCTCTGG	0.627																																						uc002sqs.2		NA																	0				ovary(2)|skin(1)	3						c.(3658-3660)GGA>AGA		DNA-directed RNA polymerase I A							50.0	61.0	57.0					2																	86267597		2079	4238	6317	SO:0001583	missense	25885				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr2:86267597C>T	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.3658G>A	2.37:g.86267597C>T	ENSP00000263857:p.Gly1220Arg		Somatic				POLR1A_uc010ytb.1_Missense_Mutation_p.G586R|POLR1A_uc002sqt.1_Missense_Mutation_p.G243R	p.G1220R	NM_015425	NP_056240	WXS	Illumina HiSeq	Unspecified	O95602	RPA1_HUMAN			25	4037	-			1220					B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	c.3658G>A	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562819	0.86335	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	D;D	0.87491	-2.26;-2.26	5.57	5.57	0.84162	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	D	0.96442	0.8839	H	0.98048	4.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97715	1.0193	10	0.87932	D	0	-29.3309	19.557	0.95354	0.0:1.0:0.0:0.0	.	586;1220	B7Z8X7;O95602	.;RPA1_HUMAN	R	1220	ENSP00000263857:G1220R;ENSP00000386300:G1220R	ENSP00000263857:G1220R	G	-	1	0	POLR1A	86121108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.630000	0.89119	0.655000	0.94253	GGA		0.627	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		11	41	0	0	0	0	11	41				
LONRF2	164832	broad.mit.edu	37	2	100916183	100916183	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:100916183C>T	ENST00000393437.3	-	5	1902	c.1263G>A	c.(1261-1263)aaG>aaA	p.K421K	LONRF2_ENST00000409647.1_Silent_p.K178K	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	421							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						ACTGACCTTTCTTGGGAATTT	0.408																																						uc002tal.3		NA																	0				large_intestine(1)|skin(1)	2						c.(1261-1263)AAG>AAA		LON peptidase N-terminal domain and ring finger							73.0	74.0	73.0					2																	100916183		2203	4300	6503	SO:0001819	synonymous_variant	164832				proteolysis		ATP-dependent peptidase activity|zinc ion binding	g.chr2:100916183C>T	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1263G>A	2.37:g.100916183C>T			Somatic				LONRF2_uc010yvs.1_RNA	p.K421K	NM_198461	NP_940863	WXS	Illumina HiSeq	Unspecified	Q1L5Z9	LONF2_HUMAN			5	1903	-			421					B9A006|Q6ZSR4	Silent	SNP	ENST00000393437.3	37	c.1263G>A	CCDS2046.2																																																																																				0.408	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461		22	68	0	0	0	0	22	68				
SLC5A7	60482	broad.mit.edu	37	2	108608589	108608589	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:108608589A>G	ENST00000264047.2	+	3	482	c.206A>G	c.(205-207)aAt>aGt	p.N69S	SLC5A7_ENST00000540517.1_5'UTR|SLC5A7_ENST00000409059.1_Missense_Mutation_p.N69S	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	69					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	GGGTATATCAATGGCACAGCT	0.458																																						uc002tdv.2		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(205-207)AAT>AGT		solute carrier family 5 (choline transporter),	Choline(DB00122)						177.0	150.0	159.0					2																	108608589		2203	4300	6503	SO:0001583	missense	60482				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	g.chr2:108608589A>G	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.206A>G	2.37:g.108608589A>G	ENSP00000264047:p.Asn69Ser		Somatic				SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Missense_Mutation_p.N69S|SLC5A7_uc010ywn.1_5'UTR	p.N69S	NM_021815	NP_068587	WXS	Illumina HiSeq	Unspecified	Q9GZV3	SC5A7_HUMAN			3	482	+			69			Helical; (Potential).		Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	c.206A>G	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072690	0.76415	.	.	ENSG00000115665	ENST00000409059;ENST00000264047	D;D	0.87571	-2.27;-2.27	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.86952	0.6057	L	0.52126	1.63	0.80722	D	1	P	0.42123	0.771	P	0.44422	0.449	D	0.86556	0.1838	10	0.44086	T	0.13	-0.4764	16.8061	0.85666	1.0:0.0:0.0:0.0	.	69	Q9GZV3	SC5A7_HUMAN	S	69	ENSP00000387346:N69S;ENSP00000264047:N69S	ENSP00000264047:N69S	N	+	2	0	SLC5A7	107975021	1.000000	0.71417	0.945000	0.38365	0.990000	0.78478	8.962000	0.93254	2.367000	0.80283	0.528000	0.53228	AAT		0.458	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			16	24	0	0	0	0	16	24				
CCDC93	54520	broad.mit.edu	37	2	118758500	118758500	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:118758500G>C	ENST00000376300.2	-	4	397	c.260C>G	c.(259-261)tCa>tGa	p.S87*	CCDC93_ENST00000319432.5_Nonsense_Mutation_p.S87*|RP11-98C1.1_ENST00000588733.1_RNA|AC009303.1_ENST00000590516.1_RNA|AC009303.1_ENST00000588042.1_RNA|RP11-98C1.2_ENST00000591103.1_RNA	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	87										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						AATTTTTTCTGACAGAGCTCT	0.463																																						uc002tlj.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(259-261)TCA>TGA		coiled-coil domain containing 93							77.0	79.0	78.0					2																	118758500		2203	4300	6503	SO:0001587	stop_gained	54520							g.chr2:118758500G>C	BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.260C>G	2.37:g.118758500G>C	ENSP00000365477:p.Ser87*		Somatic				CCDC93_uc010fld.1_Nonsense_Mutation_p.S87*	p.S87*	NM_019044	NP_061917	WXS	Illumina HiSeq	Unspecified	Q567U6	CCD93_HUMAN			4	386	-			87					A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Nonsense_Mutation	SNP	ENST00000376300.2	37	c.260C>G	CCDS2121.2	.	.	.	.	.	.	.	.	.	.	G	38	7.194865	0.98129	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	.	.	.	5.01	5.01	0.66863	.	0.056971	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-7.5417	17.6037	0.88032	0.0:0.0:1.0:0.0	.	.	.	.	X	87	.	ENSP00000324135:S87X	S	-	2	0	CCDC93	118474970	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	8.991000	0.93514	2.767000	0.95098	0.591000	0.81541	TCA		0.463	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044		14	29	0	0	0	0	14	29				
LIMS2	55679	broad.mit.edu	37	2	128412466	128412466	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:128412466T>C	ENST00000355119.4	-	3	341	c.176A>G	c.(175-177)gAa>gGa	p.E59G	LIMS2_ENST00000410011.1_Missense_Mutation_p.E54G|LIMS2_ENST00000545738.2_Missense_Mutation_p.E81G|LIMS2_ENST00000324938.5_Missense_Mutation_p.E83G|LIMS2_ENST00000409808.2_Missense_Mutation_p.E54G|LIMS2_ENST00000409455.1_Missense_Mutation_p.E54G	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	59	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		CTTCCGGCCTTCAAACTGCAA	0.582																																						uc002tpa.2		NA																	0					0						c.(175-177)GAA>GGA		LIM and senescent cell antigen-like domains 2							82.0	68.0	73.0					2																	128412466		2203	4300	6503	SO:0001583	missense	55679				cell junction assembly	cytosol|focal adhesion|nucleus	zinc ion binding	g.chr2:128412466T>C	AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.176A>G	2.37:g.128412466T>C	ENSP00000347240:p.Glu59Gly		Somatic				LIMS2_uc002tox.2_Missense_Mutation_p.E83G|LIMS2_uc010fmb.2_5'UTR|LIMS2_uc002toy.2_Missense_Mutation_p.E54G|LIMS2_uc010yzm.1_Missense_Mutation_p.E81G|LIMS2_uc002toz.2_Missense_Mutation_p.E54G|LIMS2_uc002tpb.2_Missense_Mutation_p.E54G	p.E59G	NM_001161403	NP_001154875	WXS	Illumina HiSeq	Unspecified	Q7Z4I7	LIMS2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0681)	3	342	-	Colorectal(110;0.1)		59			LIM zinc-binding 1.		A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	Missense_Mutation	SNP	ENST00000355119.4	37	c.176A>G	CCDS54395.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	28.8|28.8	4.953937|4.953937	0.92660|0.92660	.|.	.|.	ENSG00000072163|ENSG00000144230	ENST00000545738;ENST00000355119;ENST00000324938;ENST00000409455;ENST00000410109;ENST00000409808;ENST00000410011;ENST00000544917;ENST00000422034|ENST00000339805	D;D;D;D;D;D|.	0.89415|.	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51|.	5.14|5.14	5.14|5.14	0.70334|0.70334	Zinc finger, LIM-type (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77384|0.77384	0.4122|0.4122	M|M	0.79926|0.79926	2.475|2.475	0.80722|0.80722	D|D	1|1	B;D;D|.	0.67145|.	0.317;0.99;0.996|.	B;P;D|.	0.75484|.	0.267;0.87;0.986|.	T|T	0.81348|0.81348	-0.0973|-0.0973	10|6	0.87932|0.87932	D|D	0|0	.|.	15.2502|15.2502	0.73539|0.73539	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	81;59;83|.	F5H6E6;Q7Z4I7;Q7Z4I7-2|.	.;LIMS2_HUMAN;.|.	G|S	81;59;83;54;54;54;54;81;54|75	ENSP00000443794:E81G;ENSP00000347240:E59G;ENSP00000326888:E83G;ENSP00000386383:E54G;ENSP00000386637:E54G;ENSP00000387002:E54G|.	ENSP00000326888:E83G|ENSP00000345388:F75S	E|F	-|+	2|2	0|0	LIMS2|GPR17	128128936|128128936	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	7.883000|7.883000	0.87264|0.87264	2.082000|2.082000	0.62665|0.62665	0.459000|0.459000	0.35465|0.35465	GAA|TTC		0.582	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331133.2	NM_017980		3	23	0	0	0	0	3	23				
ACVR1C	130399	broad.mit.edu	37	2	158390507	158390507	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:158390507C>T	ENST00000243349.8	-	9	1765	c.1405G>A	c.(1405-1407)Gga>Aga	p.G469R	ACVR1C_ENST00000409680.3_Missense_Mutation_p.G419R|ACVR1C_ENST00000348328.5_Missense_Mutation_p.G312R|ACVR1C_ENST00000335450.7_Missense_Mutation_p.G389R	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						CGGGCCGCTCCGTTGGCATAC	0.388																																						uc002tzk.3		NA																	0				lung(3)|ovary(2)|skin(2)	7						c.(1405-1407)GGA>AGA		activin A receptor, type IC isoform 1							91.0	100.0	97.0					2																	158390507		2203	4300	6503	SO:0001583	missense	130399				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity	g.chr2:158390507C>T	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1405G>A	2.37:g.158390507C>T	ENSP00000243349:p.Gly469Arg		Somatic				ACVR1C_uc002tzl.3_Missense_Mutation_p.G389R|ACVR1C_uc010fof.2_Missense_Mutation_p.G312R|ACVR1C_uc010foe.2_Missense_Mutation_p.G419R	p.G469R	NM_145259	NP_660302	WXS	Illumina HiSeq	Unspecified	Q8NER5	ACV1C_HUMAN			9	1648	-			469			Protein kinase.|Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000243349.8	37	c.1405G>A	CCDS2205.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457483	0.84317	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000061	D	0.94404	0.8200	N	0.25890	0.77	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74348	0.975;0.954;0.983	D	0.95247	0.8356	10	0.72032	D	0.01	.	18.9895	0.92786	0.0:1.0:0.0:0.0	.	312;389;469	Q8NER5-2;Q8NER5-3;Q8NER5	.;.;ACV1C_HUMAN	R	469;419;312;389	ENSP00000243349:G469R;ENSP00000387168:G419R;ENSP00000335139:G312R;ENSP00000335178:G389R	ENSP00000243349:G469R	G	-	1	0	ACVR1C	158098753	0.637000	0.27216	0.997000	0.53966	0.882000	0.50991	1.922000	0.40045	2.574000	0.86865	0.591000	0.81541	GGA		0.388	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259		17	109	0	0	0	0	17	109				
TANC1	85461	broad.mit.edu	37	2	160086120	160086120	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:160086120G>A	ENST00000263635.6	+	27	4420	c.4183G>A	c.(4183-4185)Gag>Aag	p.E1395K	TANC1_ENST00000454300.1_Missense_Mutation_p.E1289K	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1395					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TGACCTGCAAGAGGCTGTGAA	0.473																																						uc002uag.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(4183-4185)GAG>AAG		tetratricopeptide repeat, ankyrin repeat and							24.0	28.0	27.0					2																	160086120		1990	4163	6153	SO:0001583	missense	85461					cell junction|postsynaptic density|postsynaptic membrane	binding	g.chr2:160086120G>A	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4183G>A	2.37:g.160086120G>A	ENSP00000263635:p.Glu1395Lys		Somatic				TANC1_uc010zcm.1_Silent_p.K1388K|TANC1_uc010fon.2_Missense_Mutation_p.E239K	p.E1395K	NM_033394	NP_203752	WXS	Illumina HiSeq	Unspecified	Q9C0D5	TANC1_HUMAN			27	4457	+			1395			TPR 3.		C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	c.4183G>A	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	G	36	5.670389	0.96754	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.71103	-0.54;-0.54	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77824	0.4188	L	0.28608	0.87	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74160	-0.3755	9	.	.	.	.	20.3125	0.98645	0.0:0.0:1.0:0.0	.	1395	Q9C0D5	TANC1_HUMAN	K	1289;1395	ENSP00000396339:E1289K;ENSP00000263635:E1395K	.	E	+	1	0	TANC1	159794366	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.824000	0.99380	2.806000	0.96561	0.655000	0.94253	GAG		0.473	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			9	40	0	0	0	0	9	40				
CERS6	253782	broad.mit.edu	37	2	169417810	169417810	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:169417810C>G	ENST00000305747.6	+	3	972	c.385C>G	c.(385-387)Ctg>Gtg	p.L129V	CERS6_ENST00000392687.4_Missense_Mutation_p.L129V	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	129					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GCCAAGCACGCTGACGAGGTT	0.448																																						uc002ueb.1		NA																	0				skin(1)	1						c.(385-387)CTG>GTG		longevity assurance homolog 6							138.0	130.0	133.0					2																	169417810		2203	4300	6503	SO:0001583	missense	253782					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity	g.chr2:169417810C>G	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.385C>G	2.37:g.169417810C>G	ENSP00000306579:p.Leu129Val		Somatic				LASS6_uc002uec.1_Missense_Mutation_p.L129V	p.L129V	NM_203463	NP_982288	WXS	Illumina HiSeq	Unspecified	Q6ZMG9	CERS6_HUMAN			3	509	+			129			Cytoplasmic (Potential).		Q32M63|Q8N617	Missense_Mutation	SNP	ENST00000305747.6	37	c.385C>G	CCDS2228.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891000	0.72524	.	.	ENSG00000172292	ENST00000305747;ENST00000392687	T;T	0.12774	2.84;2.65	5.31	5.31	0.75309	Homeobox (1);	0.000000	0.85682	D	0.000000	T	0.25531	0.0621	M	0.70595	2.14	0.80722	D	1	P;P	0.47545	0.83;0.897	B;P	0.46389	0.362;0.515	T	0.01242	-1.1408	10	0.33141	T	0.24	-20.3925	19.3447	0.94358	0.0:1.0:0.0:0.0	.	129;129	Q32M63;Q6ZMG9	.;CERS6_HUMAN	V	129	ENSP00000306579:L129V;ENSP00000376453:L129V	ENSP00000306579:L129V	L	+	1	2	CERS6	169126056	1.000000	0.71417	0.671000	0.29857	0.993000	0.82548	4.784000	0.62411	2.641000	0.89580	0.650000	0.86243	CTG		0.448	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255235.2	NM_203463		15	100	0	0	0	0	15	100				
DCAF17	80067	broad.mit.edu	37	2	172314572	172314572	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:172314572C>A	ENST00000375255.3	+	7	1046	c.719C>A	c.(718-720)aCc>aAc	p.T240N	DCAF17_ENST00000539783.1_Missense_Mutation_p.T240N|DCAF17_ENST00000468592.1_3'UTR	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	240					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						AGCTTCCAAACCATCGCTGAA	0.388																																						uc002ugx.2		NA																	0					0						c.(718-720)ACC>AAC		DDB1 and CUL4 associated factor 17 isoform 1							195.0	185.0	188.0					2																	172314572		1913	4123	6036	SO:0001583	missense	80067					CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus		g.chr2:172314572C>A	AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.719C>A	2.37:g.172314572C>A	ENSP00000364404:p.Thr240Asn		Somatic				DCAF17_uc010zdq.1_RNA|DCAF17_uc010fqf.1_Missense_Mutation_p.T240N|DCAF17_uc010zdr.1_RNA|DCAF17_uc010fqg.2_Intron	p.T240N	NM_025000	NP_079276	WXS	Illumina HiSeq	Unspecified	Q5H9S7	DCA17_HUMAN			7	948	+			240			Helical; (Potential).		B2RTW5|Q53TN3|Q9H908	Missense_Mutation	SNP	ENST00000375255.3	37	c.719C>A	CCDS2243.2	.	.	.	.	.	.	.	.	.	.	C	10.08	1.251907	0.22880	.	.	ENSG00000115827	ENST00000375255;ENST00000539783	T;T	0.43688	0.94;0.94	5.91	4.91	0.64330	.	0.446038	0.24189	N	0.040740	T	0.25754	0.0627	N	0.22421	0.69	0.25466	N	0.987875	B;B	0.18610	0.029;0.009	B;B	0.18561	0.017;0.022	T	0.16689	-1.0394	10	0.21014	T	0.42	-0.4176	7.1131	0.25401	0.1589:0.7344:0.0:0.1066	.	240;240	F5H7W1;Q5H9S7	.;DCA17_HUMAN	N	240	ENSP00000364404:T240N;ENSP00000442238:T240N	ENSP00000364404:T240N	T	+	2	0	DCAF17	172022818	0.995000	0.38212	1.000000	0.80357	0.874000	0.50279	0.970000	0.29383	1.249000	0.43950	0.650000	0.86243	ACC		0.388	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255342.2	NM_025000		81	231	1	0	1.22e-31	1.4e-31	81	231				
TTN	7273	broad.mit.edu	37	2	179434801	179434801	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:179434801C>G	ENST00000591111.1	-	276	71359	c.71135G>C	c.(71134-71136)aGa>aCa	p.R23712T	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25353T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R16288T|TTN_ENST00000359218.5_Missense_Mutation_p.R16413T|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R22785T|TTN_ENST00000342175.6_Missense_Mutation_p.R16480T			Q8WZ42	TITIN_HUMAN	titin	23712	Fibronectin type-III 72. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTATGGCATCTTGTCCATCT	0.423																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(68353-68355)AGA>ACA		titin isoform N2-A							129.0	120.0	123.0					2																	179434801		1952	4147	6099	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179434801C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.71135G>C	2.37:g.179434801C>G	ENSP00000465570:p.Arg23712Thr		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R16480T|TTN_uc010zfi.1_Missense_Mutation_p.R16413T|TTN_uc010zfj.1_Missense_Mutation_p.R16288T	p.R22785T	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	68578	-			23712					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.68354G>C		.	.	.	.	.	.	.	.	.	.	C	14.74	2.624437	0.46840	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.87	5.87	0.94306	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67776	0.2929	L	0.41236	1.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.68424	-0.5412	9	0.87932	D	0	.	20.2245	0.98337	0.0:1.0:0.0:0.0	.	16288;16413;16480;23712	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	22785;16288;16480;16413;16286	ENSP00000343764:R22785T;ENSP00000434586:R16288T;ENSP00000340554:R16480T;ENSP00000352154:R16413T	ENSP00000340554:R16480T	R	-	2	0	TTN	179143047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.093000	0.71422	2.770000	0.95276	0.650000	0.86243	AGA		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		3	141	0	0	0	0	3	141				
TTN	7273	broad.mit.edu	37	2	179474959	179474959	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:179474959C>T	ENST00000591111.1	-	221	46595	c.46371G>A	c.(46369-46371)atG>atA	p.M15457I	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.M17098I|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.M8033I|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.M8158I|TTN_ENST00000342992.6_Missense_Mutation_p.M14530I|TTN_ENST00000342175.6_Missense_Mutation_p.M8225I			Q8WZ42	TITIN_HUMAN	titin	15457	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCACCAGACATGACTGGTA	0.443																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(43588-43590)ATG>ATA		titin isoform N2-A							197.0	191.0	193.0					2																	179474959		1937	4144	6081	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179474959C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46371G>A	2.37:g.179474959C>T	ENSP00000465570:p.Met15457Ile		Somatic				uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.M8225I|TTN_uc010zfi.1_Missense_Mutation_p.M8158I|TTN_uc010zfj.1_Missense_Mutation_p.M8033I	p.M14530I	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		220	43814	-			15457					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.43590G>A		.	.	.	.	.	.	.	.	.	.	C	16.04	3.010140	0.54361	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.63	5.63	0.86233	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61714	0.2369	N	0.17800	0.525	0.58432	D	0.999999	D;D;D;D	0.59357	0.985;0.985;0.985;0.985	D;D;D;D	0.72338	0.977;0.977;0.977;0.977	T	0.66460	-0.5918	9	0.87932	D	0	.	19.6974	0.96031	0.0:1.0:0.0:0.0	.	8033;8158;8225;15457	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	14530;8033;8225;8158;8033	ENSP00000343764:M14530I;ENSP00000434586:M8033I;ENSP00000340554:M8225I;ENSP00000352154:M8158I	ENSP00000340554:M8225I	M	-	3	0	TTN	179183204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.650000	0.89964	0.655000	0.94253	ATG		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		144	169	0	0	0	0	144	169				
TTN	7273	broad.mit.edu	37	2	179616442	179616442	+	Intron	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:179616442G>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.S3562F|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAGCTGGAAGAGTGATGGTG	0.423																																						uc002unb.2		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(10684-10686)TCT>TTT		titin isoform novex-3							74.0	77.0	76.0					2																	179616442		2203	4298	6501	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179616442G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+1408C>T	2.37:g.179616442G>A			Somatic				TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.S3562F	NM_133379	NP_596870	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	10909	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.10685C>T		.	.	.	.	.	.	.	.	.	.	G	12.74	2.029380	0.35797	.	.	ENSG00000155657	ENST00000360870	T	0.68624	-0.34	5.76	3.96	0.45880	.	.	.	.	.	T	0.57066	0.2028	L	0.28274	0.84	0.80722	D	1	D	0.54964	0.969	P	0.51135	0.66	T	0.50311	-0.8843	9	0.10377	T	0.69	.	10.2808	0.43539	0.0:0.3321:0.568:0.0999	.	3562	Q8WZ42-6	.	F	3562	ENSP00000354117:S3562F	ENSP00000354117:S3562F	S	-	2	0	TTN	179324687	0.686000	0.27661	0.999000	0.59377	0.890000	0.51754	0.696000	0.25541	0.636000	0.30508	0.655000	0.94253	TCT		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		41	101	0	0	0	0	41	101				
COL3A1	1281	broad.mit.edu	37	2	189864617	189864617	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:189864617C>G	ENST00000304636.3	+	32	2449	c.2279C>G	c.(2278-2280)cCa>cGa	p.P760R	COL3A1_ENST00000317840.5_Missense_Mutation_p.P760R	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	760	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	AAAGATGGCCCAAGGGTGAGT	0.438																																						uc002uqj.1		NA																	0				central_nervous_system(7)|ovary(4)|large_intestine(2)	13						c.(2278-2280)CCA>CGA		collagen type III alpha 1 preproprotein	Collagenase(DB00048)|Palifermin(DB00039)						75.0	67.0	69.0					2																	189864617		2203	4292	6495	SO:0001583	missense	1281				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding	g.chr2:189864617C>G	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2279C>G	2.37:g.189864617C>G	ENSP00000304408:p.Pro760Arg		Somatic					p.P760R	NM_000090	NP_000081	WXS	Illumina HiSeq	Unspecified	P02461	CO3A1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		32	2396	+			760			Triple-helical region.		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	c.2279C>G	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	C	1.624	-0.520720	0.04171	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.98684	-5.07;-5.07	5.35	5.35	0.76521	.	0.182356	0.26931	N	0.021769	D	0.95392	0.8504	L	0.49778	1.585	0.09310	N	1	P	0.37864	0.61	B	0.30646	0.118	D	0.88549	0.3115	10	0.17832	T	0.49	.	5.5764	0.17225	0.1674:0.6786:0.0:0.154	.	760	P02461	CO3A1_HUMAN	R	760	ENSP00000304408:P760R;ENSP00000315243:P760R	ENSP00000304408:P760R	P	+	2	0	COL3A1	189572862	0.278000	0.24230	0.704000	0.30370	0.364000	0.29643	3.360000	0.52299	2.660000	0.90430	0.557000	0.71058	CCA		0.438	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		3	19	0	0	0	0	3	19				
CASP8	841	broad.mit.edu	37	2	202149644	202149644	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:202149644A>T	ENST00000432109.2	+	9	1097	c.908A>T	c.(907-909)gAc>gTc	p.D303V	CASP8_ENST00000358485.4_Missense_Mutation_p.D362V|CASP8_ENST00000264274.9_Missense_Mutation_p.D219V|CASP8_ENST00000323492.7_Missense_Mutation_p.D288V|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264275.5_Missense_Mutation_p.D320V	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	303					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						CAACTCATGGACCACAGTAAC	0.473										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	uc002uxr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						c.(907-909)GAC>GTC		caspase 8 isoform B precursor							168.0	145.0	153.0					2																	202149644		2203	4300	6503	SO:0001583	missense	841				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding	g.chr2:202149644A>T	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.908A>T	2.37:g.202149644A>T	ENSP00000412523:p.Asp303Val	HNSCC(4;0.00038)	Somatic				CASP8_uc002uxp.1_Missense_Mutation_p.D320V|CASP8_uc002uxq.1_Missense_Mutation_p.D288V|CASP8_uc002uxt.1_Missense_Mutation_p.D362V|CASP8_uc002uxu.1_RNA|CASP8_uc002uxw.1_Missense_Mutation_p.D288V|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Missense_Mutation_p.D219V	p.D303V	NM_033355	NP_203519	WXS	Illumina HiSeq	Unspecified	Q14790	CASP8_HUMAN			9	1117	+			303					O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	c.908A>T	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.685684	0.88639	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	T;T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	5.68	4.48	0.54585	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.253869	0.45606	D	0.000360	T	0.82153	0.4975	M	0.93106	3.38	0.80722	D	1	D;P;P;D;P	0.76494	0.999;0.748;0.915;0.968;0.748	D;P;P;P;P	0.71414	0.973;0.447;0.804;0.859;0.447	D	0.86486	0.1794	10	0.87932	D	0	.	12.9753	0.58534	0.8655:0.1345:0.0:0.0	.	219;362;303;288;320	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	V	288;219;303;320;362;288;82	ENSP00000376091:D288V;ENSP00000264274:D219V;ENSP00000412523:D303V;ENSP00000264275:D320V;ENSP00000351273:D362V;ENSP00000325722:D288V;ENSP00000394434:D82V	ENSP00000264274:D219V	D	+	2	0	CASP8	201857889	1.000000	0.71417	0.930000	0.37139	0.494000	0.33585	4.822000	0.62686	2.170000	0.68504	0.459000	0.35465	GAC		0.473	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228		81	83	0	0	0	0	81	83				
MARCH4	57574	broad.mit.edu	37	2	217124226	217124226	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:217124226C>A	ENST00000273067.4	-	4	2808	c.1042G>T	c.(1042-1044)Gaa>Taa	p.E348*	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	348						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GTCTCCTCTTCCGAGGAGGGG	0.622																																						uc002vgb.2		NA																	0				ovary(1)	1						c.(1042-1044)GAA>TAA		membrane-associated ring finger (C3HC4) 4							55.0	55.0	55.0					2																	217124226		2203	4300	6503	SO:0001587	stop_gained	57574					Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding	g.chr2:217124226C>A	AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1042G>T	2.37:g.217124226C>A	ENSP00000273067:p.Glu348*		Somatic					p.E348*	NM_020814	NP_065865	WXS	Illumina HiSeq	Unspecified	Q9P2E8	MARH4_HUMAN		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)	4	2809	-		Renal(323;0.0854)	348					Q4KMN7|Q86WR8	Nonsense_Mutation	SNP	ENST00000273067.4	37	c.1042G>T	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	C	50	17.027578	0.99877	.	.	ENSG00000144583	ENST00000273067	.	.	.	5.62	3.81	0.43845	.	0.898941	0.09702	N	0.766830	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-21.9528	6.7176	0.23312	0.1451:0.695:0.0:0.1599	.	.	.	.	X	348	.	ENSP00000273067:E348X	E	-	1	0	MARCH4	216832471	0.054000	0.20591	0.001000	0.08648	0.449000	0.32228	1.710000	0.37920	0.722000	0.32252	0.561000	0.74099	GAA		0.622	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814		18	27	1	0	5.35e-07	5.94e-07	18	27				
SIGLEC1	6614	broad.mit.edu	37	20	3669239	3669239	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr20:3669239C>T	ENST00000344754.4	-	21	5097	c.5098G>A	c.(5098-5100)Gag>Aag	p.E1700K	SIGLEC1_ENST00000202578.4_Silent_p.V1675V	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1700					cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GTTGAGGTCTCACATGTGGCT	0.612																																						uc002wja.2		NA																	0				pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						c.(5098-5100)GAG>AAG		sialoadhesin precursor							64.0	52.0	56.0					20																	3669239		2201	4300	6501	SO:0001583	missense	6614				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding	g.chr20:3669239C>T	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.5098G>A	20.37:g.3669239C>T	ENSP00000341141:p.Glu1700Lys		Somatic				SIGLEC1_uc002wjb.1_3'UTR|SIGLEC1_uc002wiz.3_Silent_p.V1675V	p.E1700K	NM_023068	NP_075556	WXS	Illumina HiSeq	Unspecified	Q9BZZ2	SN_HUMAN			21	5098	-			1700			Cytoplasmic (Potential).		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	c.5098G>A	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184104	0.38609	.	.	ENSG00000088827	ENST00000344754	T	0.21361	2.01	4.06	3.09	0.35607	.	.	.	.	.	T	0.09247	0.0228	N	0.14661	0.345	0.19945	N	0.999949	B	0.30482	0.281	B	0.24155	0.051	T	0.24368	-1.0162	9	0.02654	T	1	.	9.1471	0.36939	0.2179:0.7821:0.0:0.0	.	1700	Q9BZZ2	SN_HUMAN	K	1700	ENSP00000341141:E1700K	ENSP00000341141:E1700K	E	-	1	0	SIGLEC1	3617239	0.138000	0.22547	0.043000	0.18650	0.826000	0.46750	1.256000	0.32921	1.028000	0.39785	0.555000	0.69702	GAG		0.612	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068		5	18	0	0	0	0	5	18				
BFSP1	631	broad.mit.edu	37	20	17475534	17475534	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr20:17475534C>G	ENST00000377873.3	-	8	1222	c.1183G>C	c.(1183-1185)Gaa>Caa	p.E395Q	BFSP1_ENST00000544874.1_Missense_Mutation_p.E256Q|BFSP1_ENST00000536626.1_Missense_Mutation_p.E256Q|BFSP1_ENST00000377868.2_Missense_Mutation_p.E270Q	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	395	Tail.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						TTTGTGTCTTCCAAACCTTTT	0.413																																						uc002wpo.2		NA																	0				central_nervous_system(1)	1						c.(1183-1185)GAA>CAA		filensin isoform 1							144.0	143.0	143.0					20																	17475534		2203	4300	6503	SO:0001583	missense	631					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens	g.chr20:17475534C>G	Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1183G>C	20.37:g.17475534C>G	ENSP00000367104:p.Glu395Gln		Somatic				BFSP1_uc002wpp.2_Missense_Mutation_p.E270Q|BFSP1_uc010zrn.1_Missense_Mutation_p.E256Q|BFSP1_uc010zro.1_Missense_Mutation_p.E256Q	p.E395Q	NM_001195	NP_001186	WXS	Illumina HiSeq	Unspecified	Q12934	BFSP1_HUMAN			8	1222	-			395			Tail.		F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	ENST00000377873.3	37	c.1183G>C	CCDS13126.1	.	.	.	.	.	.	.	.	.	.	C	3.959	-0.010785	0.07727	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	D;T;T;T	0.87887	-2.31;1.4;1.4;1.4	4.94	2.74	0.32292	.	0.299034	0.35096	N	0.003441	T	0.78824	0.4344	L	0.32530	0.975	0.09310	N	1	B;B	0.27351	0.176;0.03	B;B	0.28849	0.095;0.012	T	0.65092	-0.6252	10	0.27082	T	0.32	-8.6384	9.8836	0.41249	0.1403:0.6597:0.2:0.0	.	270;395	Q12934-2;Q12934	.;BFSP1_HUMAN	Q	395;270;256;256	ENSP00000367104:E395Q;ENSP00000367099:E270Q;ENSP00000442522:E256Q;ENSP00000439870:E256Q	ENSP00000367099:E270Q	E	-	1	0	BFSP1	17423534	0.022000	0.18835	0.308000	0.25141	0.175000	0.22909	1.505000	0.35736	0.906000	0.36621	0.655000	0.94253	GAA		0.413	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078119.6	NM_001195		48	74	0	0	0	0	48	74				
SUN5	140732	broad.mit.edu	37	20	31590695	31590695	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr20:31590695C>T	ENST00000356173.3	-	2	200	c.108G>A	c.(106-108)agG>agA	p.R36R	SUN5_ENST00000375519.2_Silent_p.R36R|SUN5_ENST00000375523.3_Silent_p.R36R	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	36					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						CCTCTGCCATCCTGCTGGTGT	0.527																																						uc002wyi.2		NA																	0				skin(1)	1						c.(106-108)AGG>AGA		sperm associated antigen 4-like							128.0	118.0	121.0					20																	31590695		2203	4300	6503	SO:0001819	synonymous_variant	140732				spermatogenesis			g.chr20:31590695C>T	AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.108G>A	20.37:g.31590695C>T			Somatic					p.R36R	NM_080675	NP_542406	WXS	Illumina HiSeq	Unspecified	Q8TC36	SUN5_HUMAN			2	201	-			36					A6NJ82|Q5T9R0	Silent	SNP	ENST00000356173.3	37	c.108G>A	CCDS13209.1																																																																																				0.527	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675		19	49	0	0	0	0	19	49				
BPIFB2	80341	broad.mit.edu	37	20	31606867	31606867	+	Splice_Site	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr20:31606867G>A	ENST00000170150.3	+	10	1050		c.e10-1			NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2							extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										GCTGATTTCAGAGGTCGGATG	0.572																																						uc002wyj.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.e10-1		bactericidal/permeability-increasing							142.0	141.0	141.0					20																	31606867		2203	4300	6503	SO:0001630	splice_region_variant	80341					extracellular region	lipid binding	g.chr20:31606867G>A	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.856-1G>A	20.37:g.31606867G>A			Somatic					p.R286_splice	NM_025227	NP_079503	WXS	Illumina HiSeq	Unspecified	Q8N4F0	BPIL1_HUMAN			10	1050	+								Q6UWN3|Q6ZME0|Q8NFQ7	Splice_Site	SNP	ENST00000170150.3	37	c.856_splice	CCDS13210.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305000	0.60305	.	.	ENSG00000078898	ENST00000170150	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7414	0.57255	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BPIFB2	31070528	0.999000	0.42202	0.970000	0.41538	0.885000	0.51271	4.336000	0.59304	2.443000	0.82685	0.555000	0.69702	.		0.572	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	Intron	44	83	0	0	0	0	44	83				
OSBPL2	9885	broad.mit.edu	37	20	60835072	60835072	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr20:60835072G>A	ENST00000313733.3	+	3	275	c.73G>A	c.(73-75)Gag>Aag	p.E25K	OSBPL2_ENST00000439951.2_Intron|OSBPL2_ENST00000358053.2_Splice_Site	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	25					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			GGAATTTTCAGAGGCAAATCA	0.423																																						uc002yck.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(73-75)GAG>AAG		oxysterol-binding protein-like protein 2 isoform							93.0	98.0	96.0					20																	60835072		2203	4300	6503	SO:0001583	missense	9885				lipid transport		lipid binding	g.chr20:60835072G>A	AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.73G>A	20.37:g.60835072G>A	ENSP00000316649:p.Glu25Lys		Somatic				OSBPL2_uc002ycl.1_Splice_Site_p.E13_splice|OSBPL2_uc011aah.1_Intron	p.E25K	NM_144498	NP_653081	WXS	Illumina HiSeq	Unspecified	Q9H1P3	OSBL2_HUMAN	BRCA - Breast invasive adenocarcinoma(19;1.33e-06)		3	275	+	Breast(26;7.76e-09)		25					A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	ENST00000313733.3	37	c.73G>A	CCDS13495.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.08|15.08	2.725974|2.725974	0.48833|0.48833	.|.	.|.	ENSG00000130703|ENSG00000130703	ENST00000358053|ENST00000313733	.|T	.|0.44482	.|0.92	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.300125	.|0.27640	.|N	.|0.018468	.|T	.|0.42017	.|0.1184	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|P	.|0.36789	.|0.57	.|B	.|0.38264	.|0.269	.|T	.|0.27905	.|-1.0060	.|10	.|0.27082	.|T	.|0.32	.|-36.3345	15.2067|15.2067	0.73183|0.73183	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|25	.|Q9H1P3	.|OSBL2_HUMAN	.|K	-1|25	.|ENSP00000316649:E25K	.|ENSP00000316649:E25K	.|E	+|+	.|1	.|0	OSBPL2|OSBPL2	60268467|60268467	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.578000|0.578000	0.36192|0.36192	5.885000|5.885000	0.69736|0.69736	2.374000|2.374000	0.81015|0.81015	0.655000|0.655000	0.94253|0.94253	.|GAG		0.423	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835		23	55	0	0	0	0	23	55				
NKAIN4	128414	broad.mit.edu	37	20	61873937	61873937	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr20:61873937G>A	ENST00000370316.3	-	6	660	c.571C>T	c.(571-573)Cat>Tat	p.H191Y	NKAIN4_ENST00000370313.1_Intron|NKAIN4_ENST00000466885.1_5'UTR|NKAIN4_ENST00000370307.2_Missense_Mutation_p.H129Y	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					TCATTGACATGGTAGAGAGGA	0.453																																						uc002yek.2		NA																	0					0						c.(571-573)CAT>TAT		Na+/K+ transporting ATPase interacting 4							208.0	210.0	209.0					20																	61873937		2203	4300	6503	SO:0001583	missense	128414					integral to membrane|plasma membrane		g.chr20:61873937G>A	BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.571C>T	20.37:g.61873937G>A	ENSP00000359340:p.His191Tyr		Somatic					p.H191Y	NM_152864	NP_690603	WXS	Illumina HiSeq	Unspecified	Q8IVV8	NKAI4_HUMAN			6	661	-	all_cancers(38;2.72e-09)		191					Q4VXQ6|Q9BQU8|Q9BQU9	Missense_Mutation	SNP	ENST00000370316.3	37	c.571C>T	CCDS13514.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607488	0.66558	.	.	ENSG00000101198	ENST00000370316;ENST00000370307	T;T	0.15256	2.44;2.45	4.54	3.57	0.40892	.	0.159681	0.40554	U	0.001062	T	0.41119	0.1145	M	0.75447	2.3	0.37802	D	0.927726	D	0.76494	0.999	D	0.83275	0.996	T	0.49428	-0.8941	10	0.72032	D	0.01	-14.4004	13.3637	0.60671	0.0:0.0:0.8406:0.1594	.	191	Q8IVV8	NKAI4_HUMAN	Y	191;129	ENSP00000359340:H191Y;ENSP00000359330:H129Y	ENSP00000359330:H129Y	H	-	1	0	NKAIN4	61344382	1.000000	0.71417	0.772000	0.31596	0.894000	0.52154	5.299000	0.65716	0.855000	0.35359	0.491000	0.48974	CAT		0.453	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080117.3	NM_152864		65	198	0	0	0	0	65	198				
SCAF4	57466	broad.mit.edu	37	21	33057747	33057747	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr21:33057747G>A	ENST00000286835.7	-	18	2642	c.2260C>T	c.(2260-2262)Cct>Tct	p.P754S	SCAF4_ENST00000399804.1_Missense_Mutation_p.P754S|SCAF4_ENST00000434667.3_Missense_Mutation_p.P739S	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	754						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TGAGGAGGAGGAATGGATACT	0.453																																						uc002ypd.2		NA																	0					0						c.(2260-2262)CCT>TCT		splicing factor, arginine/serine-rich 15 isoform							103.0	102.0	103.0					21																	33057747		2203	4300	6503	SO:0001583	missense	57466					nucleus	nucleotide binding|RNA binding	g.chr21:33057747G>A	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.2260C>T	21.37:g.33057747G>A	ENSP00000286835:p.Pro754Ser		Somatic				SFRS15_uc002ype.2_Missense_Mutation_p.P754S|SFRS15_uc010glu.2_Missense_Mutation_p.P739S|SFRS15_uc002ypf.1_Missense_Mutation_p.P428S	p.P754S	NM_020706	NP_065757	WXS	Illumina HiSeq	Unspecified	O95104	SFR15_HUMAN			18	2686	-			754					C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	37	c.2260C>T	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290197	0.40494	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.58358	0.68;0.7;0.34	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000006	T	0.59018	0.2163	L	0.38838	1.175	0.49389	D	0.99978	D;P;D;D	0.60575	0.979;0.948;0.988;0.979	P;P;P;P	0.56216	0.628;0.533;0.794;0.628	T	0.50074	-0.8870	10	0.24483	T	0.36	-13.5058	19.9772	0.97314	0.0:0.0:1.0:0.0	.	739;754;754;754	C9JLZ0;C9J1W7;O95104-2;O95104	.;.;.;SFR15_HUMAN	S	739;754;754	ENSP00000402377:P739S;ENSP00000286835:P754S;ENSP00000382703:P754S	ENSP00000286835:P754S	P	-	1	0	SCAF4	31979618	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.813000	0.62620	2.724000	0.93272	0.563000	0.77884	CCT		0.453	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889		12	63	0	0	0	0	12	63				
KRTAP10-6	386674	broad.mit.edu	37	21	46011649	46011649	+	Missense_Mutation	SNP	A	A	C	rs587622046	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr21:46011649A>C	ENST00000400368.1	-	1	737	c.717T>G	c.(715-717)tgT>tgG	p.C239W	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	239	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						AGGTGGGCACACAGCACACAG	0.657																																						uc002zfm.2		NA																	0					0						c.(715-717)TGT>TGG		keratin associated protein 10-6							145.0	146.0	146.0					21																	46011649		2203	4300	6503	SO:0001583	missense	386674					keratin filament		g.chr21:46011649A>C	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.717T>G	21.37:g.46011649A>C	ENSP00000383219:p.Cys239Trp		Somatic				C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	p.C239W	NM_198688	NP_941961	WXS	Illumina HiSeq	Unspecified	P60371	KR106_HUMAN			1	738	-			239			21.|29 X 5 AA repeats of C-C-X(3).			Missense_Mutation	SNP	ENST00000400368.1	37	c.717T>G	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	a	3.133	-0.178059	0.06380	.	.	ENSG00000188155	ENST00000400368	T	0.02606	4.23	2.84	-3.52	0.04682	.	.	.	.	.	T	0.11452	0.0279	H	0.97587	4.035	0.09310	N	0.999992	P	0.44344	0.833	P	0.45406	0.479	T	0.01578	-1.1320	9	0.87932	D	0	.	8.181	0.31311	0.587:0.0:0.413:0.0	.	239	P60371	KR106_HUMAN	W	239	ENSP00000383219:C239W	ENSP00000383219:C239W	C	-	3	2	KRTAP10-6	44836077	0.000000	0.05858	0.002000	0.10522	0.032000	0.12392	-0.692000	0.05127	-0.847000	0.04168	0.319000	0.21371	TGT		0.657	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688		70	197	0	0	0	0	70	197				
SLC19A1	6573	broad.mit.edu	37	21	46957703	46957703	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr21:46957703C>T	ENST00000311124.4	-	2	323	c.171G>A	c.(169-171)aaG>aaA	p.K57K	SLC19A1_ENST00000567670.1_Silent_p.K57K|SLC19A1_ENST00000380010.4_Silent_p.K57K	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	57					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	GCGTGAAGTTCTTGTCGGGCC	0.687																																						uc002zhl.1		NA																	0					0						c.(169-171)AAG>AAA		solute carrier family 19 member 1							24.0	18.0	20.0					21																	46957703		2196	4288	6484	SO:0001819	synonymous_variant	6573				folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity	g.chr21:46957703C>T	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.171G>A	21.37:g.46957703C>T			Somatic				SLC19A1_uc010gpy.1_Silent_p.K57K|SLC19A1_uc002zhm.1_Silent_p.K57K|SLC19A1_uc010gpz.1_5'UTR	p.K57K	NM_194255	NP_919231	WXS	Illumina HiSeq	Unspecified	P41440	S19A1_HUMAN		Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	2	290	-			57			Extracellular (Probable).		B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Silent	SNP	ENST00000311124.4	37	c.171G>A	CCDS13725.1																																																																																				0.687	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1			7	7	0	0	0	0	7	7				
MCM3AP	8888	broad.mit.edu	37	21	47697544	47697544	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr21:47697544G>A	ENST00000397708.1	-	6	2009	c.1755C>T	c.(1753-1755)ctC>ctT	p.L585L	MCM3AP_ENST00000291688.1_Silent_p.L585L			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	585					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CACATGGCCCGAGGCCCTCGG	0.552																																						uc002zir.1		NA																	0				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						c.(1753-1755)CTC>CTT		minichromosome maintenance complex component 3							133.0	116.0	122.0					21																	47697544		2203	4300	6503	SO:0001819	synonymous_variant	8888				DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding	g.chr21:47697544G>A	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1755C>T	21.37:g.47697544G>A			Somatic					p.L585L	NM_003906	NP_003897	WXS	Illumina HiSeq	Unspecified	O60318	MCM3A_HUMAN			5	1791	-	Breast(49;0.112)		585					C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	c.1755C>T	CCDS13734.1																																																																																				0.552	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		12	111	0	0	0	0	12	111				
CECR1	51816	broad.mit.edu	37	22	17662734	17662734	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:17662734T>A	ENST00000399839.1	-	9	1688	c.1418A>T	c.(1417-1419)aAa>aTa	p.K473I	CECR1_ENST00000449907.2_Missense_Mutation_p.K431I|CECR1_ENST00000262607.3_Missense_Mutation_p.K473I|CECR1_ENST00000330232.4_Missense_Mutation_p.K232I|CECR1_ENST00000399837.2_Missense_Mutation_p.K473I	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	473					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GGCCAGCTGTTTGAGGGTCCT	0.547																																						uc002zmk.1		NA																	0				ovary(1)	1						c.(1417-1419)AAA>ATA		cat eye syndrome critical region protein 1							88.0	77.0	81.0					22																	17662734		2203	4300	6503	SO:0001583	missense	51816				adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding	g.chr22:17662734T>A	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1418A>T	22.37:g.17662734T>A	ENSP00000382733:p.Lys473Ile		Somatic				CECR1_uc010gqu.1_Missense_Mutation_p.K473I|CECR1_uc011agi.1_Missense_Mutation_p.K431I|CECR1_uc002zmj.1_Missense_Mutation_p.K232I	p.K473I	NM_017424	NP_059120	WXS	Illumina HiSeq	Unspecified	Q9NZK5	CECR1_HUMAN			8	1630	-		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)	473					A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	37	c.1418A>T	CCDS13742.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.389421	0.82902	.	.	ENSG00000093072	ENST00000399839;ENST00000330232;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D;D	0.95949	-3.86;-3.86;-3.86;-3.86;-3.86	3.71	3.71	0.42584	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	H	0.94964	3.605	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98755	1.0722	10	0.87932	D	0	.	12.4146	0.55486	0.0:0.0:0.0:1.0	.	473;232	Q9NZK5;Q9NZK5-2	CECR1_HUMAN;.	I	473;232;473;431;473	ENSP00000382733:K473I;ENSP00000332871:K232I;ENSP00000262607:K473I;ENSP00000406443:K431I;ENSP00000382731:K473I	ENSP00000262607:K473I	K	-	2	0	CECR1	16042734	1.000000	0.71417	0.877000	0.34402	0.987000	0.75469	4.975000	0.63777	1.316000	0.45131	0.459000	0.35465	AAA		0.547	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1			26	50	0	0	0	0	26	50				
IGLL1	3543	broad.mit.edu	37	22	23915612	23915612	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:23915612C>G	ENST00000330377.2	-	3	600	c.483G>C	c.(481-483)gaG>gaC	p.E161D	IGLL1_ENST00000249053.3_3'UTR|AP000345.2_ENST00000454863.1_RNA|AP000345.2_ENST00000458318.1_RNA	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	161	C region (By similarity to lambda light- chain).|Ig-like C1-type.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						GCGTGGTCATCTCCACGCCCT	0.582																																						uc002zxd.2		NA																	0					0						c.(481-483)GAG>GAC		immunoglobulin lambda-like polypeptide 1 isoform							125.0	111.0	115.0					22																	23915612		2203	4300	6503	SO:0001583	missense	3543				immune response	extracellular region|membrane		g.chr22:23915612C>G	X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.483G>C	22.37:g.23915612C>G	ENSP00000329312:p.Glu161Asp		Somatic				IGLL1_uc002zxe.2_3'UTR	p.E161D	NM_020070	NP_064455	WXS	Illumina HiSeq	Unspecified	P15814	IGLL1_HUMAN			3	601	-			161			C region (By similarity to lambda light- chain).|Ig-like C1-type.		Q0P681	Missense_Mutation	SNP	ENST00000330377.2	37	c.483G>C	CCDS13809.1	.	.	.	.	.	.	.	.	.	.	-	2.665	-0.278882	0.05642	.	.	ENSG00000128322	ENST00000330377;ENST00000438703	T;T	0.03124	4.04;4.04	2.45	1.29	0.21616	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.849937	0.10216	N	0.701525	T	0.04182	0.0116	L	0.39467	1.215	0.26563	N	0.973695	B	0.02656	0.0	B	0.08055	0.003	T	0.36089	-0.9762	10	0.46703	T	0.11	.	8.8654	0.35282	0.0:0.765:0.235:0.0	.	161	P15814	IGLL1_HUMAN	D	161;162	ENSP00000329312:E161D;ENSP00000403391:E162D	ENSP00000329312:E161D	E	-	3	2	IGLL1	22245612	0.970000	0.33590	0.025000	0.17156	0.002000	0.02628	0.639000	0.24690	0.295000	0.22570	0.165000	0.16767	GAG		0.582	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319569.1	NM_020070		3	154	0	0	0	0	3	154				
MGAT3	4248	broad.mit.edu	37	22	39883764	39883764	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:39883764G>A	ENST00000341184.6	+	2	627	c.412G>A	c.(412-414)Gag>Aag	p.E138K		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	138					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					GGAGAAGCCTGAGGGGGCCAA	0.741																																						uc003axv.3		NA																	0					0						c.(412-414)GAG>AAG		mannosyl (beta-1,4-)-glycoprotein							3.0	5.0	4.0					22																	39883764		1839	3707	5546	SO:0001583	missense	4248				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity	g.chr22:39883764G>A	D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.412G>A	22.37:g.39883764G>A	ENSP00000345270:p.Glu138Lys		Somatic				MGAT3_uc010gxy.2_Missense_Mutation_p.E138K	p.E138K	NM_002409	NP_002400	WXS	Illumina HiSeq	Unspecified	Q09327	MGAT3_HUMAN			2	651	+	Melanoma(58;0.04)		138			Lumenal (Potential).		A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	ENST00000341184.6	37	c.412G>A	CCDS13994.2	.	.	.	.	.	.	.	.	.	.	G	7.973	0.749481	0.15778	.	.	ENSG00000128268	ENST00000341184;ENST00000429402	.	.	.	5.03	1.65	0.23941	.	0.572712	0.15962	N	0.236200	T	0.18509	0.0444	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14531	-1.0469	9	0.48119	T	0.1	.	4.8177	0.13374	0.2492:0.0:0.6037:0.1472	.	138	Q09327	MGAT3_HUMAN	K	138	.	ENSP00000345270:E138K	E	+	1	0	MGAT3	38213710	0.981000	0.34729	0.001000	0.08648	0.104000	0.19210	4.395000	0.59678	0.460000	0.27045	0.467000	0.42956	GAG		0.741	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409		4	11	0	0	0	0	4	11				
MKL1	57591	broad.mit.edu	37	22	40815316	40815316	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:40815316G>A	ENST00000355630.3	-	12	1716	c.1126C>T	c.(1126-1128)Cgc>Tgc	p.R376C	MKL1_ENST00000407029.1_Missense_Mutation_p.R376C|MKL1_ENST00000396617.3_Missense_Mutation_p.R376C|MKL1_ENST00000402042.1_Missense_Mutation_p.R326C	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	376	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCTCGAAGGCGCTCAATCAGC	0.607			T	RBM15	acute megakaryocytic leukemia																																	uc003ayv.1		NA		Dom	yes		22	22q13	57591	T	megakaryoblastic leukemia (translocation) 1			L	RBM15		acute megakaryocytic leukemia		0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1126-1128)CGC>TGC		megakaryoblastic leukemia 1 protein							45.0	47.0	46.0					22																	40815316		2203	4300	6503	SO:0001583	missense	57591				positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity	g.chr22:40815316G>A	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1126C>T	22.37:g.40815316G>A	ENSP00000347847:p.Arg376Cys		Somatic				MKL1_uc003ayw.1_Missense_Mutation_p.R376C|MKL1_uc010gye.1_Missense_Mutation_p.R376C|MKL1_uc010gyf.1_Missense_Mutation_p.R326C	p.R376C	NM_020831	NP_065882	WXS	Illumina HiSeq	Unspecified	Q969V6	MKL1_HUMAN			9	1333	-			376			SAP.		Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	c.1126C>T	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780227	0.70222	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	D;D;D;D	0.88896	-2.29;-2.44;-2.29;-2.29	5.03	5.03	0.67393	DNA-binding SAP (4);	0.000000	0.85682	D	0.000000	D	0.95802	0.8634	H	0.95504	3.68	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.997	D;D;P	0.91635	0.999;0.91;0.807	D	0.96353	0.9260	10	0.87932	D	0	-26.8399	12.3777	0.55289	0.0:0.0:0.7111:0.2889	.	326;376;376	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	C	376;376;326;376	ENSP00000347847:R376C;ENSP00000379861:R376C;ENSP00000385584:R326C;ENSP00000385835:R376C	ENSP00000347847:R376C	R	-	1	0	MKL1	39145262	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.190000	0.50973	2.613000	0.88420	0.655000	0.94253	CGC		0.607	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831		8	26	0	0	0	0	8	26				
EP300	2033	broad.mit.edu	37	22	41573028	41573028	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:41573028C>A	ENST00000263253.7	+	31	6532	c.5313C>A	c.(5311-5313)tgC>tgA	p.C1771*	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1771	Binding region for E1A adenovirus.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CCAAGGGTTGCAAACGGAAAA	0.567			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													uc003azl.3		NA		Rec	yes		22	22q13	2033	T| N|F|Mis|O	300 kd E1A-Binding protein gene			"""L, E"""	MLL|RUNXBP2		colorectal|breast|pancreatic|AML|ALL|DLBCL		0				haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						c.(5311-5313)TGC>TGA		E1A binding protein p300							80.0	69.0	73.0					22																	41573028		2203	4300	6503	SO:0001587	stop_gained	2033	Rubinstein-Taybi_syndrome	Familial Cancer Database	Broad Thumb-Hallux syndrome	apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	g.chr22:41573028C>A	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5313C>A	22.37:g.41573028C>A	ENSP00000263253:p.Cys1771*		Somatic					p.C1771*	NM_001429	NP_001420	WXS	Illumina HiSeq	Unspecified	Q09472	EP300_HUMAN			31	5708	+			1771			Binding region for E1A adenovirus.|TAZ-type 2.		B1AKC2	Nonsense_Mutation	SNP	ENST00000263253.7	37	c.5313C>A	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	52	19.784586	0.99923	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.75	5.75	0.90469	.	0.000000	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0783	19.9469	0.97185	0.0:1.0:0.0:0.0	.	.	.	.	X	1771	.	ENSP00000263253:C1771X	C	+	3	2	EP300	39902974	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.926000	0.63433	2.714000	0.92807	0.650000	0.86243	TGC		0.567	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429		9	38	1	0	3.86e-05	4.23e-05	9	38				
XRCC6	2547	broad.mit.edu	37	22	42033722	42033722	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:42033722G>C	ENST00000359308.4	+	5	1355	c.700G>C	c.(700-702)Gag>Cag	p.E234Q	XRCC6_ENST00000405506.1_Missense_Mutation_p.E184Q|XRCC6_ENST00000428575.2_Missense_Mutation_p.E101Q|XRCC6_ENST00000360079.3_Missense_Mutation_p.E234Q|XRCC6_ENST00000405878.1_Missense_Mutation_p.E234Q|XRCC6_ENST00000402580.3_Missense_Mutation_p.E193Q			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	234					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						GGTTCACTTTGAGGAATCCAG	0.537								Non-homologous end-joining																														uc003bao.1		NA																	0				skin(2)|ovary(1)|lung(1)|kidney(1)	5						c.(700-702)GAG>CAG	Direct_reversal_of_damage|NHEJ	ATP-dependent DNA helicase II, 70 kDa subunit							48.0	41.0	43.0					22																	42033722		2203	4300	6503	SO:0001583	missense	2547				DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding	g.chr22:42033722G>C	J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.700G>C	22.37:g.42033722G>C	ENSP00000352257:p.Glu234Gln		Somatic				XRCC6_uc003bap.1_Missense_Mutation_p.E193Q|XRCC6_uc011apc.1_Missense_Mutation_p.E184Q|XRCC6_uc003baq.1_Missense_Mutation_p.E234Q|XRCC6_uc003bar.1_Missense_Mutation_p.E234Q|XRCC6_uc003bas.1_Missense_Mutation_p.E184Q	p.E234Q	NM_001469	NP_001460	WXS	Illumina HiSeq	Unspecified	P12956	XRCC6_HUMAN			6	770	+			234					B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	37	c.700G>C	CCDS14021.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971006	0.53614	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	5.6	5.6	0.85130	Ku70/Ku80, N-terminal alpha/beta (1);	0.090075	0.85682	D	0.000000	T	0.50069	0.1594	L	0.39397	1.21	0.58432	D	0.99999	B;B;B;B	0.25904	0.019;0.011;0.137;0.042	B;B;B;B	0.32677	0.055;0.028;0.15;0.055	T	0.46034	-0.9220	9	0.35671	T	0.21	-30.9788	11.0331	0.47785	0.1433:0.0:0.8567:0.0	.	184;234;193;234	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	Q	234;193;101;234;234;234;184	.	ENSP00000352257:E234Q	E	+	1	0	XRCC6	40363668	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.706000	0.54830	2.628000	0.89032	0.655000	0.94253	GAG		0.537	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469		3	18	0	0	0	0	3	18				
TRMU	55687	broad.mit.edu	37	22	46751462	46751462	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:46751462G>C	ENST00000290846.4	+	9	1335	c.995G>C	c.(994-996)cGa>cCa	p.R332P	TRMU_ENST00000381019.3_Missense_Mutation_p.R332P	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	332					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		TGCCACTTCCGATTCCGCCAC	0.642											OREG0026654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003bhp.2		NA																	0				ovary(1)	1						c.(994-996)CGA>CCA		tRNA 5-methylaminomethyl-2-thiouridylate							57.0	53.0	54.0					22																	46751462		2203	4300	6503	SO:0001583	missense	55687					mitochondrion	ATP binding|sulfurtransferase activity|tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity|tRNA binding	g.chr22:46751462G>C	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.995G>C	22.37:g.46751462G>C	ENSP00000290846:p.Arg332Pro		Somatic	OREG0026654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	941	TRMU_uc003bhq.2_Missense_Mutation_p.R114P|TRMU_uc003bhs.2_Missense_Mutation_p.R332P|TRMU_uc003bhr.2_Missense_Mutation_p.R218P|TRMU_uc003bht.2_Missense_Mutation_p.R185P|TRMU_uc003bhu.2_Missense_Mutation_p.R114P|TRMU_uc003bhv.2_Missense_Mutation_p.R185P	p.R332P	NM_018006	NP_060476	WXS	Illumina HiSeq	Unspecified	O75648	MTU1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)	9	1359	+		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)	332					A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	37	c.995G>C	CCDS14075.1	.	.	.	.	.	.	.	.	.	.	G	33	5.216850	0.95104	.	.	ENSG00000100416	ENST00000290846;ENST00000381019	T;T	0.74526	-0.85;-0.85	5.5	5.5	0.81552	.	0.055023	0.64402	D	0.000001	D	0.88588	0.6477	M	0.87038	2.855	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.996;0.981;0.997	D	0.90132	0.4207	10	0.87932	D	0	-19.5743	19.0082	0.92861	0.0:0.0:1.0:0.0	.	178;178;332;332	O75648-3;O75648-4;O75648-2;O75648	.;.;.;MTU1_HUMAN	P	332	ENSP00000290846:R332P;ENSP00000370407:R332P	ENSP00000290846:R332P	R	+	2	0	TRMU	45130126	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	7.338000	0.79269	2.597000	0.87782	0.563000	0.77884	CGA		0.642	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006		19	33	0	0	0	0	19	33				
TRMU	55687	broad.mit.edu	37	22	46752850	46752850	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr22:46752850G>A	ENST00000290846.4	+	11	1553	c.1213G>A	c.(1213-1215)Gag>Aag	p.E405K	TRMU_ENST00000381019.3_Silent_p.*377*	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	405					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		GATGGCCACTGAGAGCCCCAG	0.632																																						uc003bhp.2		NA																	0				ovary(1)	1						c.(1213-1215)GAG>AAG		tRNA 5-methylaminomethyl-2-thiouridylate							55.0	57.0	56.0					22																	46752850		2203	4300	6503	SO:0001583	missense	55687					mitochondrion	ATP binding|sulfurtransferase activity|tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity|tRNA binding	g.chr22:46752850G>A	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.1213G>A	22.37:g.46752850G>A	ENSP00000290846:p.Glu405Lys		Somatic				TRMU_uc003bhq.2_Missense_Mutation_p.E187K|TRMU_uc003bhs.2_Silent_p.*377*|TRMU_uc003bhr.2_Missense_Mutation_p.E291K|TRMU_uc003bht.2_Missense_Mutation_p.E258K|TRMU_uc003bhu.2_Missense_Mutation_p.E187K|TRMU_uc003bhv.2_Silent_p.*230*	p.E405K	NM_018006	NP_060476	WXS	Illumina HiSeq	Unspecified	O75648	MTU1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)	11	1577	+		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)	405					A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	37	c.1213G>A	CCDS14075.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.712323	0.30322	.	.	ENSG00000100416	ENST00000290846	T	0.70749	-0.51	4.32	1.01	0.19927	.	0.713969	0.12987	N	0.422772	T	0.44307	0.1287	N	0.08118	0	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.23368	-1.0190	10	0.23302	T	0.38	-23.7749	5.8804	0.18852	0.4253:0.0:0.5747:0.0	.	251;405	O75648-4;O75648	.;MTU1_HUMAN	K	405	ENSP00000290846:E405K	ENSP00000290846:E405K	E	+	1	0	TRMU	45131514	0.018000	0.18449	0.007000	0.13788	0.001000	0.01503	0.514000	0.22786	0.394000	0.25230	-0.339000	0.08088	GAG		0.632	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006		15	39	0	0	0	0	15	39				
KCNH8	131096	broad.mit.edu	37	3	19295208	19295208	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:19295208G>A	ENST00000328405.2	+	2	405	c.139G>A	c.(139-141)Gat>Aat	p.D47N		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	47	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CTACTGTTCCGATGGCTTCTG	0.453																																					NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	0				lung(4)|ovary(1)	5						c.(139-141)GAT>AAT		potassium voltage-gated channel, subfamily H,							184.0	186.0	185.0					3																	19295208		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19295208G>A	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.139G>A	3.37:g.19295208G>A	ENSP00000328813:p.Asp47Asn		Somatic				KCNH8_uc011awe.1_Missense_Mutation_p.D47N|KCNH8_uc010hex.1_5'UTR	p.D47N	NM_144633	NP_653234	WXS	Illumina HiSeq	Unspecified	Q96L42	KCNH8_HUMAN			2	334	+			47			Cytoplasmic (Potential).|PAS.		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.139G>A	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	35	5.551994	0.96501	.	.	ENSG00000183960	ENST00000328405	D	0.99582	-6.22	5.58	5.58	0.84498	PAS fold-3 (1);PAS (1);	0.000000	0.32372	U	0.006186	D	0.99609	0.9858	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98554	1.0638	9	.	.	.	.	19.5716	0.95423	0.0:0.0:1.0:0.0	.	47;47	B7Z398;Q96L42	.;KCNH8_HUMAN	N	47	ENSP00000328813:D47N	.	D	+	1	0	KCNH8	19270212	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.771000	0.98977	2.611000	0.88343	0.655000	0.94253	GAT		0.453	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		12	103	0	0	0	0	12	103				
SLC6A20	54716	broad.mit.edu	37	3	45804560	45804560	+	Silent	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:45804560C>G	ENST00000358525.4	-	9	1423	c.1308G>C	c.(1306-1308)ctG>ctC	p.L436L	SLC6A20_ENST00000353278.4_Silent_p.L399L|SLC6A20_ENST00000493980.1_5'UTR|SLC6A20_ENST00000456124.2_Silent_p.L436L	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	436					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		CAAGGCACACCAGACCTGGGG	0.592																																						uc011bai.1		NA																	0				ovary(2)	2						c.(1306-1308)CTG>CTC		solute carrier family 6, member 20 isoform 1							140.0	112.0	121.0					3																	45804560		2203	4300	6503	SO:0001819	synonymous_variant	54716				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity	g.chr3:45804560C>G	AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.1308G>C	3.37:g.45804560C>G			Somatic				SLC6A20_uc003cow.2_Silent_p.L86L|SLC6A20_uc011baj.1_Silent_p.L399L	p.L436L	NM_020208	NP_064593	WXS	Illumina HiSeq	Unspecified	Q9NP91	S6A20_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)	9	1432	-			436			Helical; Name=9; (Potential).		A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	ENST00000358525.4	37	c.1308G>C	CCDS43077.1																																																																																				0.592	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	NM_020208		13	55	0	0	0	0	13	55				
CACNA1D	776	broad.mit.edu	37	3	53757958	53757958	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:53757958T>A	ENST00000350061.5	+	14	2543	c.2032T>A	c.(2032-2034)Ttt>Att	p.F678I	CACNA1D_ENST00000288139.4_Missense_Mutation_p.F698I|CACNA1D_ENST00000422281.2_Missense_Mutation_p.F678I	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	678					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAGTTTAATTTTGATGAAAC	0.463																																						uc003dgv.3		NA																	0				ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11						c.(2032-2034)TTT>ATT		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						136.0	126.0	129.0					3																	53757958		2203	4300	6503	SO:0001583	missense	776				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity	g.chr3:53757958T>A	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2032T>A	3.37:g.53757958T>A	ENSP00000288133:p.Phe678Ile		Somatic				CACNA1D_uc003dgu.3_Missense_Mutation_p.F698I|CACNA1D_uc003dgy.3_Missense_Mutation_p.F678I|CACNA1D_uc003dgw.3_Missense_Mutation_p.F345I	p.F678I	NM_001128840	NP_001122312	WXS	Illumina HiSeq	Unspecified	Q01668	CAC1D_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	14	2195	+			678			Extracellular (Potential).|II.		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	c.2032T>A	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	T	33	5.255831	0.95336	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91	5.97	5.97	0.96955	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98985	0.9654	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;0.993;0.997;1.0	D;D;D;D	0.81914	0.995;0.942;0.976;0.991	D	0.99793	1.1032	10	0.87932	D	0	.	16.4416	0.83903	0.0:0.0:0.0:1.0	.	678;371;678;698	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	I	678;698;678;371	ENSP00000288133:F678I;ENSP00000288139:F698I;ENSP00000409174:F678I;ENSP00000418014:F371I	ENSP00000288139:F698I	F	+	1	0	CACNA1D	53732998	1.000000	0.71417	0.951000	0.38953	0.994000	0.84299	8.040000	0.89188	2.285000	0.76669	0.477000	0.44152	TTT		0.463	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		15	39	0	0	0	0	15	39				
PARP14	54625	broad.mit.edu	37	3	122420364	122420364	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:122420364C>T	ENST00000474629.2	+	6	3229	c.2963C>T	c.(2962-2964)cCg>cTg	p.P988L		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	988					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		ACAGCTGCCCCGCCAGGTTTA	0.522																																						uc003efq.3		NA																	0				ovary(2)|breast(2)|lung(1)|pancreas(1)	6						c.(2962-2964)CCG>CTG		poly (ADP-ribose) polymerase family, member 14							30.0	31.0	31.0					3																	122420364		1922	4136	6058	SO:0001583	missense	54625				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity	g.chr3:122420364C>T	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.2963C>T	3.37:g.122420364C>T	ENSP00000418194:p.Pro988Leu		Somatic				PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Missense_Mutation_p.P705L|PARP14_uc003efs.1_Missense_Mutation_p.P705L	p.P988L	NM_017554	NP_060024	WXS	Illumina HiSeq	Unspecified	Q460N5	PAR14_HUMAN		GBM - Glioblastoma multiforme(114;0.0531)	6	3022	+			988					B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	c.2963C>T	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	C	8.027	0.760897	0.15914	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.10382	2.88	5.14	-10.3	0.00346	.	3.763150	0.00550	N	0.000258	T	0.03220	0.0094	N	0.03177	-0.4	0.09310	N	0.999993	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.001	T	0.35101	-0.9802	10	0.20519	T	0.43	.	1.9535	0.03371	0.2784:0.3632:0.1888:0.1696	.	988;988	Q460N5-4;Q460N5	.;PAR14_HUMAN	L	988;907	ENSP00000418194:P988L	ENSP00000381228:P907L	P	+	2	0	PARP14	123903054	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.751000	0.00792	-2.773000	0.00364	-2.108000	0.00357	CCG		0.522	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554		4	17	0	0	0	0	4	17				
ROPN1B	152015	broad.mit.edu	37	3	125694519	125694519	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:125694519C>G	ENST00000514116.1	+	4	545	c.230C>G	c.(229-231)tCt>tGt	p.S77C	ROPN1B_ENST00000505382.1_5'UTR|ROPN1B_ENST00000251776.4_Missense_Mutation_p.S77C|ROPN1B_ENST00000511082.1_5'UTR			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	77					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		ATCCTGCATTCTCAGGTAAGG	0.567																																						uc003eih.2		NA																	0					0						c.(229-231)TCT>TGT		ropporin, rhophilin associated protein 1B							79.0	68.0	72.0					3																	125694519		2203	4300	6503	SO:0001583	missense	152015				acrosome reaction|cell-cell adhesion|cytokinesis|fusion of sperm to egg plasma membrane|Rho protein signal transduction|sperm motility|spermatogenesis	cytoplasm|flagellum	cAMP-dependent protein kinase regulator activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling complex scaffold activity	g.chr3:125694519C>G	AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.230C>G	3.37:g.125694519C>G	ENSP00000426271:p.Ser77Cys		Somatic				ROPN1B_uc010hsb.2_Missense_Mutation_p.S77C|ROPN1B_uc010hsc.2_5'UTR|ROPN1B_uc011bkg.1_Missense_Mutation_p.S77C	p.S77C	NM_001012337	NP_001012337	WXS	Illumina HiSeq	Unspecified	Q9BZX4	ROP1B_HUMAN		GBM - Glioblastoma multiforme(114;0.151)	3	458	+			77					D3DNA6|Q96BM7	Missense_Mutation	SNP	ENST00000514116.1	37	c.230C>G	CCDS33841.1	.	.	.	.	.	.	.	.	.	.	C	7.399	0.632462	0.14322	.	.	ENSG00000114547	ENST00000514116;ENST00000251776;ENST00000513830;ENST00000508088	T;T;T;T	0.47177	1.93;1.93;1.42;0.85	2.76	1.85	0.25348	.	0.113450	0.40385	N	0.001116	T	0.32793	0.0841	L	0.29908	0.895	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.10450	0.002;0.005	T	0.13899	-1.0492	10	0.87932	D	0	-36.9239	8.0851	0.30767	0.0:0.7477:0.2523:0.0	.	77;77	B7Z7H1;Q9BZX4	.;ROP1B_HUMAN	C	77	ENSP00000426271:S77C;ENSP00000251776:S77C;ENSP00000425548:S77C;ENSP00000423058:S77C	ENSP00000251776:S77C	S	+	2	0	ROPN1B	127177209	1.000000	0.71417	0.993000	0.49108	0.538000	0.34931	2.782000	0.47758	0.426000	0.26116	-0.914000	0.02751	TCT		0.567	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369931.1	NM_001012337		18	42	0	0	0	0	18	42				
PLXNA1	5361	broad.mit.edu	37	3	126733043	126733043	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:126733043C>T	ENST00000393409.2	+	11	2429	c.2429C>T	c.(2428-2430)cCg>cTg	p.P810L	PLXNA1_ENST00000251772.4_Missense_Mutation_p.P787L	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	810					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TACAAGTGCCCGGCCCTGCGC	0.736																																						uc003ejg.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2359-2361)CCG>CTG		plexin A1							23.0	26.0	25.0					3																	126733043		2199	4292	6491	SO:0001583	missense	5361				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity	g.chr3:126733043C>T	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2429C>T	3.37:g.126733043C>T	ENSP00000377061:p.Pro810Leu		Somatic					p.P787L	NM_032242	NP_115618	WXS	Illumina HiSeq	Unspecified	Q9UIW2	PLXA1_HUMAN		GBM - Glioblastoma multiforme(114;0.155)	11	2364	+			810			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000393409.2	37	c.2360C>T	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590288	0.28357	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.48201	0.82;0.82	2.86	2.86	0.33363	.	0.295493	0.29093	N	0.013172	T	0.34077	0.0885	N	0.22421	0.69	0.47308	D	0.999388	B	0.25235	0.121	B	0.29942	0.109	T	0.15867	-1.0422	10	0.25751	T	0.34	.	13.5801	0.61898	0.0:1.0:0.0:0.0	.	810	Q9UIW2	PLXA1_HUMAN	L	810;787	ENSP00000377061:P810L;ENSP00000251772:P787L	ENSP00000251772:P787L	P	+	2	0	PLXNA1	128215733	0.881000	0.30235	0.984000	0.44739	0.921000	0.55340	2.220000	0.42908	1.908000	0.55244	0.486000	0.48141	CCG		0.736	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242		6	25	0	0	0	0	6	25				
ASTE1	28990	broad.mit.edu	37	3	130744130	130744130	+	Missense_Mutation	SNP	C	C	G	rs139512239		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:130744130C>G	ENST00000264992.3	-	3	462	c.21G>C	c.(19-21)atG>atC	p.M7I	NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000510688.1_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.M7I|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000510769.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	7					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						CCACAAAACTCATTAGTCCTC	0.378																																						uc003env.1		NA																	0					0						c.(19-21)ATG>ATC		asteroid homolog 1							88.0	91.0	90.0					3																	130744130		2202	4289	6491	SO:0001583	missense	28990				DNA repair		nuclease activity	g.chr3:130744130C>G	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.21G>C	3.37:g.130744130C>G	ENSP00000264992:p.Met7Ile		Somatic				NEK11_uc003enx.2_5'Flank|NEK11_uc003eny.2_5'Flank|NEK11_uc003eoa.2_5'Flank|NEK11_uc003enz.2_5'Flank|NEK11_uc010htn.2_5'Flank|NEK11_uc011blk.1_5'Flank|NEK11_uc011bll.1_5'Flank|NEK11_uc003enw.1_5'Flank|NEK11_uc011blm.1_5'Flank|ASTE1_uc010htm.1_Missense_Mutation_p.M7I|ASTE1_uc011blj.1_RNA	p.M7I	NM_014065	NP_054784	WXS	Illumina HiSeq	Unspecified	Q2TB18	ASTE1_HUMAN			3	463	-			7					B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	c.21G>C	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.296642	0.60086	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270;ENST00000505545;ENST00000504725;ENST00000509060	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.44	4.56	0.56223	XPG N-terminal (1);	0.084420	0.85682	D	0.000000	T	0.41903	0.1179	L	0.28274	0.84	0.34207	D	0.673819	P;P	0.44521	0.837;0.837	P;P	0.45195	0.473;0.473	T	0.51741	-0.8667	10	0.28530	T	0.3	-31.7547	10.833	0.46671	0.0:0.7961:0.1302:0.0737	.	7;7	D6RG30;Q2TB18	.;ASTE1_HUMAN	I	7	ENSP00000426421:M7I;ENSP00000264992:M7I;ENSP00000425683:M7I;ENSP00000422851:M7I	ENSP00000264992:M7I	M	-	3	0	ASTE1	132226820	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.703000	0.25646	2.551000	0.86045	0.650000	0.86243	ATG		0.378	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065		22	57	0	0	0	0	22	57				
GYG1	2992	broad.mit.edu	37	3	148712030	148712030	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:148712030G>A	ENST00000345003.4	+	2	409	c.109G>A	c.(109-111)Gtg>Atg	p.V37M	GYG1_ENST00000484197.1_Missense_Mutation_p.V37M|GYG1_ENST00000296048.6_Missense_Mutation_p.V37M|GYG1_ENST00000483267.1_Missense_Mutation_p.V37M	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1	37					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GAGGCTGGTCGTGCTCGCCAC	0.587																																						uc003ewn.2		NA																	0				ovary(1)	1						c.(109-111)GTG>ATG		glycogenin 1							72.0	69.0	70.0					3																	148712030		2203	4300	6503	SO:0001583	missense	2992				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding	g.chr3:148712030G>A	AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.109G>A	3.37:g.148712030G>A	ENSP00000340736:p.Val37Met		Somatic				GYG1_uc011bnp.1_Missense_Mutation_p.V37M|GYG1_uc003ewo.2_Missense_Mutation_p.V37M|GYG1_uc003ewp.2_Missense_Mutation_p.V37M	p.V37M	NM_004130	NP_004121	WXS	Illumina HiSeq	Unspecified	P46976	GLYG_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		2	162	+			37					D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Missense_Mutation	SNP	ENST00000345003.4	37	c.109G>A	CCDS3139.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291027	0.80914	.	.	ENSG00000163754	ENST00000345003;ENST00000296048;ENST00000483267;ENST00000484197;ENST00000461191	T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47	5.31	5.31	0.75309	.	0.179846	0.48286	D	0.000185	T	0.81341	0.4802	M	0.80982	2.52	0.54753	D	0.999983	P;D;D;D	0.63046	0.823;0.987;0.979;0.992	B;P;P;P	0.52881	0.29;0.571;0.712;0.668	D	0.84506	0.0619	10	0.72032	D	0.01	-17.9699	18.9832	0.92762	0.0:0.0:1.0:0.0	.	37;37;37;37	G5E9W8;D3DNH0;P46976-2;P46976	.;.;.;GLYG_HUMAN	M	37	ENSP00000340736:V37M;ENSP00000296048:V37M;ENSP00000419499:V37M;ENSP00000420683:V37M;ENSP00000420247:V37M	ENSP00000296048:V37M	V	+	1	0	GYG1	150194720	1.000000	0.71417	0.928000	0.36995	0.378000	0.30076	9.378000	0.97191	2.475000	0.83589	0.650000	0.86243	GTG		0.587	GYG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356046.1	NM_004130		18	65	0	0	0	0	18	65				
TNIK	23043	broad.mit.edu	37	3	170802911	170802911	+	Silent	SNP	G	G	A	rs368574578		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:170802911G>A	ENST00000436636.2	-	25	3338	c.2994C>T	c.(2992-2994)gcC>gcT	p.A998A	TNIK_ENST00000460047.1_Silent_p.A935A|TNIK_ENST00000369326.5_Silent_p.A976A|TNIK_ENST00000284483.8_Silent_p.A990A|TNIK_ENST00000475336.1_Silent_p.A906A|TNIK_ENST00000538048.1_Silent_p.A950A|TNIK_ENST00000488470.1_Silent_p.A943A|TNIK_ENST00000357327.5_Silent_p.A969A|TNIK_ENST00000341852.6_Silent_p.A914A|TNIK_ENST00000470834.1_Silent_p.A961A	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	998	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.A998A(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GCTTACCTGCGGCTGATGATT	0.483																																						uc003fhh.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|large_intestine(1)	5						c.(2992-2994)GCC>GCT		TRAF2 and NCK interacting kinase isoform 1		G	,,,,,,,	0,3814		0,0,1907	59.0	60.0	59.0		2970,2907,2883,2829,2805,2742,2718,2994	-10.7	0.0	3		59	1,8245		0,1,4122	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TNIK	NM_001161560.1,NM_001161561.1,NM_001161562.1,NM_001161563.1,NM_001161564.1,NM_001161565.1,NM_001161566.1,NM_015028.2	,,,,,,,	0,1,6029	AA,AG,GG		0.0121,0.0,0.0083	,,,,,,,	990/1353,969/1332,961/1324,943/1306,935/1298,914/1277,906/1269,998/1361	170802911	1,12059	1907	4123	6030	SO:0001819	synonymous_variant	23043				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr3:170802911G>A	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2994C>T	3.37:g.170802911G>A			Somatic				TNIK_uc003fhi.2_Silent_p.A943A|TNIK_uc003fhj.2_Silent_p.A969A|TNIK_uc003fhk.2_Silent_p.A990A|TNIK_uc003fhl.2_Silent_p.A914A|TNIK_uc003fhm.2_Silent_p.A935A|TNIK_uc003fhn.2_Silent_p.A961A|TNIK_uc003fho.2_Silent_p.A906A|TNIK_uc003fhg.2_Silent_p.A176A|TNIK_uc003fhp.2_5'Flank	p.A998A	NM_015028	NP_055843	WXS	Illumina HiSeq	Unspecified	Q9UKE5	TNIK_HUMAN	LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		25	3339	-	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		998			Mediates interaction with NEDD4.		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Silent	SNP	ENST00000436636.2	37	c.2994C>T	CCDS46956.1																																																																																				0.483	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796		3	8	0	0	0	0	3	8				
IQCG	84223	broad.mit.edu	37	3	197670906	197670906	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:197670906A>G	ENST00000265239.6	-	4	449	c.25T>C	c.(25-27)Tca>Cca	p.S9P	IQCG_ENST00000453254.1_Missense_Mutation_p.S9P|IQCG_ENST00000455191.1_Missense_Mutation_p.S9P|IQCG_ENST00000480302.1_5'UTR	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	9						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		GGAAGGTTTGAGTCTTCCAGG	0.408																																						uc003fyo.2		NA																	0					0						c.(25-27)TCA>CCA		IQ motif containing G							116.0	121.0	119.0					3																	197670906		2203	4300	6503	SO:0001583	missense	84223							g.chr3:197670906A>G	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.25T>C	3.37:g.197670906A>G	ENSP00000265239:p.Ser9Pro		Somatic				IQCG_uc003fyp.2_Missense_Mutation_p.S9P|IQCG_uc003fyq.3_Missense_Mutation_p.S9P	p.S9P	NM_001134435	NP_001127907	WXS	Illumina HiSeq	Unspecified	Q9H095	IQCG_HUMAN	Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)	3	171	-	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		9					Q9BST2|Q9HAG8	Missense_Mutation	SNP	ENST00000265239.6	37	c.25T>C	CCDS3331.1	.	.	.	.	.	.	.	.	.	.	A	11.03	1.518726	0.27211	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000452735	T;T;T	0.52057	0.68;0.68;0.69	3.6	-2.18	0.07037	.	2.050120	0.02410	N	0.081573	T	0.60366	0.2263	M	0.68317	2.08	0.09310	N	1	D;D	0.71674	0.998;0.99	D;P	0.69142	0.962;0.676	T	0.50171	-0.8859	10	0.72032	D	0.01	2.8335	1.2296	0.01941	0.3425:0.3611:0.1202:0.1762	.	9;9	C9JKX8;Q9H095	.;IQCG_HUMAN	P	9	ENSP00000265239:S9P;ENSP00000407736:S9P;ENSP00000389897:S9P	ENSP00000265239:S9P	S	-	1	0	IQCG	199155303	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.084000	0.11268	-0.365000	0.08076	0.451000	0.29950	TCA		0.408	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1	NM_032263		3	161	0	0	0	0	3	161				
DGKQ	1609	broad.mit.edu	37	4	959304	959304	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:959304G>A	ENST00000273814.3	-	14	1666	c.1593C>T	c.(1591-1593)tcC>tcT	p.S531S	DGKQ_ENST00000502309.1_5'UTR	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	531					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TGTGACTCACGGACACCACGG	0.667																																					Esophageal Squamous(17;537 645 4447 26373)	uc003gbw.2		NA																	0				kidney(1)	1						c.(1591-1593)TCC>TCT		diacylglycerol kinase, theta							62.0	52.0	55.0					4																	959304		2199	4299	6498	SO:0001819	synonymous_variant	1609				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding	g.chr4:959304G>A	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.1593C>T	4.37:g.959304G>A			Somatic				DGKQ_uc010ibn.2_Intron	p.S531S	NM_001347	NP_001338	WXS	Illumina HiSeq	Unspecified	P52824	DGKQ_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		14	1667	-			531					Q6P3W4	Silent	SNP	ENST00000273814.3	37	c.1593C>T	CCDS3342.1																																																																																				0.667	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000200888.1			5	18	0	0	0	0	5	18				
IDUA	3425	broad.mit.edu	37	4	995557	995557	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:995557C>G	ENST00000247933.4	+	6	768	c.680C>G	c.(679-681)aCc>aGc	p.T227S	IDUA_ENST00000514224.1_Missense_Mutation_p.T95S|IDUA_ENST00000453894.1_Missense_Mutation_p.T180S	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	227					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TCCTTCCACACCCCACCGCGA	0.711																																						uc003gby.2		NA																	0					0						c.(679-681)ACC>AGC		alpha-L-iduronidase precursor	Laronidase(DB00090)						11.0	12.0	12.0					4																	995557		2179	4278	6457	SO:0001583	missense	3425				disaccharide metabolic process	lysosome	cation binding|L-iduronidase activity	g.chr4:995557C>G	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.680C>G	4.37:g.995557C>G	ENSP00000247933:p.Thr227Ser		Somatic				IDUA_uc003gbz.2_RNA|IDUA_uc003gca.2_Missense_Mutation_p.T180S	p.T227S	NM_000203	NP_000194	WXS	Illumina HiSeq	Unspecified	P35475	IDUA_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		6	768	+			227					B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	c.680C>G	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	C	2.787	-0.252139	0.05829	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000502910;ENST00000514192;ENST00000509948;ENST00000514224	D;D;D;D;D;D	0.94497	-3.44;-3.44;-3.44;-3.44;-3.44;-3.44	5.42	4.56	0.56223	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.259165	0.40144	N	0.001178	T	0.77987	0.4213	N	0.00446	-1.495	0.21802	N	0.999535	B;B	0.14438	0.01;0.004	B;B	0.13407	0.004;0.009	T	0.64769	-0.6329	10	0.02654	T	1	-0.0826	13.0835	0.59127	0.162:0.838:0.0:0.0	.	180;227	B3KWK6;P35475	.;IDUA_HUMAN	S	227;180;180;166;158;95	ENSP00000247933:T227S;ENSP00000396458:T180S;ENSP00000422952:T180S;ENSP00000423685:T166S;ENSP00000424227:T158S;ENSP00000425081:T95S	ENSP00000247933:T227S	T	+	2	0	IDUA	985557	0.026000	0.19158	0.537000	0.28052	0.006000	0.05464	3.007000	0.49536	1.262000	0.44165	0.555000	0.69702	ACC		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203		3	16	0	0	0	0	3	16				
OTOP1	133060	broad.mit.edu	37	4	4199228	4199228	+	Missense_Mutation	SNP	C	C	G	rs566380189		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:4199228C>G	ENST00000296358.4	-	5	1357	c.1333G>C	c.(1333-1335)Gaa>Caa	p.E445Q		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	445					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGAATGGATTCAAAGATGAAG	0.542																																						uc003ghp.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1333-1335)GAA>CAA		otopetrin 1							58.0	62.0	61.0					4																	4199228		2203	4300	6503	SO:0001583	missense	133060				biomineral tissue development	extracellular space|integral to membrane		g.chr4:4199228C>G	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1333G>C	4.37:g.4199228C>G	ENSP00000296358:p.Glu445Gln		Somatic					p.E445Q	NM_177998	NP_819056	WXS	Illumina HiSeq	Unspecified	Q7RTM1	OTOP1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	5	1363	-			445					A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	c.1333G>C	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760213	0.49468	.	.	ENSG00000163982	ENST00000296358	T	0.22336	1.96	4.76	4.76	0.60689	.	0.105487	0.64402	D	0.000005	T	0.51805	0.1696	M	0.82716	2.605	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.60224	-0.7305	10	0.87932	D	0	-2.5669	18.1569	0.89694	0.0:1.0:0.0:0.0	.	445	Q7RTM1	OTOP1_HUMAN	Q	445	ENSP00000296358:E445Q	ENSP00000296358:E445Q	E	-	1	0	OTOP1	4250129	1.000000	0.71417	0.767000	0.31495	0.226000	0.24999	5.574000	0.67424	2.365000	0.80145	0.195000	0.17529	GAA		0.542	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998		10	62	0	0	0	0	10	62				
EPHA5	2044	broad.mit.edu	37	4	66356413	66356413	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:66356413G>C	ENST00000273854.3	-	5	1684	c.1084C>G	c.(1084-1086)Cgg>Ggg	p.R362G	EPHA5_ENST00000511294.1_Missense_Mutation_p.R362G|EPHA5_ENST00000354839.4_Missense_Mutation_p.R362G|EPHA5_ENST00000432638.2_Intron	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	362	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ATGGCATTCCGAGGAGCAGAG	0.393										TSP Lung(17;0.13)																												uc003hcy.2		NA																	0				lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						c.(1084-1086)CGG>GGG		ephrin receptor EphA5 isoform a precursor							42.0	42.0	42.0					4																	66356413		2203	4300	6503	SO:0001583	missense	2044				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity	g.chr4:66356413G>C	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1084C>G	4.37:g.66356413G>C	ENSP00000273854:p.Arg362Gly	TSP Lung(17;0.13)	Somatic				EPHA5_uc003hcx.2_Missense_Mutation_p.R293G|EPHA5_uc003hcz.2_Missense_Mutation_p.R362G|EPHA5_uc011cah.1_Missense_Mutation_p.R362G|EPHA5_uc011cai.1_Missense_Mutation_p.R362G|EPHA5_uc003hda.2_Missense_Mutation_p.R362G	p.R362G	NM_004439	NP_004430	WXS	Illumina HiSeq	Unspecified	P54756	EPHA5_HUMAN			5	1277	-			362			Fibronectin type-III 1.|Extracellular (Potential).		Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	c.1084C>G	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361637	0.61403	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.57436	0.4;0.4;0.4	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000052	T	0.77356	0.4118	M	0.87971	2.92	0.80722	D	1	D;B;D;B	0.65815	0.995;0.066;0.994;0.045	D;B;D;B	0.67725	0.953;0.143;0.922;0.013	T	0.79722	-0.1684	10	0.66056	D	0.02	.	20.1858	0.98214	0.0:0.0:1.0:0.0	.	362;362;362;362	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	G	362	ENSP00000273854:R362G;ENSP00000346899:R362G;ENSP00000427638:R362G	ENSP00000273854:R362G	R	-	1	2	EPHA5	66039008	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.912000	0.87465	2.777000	0.95525	0.591000	0.81541	CGG		0.393	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		13	37	0	0	0	0	13	37				
SHROOM3	57619	broad.mit.edu	37	4	77675521	77675521	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:77675521C>T	ENST00000296043.6	+	7	4838	c.3885C>T	c.(3883-3885)ctC>ctT	p.L1295L	RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1295					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TCCACCATCTCACCCCTCGTT	0.542																																						uc011cbx.1		NA																	0				skin(2)|ovary(1)	3						c.(3883-3885)CTC>CTT		shroom family member 3 protein							141.0	137.0	138.0					4																	77675521		2203	4300	6503	SO:0001819	synonymous_variant	57619				apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding	g.chr4:77675521C>T	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.3885C>T	4.37:g.77675521C>T			Somatic				SHROOM3_uc003hkg.2_Silent_p.L1073L	p.L1295L	NM_020859	NP_065910	WXS	Illumina HiSeq	Unspecified	Q8TF72	SHRM3_HUMAN	Lung(101;0.0903)		7	4838	+			1295					Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	c.3885C>T	CCDS3579.2																																																																																				0.542	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859		41	133	0	0	0	0	41	133				
FRAS1	80144	broad.mit.edu	37	4	79403007	79403007	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:79403007C>T	ENST00000264895.6	+	57	8933	c.8493C>T	c.(8491-8493)ttC>ttT	p.F2831F		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2827	Calx-beta 3.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCTCTACTTTCGCATCTGTCT	0.493																																						uc003hlb.2		NA																	0				large_intestine(5)	5						c.(8491-8493)TTC>TTT		Fraser syndrome 1							197.0	200.0	199.0					4																	79403007		1930	4131	6061	SO:0001819	synonymous_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79403007C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.8493C>T	4.37:g.79403007C>T			Somatic					p.F2831F	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			57	8933	+			2826			Calx-beta 3.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	c.8493C>T	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	4.656	0.121945	0.08931	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.57	2.85	0.33270	.	.	.	.	.	T	0.54175	0.1842	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46610	-0.9179	4	.	.	.	.	5.8211	0.18528	0.0:0.5948:0.1305:0.2747	.	.	.	.	C	1060	.	.	R	+	1	0	FRAS1	79622031	0.939000	0.31865	0.995000	0.50966	0.410000	0.31052	0.338000	0.19858	0.687000	0.31509	0.650000	0.86243	CGC		0.493	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				63	180	0	0	0	0	63	180				
CCSER1	401145	broad.mit.edu	37	4	91230090	91230090	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:91230090A>G	ENST00000509176.1	+	2	943	c.655A>G	c.(655-657)Aga>Gga	p.R219G	CCSER1_ENST00000333691.8_Missense_Mutation_p.R219G|CCSER1_ENST00000432775.2_Missense_Mutation_p.R219G	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	219																	GTACCAAGAGAGAGAACCTGT	0.408																																						uc003hsv.3		NA																	0				large_intestine(1)|ovary(1)	2						c.(655-657)AGA>GGA		KIAA1680 protein isoform 1							57.0	55.0	56.0					4																	91230090		1864	4104	5968	SO:0001583	missense	401145							g.chr4:91230090A>G		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.655A>G	4.37:g.91230090A>G	ENSP00000425040:p.Arg219Gly		Somatic				FAM190A_uc003hsu.3_Missense_Mutation_p.R219G|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.R219G	p.R219G	NM_001145065	NP_001138537	WXS	Illumina HiSeq	Unspecified	Q9C0I3	F190A_HUMAN			2	995	+			219					Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	c.655A>G	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	A	8.454	0.853652	0.17106	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.44482	1.49;0.92;1.49	4.66	-1.22	0.09494	.	1.001990	0.08044	N	0.995648	T	0.26919	0.0659	N	0.22421	0.69	0.09310	N	1	B;B;B	0.22480	0.07;0.044;0.044	B;B;B	0.21151	0.033;0.014;0.014	T	0.25433	-1.0132	10	0.29301	T	0.29	-0.0042	8.8399	0.35135	0.4724:0.4572:0.0704:0.0	.	219;219;219	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	G	219	ENSP00000425040:R219G;ENSP00000389283:R219G;ENSP00000329482:R219G	ENSP00000329482:R219G	R	+	1	2	FAM190A	91449113	0.042000	0.20092	0.009000	0.14445	0.951000	0.60555	0.476000	0.22180	-0.262000	0.09392	0.533000	0.62120	AGA		0.408	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065		12	30	0	0	0	0	12	30				
C4orf33	132321	broad.mit.edu	37	4	130023861	130023861	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:130023861G>A	ENST00000281146.5	+	2	817	c.96G>A	c.(94-96)atG>atA	p.M32I	C4orf33_ENST00000502887.1_Missense_Mutation_p.M32I|C4orf33_ENST00000425929.1_Missense_Mutation_p.M32I	NM_173487.2	NP_775758.2	Q8N1A6	CD033_HUMAN	chromosome 4 open reading frame 33	32										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	10						GAGTGATGATGGACATTAGTG	0.438																																						uc003igu.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(94-96)ATG>ATA		hypothetical protein LOC132321							146.0	140.0	142.0					4																	130023861		2203	4300	6503	SO:0001583	missense	132321							g.chr4:130023861G>A	AK091022	CCDS3741.1	4q28.2	2008-02-05			ENSG00000151470	ENSG00000151470			27025	protein-coding gene	gene with protein product						12477932	Standard	NM_001099783		Approved	FLJ33703	uc010iod.3	Q8N1A6	OTTHUMG00000133347	ENST00000281146.5:c.96G>A	4.37:g.130023861G>A	ENSP00000281146:p.Met32Ile		Somatic				C4orf33_uc010ioc.1_Missense_Mutation_p.M32I|C4orf33_uc010iod.2_Missense_Mutation_p.M32I	p.M32I	NM_173487	NP_775758	WXS	Illumina HiSeq	Unspecified	Q8N1A6	CD033_HUMAN			2	460	+			32					D3DNY2|Q6PJF3|Q8NBC5	Missense_Mutation	SNP	ENST00000281146.5	37	c.96G>A	CCDS3741.1	.	.	.	.	.	.	.	.	.	.	g	6.961	0.547234	0.13312	.	.	ENSG00000151470	ENST00000281146;ENST00000502887;ENST00000425929;ENST00000508673;ENST00000508622	T;T;T;T;T	0.39056	2.44;2.13;2.44;1.1;1.14	4.59	3.75	0.43078	.	0.156200	0.64402	N	0.000001	T	0.31167	0.0788	L	0.37507	1.11	0.41248	D	0.986697	B;B	0.24721	0.046;0.11	B;B	0.22152	0.026;0.038	T	0.08493	-1.0719	10	0.20519	T	0.43	-51.8837	12.2169	0.54412	0.0851:0.0:0.9149:0.0	.	32;32	D6RIT3;Q8N1A6	.;CD033_HUMAN	I	32	ENSP00000281146:M32I;ENSP00000427406:M32I;ENSP00000401090:M32I;ENSP00000427096:M32I;ENSP00000427431:M32I	ENSP00000281146:M32I	M	+	3	0	C4orf33	130243311	1.000000	0.71417	0.965000	0.40720	0.125000	0.20455	4.021000	0.57196	1.288000	0.44600	-0.119000	0.15052	ATG		0.438	C4orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257177.2	NM_173487		13	48	0	0	0	0	13	48				
FBXW7	55294	broad.mit.edu	37	4	153332853	153332853	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:153332853G>A	ENST00000281708.4	-	2	1332	c.103C>T	c.(103-105)Cgt>Tgt	p.R35C	FBXW7_ENST00000603548.1_Missense_Mutation_p.R35C|FBXW7_ENST00000603841.1_Missense_Mutation_p.R35C|FBXW7_ENST00000604872.1_Missense_Mutation_p.R35C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	35					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TCTACCACACGATTCATCTGT	0.507			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	uc003ims.2		NA		Rec	yes		4	4q31.3	55294	Mis|N|D|F	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""			"""E, L"""			colorectal|endometrial|T-ALL		0				haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308						c.(103-105)CGT>TGT		F-box and WD repeat domain containing 7 isoform							214.0	186.0	195.0					4																	153332853		2203	4300	6503	SO:0001583	missense	55294				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	g.chr4:153332853G>A	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.103C>T	4.37:g.153332853G>A	ENSP00000281708:p.Arg35Cys		Somatic				FBXW7_uc011cii.1_Missense_Mutation_p.R35C|FBXW7_uc003imt.2_Missense_Mutation_p.R35C|FBXW7_uc003imu.2_Missense_Mutation_p.R35C	p.R35C	NM_033632	NP_361014	WXS	Illumina HiSeq	Unspecified	Q969H0	FBXW7_HUMAN			2	252	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)	35					B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	c.103C>T	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375820	0.61735	.	.	ENSG00000109670	ENST00000281708	T	0.60424	0.19	5.82	5.82	0.92795	.	0.421134	0.22050	N	0.065327	T	0.64360	0.2591	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.79108	0.992;0.454	T	0.66878	-0.5812	10	0.72032	D	0.01	-5.7879	14.8919	0.70614	0.0:0.0:0.8567:0.1433	.	35;35	G0Z2K0;Q969H0	.;FBXW7_HUMAN	C	35	ENSP00000281708:R35C	ENSP00000281708:R35C	R	-	1	0	FBXW7	153552303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.262000	0.58847	2.745000	0.94114	0.650000	0.86243	CGT		0.507	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1			47	90	0	0	0	0	47	90				
FAT1	2195	broad.mit.edu	37	4	187539252	187539252	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr4:187539252G>A	ENST00000441802.2	-	10	8697	c.8488C>T	c.(8488-8490)Cag>Tag	p.Q2830*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2830	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GCCCTGATCTGAATTACTCTA	0.438										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(8488-8490)CAG>TAG		FAT tumor suppressor 1 precursor							108.0	102.0	104.0					4																	187539252		1900	4137	6037	SO:0001587	stop_gained	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187539252G>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8488C>T	4.37:g.187539252G>A	ENSP00000406229:p.Gln2830*	HNSCC(5;0.00058)	Somatic					p.Q2830*	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			10	8676	-			2830			Extracellular (Potential).|Cadherin 26.			Nonsense_Mutation	SNP	ENST00000441802.2	37	c.8488C>T	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	50	16.712450	0.99870	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	18.3344	0.90282	0.0:0.0:1.0:0.0	.	.	.	.	X	2830;2832	.	ENSP00000260147:Q2832X	Q	-	1	0	FAT1	187776246	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	9.657000	0.98554	2.635000	0.89317	0.650000	0.86243	CAG		0.438	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		35	72	0	0	0	0	35	72				
IRX1	79192	broad.mit.edu	37	5	3600291	3600291	+	Missense_Mutation	SNP	C	C	G	rs372921884		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:3600291C>G	ENST00000302006.3	+	2	1281	c.1229C>G	c.(1228-1230)cCa>cGa	p.P410R	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	410	Poly-Pro.				proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CCTGCACCTCCACCACCGCAG	0.701																																						uc003jde.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1228-1230)CCA>CGA		iroquois homeobox protein 1							25.0	29.0	28.0					5																	3600291		2203	4299	6502	SO:0001583	missense	79192					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:3600291C>G	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1229C>G	5.37:g.3600291C>G	ENSP00000305244:p.Pro410Arg		Somatic					p.P410R	NM_024337	NP_077313	WXS	Illumina HiSeq	Unspecified	P78414	IRX1_HUMAN			2	1281	+			410			Poly-Pro.		Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	c.1229C>G	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	4.722	0.134316	0.09032	.	.	ENSG00000170549	ENST00000302006	T	0.56103	0.48	4.03	3.04	0.35103	.	0.736785	0.12831	U	0.435612	T	0.29914	0.0748	N	0.08118	0	0.30407	N	0.779459	B	0.30068	0.267	B	0.30495	0.116	T	0.22452	-1.0216	10	0.22706	T	0.39	.	9.0072	0.36120	0.545:0.455:0.0:0.0	.	410	P78414	IRX1_HUMAN	R	410	ENSP00000305244:P410R	ENSP00000305244:P410R	P	+	2	0	IRX1	3653291	0.041000	0.20044	0.018000	0.16275	0.232000	0.25224	2.463000	0.45058	1.762000	0.52044	0.313000	0.20887	CCA		0.701	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337		15	69	0	0	0	0	15	69				
TRIO	7204	broad.mit.edu	37	5	14406048	14406048	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:14406048A>G	ENST00000344204.4	+	32	4832	c.4808A>G	c.(4807-4809)gAg>gGg	p.E1603G	TRIO_ENST00000537187.1_Missense_Mutation_p.E1603G	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1603					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GCCCTGAAGGAGCCCATTCAC	0.577																																						uc003jff.2		NA																	0				skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(4807-4809)GAG>GGG		triple functional domain (PTPRF interacting)							51.0	47.0	48.0					5																	14406048		2203	4300	6503	SO:0001583	missense	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14406048A>G	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4808A>G	5.37:g.14406048A>G	ENSP00000339299:p.Glu1603Gly		Somatic				TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.E1252G	p.E1603G	NM_007118	NP_009049	WXS	Illumina HiSeq	Unspecified	O75962	TRIO_HUMAN			32	4814	+	Lung NSC(4;0.000742)		1603					D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	c.4808A>G	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075012	0.76415	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.21361	2.01;2.01	5.32	5.32	0.75619	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.37598	0.1009	L	0.44542	1.39	0.58432	D	0.999997	B;D	0.57899	0.13;0.981	B;D	0.67900	0.098;0.954	T	0.05903	-1.0857	10	0.45353	T	0.12	.	15.299	0.73931	1.0:0.0:0.0:0.0	.	1603;1603	O75962-5;O75962	.;TRIO_HUMAN	G	1603;1603;1290	ENSP00000339299:E1603G;ENSP00000446348:E1603G	ENSP00000339299:E1603G	E	+	2	0	TRIO	14459048	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.263000	0.95617	2.011000	0.59026	0.528000	0.53228	GAG		0.577	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		10	25	0	0	0	0	10	25				
ZNF622	90441	broad.mit.edu	37	5	16465329	16465329	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:16465329G>A	ENST00000308683.2	-	1	572	c.446C>T	c.(445-447)cCa>cTa	p.P149L		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	149					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						TGCAGGCGCTGGGGGCGCCTT	0.652																																						uc003jfq.2		NA																	0				ovary(1)	1						c.(445-447)CCA>CTA		zinc finger protein 622							81.0	83.0	83.0					5																	16465329		2203	4300	6503	SO:0001583	missense	90441					cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr5:16465329G>A	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.446C>T	5.37:g.16465329G>A	ENSP00000310042:p.Pro149Leu		Somatic					p.P149L	NM_033414	NP_219482	WXS	Illumina HiSeq	Unspecified	Q969S3	ZN622_HUMAN			1	566	-			149						Missense_Mutation	SNP	ENST00000308683.2	37	c.446C>T	CCDS3886.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.425370	0.25639	.	.	ENSG00000173545	ENST00000308683	.	.	.	4.46	1.67	0.24075	.	1.157390	0.06224	N	0.687249	T	0.30135	0.0755	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24941	-1.0146	9	0.19147	T	0.46	-24.2292	7.6932	0.28579	0.4416:0.0:0.5584:0.0	.	149	Q969S3	ZN622_HUMAN	L	149	.	ENSP00000310042:P149L	P	-	2	0	ZNF622	16518329	0.000000	0.05858	0.000000	0.03702	0.245000	0.25701	0.832000	0.27490	0.140000	0.18849	0.650000	0.86243	CCA		0.652	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414		65	92	0	0	0	0	65	92				
RANBP3L	202151	broad.mit.edu	37	5	36265595	36265595	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:36265595G>C	ENST00000296604.3	-	5	781	c.296C>G	c.(295-297)tCa>tGa	p.S99*	RANBP3L_ENST00000502994.1_Nonsense_Mutation_p.S124*|RANBP3L_ENST00000515759.1_Nonsense_Mutation_p.S99*	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	99					intracellular transport (GO:0046907)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			CACAAGAGCTGATGTCATAAA	0.299																																						uc003jkh.2		NA																	0				ovary(1)	1						c.(295-297)TCA>TGA		RAN binding protein 3-like isoform 2							85.0	85.0	85.0					5																	36265595		2203	4300	6503	SO:0001587	stop_gained	202151				intracellular transport			g.chr5:36265595G>C	BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.296C>G	5.37:g.36265595G>C	ENSP00000296604:p.Ser99*		Somatic				RANBP3L_uc011cow.1_Nonsense_Mutation_p.S124*	p.S99*	NM_145000	NP_659437	WXS	Illumina HiSeq	Unspecified	Q86VV4	RNB3L_HUMAN	Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)		5	789	-	all_lung(31;4.52e-05)		99					B7Z866|E9PGP9|Q96LK2	Nonsense_Mutation	SNP	ENST00000296604.3	37	c.296C>G	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704281	0.30232	.	.	ENSG00000164188	ENST00000296604;ENST00000502994;ENST00000515759;ENST00000505865	.	.	.	5.12	5.12	0.69794	.	0.643379	0.14566	N	0.311747	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	0.085	14.2461	0.65990	0.0:0.0:1.0:0.0	.	.	.	.	X	99;124;99;99	.	ENSP00000296604:S99X	S	-	2	0	RANBP3L	36301352	0.985000	0.35326	0.927000	0.36925	0.018000	0.09664	3.195000	0.51013	2.817000	0.96982	0.563000	0.77884	TCA		0.299	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000		6	32	0	0	0	0	6	32				
NIPBL	25836	broad.mit.edu	37	5	37048678	37048678	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:37048678G>C	ENST00000282516.8	+	39	7163	c.6664G>C	c.(6664-6666)Gat>Cat	p.D2222H	NIPBL_ENST00000448238.2_Missense_Mutation_p.D2222H	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2222					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TATTTTATCTGATAAGAACTC	0.363																																						uc003jkl.3		NA																	0				ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9						c.(6664-6666)GAT>CAT		delangin isoform A							38.0	44.0	42.0					5																	37048678		2184	4285	6469	SO:0001583	missense	25836				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding	g.chr5:37048678G>C	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6664G>C	5.37:g.37048678G>C	ENSP00000282516:p.Asp2222His		Somatic				NIPBL_uc003jkk.3_Missense_Mutation_p.D2222H|NIPBL_uc003jkn.2_5'Flank	p.D2222H	NM_133433	NP_597677	WXS	Illumina HiSeq	Unspecified	Q6KC79	NIPBL_HUMAN	Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)		39	7163	+	all_lung(31;0.000447)|Hepatocellular(1;0.108)		2222					Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	c.6664G>C	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172493	0.78452	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93763	-3.28;-3.28	6.06	6.06	0.98353	Armadillo-like helical (1);Armadillo-type fold (1);	0.044331	0.85682	D	0.000000	D	0.95752	0.8618	L	0.53249	1.67	0.80722	D	1	D;D	0.67145	0.989;0.996	P;D	0.64877	0.854;0.93	D	0.94955	0.8103	10	0.52906	T	0.07	-16.5631	20.6397	0.99537	0.0:0.0:1.0:0.0	.	2222;2222	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	H	2222	ENSP00000282516:D2222H;ENSP00000406266:D2222H	ENSP00000282516:D2222H	D	+	1	0	NIPBL	37084435	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.439000	0.97543	2.880000	0.98712	0.650000	0.86243	GAT		0.363	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		13	37	0	0	0	0	13	37				
C6	729	broad.mit.edu	37	5	41143093	41143093	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:41143093C>G	ENST00000263413.3	-	18	2903	c.2639G>C	c.(2638-2640)tGt>tCt	p.C880S	C6_ENST00000337836.5_Missense_Mutation_p.C880S	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	880	C5b-binding domain.|Factor I module (FIM) 2.|Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TAGGCAGACACATTTGGAAGT	0.458																																						uc003jmk.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(2638-2640)TGT>TCT		complement component 6 precursor							113.0	99.0	104.0					5																	41143093		2203	4300	6503	SO:0001583	missense	729				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding	g.chr5:41143093C>G	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2639G>C	5.37:g.41143093C>G	ENSP00000263413:p.Cys880Ser		Somatic				C6_uc003jml.1_Missense_Mutation_p.C880S	p.C880S	NM_000065	NP_000056	WXS	Illumina HiSeq	Unspecified	P13671	CO6_HUMAN			18	2849	-		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)	880			Complement control factor I module 2.|C5b-binding domain.|Kazal-like 2.			Missense_Mutation	SNP	ENST00000263413.3	37	c.2639G>C	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024453	0.75390	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.72835	-0.69;-0.69	5.71	5.71	0.89125	Factor I / membrane attack complex (1);	2.332300	0.01464	N	0.016011	T	0.81772	0.4893	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67787	-0.5580	10	0.72032	D	0.01	-14.6488	19.472	0.94966	0.0:1.0:0.0:0.0	.	880	P13671	CO6_HUMAN	S	880	ENSP00000338861:C880S;ENSP00000263413:C880S	ENSP00000263413:C880S	C	-	2	0	C6	41178850	0.995000	0.38212	0.938000	0.37757	0.783000	0.44284	5.109000	0.64615	2.712000	0.92718	0.650000	0.86243	TGT		0.458	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1			12	53	0	0	0	0	12	53				
ITGA2	3673	broad.mit.edu	37	5	52351412	52351412	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:52351412C>T	ENST00000296585.5	+	8	967	c.824C>T	c.(823-825)aCg>aTg	p.T275M		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	275	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CGAAGTGCTACGAAAGTAATG	0.373																																						uc003joy.2		NA																	0				lung(1)	1						c.(823-825)ACG>ATG		integrin alpha 2 precursor							163.0	155.0	158.0					5																	52351412		2203	4300	6503	SO:0001583	missense	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52351412C>T		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.824C>T	5.37:g.52351412C>T	ENSP00000296585:p.Thr275Met		Somatic				ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.T199M|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	p.T275M	NM_002203	NP_002194	WXS	Illumina HiSeq	Unspecified	P17301	ITA2_HUMAN			8	967	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	275			Extracellular (Potential).|VWFA.		Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	c.824C>T	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110497	0.77210	.	.	ENSG00000164171	ENST00000296585	D	0.83591	-1.74	5.54	5.54	0.83059	von Willebrand factor, type A (3);	0.173963	0.52532	D	0.000076	D	0.89427	0.6712	M	0.73962	2.25	0.48830	D	0.999713	D;D	0.89917	0.996;1.0	D;P	0.63192	0.912;0.894	D	0.89829	0.3994	10	0.56958	D	0.05	.	14.331	0.66556	0.1483:0.8517:0.0:0.0	.	275;275	E7ESP4;P17301	.;ITA2_HUMAN	M	275	ENSP00000296585:T275M	ENSP00000296585:T275M	T	+	2	0	ITGA2	52387169	0.942000	0.31987	0.951000	0.38953	0.907000	0.53573	4.290000	0.59019	2.593000	0.87608	0.650000	0.86243	ACG		0.373	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203		15	58	0	0	0	0	15	58				
SNCAIP	9627	broad.mit.edu	37	5	121761101	121761101	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:121761101C>G	ENST00000261368.8	+	5	1319	c.1057C>G	c.(1057-1059)Cta>Gta	p.L353V	SNCAIP_ENST00000504884.2_Missense_Mutation_p.S62C|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000379533.2_Missense_Mutation_p.L400V|SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000379536.2_Intron|SNCAIP_ENST00000503116.2_Missense_Mutation_p.L400V|SNCAIP_ENST00000261367.7_Missense_Mutation_p.L400V	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	353					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TGGAAACAATCTATTACATAT	0.428																																						uc003ksw.1		NA																	0				ovary(1)|pancreas(1)	2						c.(1057-1059)CTA>GTA		synuclein alpha interacting protein							118.0	123.0	121.0					5																	121761101		2203	4300	6503	SO:0001583	missense	9627				cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding	g.chr5:121761101C>G	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1057C>G	5.37:g.121761101C>G	ENSP00000261368:p.Leu353Val		Somatic				SNCAIP_uc011cwl.1_Intron|SNCAIP_uc010jct.2_Missense_Mutation_p.L353V|SNCAIP_uc003ksx.1_Missense_Mutation_p.L400V|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron|SNCAIP_uc003kta.1_Intron|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Missense_Mutation_p.L47V|SNCAIP_uc010jcx.1_Intron	p.L353V	NM_005460	NP_005451	WXS	Illumina HiSeq	Unspecified	Q9Y6H5	SNCAP_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)	5	1263	+		all_cancers(142;0.00787)|Prostate(80;0.0327)	353			ANK 1.		D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	c.1057C>G	CCDS4131.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.52|15.52	2.859191|2.859191	0.51376|0.51376	.|.	.|.	ENSG00000064692|ENSG00000064692	ENST00000261368;ENST00000379533;ENST00000261367;ENST00000503116|ENST00000504884	T;T;T;T|T	0.63744|0.53423	-0.06;-0.06;-0.06;-0.06|0.62	5.54|5.54	5.54|5.54	0.83059|0.83059	Ankyrin repeat-containing domain (4);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.56187|0.56187	0.1968|0.1968	L|L	0.38649|0.38649	1.16|1.16	0.80722|0.80722	D|D	1|1	P;D;D|.	0.76494|.	0.916;0.99;0.999|.	P;D;D|.	0.87578|.	0.861;0.979;0.998|.	T|T	0.57900|0.57900	-0.7731|-0.7731	10|7	0.26408|0.87932	T|D	0.33|0	-12.6485|-12.6485	19.4885|19.4885	0.95040|0.95040	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	400;400;353|.	Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5|.	.;.;SNCAP_HUMAN|.	V|C	353;400;400;400|62	ENSP00000261368:L353V;ENSP00000368848:L400V;ENSP00000261367:L400V;ENSP00000423199:L400V|ENSP00000426904:S62C	ENSP00000261367:L400V|ENSP00000378849:S62C	L|S	+|+	1|2	2|0	SNCAIP|SNCAIP	121789000|121789000	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.258000|0.258000	0.26162|0.26162	5.556000|5.556000	0.67307|0.67307	2.609000|2.609000	0.88269|0.88269	0.563000|0.563000	0.77884|0.77884	CTA|TCT		0.428	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1			55	54	0	0	0	0	55	54				
PCDHB2	56133	broad.mit.edu	37	5	140476460	140476460	+	Silent	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:140476460T>C	ENST00000194155.4	+	1	2234	c.2086T>C	c.(2086-2088)Ttg>Ctg	p.L696L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	696					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGGCGTTGGCCTCGGT	0.697																																						uc003lil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(2086-2088)TTG>CTG		protocadherin beta 2 precursor							52.0	55.0	54.0					5																	140476460		2157	4188	6345	SO:0001819	synonymous_variant	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140476460T>C	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2086T>C	5.37:g.140476460T>C			Somatic				PCDHB2_uc003lim.1_Silent_p.L357L	p.L696L	NM_018936	NP_061759	WXS	Illumina HiSeq	Unspecified	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2224	+			696			Helical; (Potential).		Q4KMU1	Silent	SNP	ENST00000194155.4	37	c.2086T>C	CCDS4244.1																																																																																				0.697	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		52	166	0	0	0	0	52	166				
PCDHB3	56132	broad.mit.edu	37	5	140482313	140482313	+	Silent	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:140482313T>C	ENST00000231130.2	+	1	2080	c.2080T>C	c.(2080-2082)Ttg>Ctg	p.L694L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	694					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGGCATTGGCCTCGGT	0.687																																						uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2080-2082)TTG>CTG		protocadherin beta 3 precursor							92.0	93.0	93.0					5																	140482313		2198	4287	6485	SO:0001819	synonymous_variant	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140482313T>C	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2080T>C	5.37:g.140482313T>C			Somatic				uc003lin.2_5'Flank	p.L694L	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2080	+			694			Helical; (Potential).		B2R8P2	Silent	SNP	ENST00000231130.2	37	c.2080T>C	CCDS4245.1																																																																																				0.687	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		10	67	0	0	0	0	10	67				
PCDHB10	56126	broad.mit.edu	37	5	140568971	140568971	+	5'Flank	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:140568971T>C	ENST00000239446.4	+	0	0					NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGGCGTTGGCCTCGGT	0.706																																						uc003liw.1		NA																	0					0						c.(2080-2082)TTG>CTG		protocadherin beta 9 precursor							59.0	67.0	64.0					5																	140568971		2169	4220	6389	SO:0001631	upstream_gene_variant	56127				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140568971T>C	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626		5.37:g.140568971T>C	Exception_encountered		Somatic				PCDHB10_uc003lix.2_5'Flank	p.L694L	NM_019119	NP_061992	WXS	Illumina HiSeq	Unspecified	Q9Y5E1	PCDB9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		3	2080	+			694			Helical; (Potential).		Q96T99	Silent	SNP	ENST00000239446.4	37	c.2080T>C	CCDS4252.1																																																																																				0.706	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		7	179	0	0	0	0	7	179				
PCDHB13	56123	broad.mit.edu	37	5	140595775	140595775	+	Silent	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:140595775T>C	ENST00000341948.4	+	1	2267	c.2080T>C	c.(2080-2082)Ttg>Ctg	p.L694L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	694					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGGCGTTGGCCTCGGT	0.682																																						uc003lja.1		NA																	0				skin(2)|ovary(1)	3						c.(2080-2082)TTG>CTG		protocadherin beta 13 precursor							85.0	89.0	88.0					5																	140595775		2197	4284	6481	SO:0001819	synonymous_variant	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140595775T>C	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.2080T>C	5.37:g.140595775T>C			Somatic					p.L694L	NM_018933	NP_061756	WXS	Illumina HiSeq	Unspecified	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2267	+			694			Helical; (Potential).		A8K9V6	Silent	SNP	ENST00000341948.4	37	c.2080T>C	CCDS4255.1																																																																																				0.682	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		5	227	0	0	0	0	5	227				
ZNF300	91975	broad.mit.edu	37	5	150276445	150276445	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:150276445C>T	ENST00000274599.5	-	6	776	c.356G>A	c.(355-357)gGt>gAt	p.G119D	ZNF300_ENST00000418587.2_Missense_Mutation_p.G83D|ZNF300_ENST00000394226.2_Missense_Mutation_p.G119D|ZNF300_ENST00000446148.2_Missense_Mutation_p.G135D|ZNF300_ENST00000427179.1_3'UTR	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCACAATGAACCATCCCTTGT	0.413																																						uc003lsy.1		NA																	0				ovary(1)|skin(1)	2						c.(355-357)GGT>GAT		zinc finger protein 300							90.0	84.0	86.0					5																	150276445		2203	4299	6502	SO:0001583	missense	91975				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr5:150276445C>T	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.356G>A	5.37:g.150276445C>T	ENSP00000274599:p.Gly119Asp		Somatic				IRGM_uc011dcl.1_Intron	p.G119D	NM_052860	NP_443092	WXS	Illumina HiSeq	Unspecified	Q96RE9	ZN300_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		6	623	-		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	119					A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	ENST00000274599.5	37	c.356G>A	CCDS4311.2	.	.	.	.	.	.	.	.	.	.	C	0.137	-1.106470	0.01828	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.07908	3.22;3.23;3.15;3.22	2.32	-0.503	0.12000	.	.	.	.	.	T	0.03608	0.0103	N	0.11064	0.09	0.25226	N	0.989864	B	0.02656	0.0	B	0.01281	0.0	T	0.48139	-0.9061	9	0.11794	T	0.64	.	6.456	0.21930	0.0:0.6066:0.0:0.3934	.	119	Q96RE9	ZN300_HUMAN	D	135;119;83;119	ENSP00000397178:G135D;ENSP00000274599:G119D;ENSP00000392593:G83D;ENSP00000377773:G119D	ENSP00000274599:G119D	G	-	2	0	ZNF300	150256638	0.001000	0.12720	0.996000	0.52242	0.823000	0.46562	-0.155000	0.10115	-0.160000	0.11002	0.455000	0.32223	GGT		0.413	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860		26	24	0	0	0	0	26	24				
FLT4	2324	broad.mit.edu	37	5	180047255	180047255	+	Silent	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr5:180047255C>A	ENST00000261937.6	-	17	2538	c.2460G>T	c.(2458-2460)ggG>ggT	p.G820G	FLT4_ENST00000502649.1_Silent_p.G820G|FLT4_ENST00000393347.3_Silent_p.G820G|FLT4_ENST00000424276.2_5'Flank	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	820					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGGCACCTCCCCGGGGTCCA	0.652																																					Colon(97;1075 1466 27033 27547 35871)	uc003mma.3		NA																	0				lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15						c.(2458-2460)GGG>GGT		fms-related tyrosine kinase 4 isoform 2	Sorafenib(DB00398)|Sunitinib(DB01268)						79.0	83.0	81.0					5																	180047255		2203	4300	6503	SO:0001819	synonymous_variant	2324	Congenital_Hereditary_Lymphedema			positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity	g.chr5:180047255C>A	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2460G>T	5.37:g.180047255C>A			Somatic				FLT4_uc003mlz.3_Silent_p.G820G|FLT4_uc003mmb.1_Silent_p.G353G	p.G820G	NM_002020	NP_002011	WXS	Illumina HiSeq	Unspecified	P35916	VGFR3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	17	2539	-	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	820			Cytoplasmic (Potential).		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	37	c.2460G>T	CCDS4457.1																																																																																				0.652	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			49	48	1	0	1.86e-20	2.14e-20	49	48				
FAM136BP	387071	broad.mit.edu	37	6	3045940	3045941	+	IGR	DNP	AC	AC	TT	rs576793102	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:3045940_3045941AC>TT								RP1-90J20.11 (18281 upstream) : RP1-40E16.2 (10182 downstream)																							CAGCAGCTGGACGGTTGTGTGA	0.48																																						uc011dhr.1		NA																	0					0						c.(322-324)GAC>GTT		hypothetical protein LOC387071																																				SO:0001628	intergenic_variant	387071							g.chr6:3045940_3045941AC>TT																													6.37:g.3045940_3045941delinsTT			Somatic					p.D108V	NM_001012983	NP_001013001	WXS	Illumina HiSeq	Unspecified					1	323_324	+	Ovarian(93;0.0386)	all_hematologic(90;0.108)							Missense_Mutation	DNP		37	c.323_324AC>TT																																																																																				0	0.480									8	102	0	0	0	0	8	102				
OR14J1	442191	broad.mit.edu	37	6	29274980	29274980	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:29274980A>G	ENST00000377160.2	+	1	578	c.514A>G	c.(514-516)Att>Gtt	p.I172V		NM_030946.1	NP_112208.1	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 14, subfamily J, member 1	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(2)	17						GAAGAGAGTCATTCACCAATT	0.478																																						uc011dln.1		NA																	0				ovary(1)	1						c.(514-516)ATT>GTT		olfactory receptor, family 5, subfamily U member							169.0	168.0	169.0					6																	29274980		1511	2709	4220	SO:0001583	missense	442191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29274980A>G		CCDS34362.1	6p21.3	2012-08-09	2008-04-02	2008-04-02	ENSG00000204695	ENSG00000204695		"""GPCR / Class A : Olfactory receptors"""	13971	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily U, member 1"""	OR5U1			Standard	NM_030946		Approved	hs6M1-28	uc011dln.2	Q9UGF5	OTTHUMG00000031184	ENST00000377160.2:c.514A>G	6.37:g.29274980A>G	ENSP00000366365:p.Ile172Val		Somatic					p.I172V	NM_030946	NP_112208	WXS	Illumina HiSeq	Unspecified	Q9UGF5	O14J1_HUMAN			1	514	+			172			Extracellular (Potential).		A2BEC2|B0V078|Q5ST27	Missense_Mutation	SNP	ENST00000377160.2	37	c.514A>G	CCDS34362.1	.	.	.	.	.	.	.	.	.	.	A	9.032	0.987545	0.18966	.	.	ENSG00000204695	ENST00000377160	T	0.00179	8.61	4.86	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	0.337943	0.21599	N	0.071976	T	0.00073	0.0002	M	0.64080	1.96	0.09310	N	1	B	0.27229	0.172	B	0.31614	0.133	T	0.32534	-0.9903	10	0.09084	T	0.74	.	10.5047	0.44826	0.922:0.0:0.078:0.0	.	172	Q9UGF5	O14J1_HUMAN	V	172	ENSP00000366365:I172V	ENSP00000366365:I172V	I	+	1	0	OR14J1	29382959	0.005000	0.15991	0.011000	0.14972	0.654000	0.38779	0.810000	0.27183	0.976000	0.38417	0.528000	0.53228	ATT		0.478	OR14J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076362.2			42	90	0	0	0	0	42	90				
HLA-G	3135	broad.mit.edu	37	6	29796372	29796372	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:29796372C>T	ENST00000360323.6	+	3	420	c.396C>T	c.(394-396)cgC>cgT	p.R132R	HLA-G_ENST00000376818.3_Intron|HLA-G_ENST00000376828.2_Silent_p.R137R|HLA-G_ENST00000428701.1_Silent_p.R132R|HLA-G_ENST00000376815.3_Intron			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	132	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						CCGACGGACGCCTCCTCCGCG	0.672																																						uc003nnw.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(394-396)CGC>CGT		major histocompatibility complex, class I, G							105.0	107.0	107.0					6																	29796372		1510	2709	4219	SO:0001819	synonymous_variant	3135				antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity	g.chr6:29796372C>T		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.396C>T	6.37:g.29796372C>T			Somatic				HLA-G_uc011dmb.1_Silent_p.R104R|HLA-G_uc003raj.3_Silent_p.R137R|HLA-G_uc003nnz.3_Intron|HLA-G_uc010jrn.2_Intron|HLA-G_uc003nny.3_Intron|HLA-G_uc003ran.1_5'Flank	p.R132R	NM_002127	NP_002118	WXS	Illumina HiSeq	Unspecified	P17693	HLAG_HUMAN			4	574	+			132			Extracellular (Potential).|Alpha-2.			Silent	SNP	ENST00000360323.6	37	c.396C>T	CCDS4668.1																																																																																				0.672	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127		23	83	0	0	0	0	23	83				
TRIM26	7726	broad.mit.edu	37	6	30154334	30154334	+	Splice_Site	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:30154334C>T	ENST00000454678.2	-	10	1375	c.939G>A	c.(937-939)gtG>gtA	p.V313V	TRIM26_ENST00000453195.1_Splice_Site_p.V313V|TRIM26_ENST00000437089.1_Splice_Site_p.V313V	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	313	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						GGGTGACGCTCACTGTGGGGA	0.468																																						uc003npr.2		NA																	0				ovary(2)|lung(1)	3						c.(937-939)GTG>GTA		tripartite motif-containing 26							38.0	36.0	37.0					6																	30154334		1509	2708	4217	SO:0001630	splice_region_variant	7726						DNA binding|zinc ion binding	g.chr6:30154334C>T	AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.938-1G>A	6.37:g.30154334C>T			Somatic				TRIM26_uc003nps.2_Silent_p.V313V|TRIM26_uc010jry.2_Silent_p.V43V|TRIM26_uc003npt.2_Silent_p.V313V	p.V313V	NM_003449	NP_003440	WXS	Illumina HiSeq	Unspecified	Q12899	TRI26_HUMAN			9	1148	-			313			B30.2/SPRY.		A6NG96|Q5SRL2	Silent	SNP	ENST00000454678.2	37	c.939G>A	CCDS4678.1																																																																																				0.468	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253442.1	NM_003449	Silent	15	41	0	0	0	0	15	41				
AGPAT1	10554	broad.mit.edu	37	6	32137994	32137994	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:32137994C>G	ENST00000395499.1	-	5	1133	c.554G>C	c.(553-555)gGc>gCc	p.G185A	AGPAT1_ENST00000395496.1_Missense_Mutation_p.G185A|AGPAT1_ENST00000336984.6_Missense_Mutation_p.G185A|AGPAT1_ENST00000490711.1_5'UTR|AGPAT1_ENST00000395497.1_Missense_Mutation_p.G185A|PPT2-EGFL8_ENST00000422437.1_Intron|AGPAT1_ENST00000375104.2_Missense_Mutation_p.G185A|AGPAT1_ENST00000375107.3_Missense_Mutation_p.G185A|AGPAT1_ENST00000412465.2_Missense_Mutation_p.G73A			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	185					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						CAGCATGGAGCCATTGTGGTT	0.537																																						uc003oae.2		NA																	0				central_nervous_system(1)	1						c.(553-555)GGC>GCC		1-acylglycerol-3-phosphate O-acyltransferase 1							73.0	70.0	71.0					6																	32137994		2203	4300	6503	SO:0001583	missense	10554				energy reserve metabolic process|phosphatidic acid biosynthetic process|positive regulation of cellular metabolic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity	g.chr6:32137994C>G	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.554G>C	6.37:g.32137994C>G	ENSP00000378877:p.Gly185Ala		Somatic				PPT2_uc003nzy.1_Intron|AGPAT1_uc011dpj.1_RNA|AGPAT1_uc011dpk.1_Missense_Mutation_p.G149A|AGPAT1_uc003oaf.2_Missense_Mutation_p.G185A|AGPAT1_uc003oag.2_Missense_Mutation_p.G75A|AGPAT1_uc003oah.2_Missense_Mutation_p.G185A|AGPAT1_uc003oai.1_Missense_Mutation_p.G185A|AGPAT1_uc011dpl.1_Missense_Mutation_p.G73A	p.G185A	NM_006411	NP_006402	WXS	Illumina HiSeq	Unspecified	Q99943	PLCA_HUMAN			5	872	-			185					A2BFI5|Q5BL03	Missense_Mutation	SNP	ENST00000395499.1	37	c.554G>C	CCDS4744.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926013	0.92319	.	.	ENSG00000204310	ENST00000395496;ENST00000375107;ENST00000395499;ENST00000375104;ENST00000395497;ENST00000336984;ENST00000412465	D;D;D;D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53	5.92	5.92	0.95590	Phospholipid/glycerol acyltransferase (2);1-acyl-sn-glycerol-3-phosphate acyltransferase (1);	0.103168	0.64402	D	0.000003	D	0.96500	0.8858	M	0.90198	3.095	0.80722	D	1	D;P;D	0.56746	0.974;0.952;0.977	P;P;P	0.62184	0.837;0.758;0.899	D	0.95587	0.8651	10	0.09843	T	0.71	-15.6909	17.8263	0.88666	0.0:1.0:0.0:0.0	.	149;75;185	B4DRH1;B3KPH3;Q99943	.;.;PLCA_HUMAN	A	185;185;185;185;185;185;73	ENSP00000378874:G185A;ENSP00000364248:G185A;ENSP00000378877:G185A;ENSP00000364245:G185A;ENSP00000378875:G185A;ENSP00000337463:G185A;ENSP00000410473:G73A	ENSP00000337463:G185A	G	-	2	0	AGPAT1	32245972	0.813000	0.29090	1.000000	0.80357	0.969000	0.65631	3.037000	0.49775	2.805000	0.96524	0.655000	0.94253	GGC		0.537	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411		7	12	0	0	0	0	7	12				
CMTR1	23070	broad.mit.edu	37	6	37411845	37411845	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:37411845C>T	ENST00000373451.4	+	3	368	c.204C>T	c.(202-204)gaC>gaT	p.D68D		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	68					7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										ACTCTTTTGACGATGCATTCA	0.433																																						uc003ons.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(202-204)GAC>GAT		FtsJ methyltransferase domain containing 2							177.0	160.0	166.0					6																	37411845		2203	4300	6503	SO:0001819	synonymous_variant	23070				mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding	g.chr6:37411845C>T	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.204C>T	6.37:g.37411845C>T			Somatic				FTSJD2_uc010jwu.2_Silent_p.D68D	p.D68D	NM_015050	NP_055865	WXS	Illumina HiSeq	Unspecified	Q8N1G2	MTR1_HUMAN			3	457	+			68					A8K949|Q14670|Q96FJ9	Silent	SNP	ENST00000373451.4	37	c.204C>T	CCDS4835.1																																																																																				0.433	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050		40	52	0	0	0	0	40	52				
TTBK1	84630	broad.mit.edu	37	6	43214425	43214425	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:43214425G>A	ENST00000259750.4	+	2	110	c.27G>A	c.(25-27)aaG>aaA	p.K9K	TTBK1_ENST00000304139.5_5'Flank	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	9					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CCGCCCTTAAGGACGAAACCA	0.672																																						uc003ouq.1		NA																	0				lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9						c.(25-27)AAG>AAA		tau tubulin kinase 1							34.0	32.0	33.0					6																	43214425		2203	4300	6503	SO:0001819	synonymous_variant	84630					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr6:43214425G>A	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.27G>A	6.37:g.43214425G>A			Somatic					p.K9K	NM_032538	NP_115927	WXS	Illumina HiSeq	Unspecified	Q5TCY1	TTBK1_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)		2	306	+			9					A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	c.27G>A	CCDS34455.1																																																																																				0.672	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3			10	34	0	0	0	0	10	34				
PHIP	55023	broad.mit.edu	37	6	79655871	79655871	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:79655871G>C	ENST00000275034.4	-	38	4644	c.4477C>G	c.(4477-4479)Cag>Gag	p.Q1493E	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1493					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CCGTTTATCTGAGCAGCATTG	0.433																																						uc003pir.2		NA																	0				large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(4477-4479)CAG>GAG		pleckstrin homology domain interacting protein							197.0	172.0	181.0					6																	79655871		2203	4300	6503	SO:0001583	missense	55023				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding	g.chr6:79655871G>C	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4477C>G	6.37:g.79655871G>C	ENSP00000275034:p.Gln1493Glu		Somatic				PHIP_uc003piq.2_Missense_Mutation_p.Q517E|PHIP_uc011dyp.1_Missense_Mutation_p.Q1492E|IRAK1BP1_uc010kbg.1_RNA|PHIP_uc003pio.3_Missense_Mutation_p.Q379E	p.Q1493E	NM_017934	NP_060404	WXS	Illumina HiSeq	Unspecified	Q8WWQ0	PHIP_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.231)	38	4703	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)	1493					A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	c.4477C>G	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899908	0.33535	.	.	ENSG00000146247	ENST00000275034;ENST00000355098	T	0.38887	1.11	5.96	5.96	0.96718	.	0.078877	0.53938	D	0.000043	T	0.22399	0.0540	L	0.27053	0.805	0.48087	D	0.999581	P;P	0.48764	0.915;0.915	B;B	0.40940	0.344;0.344	T	0.01386	-1.1368	9	.	.	.	-10.1262	19.4101	0.94667	0.0:0.0:1.0:0.0	.	1493;1493	A7J992;Q8WWQ0	.;PHIP_HUMAN	E	1493;219	ENSP00000275034:Q1493E	.	Q	-	1	0	PHIP	79712590	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.757000	0.74924	2.832000	0.97577	0.655000	0.94253	CAG		0.433	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2			7	89	0	0	0	0	7	89				
LAMA4	3910	broad.mit.edu	37	6	112465999	112465999	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:112465999G>C	ENST00000230538.7	-	19	2887	c.2490C>G	c.(2488-2490)agC>agG	p.S830R	LAMA4_ENST00000389463.4_Missense_Mutation_p.S823R|LAMA4_ENST00000424408.2_Missense_Mutation_p.S823R|LAMA4_ENST00000522006.1_Missense_Mutation_p.S823R	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	830	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CAGTTACCTTGCTGGCAACAC	0.512																																						uc003pvu.2		NA																	0				ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(2488-2490)AGC>AGG		laminin, alpha 4 isoform 1 precursor							111.0	111.0	111.0					6																	112465999		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112465999G>C		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2490C>G	6.37:g.112465999G>C	ENSP00000230538:p.Ser830Arg		Somatic				LAMA4_uc003pvv.2_Missense_Mutation_p.S823R|LAMA4_uc003pvt.2_Missense_Mutation_p.S823R	p.S830R	NM_001105206	NP_001098676	WXS	Illumina HiSeq	Unspecified	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	19	2799	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	830			Domain II and I.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.2490C>G	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233178	0.58777	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.35	5.35	0.76521	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin II (1);	0.162448	0.64402	D	0.000002	T	0.40423	0.1116	M	0.69823	2.125	0.80722	D	1	P;P	0.39717	0.684;0.634	B;B	0.41036	0.346;0.234	T	0.49062	-0.8978	10	0.72032	D	0.01	.	12.5526	0.56236	0.0753:0.0:0.9247:0.0	.	830;823	Q16363;Q16363-2	LAMA4_HUMAN;.	R	830;823;823;823	ENSP00000230538:S830R;ENSP00000429488:S823R;ENSP00000374114:S823R;ENSP00000416470:S823R	ENSP00000230538:S830R	S	-	3	2	LAMA4	112572692	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.661000	0.54503	2.780000	0.95670	0.655000	0.94253	AGC		0.512	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		21	82	0	0	0	0	21	82				
LAMA2	3908	broad.mit.edu	37	6	129635848	129635848	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:129635848G>A	ENST00000421865.2	+	24	3509	c.3460G>A	c.(3460-3462)Gga>Aga	p.G1154R		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1154	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGGCAAATTCGGACTCGATGC	0.527																																						uc003qbn.2		NA																	0				ovary(8)|breast(1)|skin(1)	10						c.(3460-3462)GGA>AGA		laminin alpha 2 subunit isoform a precursor							72.0	67.0	68.0					6																	129635848		2203	4300	6503	SO:0001583	missense	3908				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity	g.chr6:129635848G>A	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3460G>A	6.37:g.129635848G>A	ENSP00000400365:p.Gly1154Arg		Somatic				LAMA2_uc003qbo.2_Missense_Mutation_p.G1154R	p.G1154R	NM_000426	NP_000417	WXS	Illumina HiSeq	Unspecified	P24043	LAMA2_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)	24	3565	+			1154			Laminin EGF-like 13.		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	c.3460G>A	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043207	0.93685	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.57107	0.42	5.59	5.59	0.84812	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72798	-0.4184	10	0.62326	D	0.03	.	19.5763	0.95446	0.0:0.0:1.0:0.0	.	1154;1154	A6NF00;P24043	.;LAMA2_HUMAN	R	1154	ENSP00000400365:G1154R	ENSP00000346769:G1154R	G	+	1	0	LAMA2	129677541	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	7.425000	0.80255	2.646000	0.89796	0.655000	0.94253	GGA		0.527	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			9	37	0	0	0	0	9	37				
TCF21	6943	broad.mit.edu	37	6	134210544	134210544	+	Silent	SNP	C	C	T	rs570347337	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:134210544C>T	ENST00000367882.4	+	1	269	c.9C>T	c.(7-9)acC>acT	p.T3T	RP3-323P13.2_ENST00000606544.1_RNA|TCF21_ENST00000237316.3_Silent_p.T3T|RP3-323P13.2_ENST00000607033.1_RNA|RP3-323P13.2_ENST00000607641.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	3					branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.T3T(1)		cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		ACATGTCCACCGGCTCCCTCA	0.522													C|||	9	0.00179712	0.0	0.0	5008	,	,		18903	0.0		0.0	False		,,,				2504	0.0092					uc003qei.3		NA																	1	Substitution - coding silent(1)		prostate(1)		0						c.(7-9)ACC>ACT		transcription factor 21							90.0	93.0	92.0					6																	134210544		2203	4300	6503	SO:0001819	synonymous_variant	6943				branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity	g.chr6:134210544C>T	AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.9C>T	6.37:g.134210544C>T			Somatic				uc003qeg.1_5'Flank|TCF21_uc003qej.2_Silent_p.T3T	p.T3T	NM_003206	NP_003197	WXS	Illumina HiSeq	Unspecified	O43680	TCF21_HUMAN		GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)	1	285	+	Colorectal(23;0.221)|Breast(56;0.247)		3					E1P581|O43545|Q6ICV0|Q9BZ14	Silent	SNP	ENST00000367882.4	37	c.9C>T	CCDS5167.1																																																																																				0.522	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392		14	91	0	0	0	0	14	91				
BCLAF1	9774	broad.mit.edu	37	6	136582563	136582563	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:136582563C>T	ENST00000531224.1	-	12	2849	c.2597G>A	c.(2596-2598)cGt>cAt	p.R866H	BCLAF1_ENST00000530767.1_Missense_Mutation_p.R693H|BCLAF1_ENST00000031135.9_Missense_Mutation_p.R84H|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R815H|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R815H|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R864H|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000527536.1_Missense_Mutation_p.R817H	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	866					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AAAAGTACCACGACCTCTTCC	0.408																																					Colon(142;1534 1789 5427 7063 28491)	uc003qgx.1		NA																	0				ovary(1)	1						c.(2596-2598)CGT>CAT		BCL2-associated transcription factor 1 isoform							209.0	209.0	209.0					6																	136582563		2203	4300	6503	SO:0001583	missense	9774				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding	g.chr6:136582563C>T	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2597G>A	6.37:g.136582563C>T	ENSP00000435210:p.Arg866His		Somatic				BCLAF1_uc011edb.1_Missense_Mutation_p.R145H|BCLAF1_uc003qgw.1_Missense_Mutation_p.R693H|BCLAF1_uc003qgy.1_Missense_Mutation_p.R815H|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R864H	p.R866H	NM_014739	NP_055554	WXS	Illumina HiSeq	Unspecified	Q9NYF8	BCLF1_HUMAN		GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)	12	2850	-	Colorectal(23;0.24)		866					A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	c.2597G>A	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484459	0.84854	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000031135;ENST00000392348	T;T;T;T;T;T;T	0.58940	2.06;1.77;1.77;1.82;2.06;0.3;1.77	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000004	T	0.68201	0.2975	L	0.49126	1.545	0.58432	D	0.999992	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.991;0.999;0.991;0.991;0.993	T	0.70730	-0.4792	10	0.87932	D	0	-4.1232	19.3961	0.94607	0.0:1.0:0.0:0.0	.	864;145;815;866;693	Q9NYF8-2;B7Z8J9;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;.;BCLF1_HUMAN;.	H	866;815;817;693;864;84;815	ENSP00000435210:R866H;ENSP00000229446:R815H;ENSP00000435441:R817H;ENSP00000436501:R693H;ENSP00000434826:R864H;ENSP00000031135:R84H;ENSP00000376159:R815H	ENSP00000031135:R84H	R	-	2	0	BCLAF1	136624256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.412000	0.73303	2.581000	0.87130	0.655000	0.94253	CGT		0.408	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739		25	227	0	0	0	0	25	227				
SHPRH	257218	broad.mit.edu	37	6	146245960	146245960	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:146245960T>A	ENST00000367505.2	-	17	3581	c.3317A>T	c.(3316-3318)tAc>tTc	p.Y1106F	SHPRH_ENST00000275233.7_Missense_Mutation_p.Y1106F|SHPRH_ENST00000438092.2_Missense_Mutation_p.Y1115F|SHPRH_ENST00000367503.3_Missense_Mutation_p.Y1115F			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1106					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CTTGCTCATGTAGTGCTCTCG	0.408																																						uc003qlf.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(3316-3318)TAC>TTC		SNF2 histone linker PHD RING helicase isoform a							126.0	118.0	121.0					6																	146245960		1916	4125	6041	SO:0001583	missense	257218				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	g.chr6:146245960T>A	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.3317A>T	6.37:g.146245960T>A	ENSP00000356475:p.Tyr1106Phe		Somatic				SHPRH_uc003qld.2_Missense_Mutation_p.Y1115F|SHPRH_uc003qle.2_Missense_Mutation_p.Y1115F|SHPRH_uc003qlg.1_Missense_Mutation_p.Y662F|SHPRH_uc003qlh.2_Missense_Mutation_p.Y31F|SHPRH_uc003qli.1_Missense_Mutation_p.Y31F	p.Y1106F	NM_001042683	NP_001036148	WXS	Illumina HiSeq	Unspecified	Q149N8	SHPRH_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)	17	3716	-		Ovarian(120;0.0365)	1106					Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	c.3317A>T	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	T	31	5.093102	0.94149	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	D;D;D;D	0.83591	-1.6;-1.74;-1.53;-1.6	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000002	D	0.88680	0.6502	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.87578	0.998;0.99;0.996	D	0.87394	0.2365	10	0.31617	T	0.26	-18.5973	15.8509	0.78930	0.0:0.0:0.0:1.0	.	305;1106;1115	B3KX98;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	F	1106;1115;1115;1106	ENSP00000356475:Y1106F;ENSP00000356473:Y1115F;ENSP00000412797:Y1115F;ENSP00000275233:Y1106F	ENSP00000275233:Y1106F	Y	-	2	0	SHPRH	146287653	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	7.922000	0.87538	2.222000	0.72286	0.477000	0.44152	TAC		0.408	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082		23	59	0	0	0	0	23	59				
SYNE1	23345	broad.mit.edu	37	6	152763311	152763311	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:152763311C>T	ENST00000367255.5	-	31	4508	c.3907G>A	c.(3907-3909)Gaa>Aaa	p.E1303K	SYNE1_ENST00000367248.3_Missense_Mutation_p.E1293K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E1310K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E1369K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E1310K|SYNE1_ENST00000413186.2_Missense_Mutation_p.E1303K|SYNE1_ENST00000367253.4_Missense_Mutation_p.E1303K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E1303K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1303					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGCCCCCCTTCTCCCTGCTGC	0.582										HNSCC(10;0.0054)																												uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(3907-3909)GAA>AAA		spectrin repeat containing, nuclear envelope 1							73.0	66.0	69.0					6																	152763311		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152763311C>T	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3907G>A	6.37:g.152763311C>T	ENSP00000356224:p.Glu1303Lys	HNSCC(10;0.0054)	Somatic				SYNE1_uc003qot.3_Missense_Mutation_p.E1310K|SYNE1_uc003qou.3_Missense_Mutation_p.E1303K|SYNE1_uc010kjb.1_Missense_Mutation_p.E1286K|SYNE1_uc003qow.2_Missense_Mutation_p.E598K|SYNE1_uc003qox.1_Missense_Mutation_p.E819K	p.E1303K	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	31	4509	-		Ovarian(120;0.0955)	1303			Potential.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.3907G>A	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375679	0.42105	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.88354	0.62;0.61;0.53;0.61;0.71;-2.16;-2.37;-2.36	5.41	5.41	0.78517	.	0.112562	0.38436	N	0.001686	D	0.88198	0.6372	M	0.64997	1.995	0.80722	D	1	P;P;P;P;P;P	0.49862	0.856;0.611;0.852;0.929;0.611;0.73	B;B;B;P;B;B	0.51079	0.129;0.159;0.281;0.658;0.159;0.302	D	0.85137	0.0978	10	0.16420	T	0.52	.	19.5512	0.95322	0.0:1.0:0.0:0.0	.	1286;1303;1293;1303;1303;1310	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	K	1303;1310;1303;1310;1369;1303;1293;1303	ENSP00000356224:E1303K;ENSP00000396024:E1310K;ENSP00000265368:E1303K;ENSP00000390975:E1310K;ENSP00000341887:E1369K;ENSP00000356222:E1303K;ENSP00000356217:E1293K;ENSP00000414510:E1303K	ENSP00000265368:E1303K	E	-	1	0	SYNE1	152805004	1.000000	0.71417	0.361000	0.25849	0.124000	0.20399	6.309000	0.72825	2.685000	0.91497	0.650000	0.86243	GAA		0.582	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		18	60	0	0	0	0	18	60				
CYP2W1	54905	broad.mit.edu	37	7	1026752	1026752	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:1026752C>T	ENST00000308919.7	+	6	842	c.829C>T	c.(829-831)Ccc>Tcc	p.P277S	CYP2W1_ENST00000340150.6_Missense_Mutation_p.P221S	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	277					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GGGGGATGACCCCGAGGGCCT	0.692																																						uc003sjq.1		NA																	0					0						c.(829-831)CCC>TCC		cytochrome P450, family 2, subfamily W,							15.0	16.0	16.0					7																	1026752		2180	4277	6457	SO:0001583	missense	54905				xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen	g.chr7:1026752C>T	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.829C>T	7.37:g.1026752C>T	ENSP00000310149:p.Pro277Ser		Somatic				CYP2W1_uc003sjr.1_Missense_Mutation_p.P277S	p.P277S	NM_017781	NP_060251	WXS	Illumina HiSeq	Unspecified	Q8TAV3	CP2W1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)	6	842	+		Ovarian(82;0.0112)	277						Missense_Mutation	SNP	ENST00000308919.7	37	c.829C>T	CCDS5319.2	.	.	.	.	.	.	.	.	.	.	C	10.40	1.338892	0.24253	.	.	ENSG00000073067	ENST00000308919;ENST00000340150;ENST00000415893	T;T;T	0.68181	-0.31;-0.31;-0.31	4.32	2.31	0.28768	.	1.006700	0.07981	N	0.985657	T	0.50497	0.1619	L	0.31207	0.915	0.09310	N	1	B;B	0.14012	0.004;0.009	B;B	0.17098	0.017;0.017	T	0.35425	-0.9789	10	0.21014	T	0.42	.	5.1438	0.14973	0.3739:0.5179:0.0:0.1082	.	221;277	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	S	277;221;51	ENSP00000310149:P277S;ENSP00000344178:P221S;ENSP00000392581:P51S	ENSP00000310149:P277S	P	+	1	0	CYP2W1	993278	0.002000	0.14202	0.412000	0.26496	0.147000	0.21601	1.168000	0.31859	1.132000	0.42129	0.561000	0.74099	CCC		0.692	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781		5	7	0	0	0	0	5	7				
RADIL	55698	broad.mit.edu	37	7	4856042	4856042	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:4856042G>A	ENST00000399583.3	-	8	1970	c.1783C>T	c.(1783-1785)Cgc>Tgc	p.R595C	RADIL_ENST00000536091.1_Missense_Mutation_p.A541V|RADIL_ENST00000538469.1_Missense_Mutation_p.R355C	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	595	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CTCTCACGGCGCTCCGTCTGG	0.677																																						uc003snj.1		NA																	0				lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7						c.(1783-1785)CGC>TGC		Rap GTPase interactor							11.0	17.0	15.0					7																	4856042		1960	4116	6076	SO:0001583	missense	55698				cell adhesion|multicellular organismal development|signal transduction		protein binding	g.chr7:4856042G>A	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.1783C>T	7.37:g.4856042G>A	ENSP00000382492:p.Arg595Cys		Somatic				RADIL_uc003sng.1_RNA|RADIL_uc003sni.1_Missense_Mutation_p.R100C|RADIL_uc011jwc.1_Missense_Mutation_p.R355C|RADIL_uc011jwd.1_RNA	p.R595C	NM_018059	NP_060529	WXS	Illumina HiSeq	Unspecified	Q96JH8	RADIL_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)	8	1956	-		Ovarian(82;0.0175)	595			Dilute.		A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	c.1783C>T	CCDS43544.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.727|8.727	0.915709|0.915709	0.17907|0.17907	.|.	.|.	ENSG00000157927|ENSG00000157927	ENST00000536091|ENST00000399583;ENST00000316919;ENST00000544486;ENST00000538469	T|T;T	0.24538|0.07444	1.85|3.29;3.19	5.39|5.39	1.22|1.22	0.21188|0.21188	.|Dilute (1);	.|0.407880	.|0.27682	.|N	.|0.018297	T|T	0.03959|0.03959	0.0111|0.0111	N|N	0.16478|0.16478	0.41|0.41	0.22017|0.22017	N|N	0.999418|0.999418	.|B	.|0.17667	.|0.023	.|B	.|0.06405	.|0.002	T|T	0.34551|0.34551	-0.9824|-0.9824	7|10	0.87932|0.54805	D|T	0|0.06	-10.039|-10.039	1.1673|1.1673	0.01818|0.01818	0.1736:0.2301:0.3703:0.226|0.1736:0.2301:0.3703:0.226	.|.	.|595	.|Q96JH8	.|RADIL_HUMAN	V|C	541|595;566;329;355	ENSP00000442533:A541V|ENSP00000382492:R595C;ENSP00000442966:R355C	ENSP00000442533:A541V|ENSP00000320946:R566C	A|R	-|-	2|1	0|0	RADIL|RADIL	4822568|4822568	0.000000|0.000000	0.05858|0.05858	0.985000|0.985000	0.45067|0.45067	0.057000|0.057000	0.15508|0.15508	-0.641000|-0.641000	0.05434|0.05434	0.652000|0.652000	0.30806|0.30806	0.462000|0.462000	0.41574|0.41574	GCG|CGC		0.677	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059		4	15	0	0	0	0	4	15				
DNAH11	8701	broad.mit.edu	37	7	21646281	21646281	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:21646281T>C	ENST00000409508.3	+	20	3813	c.3782T>C	c.(3781-3783)tTc>tCc	p.F1261S	DNAH11_ENST00000328843.6_Missense_Mutation_p.F1261S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1261	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CAGGCAGAGTTCAGAGAGAGA	0.338									Kartagener syndrome																													uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(3781-3783)TTC>TCC		dynein, axonemal, heavy chain 11							78.0	71.0	73.0					7																	21646281		1835	4097	5932	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21646281T>C	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.3782T>C	7.37:g.21646281T>C	ENSP00000475939:p.Phe1261Ser		Somatic					p.F1261S	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			20	3813	+			1261			Stem (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.3782T>C		.	.	.	.	.	.	.	.	.	.	T	19.83	3.900536	0.72754	.	.	ENSG00000105877	ENST00000328843	T	0.22134	1.97	5.46	5.46	0.80206	.	0.120737	0.64402	D	0.000013	T	0.48732	0.1516	.	.	.	0.52501	D	0.999954	D	0.76494	0.999	D	0.83275	0.996	T	0.53394	-0.8445	9	0.87932	D	0	.	15.2118	0.73230	0.0:0.0:0.0:1.0	.	1261	Q96DT5	DYH11_HUMAN	S	1261	ENSP00000330671:F1261S	ENSP00000330671:F1261S	F	+	2	0	DNAH11	21612806	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.360000	0.59455	2.067000	0.61834	0.533000	0.62120	TTC		0.338	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		3	10	0	0	0	0	3	10				
PCLO	27445	broad.mit.edu	37	7	82579179	82579179	+	Silent	SNP	T	T	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:82579179T>A	ENST00000333891.9	-	6	11062	c.10725A>T	c.(10723-10725)acA>acT	p.T3575T	PCLO_ENST00000437081.1_Silent_p.T295T|PCLO_ENST00000423517.2_Silent_p.T3575T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GAGGACTTTGTGTGTCTGAAT	0.438																																						uc003uhx.2		NA																	0				ovary(7)	7						c.(10723-10725)ACA>ACT		piccolo isoform 1							188.0	181.0	184.0					7																	82579179		2044	4193	6237	SO:0001819	synonymous_variant	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82579179T>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10725A>T	7.37:g.82579179T>A			Somatic				PCLO_uc003uhv.2_Silent_p.T3575T|PCLO_uc010lec.2_Silent_p.T540T	p.T3575T	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			6	11014	-			3506						Silent	SNP	ENST00000333891.9	37	c.10725A>T	CCDS47630.1																																																																																				0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		18	48	0	0	0	0	18	48				
LMTK2	22853	broad.mit.edu	37	7	97832936	97832936	+	Silent	SNP	G	G	A	rs146973469	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:97832936G>A	ENST00000297293.5	+	12	4451	c.4158G>A	c.(4156-4158)ccG>ccA	p.P1386P		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1386					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CGTGCGGCCCGGACCTGAGCG	0.597																																						uc003upd.1		NA																	0				lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16						c.(4156-4158)CCG>CCA		lemur tyrosine kinase 2 precursor		G		0,4406		0,0,2203	28.0	26.0	26.0		4158	-10.3	0.0	7	dbSNP_134	26	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous	LMTK2	NM_014916.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1386/1504	97832936	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	22853				early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr7:97832936G>A	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4158G>A	7.37:g.97832936G>A			Somatic					p.P1386P	NM_014916	NP_055731	WXS	Illumina HiSeq	Unspecified	Q8IWU2	LMTK2_HUMAN			12	4451	+	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)		1386					A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	c.4158G>A	CCDS5654.1																																																																																				0.597	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916		11	26	0	0	0	0	11	26				
BAIAP2L1	55971	broad.mit.edu	37	7	97935815	97935815	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:97935815G>A	ENST00000005260.8	-	11	1392	c.1177C>T	c.(1177-1179)Ccg>Tcg	p.P393S	BAIAP2L1_ENST00000462558.1_5'Flank|RP4-607J23.2_ENST00000609873.1_RNA	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	393	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TACGACGACGGGAACCAACCC	0.572																																						uc003upj.2		NA																	0				ovary(1)	1						c.(1177-1179)CCG>TCG		BAI1-associated protein 2-like 1							158.0	127.0	137.0					7																	97935815		2203	4300	6503	SO:0001583	missense	55971				filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding	g.chr7:97935815G>A	AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.1177C>T	7.37:g.97935815G>A	ENSP00000005260:p.Pro393Ser		Somatic				uc003upk.1_5'Flank	p.P393S	NM_018842	NP_061330	WXS	Illumina HiSeq	Unspecified	Q9UHR4	BI2L1_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		11	1440	-	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		393			SH3.		A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Missense_Mutation	SNP	ENST00000005260.8	37	c.1177C>T	CCDS34687.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336863	0.81801	.	.	ENSG00000006453	ENST00000005260	D	0.99454	-5.92	5.28	5.28	0.74379	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.99729	0.9894	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97308	0.9935	10	0.72032	D	0.01	-19.4529	16.7557	0.85498	0.0:0.0:1.0:0.0	.	393	Q9UHR4	BI2L1_HUMAN	S	393	ENSP00000005260:P393S	ENSP00000005260:P393S	P	-	1	0	AC093799.1	97773751	1.000000	0.71417	0.999000	0.59377	0.649000	0.38597	7.457000	0.80775	2.650000	0.89964	0.591000	0.81541	CCG		0.572	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334681.1	NM_018842		25	71	0	0	0	0	25	71				
PUS7	54517	broad.mit.edu	37	7	105098338	105098338	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:105098338G>C	ENST00000356362.2	-	16	2099	c.1885C>G	c.(1885-1887)Cta>Gta	p.L629V	PUS7_ENST00000469408.1_Missense_Mutation_p.L629V	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	629					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						GAAGGGGGTAGAGAAAAATCC	0.473																																					Colon(138;2387 3051 17860)	uc003vcx.2		NA																	0				breast(1)	1						c.(1885-1887)CTA>GTA		pseudouridylate synthase 7 homolog							150.0	139.0	143.0					7																	105098338		2203	4300	6503	SO:0001583	missense	54517				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding	g.chr7:105098338G>C	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1885C>G	7.37:g.105098338G>C	ENSP00000348722:p.Leu629Val		Somatic				PUS7_uc010lji.2_Missense_Mutation_p.L635V|PUS7_uc003vcy.2_Missense_Mutation_p.L629V|PUS7_uc003vcz.1_Missense_Mutation_p.L629V	p.L629V	NM_019042	NP_061915	WXS	Illumina HiSeq	Unspecified	Q96PZ0	PUS7_HUMAN			16	2104	-			629					Q75MG4|Q9NX19	Missense_Mutation	SNP	ENST00000356362.2	37	c.1885C>G	CCDS34725.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455742	0.84209	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.59906	0.23;0.23	5.86	5.86	0.93980	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.82208	0.4987	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86123	0.1570	10	0.87932	D	0	.	12.819	0.57681	0.0741:0.0:0.9259:0.0	.	629;629	B3KY42;Q96PZ0	.;PUS7_HUMAN	V	629	ENSP00000348722:L629V;ENSP00000417402:L629V	ENSP00000348722:L629V	L	-	1	2	PUS7	104885574	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.360000	0.73064	2.937000	0.99478	0.650000	0.86243	CTA		0.473	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042		32	88	0	0	0	0	32	88				
COG5	10466	broad.mit.edu	37	7	107204296	107204296	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:107204296G>C	ENST00000347053.3	-	1	189	c.139C>G	c.(139-141)Cga>Gga	p.R47G	DUS4L_ENST00000402620.1_5'Flank|DUS4L_ENST00000498786.1_Intron|DUS4L_ENST00000265720.3_5'Flank|COG5_ENST00000297135.3_Missense_Mutation_p.R47G|COG5_ENST00000393603.2_Missense_Mutation_p.R47G	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	47					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CCAGAGCCTCGAGCTCCGAGG	0.667																																						uc003ved.2		NA																	0				central_nervous_system(2)|skin(2)	4						c.(139-141)CGA>GGA		component of oligomeric golgi complex 5 isoform							33.0	34.0	33.0					7																	107204296		2193	4285	6478	SO:0001583	missense	10466				intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding	g.chr7:107204296G>C	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.139C>G	7.37:g.107204296G>C	ENSP00000334703:p.Arg47Gly		Somatic				COG5_uc003vec.2_Missense_Mutation_p.R47G|COG5_uc003vee.2_Missense_Mutation_p.R47G|DUS4L_uc003veg.2_5'Flank|DUS4L_uc003veh.2_5'Flank|DUS4L_uc011klw.1_5'Flank|DUS4L_uc011klx.1_5'Flank	p.R47G	NM_181733	NP_859422	WXS	Illumina HiSeq	Unspecified	Q9UP83	COG5_HUMAN			1	664	-			47					A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	37	c.139C>G	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	G	2.922	-0.223080	0.06061	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.17370	2.29;2.28;2.28	5.41	1.21	0.21127	.	1.732920	0.02949	N	0.141519	T	0.10078	0.0247	N	0.08118	0	0.09310	N	0.999995	B;B	0.06786	0.001;0.001	B;B	0.12156	0.003;0.007	T	0.29640	-1.0005	10	0.21014	T	0.42	12.3555	8.2536	0.31741	0.0889:0.459:0.4521:0.0	.	47;47	Q9UP83;Q9UP83-2	COG5_HUMAN;.	G	47	ENSP00000334703:R47G;ENSP00000297135:R47G;ENSP00000377228:R47G	ENSP00000297135:R47G	R	-	1	2	COG5	106991532	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.031000	0.13710	0.354000	0.24105	0.591000	0.81541	CGA		0.667	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4			28	50	0	0	0	0	28	50				
CBLL1	79872	broad.mit.edu	37	7	107398754	107398754	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:107398754G>A	ENST00000440859.3	+	6	1074	c.607G>A	c.(607-609)Gaa>Aaa	p.E203K	CBLL1_ENST00000222597.2_Missense_Mutation_p.E202K|CBLL1_ENST00000415884.2_3'UTR	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	203	HYB domain. {ECO:0000250}.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						TGCTTCACTTGAAAATGTTCA	0.458																																						uc003veq.2		NA																	0				ovary(2)|skin(2)|lung(1)	5						c.(607-609)GAA>AAA		Cas-Br-M (murine) ecotropic retroviral							194.0	175.0	181.0					7																	107398754		2203	4300	6503	SO:0001583	missense	79872				cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr7:107398754G>A	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.607G>A	7.37:g.107398754G>A	ENSP00000401277:p.Glu203Lys		Somatic				CBLL1_uc011kme.1_Missense_Mutation_p.E82K|CBLL1_uc011kmf.1_Missense_Mutation_p.E202K	p.E203K	NM_024814	NP_079090	WXS	Illumina HiSeq	Unspecified	Q75N03	HAKAI_HUMAN			6	937	+			203					B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	c.607G>A	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.489334	0.84962	.	.	ENSG00000105879	ENST00000440859;ENST00000535365;ENST00000222597;ENST00000420796;ENST00000417616	T;T;T	0.34667	1.36;1.35;1.36	5.14	5.14	0.70334	.	0.191121	0.43747	D	0.000524	T	0.43590	0.1254	L	0.55481	1.735	0.80722	D	1	P;P	0.46784	0.884;0.884	P;P	0.46076	0.503;0.503	T	0.34551	-0.9824	10	0.45353	T	0.12	-2.5843	18.9708	0.92713	0.0:0.0:1.0:0.0	.	202;203	B7ZM03;Q75N03	.;HAKAI_HUMAN	K	203;82;202;153;149	ENSP00000401277:E203K;ENSP00000222597:E202K;ENSP00000410615:E153K	ENSP00000222597:E202K	E	+	1	0	CBLL1	107185990	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.297000	0.96120	2.558000	0.86282	0.655000	0.94253	GAA		0.458	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814		57	125	0	0	0	0	57	125				
CTTNBP2	83992	broad.mit.edu	37	7	117432019	117432019	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:117432019G>C	ENST00000160373.3	-	4	1322	c.1231C>G	c.(1231-1233)Caa>Gaa	p.Q411E	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	411	Pro-rich.				brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCTGGTGTTTGAGCGGTGGGA	0.522																																						uc003vjf.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1231-1233)CAA>GAA		cortactin binding protein 2							199.0	177.0	185.0					7																	117432019		2203	4300	6503	SO:0001583	missense	83992							g.chr7:117432019G>C		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1231C>G	7.37:g.117432019G>C	ENSP00000160373:p.Gln411Glu		Somatic					p.Q411E	NM_033427	NP_219499	WXS	Illumina HiSeq	Unspecified	Q8WZ74	CTTB2_HUMAN		LUSC - Lung squamous cell carcinoma(290;0.133)	4	1323	-	Lung NSC(10;0.0018)|all_lung(10;0.002)		411			Pro-rich.		O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	c.1231C>G	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.216641	0.00024	.	.	ENSG00000077063	ENST00000160373	T	0.63744	-0.06	4.52	4.52	0.55395	.	0.571274	0.16235	N	0.223406	T	0.57755	0.2075	M	0.75447	2.3	0.09310	N	1	B	0.21309	0.054	B	0.21360	0.034	T	0.44574	-0.9319	10	0.23891	T	0.37	-3.2383	7.4765	0.27378	0.0879:0.0:0.7447:0.1674	.	411	Q8WZ74	CTTB2_HUMAN	E	411	ENSP00000160373:Q411E	ENSP00000160373:Q411E	Q	-	1	0	CTTNBP2	117219255	0.991000	0.36638	0.096000	0.21009	0.012000	0.07955	2.855000	0.48333	2.500000	0.84329	0.460000	0.39030	CAA		0.522	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		34	115	0	0	0	0	34	115				
TAS2R16	50833	broad.mit.edu	37	7	122635216	122635216	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:122635216T>C	ENST00000249284.2	-	1	538	c.473A>G	c.(472-474)gAg>gGg	p.E158G		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	158					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGGTAGATGCTCCATGGTGAG	0.383																																						uc003vkl.1		NA																	0				ovary(1)|skin(1)	2						c.(472-474)GAG>GGG		taste receptor T2R16							163.0	152.0	156.0					7																	122635216		2203	4300	6503	SO:0001583	missense	50833				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding	g.chr7:122635216T>C	AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.473A>G	7.37:g.122635216T>C	ENSP00000249284:p.Glu158Gly		Somatic					p.E158G	NM_016945	NP_058641	WXS	Illumina HiSeq	Unspecified	Q9NYV7	T2R16_HUMAN			1	539	-			158			Extracellular (Potential).		A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	ENST00000249284.2	37	c.473A>G	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	T	5.896	0.349392	0.11182	.	.	ENSG00000128519	ENST00000249284	T	0.37058	1.22	4.56	-9.11	0.00711	.	2.716310	0.01647	N	0.024383	T	0.18635	0.0447	N	0.20685	0.6	0.09310	N	1	B	0.16603	0.018	B	0.19666	0.026	T	0.12451	-1.0547	10	0.29301	T	0.29	.	3.0104	0.06043	0.1037:0.4019:0.2739:0.2205	.	158	Q9NYV7	T2R16_HUMAN	G	158	ENSP00000249284:E158G	ENSP00000249284:E158G	E	-	2	0	TAS2R16	122422452	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.561000	0.00921	-3.144000	0.00232	-0.256000	0.11100	GAG		0.383	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945		13	46	0	0	0	0	13	46				
KDM7A	80853	broad.mit.edu	37	7	139796488	139796488	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:139796488G>A	ENST00000397560.2	-	17	2338	c.2241C>T	c.(2239-2241)tcC>tcT	p.S747S	Y_RNA_ENST00000515919.1_RNA|JHDM1D_ENST00000006967.5_Silent_p.S747S	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		747					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					GTAAACACGTGGAATAGTGCA	0.483																																						uc003vvm.2		NA																	0				ovary(1)	1						c.(2239-2241)TCC>TCT		jumonji C domain containing histone demethylase							134.0	131.0	132.0					7																	139796488		1980	4163	6143	SO:0001819	synonymous_variant	80853				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr7:139796488G>A																												ENST00000397560.2:c.2241C>T	7.37:g.139796488G>A			Somatic				JHDM1D_uc010lng.2_RNA	p.S747S	NM_030647	NP_085150	WXS	Illumina HiSeq	Unspecified	Q6ZMT4	KDM7_HUMAN			17	2245	-	Melanoma(164;0.0142)		747					A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Silent	SNP	ENST00000397560.2	37	c.2241C>T	CCDS43658.1																																																																																				0.483	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1			23	64	0	0	0	0	23	64				
OR9A4	130075	broad.mit.edu	37	7	141619579	141619579	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:141619579C>T	ENST00000548136.1	+	1	963	c.904C>T	c.(904-906)Cgg>Tgg	p.R302W	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					AGAGGCCCTTCGGGATGGGGT	0.423																																						uc003vwu.1		NA																	0				skin(1)	1						c.(904-906)CGG>TGG		olfactory receptor, family 9, subfamily A,							94.0	96.0	96.0					7																	141619579		2071	4246	6317	SO:0001583	missense	130075				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:141619579C>T		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.904C>T	7.37:g.141619579C>T	ENSP00000448789:p.Arg302Trp		Somatic					p.R302W	NM_001001656	NP_001001656	WXS	Illumina HiSeq	Unspecified	Q8NGU2	OR9A4_HUMAN			1	904	+	Melanoma(164;0.0171)		302			Cytoplasmic (Potential).		B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	37	c.904C>T	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	C	3.977	-0.007230	0.07773	.	.	ENSG00000258083	ENST00000548136	T	0.40225	1.04	3.7	-0.787	0.10943	.	.	.	.	.	T	0.28167	0.0695	L	0.39898	1.24	0.09310	N	1	B	0.18863	0.031	B	0.15870	0.014	T	0.27706	-1.0066	9	0.52906	T	0.07	0.029	2.8696	0.05613	0.3775:0.3949:0.0:0.2276	.	302	Q8NGU2	OR9A4_HUMAN	W	302	ENSP00000448789:R302W	ENSP00000386148:R302W	R	+	1	2	OR9A4	141266048	0.000000	0.05858	0.070000	0.20053	0.159000	0.22180	-2.665000	0.00848	0.023000	0.15187	-0.203000	0.12734	CGG		0.423	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656		21	70	0	0	0	0	21	70				
EPHB6	2051	broad.mit.edu	37	7	142566409	142566409	+	Missense_Mutation	SNP	G	G	A	rs201556658		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:142566409G>A	ENST00000392957.2	+	15	2985	c.2198G>A	c.(2197-2199)cGg>cAg	p.R733Q	EPHB6_ENST00000411471.2_Missense_Mutation_p.R456Q|EPHB6_ENST00000442129.1_Missense_Mutation_p.R733Q	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	733	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					AACATCCTGCGGCTGGAGGGC	0.677																																						uc011kst.1		NA																	0				lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(2197-2199)CGG>CAG		ephrin receptor EphB6 precursor		G	GLN/ARG	1,4401	2.1+/-5.4	0,1,2200	32.0	35.0	34.0		2198	5.0	1.0	7		34	1,8599	1.2+/-3.3	0,1,4299	yes	missense	EPHB6	NM_004445.3	43	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	733/1022	142566409	2,13000	2201	4300	6501	SO:0001583	missense	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142566409G>A	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2198G>A	7.37:g.142566409G>A	ENSP00000376684:p.Arg733Gln		Somatic				EPHB6_uc011ksu.1_Missense_Mutation_p.R733Q|EPHB6_uc003wbs.2_Missense_Mutation_p.R441Q|EPHB6_uc003wbt.2_Missense_Mutation_p.R207Q|EPHB6_uc003wbu.2_Missense_Mutation_p.R441Q|EPHB6_uc003wbv.2_Missense_Mutation_p.R117Q	p.R733Q	NM_004445	NP_004436	WXS	Illumina HiSeq	Unspecified	O15197	EPHB6_HUMAN			15	2985	+	Melanoma(164;0.059)		733			Cytoplasmic (Potential).|Protein kinase.		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	37	c.2198G>A	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321263	0.81580	2.27E-4	1.16E-4	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.63580	-0.05;-0.05;-0.05	4.99	4.99	0.66335	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40144	N	0.001162	T	0.51363	0.1670	N	0.25380	0.74	0.38384	D	0.945229	D;D	0.69078	0.997;0.993	P;B	0.45428	0.48;0.222	T	0.60969	-0.7157	10	0.87932	D	0	.	10.7971	0.46466	0.0979:0.0:0.9021:0.0	.	733;456	O15197;O15197-2	EPHB6_HUMAN;.	Q	733;733;456	ENSP00000376684:R733Q;ENSP00000410789:R733Q;ENSP00000409061:R456Q	ENSP00000376684:R733Q	R	+	2	0	EPHB6	142276531	0.991000	0.36638	1.000000	0.80357	0.956000	0.61745	2.164000	0.42387	2.326000	0.78906	0.313000	0.20887	CGG		0.677	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			21	36	0	0	0	0	21	36				
CNTNAP2	26047	broad.mit.edu	37	7	147336299	147336299	+	Missense_Mutation	SNP	G	G	A	rs374920791		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:147336299G>A	ENST00000361727.3	+	13	2515	c.1999G>A	c.(1999-2001)Gcc>Acc	p.A667T		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	667	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.A667T(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CGTTTACAGCGCCTCCATGGA	0.502										HNSCC(39;0.1)																												uc003weu.1		NA																	1	Substitution - Missense(1)	p.A667T(1)	ovary(1)	ovary(9)|central_nervous_system(1)|pancreas(1)	11						c.(1999-2001)GCC>ACC		cell recognition molecule Caspr2 precursor		G	THR/ALA	0,4406		0,0,2203	148.0	126.0	133.0		1999	5.7	1.0	7		133	1,8599	1.2+/-3.3	0,1,4299	no	missense	CNTNAP2	NM_014141.5	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	667/1332	147336299	1,13005	2203	4300	6503	SO:0001583	missense	26047				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	g.chr7:147336299G>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1999G>A	7.37:g.147336299G>A	ENSP00000354778:p.Ala667Thr	HNSCC(39;0.1)	Somatic					p.A667T	NM_014141	NP_054860	WXS	Illumina HiSeq	Unspecified	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)		13	2515	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	667			Extracellular (Potential).|Fibrinogen C-terminal.		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	c.1999G>A	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959480	0.74016	0.0	1.16E-4	ENSG00000174469	ENST00000361727;ENST00000455301	T;T	0.15487	2.42;2.42	5.74	5.74	0.90152	.	0.065352	0.64402	D	0.000013	T	0.24353	0.0590	M	0.78344	2.41	0.80722	D	1	B	0.34226	0.443	B	0.25291	0.059	T	0.03060	-1.1077	10	0.51188	T	0.08	.	18.8598	0.92267	0.0:0.0:1.0:0.0	.	667	Q9UHC6	CNTP2_HUMAN	T	667;58	ENSP00000354778:A667T;ENSP00000392208:A58T	ENSP00000354778:A667T	A	+	1	0	CNTNAP2	146967232	1.000000	0.71417	0.996000	0.52242	0.883000	0.51084	6.803000	0.75180	2.873000	0.98535	0.561000	0.74099	GCC		0.502	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			18	49	0	0	0	0	18	49				
C7orf33	202865	broad.mit.edu	37	7	148288041	148288041	+	Silent	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr7:148288041C>G	ENST00000307003.2	+	1	385	c.24C>G	c.(22-24)ctC>ctG	p.L8L		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	8										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTCAAAGCCTCAGCCTTGAAG	0.537																																						uc003wew.2		NA																	0				central_nervous_system(1)	1						c.(22-24)CTC>CTG		hypothetical protein LOC202865							56.0	57.0	57.0					7																	148288041		2203	4300	6503	SO:0001819	synonymous_variant	202865							g.chr7:148288041C>G	BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.24C>G	7.37:g.148288041C>G			Somatic					p.L8L	NM_145304	NP_660347	WXS	Illumina HiSeq	Unspecified	Q8WU49	CG033_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00291)		1	385	+	Melanoma(164;0.15)		8						Silent	SNP	ENST00000307003.2	37	c.24C>G	CCDS5890.1																																																																																				0.537	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304		10	65	0	0	0	0	10	65				
UNC5D	137970	broad.mit.edu	37	8	35583721	35583721	+	Missense_Mutation	SNP	G	G	A	rs190579280	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr8:35583721G>A	ENST00000404895.2	+	10	1683	c.1355G>A	c.(1354-1356)cGg>cAg	p.R452Q	UNC5D_ENST00000453357.2_Missense_Mutation_p.R447Q|UNC5D_ENST00000416672.1_Missense_Mutation_p.R457Q|UNC5D_ENST00000287272.2_Missense_Mutation_p.R383Q|UNC5D_ENST00000420357.1_Missense_Mutation_p.R385Q|UNC5D_ENST00000449677.1_Missense_Mutation_p.R28Q	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	452					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ACAGTGAGCCGGACATACAGC	0.488													G|||	2	0.000399361	0.0	0.0029	5008	,	,		19446	0.0		0.0	False		,,,				2504	0.0					uc003xjr.1		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6						c.(1354-1356)CGG>CAG		unc-5 homolog D precursor		G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	65.0	65.0	65.0		1355	6.0	1.0	8		65	0,8600		0,0,4300	yes	missense	UNC5D	NM_080872.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	452/954	35583721	1,13005	2203	4300	6503	SO:0001583	missense	137970				apoptosis|axon guidance	integral to membrane	receptor activity	g.chr8:35583721G>A	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1355G>A	8.37:g.35583721G>A	ENSP00000385143:p.Arg452Gln		Somatic				UNC5D_uc003xjs.1_Missense_Mutation_p.R447Q|UNC5D_uc003xju.1_Missense_Mutation_p.R28Q|UNC5D_uc003xjt.1_Missense_Mutation_p.R210Q	p.R452Q	NM_080872	NP_543148	WXS	Illumina HiSeq	Unspecified	Q6UXZ4	UNC5D_HUMAN		READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)	10	1683	+			452			Cytoplasmic (Potential).		Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	c.1355G>A	CCDS6093.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	20.2	3.952407	0.73787	2.27E-4	0.0	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.53857	0.63;1.08;1.09;0.63;0.6;2.49	6.04	6.04	0.98038	.	0.111373	0.64402	D	0.000010	T	0.39036	0.1063	L	0.29908	0.895	0.40738	D	0.982802	P;P;P;P	0.48503	0.911;0.522;0.597;0.462	B;B;B;B	0.28991	0.097;0.056;0.089;0.041	T	0.43956	-0.9359	10	0.46703	T	0.11	-14.7138	20.5948	0.99439	0.0:0.0:1.0:0.0	.	28;457;447;452	E9PDS8;C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;.;UNC5D_HUMAN	Q	452;385;383;457;447;28	ENSP00000385143:R452Q;ENSP00000392739:R385Q;ENSP00000287272:R383Q;ENSP00000412652:R457Q;ENSP00000394303:R447Q;ENSP00000397211:R28Q	ENSP00000287272:R383Q	R	+	2	0	UNC5D	35703263	1.000000	0.71417	0.996000	0.52242	0.958000	0.62258	7.611000	0.82962	2.873000	0.98535	0.563000	0.77884	CGG		0.488	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			59	62	0	0	0	0	59	62				
KCNU1	157855	broad.mit.edu	37	8	36671785	36671785	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr8:36671785G>A	ENST00000399881.3	+	8	830	c.793G>A	c.(793-795)Gag>Aag	p.E265K		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	265					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		ATCATATTTTGAGTCAATTTA	0.418																																						uc010lvw.2		NA																	0				ovary(1)	1						c.(793-795)GAG>AAG		potassium channel, subfamily U, member 1							70.0	66.0	67.0					8																	36671785		1868	4094	5962	SO:0001583	missense	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36671785G>A	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.793G>A	8.37:g.36671785G>A	ENSP00000382770:p.Glu265Lys		Somatic				KCNU1_uc003xjw.2_RNA	p.E265K	NM_001031836	NP_001027006	WXS	Illumina HiSeq	Unspecified	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	8	880	+			265						Missense_Mutation	SNP	ENST00000399881.3	37	c.793G>A	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680506	0.47886	.	.	ENSG00000215262	ENST00000523973;ENST00000399881	D;D	0.98567	-5.0;-5.0	5.37	4.49	0.54785	Ion transport (1);	0.921823	0.08854	U	0.883941	D	0.96738	0.8935	L	0.38838	1.175	0.80722	D	1	P	0.34955	0.477	B	0.37888	0.26	D	0.92281	0.5833	10	0.66056	D	0.02	-8.5508	14.932	0.70923	0.0:0.1443:0.8557:0.0	.	265	A8MYU2	KCNU1_HUMAN	K	265	ENSP00000429951:E265K;ENSP00000382770:E265K	ENSP00000382770:E265K	E	+	1	0	KCNU1	36790943	1.000000	0.71417	0.710000	0.30468	0.026000	0.11368	5.123000	0.64703	1.238000	0.43771	0.467000	0.42956	GAG		0.418	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		17	18	0	0	0	0	17	18				
PLEKHA2	59339	broad.mit.edu	37	8	38810819	38810819	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr8:38810819G>T	ENST00000420274.1	+	9	941	c.707G>T	c.(706-708)cGa>cTa	p.R236L	PLEKHA2_ENST00000521746.1_Intron|PLEKHA2_ENST00000388745.4_3'UTR	NM_021623.1	NP_067636.1	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	236	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)	p.R236L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			CACCAGGACCGAGAACCACTG	0.463																																						uc003xmi.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(706-708)CGA>CTA		pleckstrin homology domain containing, family A							217.0	208.0	211.0					8																	38810819		1949	4134	6083	SO:0001583	missense	59339				positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding	g.chr8:38810819G>T	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000420274.1:c.707G>T	8.37:g.38810819G>T	ENSP00000393860:p.Arg236Leu		Somatic				PLEKHA2_uc011lce.1_Missense_Mutation_p.R186L	p.R236L	NM_021623	NP_067636	WXS	Illumina HiSeq	Unspecified	Q9HB19	PKHA2_HUMAN	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)		9	941	+		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	236			PH 2.			Missense_Mutation	SNP	ENST00000420274.1	37	c.707G>T		.	.	.	.	.	.	.	.	.	.	G	17.01	3.278585	0.59758	.	.	ENSG00000169499	ENST00000420274;ENST00000535929	T	0.12569	2.67	5.56	5.56	0.83823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.112988	0.56097	D	0.000033	T	0.16642	0.0400	L	0.45744	1.44	0.39510	D	0.968341	P;P	0.39576	0.679;0.679	B;B	0.42916	0.402;0.402	T	0.00857	-1.1538	10	0.62326	D	0.03	.	10.8469	0.46748	0.0864:0.0:0.9136:0.0	.	236;236	Q9HB19;A8K727	PKHA2_HUMAN;.	L	236;186	ENSP00000393860:R236L	ENSP00000393860:R236L	R	+	2	0	PLEKHA2	38929976	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	3.702000	0.54800	2.778000	0.95560	0.655000	0.94253	CGA		0.463	PLEKHA2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021623		87	224	1	0	2.17e-41	2.5e-41	87	224				
CPA6	57094	broad.mit.edu	37	8	68334861	68334861	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr8:68334861C>T	ENST00000297770.4	-	11	1407	c.1192G>A	c.(1192-1194)Gaa>Aaa	p.E398K	CPA6_ENST00000297769.4_Missense_Mutation_p.E154K	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	398						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.E398K(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TCACGTAGTTCGAAAGCAAAT	0.383																																						uc003xxq.3		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)	2						c.(1192-1194)GAA>AAA		carboxypeptidase A6 isoform 1 precursor							130.0	130.0	130.0					8																	68334861		2203	4300	6503	SO:0001583	missense	57094				proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding	g.chr8:68334861C>T	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.1192G>A	8.37:g.68334861C>T	ENSP00000297770:p.Glu398Lys		Somatic				CPA6_uc003xxr.3_Missense_Mutation_p.E154K	p.E398K	NM_020361	NP_065094	WXS	Illumina HiSeq	Unspecified	Q8N4T0	CBPA6_HUMAN	Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)		11	1448	-			398				Nucleophile (By similarity).	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	c.1192G>A	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.151144	0.78001	.	.	ENSG00000165078	ENST00000297769;ENST00000297770	T;T	0.59364	0.27;0.27	5.86	4.99	0.66335	Peptidase M14, carboxypeptidase A (2);	0.049117	0.85682	N	0.000000	T	0.75539	0.3863	M	0.75150	2.29	0.33097	D	0.538687	P;D	0.89917	0.842;1.0	B;D	0.97110	0.214;1.0	D	0.84068	0.0378	10	0.72032	D	0.01	.	14.9884	0.71365	0.0:0.9318:0.0:0.0682	.	154;398	Q8N4T0-3;Q8N4T0	.;CBPA6_HUMAN	K	154;398	ENSP00000297769:E154K;ENSP00000297770:E398K	ENSP00000297769:E154K	E	-	1	0	CPA6	68497415	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.464000	0.80887	1.486000	0.48398	0.591000	0.81541	GAA		0.383	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361		38	94	0	0	0	0	38	94				
COL14A1	7373	broad.mit.edu	37	8	121290786	121290786	+	Silent	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr8:121290786G>C	ENST00000297848.3	+	28	3720	c.3450G>C	c.(3448-3450)gtG>gtC	p.V1150V	COL14A1_ENST00000309791.4_Silent_p.V1150V|COL14A1_ENST00000247781.3_Silent_p.V1055V	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AAGATGATGTGAACAAAATCT	0.353																																						uc003yox.2		NA																	0				ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(3448-3450)GTG>GTC		collagen, type XIV, alpha 1 precursor							91.0	82.0	85.0					8																	121290786		2203	4300	6503	SO:0001819	synonymous_variant	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121290786G>C		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3450G>C	8.37:g.121290786G>C			Somatic				COL14A1_uc003yoz.2_Silent_p.V115V	p.V1150V	NM_021110	NP_066933	WXS	Illumina HiSeq	Unspecified	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		28	3715	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		1150			VWFA 2.			Silent	SNP	ENST00000297848.3	37	c.3450G>C	CCDS34938.1																																																																																				0.353	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		18	18	0	0	0	0	18	18				
PLEC	5339	broad.mit.edu	37	8	144998292	144998292	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr8:144998292C>T	ENST00000322810.4	-	31	6385	c.6216G>A	c.(6214-6216)gaG>gaA	p.E2072E	PLEC_ENST00000527096.1_Silent_p.E1958E|PLEC_ENST00000354589.3_Silent_p.E1935E|PLEC_ENST00000357649.2_Silent_p.E1939E|PLEC_ENST00000345136.3_Silent_p.E1935E|PLEC_ENST00000398774.2_Silent_p.E1903E|PLEC_ENST00000436759.2_Silent_p.E1962E|PLEC_ENST00000356346.3_Silent_p.E1921E|PLEC_ENST00000354958.2_Silent_p.E1913E	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2072	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGGCCGCCTTCTCGAAGCTCG	0.701																																						uc003zaf.1		NA																	0				large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						c.(6214-6216)GAG>GAA		plectin isoform 1							15.0	17.0	16.0					8																	144998292		2183	4262	6445	SO:0001819	synonymous_variant	5339				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle	g.chr8:144998292C>T	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6216G>A	8.37:g.144998292C>T			Somatic				PLEC_uc003zab.1_Silent_p.E1935E|PLEC_uc003zac.1_Silent_p.E1939E|PLEC_uc003zad.2_Silent_p.E1935E|PLEC_uc003zae.1_Silent_p.E1903E|PLEC_uc003zag.1_Silent_p.E1913E|PLEC_uc003zah.2_Silent_p.E1921E|PLEC_uc003zaj.2_Silent_p.E1962E	p.E2072E	NM_201380	NP_958782	WXS	Illumina HiSeq	Unspecified	Q15149	PLEC_HUMAN			31	6386	-			2072			Central fibrous rod domain.|Potential.		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	c.6216G>A	CCDS43772.1																																																																																				0.701	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		15	28	0	0	0	0	15	28				
GLIS3	169792	broad.mit.edu	37	9	3937164	3937164	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:3937164G>A	ENST00000324333.10	-	4	1464	c.1271C>T	c.(1270-1272)tCa>tTa	p.S424L	GLIS3_ENST00000461870.1_5'UTR|GLIS3_ENST00000381971.3_Missense_Mutation_p.S579L	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	424					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TTCAAGCCTTGAAAAGGCCTT	0.458																																						uc003zhw.1		NA																	0				ovary(1)	1						c.(1270-1272)TCA>TTA		GLIS family zinc finger 3 isoform b							85.0	86.0	86.0					9																	3937164		2203	4300	6503	SO:0001583	missense	169792				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding	g.chr9:3937164G>A	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1271C>T	9.37:g.3937164G>A	ENSP00000325494:p.Ser424Leu		Somatic				GLIS3_uc003zhx.1_Missense_Mutation_p.S579L|GLIS3_uc010mhf.1_5'UTR|GLIS3_uc003zhv.1_RNA|GLIS3_uc003zhy.1_Missense_Mutation_p.S357L|GLIS3_uc003zhz.1_Missense_Mutation_p.S357L	p.S424L	NM_152629	NP_689842	WXS	Illumina HiSeq	Unspecified	Q8NEA6	GLIS3_HUMAN		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)	4	1465	-		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)	424			C2H2-type 3.		B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	c.1271C>T	CCDS6451.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986367	0.93044	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.41758	0.99;0.99	5.94	5.94	0.96194	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40064	U	0.001189	T	0.49575	0.1565	N	0.11064	0.09	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.999;0.999	T	0.58983	-0.7539	10	0.87932	D	0	.	19.9697	0.97280	0.0:0.0:1.0:0.0	.	92;92;579;424	Q1PHK2;Q1PHK3;Q8NEA6-2;Q8NEA6	.;.;.;GLIS3_HUMAN	L	424;579	ENSP00000325494:S424L;ENSP00000371398:S579L	ENSP00000325494:S424L	S	-	2	0	GLIS3	3927164	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.869000	0.99810	2.807000	0.96579	0.591000	0.81541	TCA		0.458	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629		9	69	0	0	0	0	9	69				
FREM1	158326	broad.mit.edu	37	9	14848678	14848678	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:14848678C>A	ENST00000380880.3	-	7	2029	c.1246G>T	c.(1246-1248)Gta>Tta	p.V416L	FREM1_ENST00000422223.2_Missense_Mutation_p.V416L|RNU6-1260P_ENST00000362944.1_RNA|FREM1_ENST00000380881.4_Missense_Mutation_p.V417L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	416					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTCCAGGATACACGGGGGGCA	0.423																																						uc003zlm.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(1246-1248)GTA>TTA		FRAS1 related extracellular matrix 1 precursor							133.0	118.0	123.0					9																	14848678		1902	4128	6030	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14848678C>A	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1246G>T	9.37:g.14848678C>A	ENSP00000370262:p.Val416Leu		Somatic				FREM1_uc010mic.2_RNA	p.V416L	NM_144966	NP_659403	WXS	Illumina HiSeq	Unspecified	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	7	1836	-			416			CSPG 2.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.1246G>T	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553681	0.86231	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.14391	2.51;2.51;2.51	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.33469	0.0864	L	0.46567	1.45	0.58432	D	0.999998	D	0.65815	0.995	D	0.72338	0.977	T	0.00520	-1.1692	10	0.51188	T	0.08	-14.5823	19.8344	0.96650	0.0:1.0:0.0:0.0	.	416	Q5H8C1	FREM1_HUMAN	L	417;416;416	ENSP00000370263:V417L;ENSP00000412940:V416L;ENSP00000370262:V416L	ENSP00000370257:V419L	V	-	1	0	FREM1	14838678	1.000000	0.71417	0.654000	0.29608	0.718000	0.41266	7.487000	0.81328	2.692000	0.91855	0.655000	0.94253	GTA		0.423	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		19	42	1	0	1.28e-07	1.43e-07	19	42				
UNC13B	10497	broad.mit.edu	37	9	35385812	35385812	+	Splice_Site	SNP	T	T	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:35385812T>C	ENST00000378495.3	+	22	2940		c.e22+2		UNC13B_ENST00000396787.1_Splice_Site|UNC13B_ENST00000378496.4_Splice_Site	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)						apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			AGAATGAAGGTAAGAAATGGA	0.483																																						uc003zwq.2		NA																	0				ovary(3)|large_intestine(1)|skin(1)	5						c.e22+2		UNC13 (C. elegans)-like							67.0	68.0	68.0					9																	35385812		2203	4300	6503	SO:0001630	splice_region_variant	10497				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity	g.chr9:35385812T>C	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.2718+2T>C	9.37:g.35385812T>C			Somatic				UNC13B_uc003zwr.2_Splice_Site_p.K906_splice	p.K906_splice	NM_006377	NP_006368	WXS	Illumina HiSeq	Unspecified	O14795	UN13B_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)		22	3010	+	all_epithelial(49;0.212)							Q5VYM8	Splice_Site	SNP	ENST00000378495.3	37	c.2718_splice	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816838	0.90790	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3729	0.74581	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC13B	35375812	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.166000	0.71896	2.088000	0.63022	0.533000	0.62120	.		0.483	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	Intron	27	97	0	0	0	0	27	97				
UNC13B	10497	broad.mit.edu	37	9	35403456	35403456	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:35403456C>T	ENST00000378495.3	+	38	4572	c.4350C>T	c.(4348-4350)ctC>ctT	p.L1450L	UNC13B_ENST00000396787.1_Silent_p.L1481L|UNC13B_ENST00000378496.4_Silent_p.L1469L	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1450	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CCAATGACCTCAAGTGGCAGA	0.532																																						uc003zwq.2		NA																	0				ovary(3)|large_intestine(1)|skin(1)	5						c.(4348-4350)CTC>CTT		UNC13 (C. elegans)-like							59.0	59.0	59.0					9																	35403456		2203	4300	6503	SO:0001819	synonymous_variant	10497				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity	g.chr9:35403456C>T	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4350C>T	9.37:g.35403456C>T			Somatic				UNC13B_uc003zwr.2_Silent_p.L1469L	p.L1450L	NM_006377	NP_006368	WXS	Illumina HiSeq	Unspecified	O14795	UN13B_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)		38	4642	+	all_epithelial(49;0.212)		1450			C2 3.		Q5VYM8	Silent	SNP	ENST00000378495.3	37	c.4350C>T	CCDS6579.1																																																																																				0.532	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377		27	47	0	0	0	0	27	47				
GBA2	57704	broad.mit.edu	37	9	35750328	35750328	+	5'Flank	SNP	C	C	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:35750328C>A	ENST00000378103.3	-	0	0				GBA2_ENST00000545786.1_5'Flank|RGP1_ENST00000378078.4_Missense_Mutation_p.Q69K|GBA2_ENST00000378094.4_5'Flank|MSMP_ENST00000414286.1_5'Flank|RGP1_ENST00000456972.2_Missense_Mutation_p.Q109K	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGACTCTAGTCAGCCAGATGT	0.612																																						uc011lpf.1		NA																	0				ovary(1)	1						c.(205-207)CAG>AAG		RGP1 retrograde golgi transport homolog							37.0	38.0	38.0					9																	35750328		2039	4186	6225	SO:0001631	upstream_gene_variant	9827							g.chr9:35750328C>A	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35750328C>A	Exception_encountered		Somatic				GBA2_uc011lpb.1_5'Flank|GBA2_uc003zxw.2_5'Flank|GBA2_uc011lpc.1_5'Flank|GBA2_uc011lpd.1_5'Flank|RGP1_uc011lpe.1_Missense_Mutation_p.Q109K	p.Q69K	NM_001080496	NP_001073965	WXS	Illumina HiSeq	Unspecified	Q92546	RGP1_HUMAN	Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		3	346	+	all_epithelial(49;0.167)		69					D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	37	c.205C>A	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	C	6.990	0.552694	0.13374	.	.	ENSG00000107185	ENST00000456972;ENST00000378078	.	.	.	5.33	5.33	0.75918	.	0.235838	0.43579	D	0.000546	T	0.26011	0.0634	N	0.03115	-0.41	0.41687	D	0.989322	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.004	T	0.19943	-1.0290	9	0.05833	T	0.94	-12.44	13.4625	0.61235	0.1572:0.8428:0.0:0.0	.	69;69	Q92546;A8K0K1	RGP1_HUMAN;.	K	109;69	.	ENSP00000367318:Q69K	Q	+	1	0	RGP1	35740328	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.373000	0.59537	2.478000	0.83669	0.655000	0.94253	CAG		0.612	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944		9	31	1	0	9.05e-12	1.02e-11	9	31				
VPS13A	23230	broad.mit.edu	37	9	79910535	79910535	+	Silent	SNP	T	T	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:79910535T>G	ENST00000360280.3	+	33	3845	c.3585T>G	c.(3583-3585)acT>acG	p.T1195T	VPS13A_ENST00000376636.3_Silent_p.T1156T|VPS13A_ENST00000376634.4_Silent_p.T1195T|VPS13A_ENST00000357409.5_Silent_p.T1195T|VPS13A_ENST00000423463.2_3'UTR	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1195					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGGCTGCTACTGGTGTAAAAG	0.433																																						uc004akr.2		NA																	0				pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						c.(3583-3585)ACT>ACG		vacuolar protein sorting 13A isoform A							84.0	79.0	81.0					9																	79910535		2203	4300	6503	SO:0001819	synonymous_variant	23230				Golgi to endosome transport|protein transport	intracellular	protein binding	g.chr9:79910535T>G	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.3585T>G	9.37:g.79910535T>G			Somatic				VPS13A_uc004akp.3_Silent_p.T1195T|VPS13A_uc004akq.3_Silent_p.T1195T|VPS13A_uc004aks.2_Silent_p.T1156T|VPS13A_uc010mpo.1_5'UTR	p.T1195T	NM_033305	NP_150648	WXS	Illumina HiSeq	Unspecified	Q96RL7	VP13A_HUMAN			33	3845	+			1195					Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	37	c.3585T>G	CCDS6655.1																																																																																				0.433	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186		9	50	0	0	0	0	9	50				
AGTPBP1	23287	broad.mit.edu	37	9	88307677	88307677	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:88307677G>C	ENST00000357081.3	-	3	228	c.84C>G	c.(82-84)atC>atG	p.I28M	AGTPBP1_ENST00000376109.3_Missense_Mutation_p.I80M|AGTPBP1_ENST00000376081.4_Missense_Mutation_p.I28M|AGTPBP1_ENST00000337006.4_De_novo_Start_InFrame|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.I28M|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000376080.1_De_novo_Start_InFrame			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	28					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						GCTCAGCATTGATCTTCTCCA	0.388																																						uc011ltd.1		NA																	0				ovary(4)|large_intestine(2)|skin(1)	7						c.(82-84)ATC>ATG		ATP/GTP binding protein 1							126.0	110.0	115.0					9																	88307677		2203	4300	6503	SO:0001583	missense	23287				C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr9:88307677G>C	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.84C>G	9.37:g.88307677G>C	ENSP00000349592:p.Ile28Met		Somatic				AGTPBP1_uc010mqc.2_Missense_Mutation_p.I28M|AGTPBP1_uc011lte.1_Missense_Mutation_p.I80M	p.I28M	NM_015239	NP_056054	WXS	Illumina HiSeq	Unspecified	Q9UPW5	CBPC1_HUMAN			2	117	-			28					B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37	c.84C>G		.	.	.	.	.	.	.	.	.	.	G	11.47	1.648524	0.29336	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000376081	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.65	2.72	0.32119	Armadillo-type fold (1);	0.222985	0.45606	D	0.000347	T	0.34629	0.0904	L	0.54323	1.7	0.80722	D	1	B;B;B	0.24823	0.112;0.085;0.112	B;B;B	0.20384	0.029;0.018;0.029	T	0.25433	-1.0132	10	0.72032	D	0.01	-3.8588	7.3558	0.26719	0.0922:0.0:0.7239:0.1839	.	80;28;28	Q9UPW5-3;Q9UPW5;Q9UPW5-2	.;CBPC1_HUMAN;.	M	28;28;80;28	ENSP00000349592:I28M;ENSP00000365251:I28M;ENSP00000365277:I80M;ENSP00000365249:I28M	ENSP00000349592:I28M	I	-	3	3	AGTPBP1	87497497	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	1.330000	0.33781	0.872000	0.35775	0.561000	0.74099	ATC		0.388	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239		6	25	0	0	0	0	6	25				
SLC31A1	1317	broad.mit.edu	37	9	116028637	116028637	+	IGR	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:116028637A>G	ENST00000374212.4	+	0	4744				SLC31A1_ENST00000374210.6_Missense_Mutation_p.E177G|CDC26_ENST00000490408.1_Intron	NM_001859.3	NP_001850.1	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporter), member 1						cellular copper ion homeostasis (GO:0006878)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)|copper uptake transmembrane transporter activity (GO:0015088)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7					Bortezomib(DB00188)|Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ATGATTCAAGAGGCTCTTATG	0.473																																					Ovarian(135;1049 1799 4519 17564 28677)	uc004bgv.3		NA																	0					0						c.(529-531)GAG>GGG		solute carrier family 31 (copper transporters),							17.0	15.0	16.0					9																	116028637		876	1991	2867	SO:0001628	intergenic_variant	1317					integral to plasma membrane	copper ion transmembrane transporter activity	g.chr9:116028637A>G	U83460	CCDS6789.1	9q32	2013-07-17	2013-07-17		ENSG00000136868	ENSG00000136868		"""Solute carriers"""	11016	protein-coding gene	gene with protein product	copper transport 1 homolog (S. cerevisiae)	603085		COPT1		9207117	Standard	NM_001859		Approved	hCTR1, CTR1	uc004bgu.3	O15431	OTTHUMG00000020519		9.37:g.116028637A>G			Somatic				FKBP15_uc010muu.1_Intron	p.E177G	NM_001859	NP_001850	WXS	Illumina HiSeq	Unspecified	O15431	COPT1_HUMAN			6	716	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A8K8Z6|Q53GR5|Q5T1M4	Missense_Mutation	SNP	ENST00000374212.4	37	c.530A>G	CCDS6789.1	.	.	.	.	.	.	.	.	.	.	A	10.77	1.443893	0.25987	.	.	ENSG00000136868	ENST00000374210	T	0.76709	-1.04	2.72	1.57	0.23409	.	.	.	.	.	T	0.66218	0.2767	.	.	.	0.09310	N	1	B	0.19073	0.033	B	0.25140	0.058	T	0.58951	-0.7545	8	0.87932	D	0	.	4.4206	0.11479	0.84:0.0:0.16:0.0	.	177	Q5T1M3	.	G	177	ENSP00000363327:E177G	ENSP00000363327:E177G	E	+	2	0	SLC31A1	115068458	0.001000	0.12720	0.005000	0.12908	0.011000	0.07611	0.653000	0.24902	0.451000	0.26802	0.533000	0.62120	GAG		0.473	SLC31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053715.1	NM_001859		4	5	0	0	0	0	4	5				
AMBP	259	broad.mit.edu	37	9	116823771	116823771	+	Silent	SNP	G	G	A	rs374833274		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:116823771G>A	ENST00000265132.3	-	8	1048	c.786C>T	c.(784-786)ggC>ggT	p.G262G		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	262	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CCATGCAGCCGCCGTACTGGA	0.577																																						uc004bie.3		NA																	0				skin(1)	1						c.(784-786)GGC>GGT		alpha-1-microglobulin/bikunin preproprotein	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	G		0,4406		0,0,2203	78.0	73.0	75.0		786	-4.8	0.9	9		75	1,8599	2.2+/-6.3	0,1,4299	no	coding-synonymous	AMBP	NM_001633.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		262/353	116823771	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	259				cell adhesion|female pregnancy|heme catabolic process|interspecies interaction between organisms|negative regulation of immune response|negative regulation of JNK cascade|protein-chromophore linkage	extracellular region|plasma membrane	calcium channel inhibitor activity|calcium oxalate binding|heme binding|IgA binding|protein homodimerization activity|serine-type endopeptidase inhibitor activity|transporter activity	g.chr9:116823771G>A	X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.786C>T	9.37:g.116823771G>A			Somatic				AMBP_uc011lxk.1_Silent_p.G203G|AMBP_uc010mvc.1_RNA	p.G262G	NM_001633	NP_001624	WXS	Illumina HiSeq	Unspecified	P02760	AMBP_HUMAN			8	1049	-			262			BPTI/Kunitz inhibitor 1.		P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Silent	SNP	ENST00000265132.3	37	c.786C>T	CCDS6800.1																																																																																				0.577	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053758.2	NM_001633		24	86	0	0	0	0	24	86				
DFNB31	25861	broad.mit.edu	37	9	117266938	117266938	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:117266938C>T	ENST00000362057.3	-	1	312	c.144G>A	c.(142-144)gcG>gcA	p.A48A	DFNB31_ENST00000374057.3_Silent_p.A48A|DFNB31_ENST00000265134.6_5'Flank|DFNB31_ENST00000480518.1_5'Flank	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	48					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGCTCAGCAGCGCGGTCAGCG	0.746																																						uc004biz.3		NA																	0				ovary(4)|central_nervous_system(1)|pancreas(1)	6						c.(142-144)GCG>GCA		CASK-interacting protein CIP98 isoform 1							32.0	26.0	28.0					9																	117266938		2200	4297	6497	SO:0001819	synonymous_variant	25861				inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium		g.chr9:117266938C>T	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.144G>A	9.37:g.117266938C>T			Somatic				DFNB31_uc004biy.3_5'Flank|DFNB31_uc004bja.3_Silent_p.A48A|DFNB31_uc004bjb.2_Silent_p.A48A	p.A48A	NM_015404	NP_056219	WXS	Illumina HiSeq	Unspecified	Q9P202	WHRN_HUMAN			1	793	-			48					A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	ENST00000362057.3	37	c.144G>A	CCDS6806.1																																																																																				0.746	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404		8	33	0	0	0	0	8	33				
RABGAP1	23637	broad.mit.edu	37	9	125861042	125861042	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:125861042A>T	ENST00000373647.4	+	23	2916	c.2782A>T	c.(2782-2784)Aaa>Taa	p.K928*	RABGAP1_ENST00000373643.5_Nonsense_Mutation_p.K267*	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	928					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ATCTGAGATTAAAAAAAACAG	0.398																																						uc011lzh.1		NA																	0				ovary(3)|kidney(2)	5						c.(2782-2784)AAA>TAA		RAB GTPase activating protein 1							90.0	94.0	93.0					9																	125861042		2203	4300	6503	SO:0001587	stop_gained	23637				cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding	g.chr9:125861042A>T	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.2782A>T	9.37:g.125861042A>T	ENSP00000362751:p.Lys928*		Somatic				RABGAP1_uc004bnl.3_RNA|RABGAP1_uc011lzj.1_Nonsense_Mutation_p.K267*	p.K928*	NM_012197	NP_036329	WXS	Illumina HiSeq	Unspecified	Q9Y3P9	RBGP1_HUMAN			23	2916	+			928			Potential.		B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Nonsense_Mutation	SNP	ENST00000373647.4	37	c.2782A>T	CCDS6848.2	.	.	.	.	.	.	.	.	.	.	A	40	8.040818	0.98624	.	.	ENSG00000011454	ENST00000373647;ENST00000373643	.	.	.	5.22	5.22	0.72569	.	0.108853	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.1277	15.2676	0.73675	1.0:0.0:0.0:0.0	.	.	.	.	X	928;267	.	ENSP00000362747:K267X	K	+	1	0	RABGAP1	124900863	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.158000	0.89649	2.193000	0.70182	0.533000	0.62120	AAA		0.398	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197		10	30	0	0	0	0	10	30				
ZNF79	7633	broad.mit.edu	37	9	130206706	130206706	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:130206706C>T	ENST00000342483.5	+	5	1133	c.727C>T	c.(727-729)Cac>Tac	p.H243Y	ZNF79_ENST00000543471.1_Missense_Mutation_p.H219Y	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						CCAGAGGATTCACACTGGAGA	0.537																																						uc004bqw.3		NA																	0				central_nervous_system(1)	1						c.(727-729)CAC>TAC		zinc finger protein 79							83.0	80.0	81.0					9																	130206706		2203	4300	6503	SO:0001583	missense	7633				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr9:130206706C>T	X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.727C>T	9.37:g.130206706C>T	ENSP00000362446:p.His243Tyr		Somatic				ZNF79_uc011maf.1_Missense_Mutation_p.H219Y|ZNF79_uc011mag.1_Missense_Mutation_p.H219Y	p.H243Y	NM_007135	NP_009066	WXS	Illumina HiSeq	Unspecified	Q15937	ZNF79_HUMAN			5	1141	+			243			C2H2-type 2.		Q5VVW1|Q96NV1	Missense_Mutation	SNP	ENST00000342483.5	37	c.727C>T	CCDS6871.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986623	0.74589	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	D;D	0.88896	-2.44;-2.44	3.83	3.83	0.44106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95784	0.8628	H	0.95365	3.66	0.46203	D	0.998929	D	0.76494	0.999	D	0.87578	0.998	D	0.96744	0.9549	9	0.87932	D	0	.	13.286	0.60243	0.0:1.0:0.0:0.0	.	243	Q15937	ZNF79_HUMAN	Y	243;219	ENSP00000362446:H243Y;ENSP00000438418:H219Y	ENSP00000362446:H243Y	H	+	1	0	ZNF79	129246527	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.843000	0.75384	1.973000	0.57446	0.655000	0.94253	CAC		0.537	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1	NM_007135		15	59	0	0	0	0	15	59				
SLC27A4	10999	broad.mit.edu	37	9	131115719	131115719	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:131115719G>A	ENST00000300456.4	+	9	1340	c.1223G>A	c.(1222-1224)cGc>cAc	p.R408H	SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	408					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						TTCAATAGCCGCATCCTGTCC	0.617																																					Pancreas(107;1554 2241 10946 12953)	uc004but.2		NA																	0					0						c.(1222-1224)CGC>CAC		solute carrier family 27 (fatty acid							95.0	86.0	89.0					9																	131115719		2203	4300	6503	SO:0001583	missense	10999				long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding	g.chr9:131115719G>A	AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.1223G>A	9.37:g.131115719G>A	ENSP00000300456:p.Arg408His		Somatic				SLC27A4_uc004buu.2_Intron	p.R408H	NM_005094	NP_005085	WXS	Illumina HiSeq	Unspecified	Q6P1M0	S27A4_HUMAN			9	1507	+			408					A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	ENST00000300456.4	37	c.1223G>A	CCDS6899.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475108	0.84640	.	.	ENSG00000167114	ENST00000300456	T	0.49432	0.78	5.9	5.9	0.94986	AMP-dependent synthetase/ligase (1);	0.054604	0.85682	D	0.000000	T	0.51958	0.1705	M	0.86028	2.79	0.80722	D	1	P	0.40553	0.721	B	0.34652	0.187	T	0.55872	-0.8072	10	0.15499	T	0.54	-23.5392	19.2671	0.93993	0.0:0.0:1.0:0.0	.	408	Q6P1M0	S27A4_HUMAN	H	408	ENSP00000300456:R408H	ENSP00000300456:R408H	R	+	2	0	SLC27A4	130155540	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.483000	0.60264	2.788000	0.95919	0.650000	0.86243	CGC		0.617	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054432.2			4	91	0	0	0	0	4	91				
RALGDS	5900	broad.mit.edu	37	9	135984211	135984211	+	Silent	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr9:135984211C>T	ENST00000372050.3	-	5	648	c.627G>A	c.(625-627)tcG>tcA	p.S209S	RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000393157.3_Silent_p.S208S|RALGDS_ENST00000372062.3_Silent_p.S180S|RALGDS_ENST00000393160.3_Silent_p.S154S|RALGDS_ENST00000372047.3_Silent_p.S197S|RALGDS_ENST00000542690.1_Silent_p.S280S	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	209	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		AGAAATCCTCCGAGTACTGGT	0.647			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)	uc004cco.2		NA		Dom	yes		9	9q34.3	5900	T	ral guanine nucleotide dissociation stimulator			L	CIITA		PMBL|Hodgkin Lymphona|		0				large_intestine(1)|lung(1)|ovary(1)	3						c.(625-627)TCG>TCA		ral guanine nucleotide dissociation stimulator							74.0	63.0	67.0					9																	135984211		2203	4299	6502	SO:0001819	synonymous_variant	5900				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity	g.chr9:135984211C>T	AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.627G>A	9.37:g.135984211C>T			Somatic				RALGDS_uc004ccp.2_RNA|RALGDS_uc004ccq.2_Silent_p.S197S|RALGDS_uc004ccr.2_Silent_p.S208S|RALGDS_uc011mcv.1_Silent_p.S180S|RALGDS_uc004ccs.2_Silent_p.S154S|RALGDS_uc011mcw.1_Silent_p.S280S|RALGDS_uc004ccv.1_5'UTR|RALGDS_uc004ccu.1_5'UTR	p.S209S	NM_006266	NP_006257	WXS	Illumina HiSeq	Unspecified	Q12967	GNDS_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)	5	647	-			209			N-terminal Ras-GEF.		B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Silent	SNP	ENST00000372050.3	37	c.627G>A	CCDS6959.1																																																																																				0.647	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1	NM_006266		5	33	0	0	0	0	5	33				
MXRA5	25878	broad.mit.edu	37	X	3241681	3241681	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:3241681C>T	ENST00000217939.6	-	5	2199	c.2045G>A	c.(2044-2046)cGc>cAc	p.R682H		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	682						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGCACCTGGGCGTCTGCCTCT	0.532																																						uc004crg.3		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(2044-2046)CGC>CAC		adlican precursor							78.0	73.0	74.0					X																	3241681		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3241681C>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2045G>A	X.37:g.3241681C>T	ENSP00000217939:p.Arg682His		Somatic					p.R682H	NM_015419	NP_056234	WXS	Illumina HiSeq	Unspecified	Q9NR99	MXRA5_HUMAN			5	2202	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	682					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.2045G>A	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	c	4.025	0.002194	0.07819	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.65549	-0.16	3.48	0.632	0.17705	.	0.561089	0.14863	N	0.293997	T	0.34919	0.0914	N	0.08118	0	0.20975	N	0.999819	B	0.19331	0.035	B	0.10450	0.005	T	0.16188	-1.0411	10	0.24483	T	0.36	.	6.6189	0.22792	0.0:0.5558:0.0:0.4442	.	682	Q9NR99	MXRA5_HUMAN	H	682	ENSP00000217939:R682H	ENSP00000217939:R682H	R	-	2	0	MXRA5	3251681	0.875000	0.30112	0.004000	0.12327	0.007000	0.05969	-0.070000	0.11523	-0.013000	0.14199	0.529000	0.55759	CGC		0.532	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		27	71	0	0	0	0	27	71				
KAL1	3730	broad.mit.edu	37	X	8522000	8522000	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:8522000C>G	ENST00000262648.3	-	9	1496	c.1347G>C	c.(1345-1347)aaG>aaC	p.K449N		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	449	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						TACCTTCTGTCTTCTTCCAGT	0.413																																						uc004csf.2		NA																	0				ovary(3)|pancreas(1)	4						c.(1345-1347)AAG>AAC		Kallmann syndrome 1 protein precursor							116.0	100.0	105.0					X																	8522000		2203	4300	6503	SO:0001583	missense	3730				axon guidance|cell adhesion|cellular component movement	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|serine-type endopeptidase inhibitor activity	g.chrX:8522000C>G		CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.1347G>C	X.37:g.8522000C>G	ENSP00000262648:p.Lys449Asn		Somatic					p.K449N	NM_000216	NP_000207	WXS	Illumina HiSeq	Unspecified	P23352	KALM_HUMAN			9	1497	-			449			Fibronectin type-III 3.		B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	37	c.1347G>C	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	C	2.815	-0.246032	0.05906	.	.	ENSG00000011201	ENST00000262648	T	0.54279	0.58	4.2	3.32	0.38043	Fibronectin, type III (2);	0.107611	0.64402	D	0.000007	T	0.53417	0.1795	M	0.73598	2.24	0.30534	N	0.767128	B	0.25563	0.129	B	0.30495	0.116	T	0.52503	-0.8567	10	0.32370	T	0.25	-16.6521	12.2796	0.54757	0.0:0.8998:0.0:0.1002	.	449	P23352	KALM_HUMAN	N	449	ENSP00000262648:K449N	ENSP00000262648:K449N	K	-	3	2	KAL1	8482000	1.000000	0.71417	0.234000	0.24042	0.023000	0.10783	1.188000	0.32102	0.149000	0.19098	-1.195000	0.01675	AAG		0.413	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216		5	21	0	0	0	0	5	21				
DMD	1756	broad.mit.edu	37	X	31986549	31986549	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:31986549G>C	ENST00000357033.4	-	45	6727	c.6521C>G	c.(6520-6522)tCa>tGa	p.S2174*	DMD_ENST00000541735.1_5'UTR|DMD_ENST00000343523.2_5'UTR|DMD_ENST00000378677.2_Nonsense_Mutation_p.S2170*|DMD_ENST00000359836.1_5'UTR|DMD_ENST00000474231.1_5'UTR|DMD_ENST00000378707.3_5'UTR	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2174					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATCTGTTTTTGAGGATTGCTG	0.458																																						uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(6520-6522)TCA>TGA		dystrophin Dp427m isoform							109.0	97.0	101.0					X																	31986549		2202	4300	6502	SO:0001587	stop_gained	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:31986549G>C	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6521C>G	X.37:g.31986549G>C	ENSP00000354923:p.Ser2174*		Somatic				DMD_uc004dcr.1_5'UTR|DMD_uc004dcs.1_5'UTR|DMD_uc004dct.1_5'UTR|DMD_uc004dcu.1_5'UTR|DMD_uc004dcv.1_5'UTR|DMD_uc004dcw.2_Nonsense_Mutation_p.S830*|DMD_uc004dcx.2_Nonsense_Mutation_p.S833*|DMD_uc004dcz.2_Nonsense_Mutation_p.S2051*|DMD_uc004dcy.1_Nonsense_Mutation_p.S2170*|DMD_uc004ddb.1_Nonsense_Mutation_p.S2166*|DMD_uc010ngo.1_Nonsense_Mutation_p.S83*|DMD_uc010ngn.1_Intron	p.S2174*	NM_004006	NP_003997	WXS	Illumina HiSeq	Unspecified	P11532	DMD_HUMAN			45	6765	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	2174			Spectrin 15.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	c.6521C>G	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	49	15.110781	0.99822	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.37	5.37	0.77165	.	0.000000	0.30356	U	0.009817	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.2351	0.89947	0.0:0.0:1.0:0.0	.	.	.	.	X	2166;833;830;2170;2174;2174;2051	.	ENSP00000354923:S2174X	S	-	2	0	DMD	31896470	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.453000	0.66645	2.244000	0.73946	0.538000	0.68166	TCA		0.458	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		23	72	0	0	0	0	23	72				
CFP	5199	broad.mit.edu	37	X	47486681	47486681	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:47486681A>G	ENST00000396992.3	-	5	745	c.625T>C	c.(625-627)Tgc>Cgc	p.C209R	CFP_ENST00000480317.1_5'Flank|CFP_ENST00000377005.2_Missense_Mutation_p.C209R|CFP_ENST00000247153.3_Missense_Mutation_p.C209R	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	209	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						CCACCGTGGCAGGAGGCTGAG	0.667																																						uc004dig.3		NA																	0				breast(2)|lung(1)	3						c.(625-627)TGC>CGC		complement factor properdin precursor							31.0	37.0	35.0					X																	47486681		2202	4299	6501	SO:0001583	missense	5199				complement activation, alternative pathway|defense response to bacterium	extracellular space		g.chrX:47486681A>G	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.625T>C	X.37:g.47486681A>G	ENSP00000380189:p.Cys209Arg		Somatic				CFP_uc004dih.2_Missense_Mutation_p.C209R|CFP_uc004dii.1_Missense_Mutation_p.C145R|CFP_uc010nhu.2_Missense_Mutation_p.C209R	p.C209R	NM_001145252	NP_001138724	WXS	Illumina HiSeq	Unspecified	P27918	PROP_HUMAN			5	751	-			209			TSP type-1 3.		O15134|O15135|O15136|O75826	Missense_Mutation	SNP	ENST00000396992.3	37	c.625T>C	CCDS14282.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770783	0.49680	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005;ENST00000469388	D;D;D;D	0.96491	-4.03;-4.03;-4.03;-4.03	5.09	5.09	0.68999	.	0.241866	0.44285	D	0.000461	D	0.98874	0.9619	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.992;0.999	D	0.98688	1.0695	10	0.66056	D	0.02	.	10.4497	0.44516	1.0:0.0:0.0:0.0	.	145;209	B3KVK6;P27918	.;PROP_HUMAN	R	209;209;209;74	ENSP00000380189:C209R;ENSP00000247153:C209R;ENSP00000366204:C209R;ENSP00000418258:C74R	ENSP00000247153:C209R	C	-	1	0	CFP	47371625	1.000000	0.71417	0.910000	0.35882	0.402000	0.30811	4.837000	0.62796	1.806000	0.52798	0.483000	0.47432	TGC		0.667	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621		3	14	0	0	0	0	3	14				
ZNF630	57232	broad.mit.edu	37	X	47918145	47918145	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:47918145C>G	ENST00000409324.3	-	5	1912	c.1686G>C	c.(1684-1686)caG>caC	p.Q562H	ZNF630_ENST00000276054.4_Missense_Mutation_p.Q438H|ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Missense_Mutation_p.Q548H	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	562					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						TATGACCTCTCTGATGTAGAA	0.448																																						uc004div.3		NA																	0				ovary(1)|lung(1)	2						c.(1684-1686)CAG>CAC		zinc finger protein 630							55.0	48.0	50.0					X																	47918145		2192	4287	6479	SO:0001583	missense	57232				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chrX:47918145C>G	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1686G>C	X.37:g.47918145C>G	ENSP00000386393:p.Gln562His		Somatic				ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Missense_Mutation_p.Q438H	p.Q562H	NM_001037735	NP_001032824	WXS	Illumina HiSeq	Unspecified	Q2M218	ZN630_HUMAN			5	1938	-			562			C2H2-type 11.		F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	c.1686G>C	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	13.51	2.259266	0.39995	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.07567	3.18;3.18;3.18	2.31	2.31	0.28768	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18215	0.0437	L	0.49699	1.58	0.26163	N	0.979972	D	0.65815	0.995	P	0.61328	0.887	T	0.03840	-1.0999	9	0.59425	D	0.04	.	9.8164	0.40856	0.0:1.0:0.0:0.0	.	562	Q2M218	ZN630_HUMAN	H	548;438;562	ENSP00000393163:Q548H;ENSP00000354683:Q438H;ENSP00000386393:Q562H	ENSP00000354683:Q438H	Q	-	3	2	ZNF630	47803089	0.000000	0.05858	0.993000	0.49108	0.813000	0.45954	-0.211000	0.09332	1.179000	0.42884	0.544000	0.68410	CAG		0.448	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735		10	11	0	0	0	0	10	11				
WAS	7454	broad.mit.edu	37	X	48542320	48542320	+	Silent	SNP	C	C	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:48542320C>G	ENST00000376701.4	+	1	153	c.78C>G	c.(76-78)ctC>ctG	p.L26L	WAS_ENST00000483750.1_3'UTR	NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	26					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				CCTCCACCCTCCTCCAGGACC	0.617			"""Mis, N, F, S"""			lymphoma																																uc004dkm.3		NA		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Mis|N|F|S	Wiskott-Aldrich syndrome			L		lymphoma			0				ovary(1)	1						c.(76-78)CTC>CTG		Wiskott-Aldrich syndrome protein							113.0	88.0	96.0					X																	48542320		2203	4300	6503	SO:0001819	synonymous_variant	7454	Wiskott-Aldrich_syndrome			blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity	g.chrX:48542320C>G	AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.78C>G	X.37:g.48542320C>G			Somatic					p.L26L	NM_000377	NP_000368	WXS	Illumina HiSeq	Unspecified	P42768	WASP_HUMAN			1	135	+		all_lung(315;1.27e-10)	26					Q9BU11|Q9UNJ9	Silent	SNP	ENST00000376701.4	37	c.78C>G	CCDS14303.1																																																																																				0.617	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377		16	50	0	0	0	0	16	50				
BRWD3	254065	broad.mit.edu	37	X	79980467	79980467	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:79980467C>T	ENST00000373275.4	-	15	1702	c.1486G>A	c.(1486-1488)Gac>Aac	p.D496N	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	496					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GTCCCCCGGTCAAGGTCCCAA	0.388																																						uc004edt.2		NA																	0				ovary(4)	4						c.(1486-1488)GAC>AAC		bromodomain and WD repeat domain containing 3							99.0	86.0	91.0					X																	79980467		2203	4300	6503	SO:0001583	missense	254065							g.chrX:79980467C>T		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1486G>A	X.37:g.79980467C>T	ENSP00000362372:p.Asp496Asn		Somatic				BRWD3_uc004edo.2_Missense_Mutation_p.D92N|BRWD3_uc004edp.2_Missense_Mutation_p.D325N|BRWD3_uc004edq.2_Missense_Mutation_p.D92N|BRWD3_uc010nmj.1_Missense_Mutation_p.D92N|BRWD3_uc004edr.2_Missense_Mutation_p.D166N|BRWD3_uc004eds.2_Missense_Mutation_p.D92N|BRWD3_uc004edu.2_Missense_Mutation_p.D166N|BRWD3_uc004edv.2_Missense_Mutation_p.D92N|BRWD3_uc004edw.2_Missense_Mutation_p.D92N|BRWD3_uc004edx.2_Missense_Mutation_p.D92N|BRWD3_uc004edy.2_Missense_Mutation_p.D92N|BRWD3_uc004edz.2_Missense_Mutation_p.D166N|BRWD3_uc004eea.2_Missense_Mutation_p.D166N|BRWD3_uc004eeb.2_Missense_Mutation_p.D92N	p.D496N	NM_153252	NP_694984	WXS	Illumina HiSeq	Unspecified	Q6RI45	BRWD3_HUMAN			15	1749	-			496			WD 8.		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	c.1486G>A	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.874287	0.33069	.	.	ENSG00000165288	ENST00000373275	T	0.42513	0.97	5.25	5.25	0.73442	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.159177	0.56097	D	0.000024	T	0.29355	0.0731	N	0.17248	0.465	0.34480	D	0.703798	B	0.10296	0.003	B	0.09377	0.004	T	0.24476	-1.0159	9	.	.	.	-11.0384	17.9334	0.89005	0.0:1.0:0.0:0.0	.	496	Q6RI45	BRWD3_HUMAN	N	496	ENSP00000362372:D496N	.	D	-	1	0	BRWD3	79867123	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.042000	0.41222	2.425000	0.82216	0.600000	0.82982	GAC		0.388	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		8	14	0	0	0	0	8	14				
ZNF711	7552	broad.mit.edu	37	X	84525039	84525039	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:84525039G>C	ENST00000373165.3	+	8	1301	c.995G>C	c.(994-996)aGa>aCa	p.R332T	ZNF711_ENST00000276123.3_Missense_Mutation_p.R332T|ZNF711_ENST00000542798.1_Missense_Mutation_p.R174T|ZNF711_ENST00000395402.1_Missense_Mutation_p.R340T|ZNF711_ENST00000360700.4_Missense_Mutation_p.R378T	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	332					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TTAGAAAGCAGAAGTAGTACA	0.333																																						uc004eeo.2		NA																	0				ovary(3)|skin(1)	4						c.(994-996)AGA>ACA		zinc finger protein 711							93.0	88.0	90.0					X																	84525039		2203	4300	6503	SO:0001583	missense	7552				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding	g.chrX:84525039G>C	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.995G>C	X.37:g.84525039G>C	ENSP00000362260:p.Arg332Thr		Somatic				ZNF711_uc004eep.2_Missense_Mutation_p.R332T|ZNF711_uc004eeq.2_Missense_Mutation_p.R378T|ZNF711_uc011mqy.1_5'UTR	p.R332T	NM_021998	NP_068838	WXS	Illumina HiSeq	Unspecified	Q9Y462	ZN711_HUMAN			8	1342	+			332					B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	c.995G>C	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090755	0.36855	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	4.73	3.72	0.42706	Transcriptional activator, Zfx / Zfy domain (1);	0.161017	0.28834	U	0.013996	T	0.31358	0.0794	L	0.38175	1.15	0.35146	D	0.769331	B;B	0.31413	0.0;0.322	B;B	0.28139	0.002;0.086	T	0.46610	-0.9179	10	0.72032	D	0.01	-12.9971	3.0814	0.06264	0.5349:0.0:0.4651:0.0	.	378;332	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	T	340;332;332;378;174	ENSP00000378798:R340T;ENSP00000362260:R332T;ENSP00000276123:R332T;ENSP00000353922:R378T;ENSP00000442071:R174T	ENSP00000276123:R332T	R	+	2	0	ZNF711	84411695	1.000000	0.71417	0.998000	0.56505	0.857000	0.48899	5.147000	0.64851	1.924000	0.55735	0.556000	0.70494	AGA		0.333	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		8	30	0	0	0	0	8	30				
ZNF449	203523	broad.mit.edu	37	X	134494925	134494925	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:134494925C>T	ENST00000339249.4	+	5	1621	c.1481C>T	c.(1480-1482)aCt>aTt	p.T494I		NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	494					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TACAAGTGTACTCATTGTTCT	0.393																																						uc004eys.2		NA																	0				ovary(2)	2						c.(1480-1482)ACT>ATT		zinc finger protein 449							148.0	146.0	147.0					X																	134494925		2203	4299	6502	SO:0001583	missense	203523				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:134494925C>T	AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.1481C>T	X.37:g.134494925C>T	ENSP00000339585:p.Thr494Ile		Somatic				ZNF449_uc004eyt.2_Missense_Mutation_p.T374I|ZNF449_uc004eyu.2_Missense_Mutation_p.T300I	p.T494I	NM_152695	NP_689908	WXS	Illumina HiSeq	Unspecified	Q6P9G9	ZN449_HUMAN			5	1646	+	Acute lymphoblastic leukemia(192;6.56e-05)		494			C2H2-type 7.		Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Missense_Mutation	SNP	ENST00000339249.4	37	c.1481C>T	CCDS14649.1	.	.	.	.	.	.	.	.	.	.	C	9.963	1.223338	0.22457	.	.	ENSG00000173275	ENST00000339249	T	0.18338	2.22	4.55	2.7	0.31948	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.264596	0.27000	N	0.021439	T	0.12902	0.0313	L	0.35487	1.065	0.80722	D	1	B	0.33044	0.395	B	0.35813	0.211	T	0.07849	-1.0751	10	0.87932	D	0	.	6.236	0.20764	0.1108:0.4252:0.464:0.0	.	494	Q6P9G9	ZN449_HUMAN	I	494	ENSP00000339585:T494I	ENSP00000339585:T494I	T	+	2	0	ZNF449	134322591	0.000000	0.05858	0.996000	0.52242	0.979000	0.70002	-0.322000	0.08007	0.457000	0.26962	0.529000	0.55759	ACT		0.393	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058411.1	NM_152695		92	135	0	0	0	0	92	135				
GPR112	139378	broad.mit.edu	37	X	135431707	135431707	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:135431707A>T	ENST00000394143.1	+	6	6133	c.5842A>T	c.(5842-5844)Aac>Tac	p.N1948Y	GPR112_ENST00000394141.1_Missense_Mutation_p.N1743Y|GPR112_ENST00000412101.1_Missense_Mutation_p.N1743Y|GPR112_ENST00000370652.1_Missense_Mutation_p.N1948Y|GPR112_ENST00000287534.4_Missense_Mutation_p.N1885Y	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1948					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AATTCTTCCTAACCATGGGCT	0.418																																						uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(5842-5844)AAC>TAC		G-protein coupled receptor 112							118.0	111.0	113.0					X																	135431707		2203	4299	6502	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135431707A>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5842A>T	X.37:g.135431707A>T	ENSP00000377699:p.Asn1948Tyr		Somatic				GPR112_uc010nsb.1_Missense_Mutation_p.N1743Y|GPR112_uc010nsc.1_Missense_Mutation_p.N1715Y	p.N1948Y	NM_153834	NP_722576	WXS	Illumina HiSeq	Unspecified	Q8IZF6	GP112_HUMAN			6	6133	+	Acute lymphoblastic leukemia(192;0.000127)		1948			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.5842A>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	2.435	-0.329841	0.05314	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.29655	1.59;1.59;1.56;1.7;1.56	3.94	1.28	0.21552	.	.	.	.	.	T	0.13329	0.0323	N	0.08118	0	0.09310	N	1	B;B;B	0.31351	0.32;0.115;0.029	B;B;B	0.28385	0.089;0.055;0.001	T	0.25882	-1.0119	9	0.27082	T	0.32	.	6.3649	0.21449	0.5989:0.0:0.0:0.4011	.	1885;1743;1948	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	Y	1948;1948;1743;1885;1743	ENSP00000377699:N1948Y;ENSP00000359686:N1948Y;ENSP00000416526:N1743Y;ENSP00000287534:N1885Y;ENSP00000377697:N1743Y	ENSP00000287534:N1885Y	N	+	1	0	GPR112	135259373	0.009000	0.17119	0.036000	0.18154	0.122000	0.20287	1.067000	0.30616	-0.028000	0.13850	-0.583000	0.04132	AAC		0.418	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			6	147	0	0	0	0	6	147				
MAGEC1	9947	broad.mit.edu	37	X	140995473	140995473	+	Silent	SNP	G	G	A			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chrX:140995473G>A	ENST00000285879.4	+	4	2569	c.2283G>A	c.(2281-2283)gaG>gaA	p.E761E	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	761										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GTTTCCCTGAGAGTCCTCAGA	0.542										HNSCC(15;0.026)																												uc004fbt.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(2281-2283)GAG>GAA		melanoma antigen family C, 1							129.0	142.0	137.0					X																	140995473		2203	4300	6503	SO:0001819	synonymous_variant	9947						protein binding	g.chrX:140995473G>A	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2283G>A	X.37:g.140995473G>A		HNSCC(15;0.026)	Somatic				MAGEC1_uc010nsl.1_Intron	p.E761E	NM_005462	NP_005453	WXS	Illumina HiSeq	Unspecified	O60732	MAGC1_HUMAN			4	2569	+	Acute lymphoblastic leukemia(192;6.56e-05)		761					A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	c.2283G>A	CCDS35417.1																																																																																				0.542	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462		82	238	0	0	0	0	82	238				
CDK4	1019	broad.mit.edu	37	12	58145367	58145369	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:58145367_58145369delCCT	ENST00000257904.6	-	2	497_499	c.132_134delAGG	c.(130-135)ggaggt>ggt	p.44_45GG>G	CDK4_ENST00000540325.1_5'UTR|CDK4_ENST00000549606.1_Intron|CDK4_ENST00000551888.1_5'UTR|CDK4_ENST00000312990.6_In_Frame_Del_p.44_45GG>G	NM_000075.3	NP_000066.1	P11802	CDK4_HUMAN	cyclin-dependent kinase 4	44	Poly-Gly.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|circadian rhythm (GO:0007623)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell cycle arrest (GO:0071157)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell size (GO:0045793)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of translation (GO:0045727)|protein phosphorylation (GO:0006468)|regulation of gene expression (GO:0010468)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to lead ion (GO:0010288)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	21	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			GCCTCCTCCACCTCCTCCTCCAT	0.567			Mis			melanoma			Hereditary Melanoma																													uc001spv.2		NA	yes	Dom		Familial malignant melanoma	12	12q14	1019	Mis	cyclin-dependent kinase 4			E		melanoma 			0				lung(1)|breast(1)|central_nervous_system(1)	3						c.(130-135)GGAGGT>GGT		cyclin-dependent kinase 4																																				SO:0001651	inframe_deletion	1019	Hereditary_Melanoma	Familial Cancer Database	Familial Atypical Multiple Mole Melanoma sydrome, FAMMM, Familial Dysplastic Nevus syndrome	cell division|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|positive regulation of fibroblast proliferation|regulation of gene expression|response to drug|S phase of mitotic cell cycle	cyclin-dependent protein kinase holoenzyme complex|cytosol|membrane	ATP binding|cyclin-dependent protein kinase activity|protein binding	g.chr12:58145367_58145369delCCT	M14505	CCDS8953.1	12q13	2014-09-17				ENSG00000135446		"""Cyclin-dependent kinases"""	1773	protein-coding gene	gene with protein product		123829				8275715	Standard	NM_000075		Approved	PSK-J3	uc001spv.3	P11802		ENST00000257904.6:c.132_134delAGG	12.37:g.58145373_58145375delCCT	ENSP00000257904:p.Gly48del		Somatic				CDK4_uc010ssb.1_5'UTR|CDK4_uc001spw.2_RNA|uc010ssc.1_5'Flank	p.44_45GG>G	NM_000075	NP_000066	WXS	Illumina HiSeq	Unspecified	P11802	CDK4_HUMAN	GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		2	359_361	-	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		44_45			Poly-Gly.|Protein kinase.		B2R9A0|B4DNF9|O00576|Q6FG61	In_Frame_Del	DEL	ENST00000257904.6	37	c.132_134delAGG	CCDS8953.1																																																																																				0.567	CDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408790.2	NM_000075		20	68	NA	NA	NA	NA	20	68	---	---	---	---
MLEC	9761	broad.mit.edu	37	12	121134166	121134168	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr12:121134166_121134168delGAA	ENST00000228506.3	+	5	1125_1127	c.697_699delGAA	c.(697-699)gaadel	p.E238del	MLEC_ENST00000412616.2_In_Frame_Del_p.K159del|RP11-173P15.3_ENST00000541383.1_RNA|RP11-173P15.3_ENST00000535720.1_RNA	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	238	Poly-Glu.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)	p.E233E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						gaaagaagaggaagaagaagaag	0.458																																						uc001tyy.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(1)	1						c.(697-699)GAAdel		malectin precursor				4,33,4227		0,0,4,8,17,2103						1.0	1.0			129	1,29,8224		0,0,1,6,17,4103	no	codingComplex	MLEC	NM_014730.2		0,0,5,14,34,6206	A1A1,A1A2,A1R,A2A2,A2R,RR		0.3635,0.8677,0.5352				5,62,12451				SO:0001651	inframe_deletion	9761				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding	g.chr12:121134166_121134168delGAA	BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.697_699delGAA	12.37:g.121134175_121134177delGAA	ENSP00000228506:p.Glu238del		Somatic					p.E238del	NM_014730	NP_055545	WXS	Illumina HiSeq	Unspecified	Q14165	MLEC_HUMAN			5	848_850	+			238			Poly-Glu.|Lumenal (Potential).			In_Frame_Del	DEL	ENST00000228506.3	37	c.697_699delGAA	CCDS9206.1																																																																																				0.458	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	NM_014730		7	200	NA	NA	NA	NA	7	200	---	---	---	---
MAP1A	4130	broad.mit.edu	37	15	43820775	43820775	+	Frame_Shift_Del	DEL	C	C	-	rs561219457		TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr15:43820775delC	ENST00000300231.5	+	4	7554	c.7104delC	c.(7102-7104)aacfs	p.N2368fs	MAP1A_ENST00000382031.1_Frame_Shift_Del_p.N2606fs|MAP1A_ENST00000399453.1_Frame_Shift_Del_p.N2368fs			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2368					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CCAGCCCTAACCCCCCAGGCC	0.642																																						uc001zrt.2		NA																	0				ovary(3)|breast(3)|pancreas(2)|skin(1)	9						c.(7102-7104)AACfs		microtubule-associated protein 1A	Estramustine(DB01196)						27.0	31.0	30.0					15																	43820775		1963	4133	6096	SO:0001589	frameshift_variant	4130					cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity	g.chr15:43820775delC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7104delC	15.37:g.43820775delC	ENSP00000300231:p.Asn2368fs		Somatic					p.N2368fs	NM_002373	NP_002364	WXS	Illumina HiSeq	Unspecified	P78559	MAP1A_HUMAN		GBM - Glioblastoma multiforme(94;3.05e-06)	4	7571	+		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)	2368					O95643|Q12973|Q15882|Q9UJT4	Frame_Shift_Del	DEL	ENST00000300231.5	37	c.7104delC	CCDS42031.1																																																																																				0.642	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373		12	38	NA	NA	NA	NA	12	38	---	---	---	---
TRIM65	201292	broad.mit.edu	37	17	73888194	73888194	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr17:73888194delG	ENST00000269383.3	-	4	882	c.817delC	c.(817-819)ctgfs	p.L273fs		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	273						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGTCACCCAGCTGTTGGTCT	0.632																																						uc002jpx.2		NA																	0					0						c.(817-819)CTGfs		tripartite motif-containing 65							20.0	21.0	20.0					17																	73888194		2173	4260	6433	SO:0001589	frameshift_variant	201292					intracellular	zinc ion binding	g.chr17:73888194delG	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.817delC	17.37:g.73888194delG	ENSP00000269383:p.Leu273fs		Somatic					p.L273fs	NM_173547	NP_775818	WXS	Illumina HiSeq	Unspecified	Q6PJ69	TRI65_HUMAN	Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)		4	853	-			273					Q4G0F0|Q6DKJ6|Q9BRP6	Frame_Shift_Del	DEL	ENST00000269383.3	37	c.817delC	CCDS11732.1																																																																																				0.632	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547		2	4	NA	NA	NA	NA	2	4	---	---	---	---
ROCK2	9475	broad.mit.edu	37	2	11389837	11389837	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:11389837delA	ENST00000315872.6	-	4	860	c.412delT	c.(412-414)tggfs	p.W138fs	ROCK2_ENST00000462366.1_5'UTR	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	138	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CTTTCTTCCCAAAAAAAGGCA	0.358																																						uc002rbd.1		NA																	0		p.W138fs*31(1)		stomach(2)|skin(2)	4						c.(412-414)TGGfs		Rho-associated, coiled-coil containing protein							128.0	123.0	125.0					2																	11389837		1859	4116	5975	SO:0001589	frameshift_variant	9475				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity	g.chr2:11389837delA	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.412delT	2.37:g.11389837delA	ENSP00000317985:p.Trp138fs		Somatic					p.W138fs	NM_004850	NP_004841	WXS	Illumina HiSeq	Unspecified	O75116	ROCK2_HUMAN		Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)	4	861	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		138			Protein kinase.		Q53QZ0|Q53SJ7|Q9UQN5	Frame_Shift_Del	DEL	ENST00000315872.6	37	c.412delT	CCDS42654.1																																																																																				0.358	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3			32	118	NA	NA	NA	NA	32	118	---	---	---	---
PMS1	5378	broad.mit.edu	37	2	190660652	190660653	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr2:190660652_190660653insG	ENST00000441310.2	+	3	523_524	c.290_291insG	c.(289-294)ttggggfs	p.LG97fs	PMS1_ENST00000409985.1_Frame_Shift_Ins_p.LG97fs|PMS1_ENST00000432292.3_Intron|PMS1_ENST00000409823.3_Frame_Shift_Ins_p.LG97fs|PMS1_ENST00000447232.2_Frame_Shift_Ins_p.LG97fs|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000374826.4_Frame_Shift_Ins_p.LG97fs	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	97					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			GGAGAAGCCTTGGGGTCAATTT	0.342			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														uc002urh.3		NA	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	Mis|N	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)			E		colorectal|endometrial|ovarian			0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(289-291)TTGfs	Direct_reversal_of_damage|MMR	postmeiotic segregation 1 isoform a																																				SO:0001589	frameshift_variant	5378				mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding	g.chr2:190660652_190660653insG		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.294dupG	2.37:g.190660656_190660656dupG	ENSP00000406490:p.Leu97fs		Somatic				PMS1_uc010zga.1_Frame_Shift_Ins_p.L97fs|PMS1_uc010zgb.1_Intron|PMS1_uc002urk.3_Frame_Shift_Ins_p.L97fs|PMS1_uc002uri.3_Frame_Shift_Ins_p.L97fs|PMS1_uc010zgc.1_5'UTR|PMS1_uc010zgd.1_Intron|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Frame_Shift_Ins_p.L97fs|PMS1_uc010frz.2_Frame_Shift_Ins_p.L97fs|PMS1_uc010zfz.1_Frame_Shift_Ins_p.L97fs	p.L97fs	NM_000534	NP_000525	WXS	Illumina HiSeq	Unspecified	P54277	PMS1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)		3	819_820	+			97					D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Frame_Shift_Ins	INS	ENST00000441310.2	37	c.290_291insG	CCDS2302.1																																																																																				0.342	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2			35	84	NA	NA	NA	NA	35	84	---	---	---	---
PARL	55486	broad.mit.edu	37	3	183551318	183551318	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr3:183551318delA	ENST00000317096.4	-	9	1050	c.990delT	c.(988-990)tttfs	p.F330fs	PARL_ENST00000311101.5_Frame_Shift_Del_p.F280fs|PARL_ENST00000435888.1_Frame_Shift_Del_p.F246fs	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	330					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCGCATGATCAAAAAATTTCC	0.473																																						uc003fmd.2		NA																	0					0						c.(988-990)TTTfs		presenilin associated, rhomboid-like isoform 1							117.0	101.0	106.0					3																	183551318		2203	4300	6503	SO:0001589	frameshift_variant	55486				proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity	g.chr3:183551318delA	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.990delT	3.37:g.183551318delA	ENSP00000325421:p.Phe330fs		Somatic				PARL_uc003fme.2_Frame_Shift_Del_p.F280fs	p.F330fs	NM_018622	NP_061092	WXS	Illumina HiSeq	Unspecified	Q9H300	PARL_HUMAN	all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		9	1049	-	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		330			Mitochondrial matrix (Potential).		Q96CQ4|Q9BTJ6|Q9P1E3	Frame_Shift_Del	DEL	ENST00000317096.4	37	c.990delT	CCDS3248.1																																																																																				0.473	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622		25	59	NA	NA	NA	NA	25	59	---	---	---	---
MYO6	4646	broad.mit.edu	37	6	76599857	76599858	+	Frame_Shift_Ins	INS	-	-	A	rs551348450	byFrequency	TCGA-CV-7095-01A-21D-2012-08	TCGA-CV-7095-10A-01D-2013-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	e4aba107-a048-46e5-b0aa-901f076b6f61	8b5bfd48-6872-43dc-8c75-4c56f159eed4	g.chr6:76599857_76599858insA	ENST00000369977.3	+	26	2881_2882	c.2742_2743insA	c.(2743-2745)aaafs	p.K915fs	MYO6_ENST00000369981.3_Frame_Shift_Ins_p.K915fs|MYO6_ENST00000369985.4_Frame_Shift_Ins_p.K915fs|MYO6_ENST00000369975.1_Frame_Shift_Ins_p.K915fs	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	915					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)	p.K917fs*10(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GTGCATTACAGAAAAAAAAACA	0.381													AAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|insertion	18	0.00359425	0.0083	0.0014	5008	,	,		16538	0.0		0.0	False		,,,				2504	0.0061					uc003pih.1		NA																	1	Deletion - Frameshift(1)		large_intestine(1)	kidney(1)|pancreas(1)	2						c.(2740-2745)CAGAAAfs		myosin VI				9,4255		0,9,2123						5.8	1.0			86	31,8223		0,31,4096	no	frameshift	MYO6	NM_004999.3		0,40,6219	A1A1,A1R,RR		0.3756,0.2111,0.3195				40,12478				SO:0001589	frameshift_variant	4646				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding	g.chr6:76599857_76599858insA	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2751dupA	6.37:g.76599866_76599866dupA	ENSP00000358994:p.Lys915fs		Somatic				MYO6_uc003pig.1_Frame_Shift_Ins_p.Q914fs|MYO6_uc003pii.1_Frame_Shift_Ins_p.Q914fs	p.Q914fs	NM_004999	NP_004990	WXS	Illumina HiSeq	Unspecified	Q9UM54	MYO6_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.223)	26	3021_3022	+		all_hematologic(105;0.189)	914_915			Potential.		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Frame_Shift_Ins	INS	ENST00000369977.3	37	c.2742_2743insA	CCDS34487.1																																																																																				0.381	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999		7	66	NA	NA	NA	NA	7	66	---	---	---	---
