#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CA6	765	broad.mit.edu	37	1	9034714	9034714	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:9034714T>G	ENST00000377443.2	+	8	882	c.878T>G	c.(877-879)cTa>cGa	p.L293R	CA6_ENST00000476083.1_3'UTR|CA6_ENST00000377442.2_Missense_Mutation_p.L233R	NM_001215.3	NP_001206.2	P23280	CAH6_HUMAN	carbonic anhydrase VI	293					bicarbonate transport (GO:0015701)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(5)	16	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	Mafenide(DB06795)|Zonisamide(DB00909)	CAGTTTTACCTACATAAGATT	0.383																																						uc001apm.2		NA																	0				ovary(2)	2						c.(877-879)CTA>CGA		carbonic anhydrase VI precursor							79.0	77.0	78.0					1																	9034714		2202	4300	6502	SO:0001583	missense	765				one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding	g.chr1:9034714T>G	M57892	CCDS30578.1, CCDS57970.1, CCDS57971.1	1p36.2	2008-02-05			ENSG00000131686	ENSG00000131686	4.2.1.1	"""Carbonic anhydrases"""	1380	protein-coding gene	gene with protein product		114780				9691177	Standard	NM_001215		Approved		uc031plc.1	P23280	OTTHUMG00000001763	ENST00000377443.2:c.878T>G	1.37:g.9034714T>G	ENSP00000366662:p.Leu293Arg		Somatic				CA6_uc009vmn.2_Missense_Mutation_p.L233R	p.L293R	NM_001215	NP_001206	WXS	Illumina HiSeq	Unspecified	P23280	CAH6_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	8	902	+	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	293					E7EMQ1|Q5FBW3|Q5FC00|Q96QX8|Q9UF03	Missense_Mutation	SNP	ENST00000377443.2	37	c.878T>G	CCDS30578.1	.	.	.	.	.	.	.	.	.	.	T	12.71	2.019549	0.35606	.	.	ENSG00000131686	ENST00000377443;ENST00000377442	T;T	0.76316	-0.51;-1.01	3.38	-1.79	0.07932	.	.	.	.	.	T	0.61009	0.2313	N	0.08118	0	0.09310	N	1	D;D	0.53619	0.961;0.961	P;P	0.50405	0.64;0.64	T	0.54827	-0.8235	9	0.87932	D	0	.	3.1031	0.06333	0.1927:0.346:0.0:0.4613	.	233;293	E7EMQ1;P23280	.;CAH6_HUMAN	R	293;233	ENSP00000366662:L293R;ENSP00000366661:L233R	ENSP00000366661:L233R	L	+	2	0	CA6	8957301	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.068000	0.14531	-0.384000	0.07845	0.460000	0.39030	CTA		0.383	CA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000004911.1			8	10	0	0	0	0	8	10				
SLC2A5	6518	broad.mit.edu	37	1	9097693	9097693	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:9097693C>T	ENST00000377424.4	-	12	1637	c.1458G>A	c.(1456-1458)ccG>ccA	p.P486P	SLC2A5_ENST00000536305.1_Silent_p.P427P|SLC2A5_ENST00000535586.1_Silent_p.P371P	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	486					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCCTTTTCCGGGTACACTT	0.507																																						uc001apo.2		NA																	0				pancreas(2)|ovary(1)	3						c.(1456-1458)CCG>CCA		solute carrier family 2 (facilitated							138.0	143.0	141.0					1																	9097693		2203	4300	6503	SO:0001819	synonymous_variant	6518				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity	g.chr1:9097693C>T	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1458G>A	1.37:g.9097693C>T			Somatic				SLC2A5_uc010nzy.1_Silent_p.P427P|SLC2A5_uc010nzz.1_Silent_p.P371P|SLC2A5_uc010oaa.1_Silent_p.P442P|SLC2A5_uc010oab.1_Silent_p.P486P	p.P486P	NM_003039	NP_003030	WXS	Illumina HiSeq	Unspecified	P22732	GTR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)	12	1750	-	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	486			Cytoplasmic (Potential).		Q14770|Q5T977|Q8IVB3	Silent	SNP	ENST00000377424.4	37	c.1458G>A	CCDS99.1																																																																																				0.507	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039		49	75	0	0	0	0	49	75				
CLSTN1	22883	broad.mit.edu	37	1	9794124	9794124	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:9794124C>G	ENST00000377298.4	-	15	2979	c.2187G>C	c.(2185-2187)ctG>ctC	p.L729L	CLSTN1_ENST00000477264.1_5'Flank|CLSTN1_ENST00000377288.3_Silent_p.L710L|CLSTN1_ENST00000361311.4_Silent_p.L719L	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	729					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GCTCGTGGTTCAGCTCCTCTC	0.572																																						uc001aqh.2		NA																	0				skin(1)	1						c.(2185-2187)CTG>CTC		calsyntenin 1 isoform 1							129.0	91.0	104.0					1																	9794124		2203	4300	6503	SO:0001819	synonymous_variant	22883				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding	g.chr1:9794124C>G	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.2187G>C	1.37:g.9794124C>G			Somatic				CLSTN1_uc001aqi.2_Silent_p.L719L|CLSTN1_uc010oag.1_Silent_p.L710L|CLSTN1_uc001aqf.2_5'Flank	p.L729L	NM_001009566	NP_001009566	WXS	Illumina HiSeq	Unspecified	O94985	CSTN1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)	15	2946	-	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	729			Extracellular (Potential).		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	37	c.2187G>C	CCDS30580.1																																																																																				0.572	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1			18	30	0	0	0	0	18	30				
CROCC	9696	broad.mit.edu	37	1	17266512	17266512	+	Missense_Mutation	SNP	G	G	A	rs200142599		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:17266512G>A	ENST00000375541.5	+	13	1801	c.1732G>A	c.(1732-1734)Gac>Aac	p.D578N	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGACAAGACCGACGGCGCCAT	0.706													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18974	0.0		0.0	False		,,,				2504	0.0					uc001azt.2		NA																	0				ovary(2)|breast(2)|central_nervous_system(1)	5						c.(1732-1734)GAC>AAC		ciliary rootlet coiled-coil		G	ASN/ASP	3,4401		0,3,2199	25.0	25.0	25.0		1732	4.1	0.0	1		25	0,8580		0,0,4290	no	missense	CROCC	NM_014675.3	23	0,3,6489	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	578/2018	17266512	3,12981	2202	4290	6492	SO:0001583	missense	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17266512G>A	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1732G>A	1.37:g.17266512G>A	ENSP00000364691:p.Asp578Asn		Somatic				CROCC_uc009voy.1_Missense_Mutation_p.D281N|CROCC_uc009voz.1_Missense_Mutation_p.D341N|CROCC_uc001azu.2_5'UTR	p.D578N	NM_014675	NP_055490	WXS	Illumina HiSeq	Unspecified	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	13	1801	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	578			Potential.			Missense_Mutation	SNP	ENST00000375541.5	37	c.1732G>A	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026927	0.35797	6.81E-4	0.0	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.13657	2.57	4.99	4.08	0.47627	.	.	.	.	.	T	0.15955	0.0384	M	0.72894	2.215	0.09310	N	1	P;P;P	0.49253	0.733;0.777;0.921	B;B;B	0.40256	0.213;0.273;0.324	T	0.14090	-1.0485	9	0.15499	T	0.54	.	12.0543	0.53524	0.0868:0.0:0.9132:0.0	.	441;441;578	A1L0S8;A1L0S9;Q5TZA2	.;.;CROCC_HUMAN	N	578;459	ENSP00000364691:D578N	ENSP00000364691:D578N	D	+	1	0	CROCC	17139099	0.274000	0.24191	0.002000	0.10522	0.194000	0.23727	3.137000	0.50562	1.427000	0.47276	0.561000	0.74099	GAC		0.706	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		6	33	0	0	0	0	6	33				
YRDC	79693	broad.mit.edu	37	1	38272639	38272639	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:38272639T>C	ENST00000373044.2	-	3	518	c.514A>G	c.(514-516)Att>Gtt	p.I172V	C1orf122_ENST00000468084.1_5'Flank|C1orf122_ENST00000446260.2_5'Flank|C1orf122_ENST00000373043.1_5'Flank|C1orf122_ENST00000373042.4_5'Flank	NM_024640.3	NP_078916.3	Q86U90	YRDC_HUMAN	yrdC N(6)-threonylcarbamoyltransferase domain containing	172	YrdC-like. {ECO:0000255|PROSITE- ProRule:PRU00518}.				negative regulation of transport (GO:0051051)	membrane (GO:0016020)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)			lung(2)|upper_aerodigestive_tract(1)	3	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGAATCCGAATGCCTACAAGC	0.498																																						uc001cca.1		NA																	0					0						c.(514-516)ATT>GTT		ischemia/reperfusion inducible protein							82.0	73.0	76.0					1																	38272639		2203	4300	6503	SO:0001583	missense	79693				negative regulation of transport	membrane|mitochondrion		g.chr1:38272639T>C		CCDS30675.1	1p34.3	2013-09-12	2013-09-12		ENSG00000196449	ENSG00000196449			28905	protein-coding gene	gene with protein product	"""ischemia/reperfusion inducible protein"""	612276	"""yrdC domain containing (E.coli)"", ""yrdC domain containing (E. coli)"""			12730717	Standard	NM_024640		Approved	FLJ23476, IRIP, SUA5	uc001cca.1	Q86U90	OTTHUMG00000004318	ENST00000373044.2:c.514A>G	1.37:g.38272639T>C	ENSP00000362135:p.Ile172Val		Somatic				C1orf122_uc001ccb.1_5'Flank	p.I172V	NM_024640	NP_078916	WXS	Illumina HiSeq	Unspecified	Q86U90	YRDC_HUMAN			3	527	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	172			YrdC-like.		Q4W4X8|Q6NVW3|Q7L4E4|Q7Z2I4|Q9H5F8	Missense_Mutation	SNP	ENST00000373044.2	37	c.514A>G	CCDS30675.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.330448	0.24167	.	.	ENSG00000196449	ENST00000373044	.	.	.	5.58	2.04	0.26737	DHBP synthase RibB-like alpha/beta domain (2);Sua5/YciO/YrdC, N-terminal (2);Sua5/YciO/YrdC/YwlC (1);	0.220447	0.46442	N	0.000293	T	0.25158	0.0611	N	0.05351	-0.065	0.39533	D	0.968694	B	0.11235	0.004	B	0.20384	0.029	T	0.19976	-1.0289	9	0.05620	T	0.96	.	8.5045	0.33179	0.0:0.4624:0.0:0.5376	.	172	Q86U90	YRDC_HUMAN	V	172	.	ENSP00000362135:I172V	I	-	1	0	YRDC	38045226	0.997000	0.39634	0.999000	0.59377	0.792000	0.44763	2.239000	0.43079	0.095000	0.17434	0.460000	0.39030	ATT		0.498	YRDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012470.1	NM_024640		17	20	0	0	0	0	17	20				
ELOVL1	64834	broad.mit.edu	37	1	43830081	43830081	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:43830081T>C	ENST00000372458.3	-	7	649	c.532A>G	c.(532-534)Atg>Gtg	p.M178V	ELOVL1_ENST00000413844.2_Missense_Mutation_p.M151V|ELOVL1_ENST00000470769.1_5'UTR	NM_001256399.1|NM_001256402.1|NM_022821.3	NP_001243328.1|NP_001243331.1|NP_073732.1	Q9BW60	ELOV1_HUMAN	ELOVL fatty acid elongase 1	178					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|prostate(1)	4	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TACAGGTACATTATGACATGC	0.522																																						uc001ciz.2		NA																	0					0						c.(532-534)ATG>GTG		elongation of very long chain fatty acids-like							195.0	187.0	190.0					1																	43830081		2203	4300	6503	SO:0001583	missense	64834				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|sphingolipid biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	fatty acid elongase activity|protein binding	g.chr1:43830081T>C	AK001653	CCDS485.1, CCDS57987.1	1p34	2011-05-25	2011-05-25		ENSG00000066322	ENSG00000066322			14418	protein-coding gene	gene with protein product		611813	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1"""				Standard	NM_022821		Approved	Ssc1	uc031pmf.1	Q9BW60	OTTHUMG00000007422	ENST00000372458.3:c.532A>G	1.37:g.43830081T>C	ENSP00000361536:p.Met178Val		Somatic				ELOVL1_uc001cja.2_Missense_Mutation_p.M178V|ELOVL1_uc001cjb.2_Missense_Mutation_p.M178V|ELOVL1_uc001cjc.2_RNA|ELOVL1_uc010okh.1_Missense_Mutation_p.M151V	p.M178V	NM_022821	NP_073732	WXS	Illumina HiSeq	Unspecified	Q9BW60	ELOV1_HUMAN			8	775	-	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	178			Helical; (Potential).		B4DP24|Q53HT2|Q5JUY3|Q8WXU3|Q9NVD9|Q9Y396	Missense_Mutation	SNP	ENST00000372458.3	37	c.532A>G	CCDS485.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.904972	0.52333	.	.	ENSG00000066322	ENST00000372458;ENST00000413844	T;T	0.38401	1.14;1.14	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.73953	0.3653	H	0.98525	4.255	0.80722	D	1	D;D	0.65815	0.988;0.995	D;D	0.65323	0.934;0.934	D	0.85146	0.0983	10	0.87932	D	0	-5.1276	15.7054	0.77577	0.0:0.0:0.0:1.0	.	151;178	B4DP24;Q9BW60	.;ELOV1_HUMAN	V	178;151	ENSP00000361536:M178V;ENSP00000416024:M151V	ENSP00000361536:M178V	M	-	1	0	ELOVL1	43602668	1.000000	0.71417	0.996000	0.52242	0.522000	0.34438	5.954000	0.70298	2.116000	0.64780	0.402000	0.26972	ATG		0.522	ELOVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019496.1	NM_022821		66	105	0	0	0	0	66	105				
CYP4A11	1579	broad.mit.edu	37	1	47403778	47403778	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:47403778T>G	ENST00000310638.4	-	2	258	c.227A>C	c.(226-228)cAg>cCg	p.Q76P	CYP4A11_ENST00000371905.1_Missense_Mutation_p.Q76P|CYP4A11_ENST00000457840.2_5'UTR|CYP4A11_ENST00000371904.4_Missense_Mutation_p.Q76P|CYP4A11_ENST00000462347.1_Missense_Mutation_p.Q76P	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	76					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CACCCATTTCTGAATCCGTTG	0.488																																						uc001cqp.3		NA																	0				ovary(2)|skin(2)	4						c.(226-228)CAG>CCG		cytochrome P450, family 4, subfamily A,	NADH(DB00157)						202.0	159.0	174.0					1																	47403778		2203	4300	6503	SO:0001583	missense	1579				long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding	g.chr1:47403778T>G	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.227A>C	1.37:g.47403778T>G	ENSP00000311095:p.Gln76Pro		Somatic				CYP4A11_uc001cqq.2_Missense_Mutation_p.Q76P|CYP4A11_uc010omm.1_RNA	p.Q76P	NM_000778	NP_000769	WXS	Illumina HiSeq	Unspecified	Q02928	CP4AB_HUMAN			2	278	-			76					Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	c.227A>C	CCDS543.1	.	.	.	.	.	.	.	.	.	.	-	7.119	0.577595	0.13686	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.68025	-0.3;-0.3;-0.3	4.79	-4.19	0.03835	.	1.517830	0.04230	N	0.335017	T	0.50394	0.1613	L	0.38953	1.18	0.09310	N	0.999997	B	0.06786	0.001	B	0.16722	0.016	T	0.22836	-1.0205	10	0.30078	T	0.28	.	3.3133	0.07024	0.1731:0.224:0.0724:0.5304	.	76	Q02928	CP4AB_HUMAN	P	76	ENSP00000311095:Q76P;ENSP00000360971:Q76P;ENSP00000360972:Q76P	ENSP00000311095:Q76P	Q	-	2	0	CYP4A11	47176365	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.212000	0.09319	-0.532000	0.06332	-1.755000	0.00674	CAG		0.488	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778		26	53	0	0	0	0	26	53				
ZFYVE9	9372	broad.mit.edu	37	1	52759159	52759159	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:52759159C>T	ENST00000371591.1	+	10	3191	c.3060C>T	c.(3058-3060)ttC>ttT	p.F1020F	ZFYVE9_ENST00000287727.3_Silent_p.F1020F|ZFYVE9_ENST00000357206.2_Silent_p.F961F	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1020					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						ATTCCTTCTTCAGTCAAAGTT	0.353																																						uc001cto.2		NA																	0				ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						c.(3058-3060)TTC>TTT		zinc finger, FYVE domain containing 9 isoform 3							113.0	111.0	112.0					1																	52759159		2203	4300	6503	SO:0001819	synonymous_variant	9372				endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity	g.chr1:52759159C>T	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3060C>T	1.37:g.52759159C>T			Somatic				ZFYVE9_uc001ctp.2_Silent_p.F961F	p.F1020F	NM_004799	NP_004790	WXS	Illumina HiSeq	Unspecified	O95405	ZFYV9_HUMAN			11	3232	+			1020					Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Silent	SNP	ENST00000371591.1	37	c.3060C>T	CCDS563.1																																																																																				0.353	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324		15	25	0	0	0	0	15	25				
COL11A1	1301	broad.mit.edu	37	1	103427750	103427750	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:103427750T>A	ENST00000370096.3	-	40	3408	c.3096A>T	c.(3094-3096)agA>agT	p.R1032S	COL11A1_ENST00000353414.4_Missense_Mutation_p.R993S|COL11A1_ENST00000512756.1_Missense_Mutation_p.R916S|COL11A1_ENST00000358392.2_Missense_Mutation_p.R1044S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1032	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAGGAAGACCTCTTTCCCCTG	0.388																																						uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(3094-3096)AGA>AGT		alpha 1 type XI collagen isoform A							81.0	84.0	83.0					1																	103427750		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103427750T>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3096A>T	1.37:g.103427750T>A	ENSP00000359114:p.Arg1032Ser		Somatic				COL11A1_uc001duk.2_Missense_Mutation_p.R228S|COL11A1_uc001dum.2_Missense_Mutation_p.R1044S|COL11A1_uc001dun.2_Missense_Mutation_p.R993S|COL11A1_uc009weh.2_Missense_Mutation_p.R916S	p.R1032S	NM_001854	NP_001845	WXS	Illumina HiSeq	Unspecified	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	40	3414	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	1032			Triple-helical region.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.3096A>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	17.42	3.383893	0.61845	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	5.48	4.36	0.52297	.	0.110120	0.64402	D	0.000008	D	0.93275	0.7857	L	0.48260	1.515	0.80722	D	1	D;D;D;D;D	0.61080	0.985;0.989;0.989;0.981;0.981	D;D;D;D;D	0.75020	0.977;0.985;0.985;0.966;0.962	D	0.93568	0.6901	10	0.56958	D	0.05	.	10.7753	0.46346	0.0:0.0742:0.0:0.9258	.	916;993;1044;1032;252	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1032;1044;993;252;916	ENSP00000359114:R1032S;ENSP00000351163:R1044S;ENSP00000302551:R993S;ENSP00000426533:R916S	ENSP00000302551:R993S	R	-	3	2	COL11A1	103200338	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.949000	0.56668	2.067000	0.61834	0.455000	0.32223	AGA		0.388	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		26	7	0	0	0	0	26	7				
NBPF10	100132406	broad.mit.edu	37	1	145302676	145302676	+	Missense_Mutation	SNP	G	G	T	rs200242621		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:145302676G>T	ENST00000369339.3	+	5	554	c.301G>T	c.(301-303)Gct>Tct	p.A101S	NBPF10_ENST00000342960.5_Missense_Mutation_p.A372S|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Missense_Mutation_p.A101S			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	372						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCTGGTTCACGCTCAGGAACG	0.483																																						uc001end.3		NA																	0					0						c.(1114-1116)GCT>TCT		hypothetical protein LOC100132406																																				SO:0001583	missense	100132406							g.chr1:145302676G>T	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.301G>T	1.37:g.145302676G>T	ENSP00000358345:p.Ala101Ser		Somatic				NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Missense_Mutation_p.A101S	p.A372S	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	8	1149	+	all_hematologic(923;0.032)		372					Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37	c.1114G>T		.	.	.	.	.	.	.	.	.	.	.	0	-2.658305	0.00108	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.09163	3.01;3.82	0.778	-1.56	0.08532	.	.	.	.	.	T	0.00524	0.0017	N	0.01417	-0.88	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31916	-0.9926	9	0.02654	T	1	.	3.5216	0.07744	0.2134:0.0:0.5413:0.2453	.	101	A8MQ30	.	S	297;101;101;372	ENSP00000358344:A101S;ENSP00000345684:A372S	ENSP00000345684:A372S	A	+	1	0	NBPF10	144014033	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.216000	0.01221	-2.806000	0.00350	-2.574000	0.00170	GCT		0.483	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703		3	36	1	0	0.004672	0.00475577	3	36				
FCRL3	115352	broad.mit.edu	37	1	157666065	157666065	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:157666065C>G	ENST00000368184.3	-	7	1188	c.897G>C	c.(895-897)ctG>ctC	p.L299L	FCRL3_ENST00000368186.5_Silent_p.L299L|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	299	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CTCCTTCAATCAGCTGCCCTC	0.517																																						uc001frb.2		NA																	0				ovary(3)|breast(1)	4						c.(895-897)CTG>CTC		Fc receptor-like 3 precursor							112.0	106.0	108.0					1																	157666065		2203	4300	6503	SO:0001819	synonymous_variant	115352					integral to membrane|plasma membrane	receptor activity	g.chr1:157666065C>G	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.897G>C	1.37:g.157666065C>G			Somatic				FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.L299L|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Silent_p.L25L|FCRL3_uc001frc.1_Silent_p.L299L	p.L299L	NM_052939	NP_443171	WXS	Illumina HiSeq	Unspecified	Q96P31	FCRL3_HUMAN			7	1189	-	all_hematologic(112;0.0378)		299			Ig-like C2-type 4.|Extracellular (Potential).		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	c.897G>C	CCDS1167.1																																																																																				0.517	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		7	95	0	0	0	0	7	95				
ARHGAP30	257106	broad.mit.edu	37	1	161021182	161021182	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:161021182C>G	ENST00000368013.3	-	10	1662	c.1342G>C	c.(1342-1344)Gag>Cag	p.E448Q	ARHGAP30_ENST00000368016.3_Missense_Mutation_p.E448Q|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.E271Q	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	448					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GCAGGGCACTCAAGGCCACGG	0.627																																						uc001fxl.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(1342-1344)GAG>CAG		Rho GTPase activating protein 30 isoform 1							75.0	61.0	66.0					1																	161021182		2203	4300	6503	SO:0001583	missense	257106				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr1:161021182C>G	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.1342G>C	1.37:g.161021182C>G	ENSP00000356992:p.Glu448Gln		Somatic				ARHGAP30_uc001fxk.2_Missense_Mutation_p.E448Q|ARHGAP30_uc001fxm.2_Missense_Mutation_p.E294Q|ARHGAP30_uc009wtx.2_Missense_Mutation_p.E121Q|ARHGAP30_uc001fxn.1_Missense_Mutation_p.E294Q	p.E448Q	NM_001025598	NP_001020769	WXS	Illumina HiSeq	Unspecified	Q7Z6I6	RHG30_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00122)		10	1688	-	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		448					Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	c.1342G>C	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275545	0.80580	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.38722	2.79;2.67;1.12	4.96	4.96	0.65561	.	0.000000	0.47852	D	0.000216	T	0.42539	0.1207	L	0.36672	1.1	0.38500	D	0.948197	D;D	0.67145	0.996;0.993	D;D	0.63381	0.914;0.91	T	0.43877	-0.9364	10	0.72032	D	0.01	.	14.1198	0.65180	0.0:1.0:0.0:0.0	.	448;448	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	Q	448;448;300;271	ENSP00000356995:E448Q;ENSP00000356992:E448Q;ENSP00000356994:E271Q	ENSP00000356992:E448Q	E	-	1	0	ARHGAP30	159287806	0.995000	0.38212	0.998000	0.56505	0.964000	0.63967	2.028000	0.41088	2.471000	0.83476	0.555000	0.69702	GAG		0.627	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720		6	49	0	0	0	0	6	49				
TOR1AIP2	163590	broad.mit.edu	37	1	179815318	179815318	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:179815318G>C	ENST00000367612.3	-	6	1688	c.1301C>G	c.(1300-1302)tCc>tGc	p.S434C	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.S434C	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						GTGGTTGAAGGAGGTGGGAGT	0.502																																						uc001gnk.2		NA																	0				ovary(1)	1						c.(1300-1302)TCC>TGC		torsin A interacting protein 2							186.0	174.0	179.0					1																	179815318		2203	4300	6503	SO:0001583	missense	163590					endoplasmic reticulum membrane|integral to membrane	protein binding	g.chr1:179815318G>C		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.1301C>G	1.37:g.179815318G>C	ENSP00000356584:p.Ser434Cys		Somatic				TOR1AIP2_uc001gnl.2_Missense_Mutation_p.S434C	p.S434C	NM_145034	NP_659471	WXS	Illumina HiSeq	Unspecified	Q8NFQ8	TOIP2_HUMAN			6	1689	-			434					Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	c.1301C>G	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815362	0.50527	.	.	ENSG00000169905	ENST00000367612	T	0.35605	1.3	5.87	5.87	0.94306	.	0.385759	0.27294	N	0.020039	T	0.66509	0.2796	M	0.83483	2.645	0.40120	D	0.976587	D	0.89917	1.0	D	0.91635	0.999	T	0.70142	-0.4953	10	0.87932	D	0	-14.8417	19.8741	0.96863	0.0:0.0:1.0:0.0	.	434	Q8NFQ8	TOIP2_HUMAN	C	434	ENSP00000356584:S434C	ENSP00000356584:S434C	S	-	2	0	TOR1AIP2	178081941	1.000000	0.71417	0.995000	0.50966	0.239000	0.25481	5.155000	0.64900	2.789000	0.95967	0.650000	0.86243	TCC		0.502	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034		5	61	0	0	0	0	5	61				
DHX9	1660	broad.mit.edu	37	1	182845596	182845596	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:182845596C>G	ENST00000367549.3	+	18	2154	c.2044C>G	c.(2044-2046)Cag>Gag	p.Q682E		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	682	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						CCATCGGTATCAGATTCTACC	0.383																																					Colon(69;210 1162 3697 13559 39565)	uc001gpr.2		NA																	0				ovary(2)	2						c.(2044-2046)CAG>GAG		DEAH (Asp-Glu-Ala-His) box polypeptide 9							94.0	82.0	86.0					1																	182845596		1831	4083	5914	SO:0001583	missense	1660				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding	g.chr1:182845596C>G	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2044C>G	1.37:g.182845596C>G	ENSP00000356520:p.Gln682Glu		Somatic				DHX9_uc001gps.2_Missense_Mutation_p.Q468E|DHX9_uc001gpt.2_5'Flank	p.Q682E	NM_001357	NP_001348	WXS	Illumina HiSeq	Unspecified	Q08211	DHX9_HUMAN			18	2207	+			682			Helicase C-terminal.		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	c.2044C>G	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	9.359	1.067486	0.20067	.	.	ENSG00000135829	ENST00000367549	T	0.74526	-0.85	5.54	5.54	0.83059	Helicase, C-terminal (3);	0.207799	0.41001	D	0.000972	T	0.46964	0.1420	N	0.02247	-0.625	0.38289	D	0.942651	B	0.11235	0.004	B	0.15052	0.012	T	0.49579	-0.8925	10	0.31617	T	0.26	.	7.7433	0.28853	0.2063:0.7133:0.0:0.0804	.	682	Q08211	DHX9_HUMAN	E	682	ENSP00000356520:Q682E	ENSP00000356520:Q682E	Q	+	1	0	DHX9	181112219	0.995000	0.38212	1.000000	0.80357	0.947000	0.59692	2.448000	0.44926	2.751000	0.94390	0.591000	0.81541	CAG		0.383	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588		6	56	0	0	0	0	6	56				
CDK18	5129	broad.mit.edu	37	1	205499409	205499409	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:205499409C>T	ENST00000360066.2	+	14	1545	c.1244C>T	c.(1243-1245)tCa>tTa	p.S415L	CDK18_ENST00000506784.1_Missense_Mutation_p.S445L|CDK18_ENST00000429964.2_Missense_Mutation_p.S415L|CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	413	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						AGTCGCATGTCAGCAGAGGCT	0.622																																					Pancreas(180;489 2072 28461 40831 44265)	uc001hcr.2		NA																	0				stomach(2)	2						c.(1333-1335)TCA>TTA		PCTAIRE protein kinase 3 isoform a							75.0	77.0	76.0					1																	205499409		2203	4300	6503	SO:0001583	missense	5129						ATP binding|cyclin-dependent protein kinase activity|protein binding|signal transducer activity	g.chr1:205499409C>T	X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.1244C>T	1.37:g.205499409C>T	ENSP00000353176:p.Ser415Leu		Somatic				CDK18_uc001hcp.2_Missense_Mutation_p.S415L|CDK18_uc001hcq.2_Missense_Mutation_p.S415L|CDK18_uc010prj.1_Missense_Mutation_p.S326L|CDK18_uc001hcs.2_Missense_Mutation_p.S326L|CDK18_uc009xbm.1_3'UTR|CDK18_uc001hct.2_RNA	p.S445L	NM_212503	NP_997668	WXS	Illumina HiSeq	Unspecified	Q07002	CDK18_HUMAN			14	1553	+			413			Protein kinase.		Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Missense_Mutation	SNP	ENST00000360066.2	37	c.1334C>T	CCDS44300.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733240	0.69189	.	.	ENSG00000117266	ENST00000429964;ENST00000506784;ENST00000360066	T;T;T	0.51325	0.71;0.71;0.71	5.12	5.12	0.69794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.176264	0.50627	D	0.000102	T	0.64271	0.2583	M	0.91038	3.17	0.80722	D	1	B;B;B	0.30326	0.01;0.107;0.276	B;B;B	0.37346	0.061;0.134;0.247	T	0.71130	-0.4682	10	0.87932	D	0	-9.5681	17.4746	0.87656	0.0:1.0:0.0:0.0	.	413;445;415	Q07002;Q07002-3;Q07002-2	CDK18_HUMAN;.;.	L	415;445;415	ENSP00000399082:S415L;ENSP00000423665:S445L;ENSP00000353176:S415L	ENSP00000353176:S415L	S	+	2	0	CDK18	203766032	0.989000	0.36119	0.574000	0.28523	0.832000	0.47134	3.212000	0.51145	2.543000	0.85770	0.561000	0.74099	TCA		0.622	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090407.2	NM_002596		5	70	0	0	0	0	5	70				
SLC26A9	115019	broad.mit.edu	37	1	205892256	205892256	+	Missense_Mutation	SNP	C	C	T	rs566271291		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:205892256C>T	ENST00000367135.3	-	16	1840	c.1727G>A	c.(1726-1728)aGa>aAa	p.R576K	SLC26A9_ENST00000340781.4_Missense_Mutation_p.R576K|SLC26A9_ENST00000367134.2_Missense_Mutation_p.R576K	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	576	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GGGCCTCATTCTCCGCTTCTC	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		18557	0.001		0.0	False		,,,				2504	0.0					uc001hdq.2		NA																	0				ovary(1)|skin(1)	2						c.(1726-1728)AGA>AAA		solute carrier family 26, member 9 isoform a							244.0	209.0	221.0					1																	205892256		2203	4300	6503	SO:0001583	missense	115019					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity	g.chr1:205892256C>T	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1727G>A	1.37:g.205892256C>T	ENSP00000356103:p.Arg576Lys		Somatic				SLC26A9_uc001hdo.2_Missense_Mutation_p.R244K|SLC26A9_uc001hdp.2_Missense_Mutation_p.R576K	p.R576K	NM_052934	NP_443166	WXS	Illumina HiSeq	Unspecified	Q7LBE3	S26A9_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.0458)		16	1841	-	Breast(84;0.201)		576			STAS.		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	c.1727G>A	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	C	1.060	-0.673161	0.03403	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92199	-2.99;-2.95;-2.99	5.24	-4.07	0.03975	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.396246	0.18504	N	0.139246	T	0.69726	0.3143	N	0.04090	-0.28	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.67098	-0.5756	10	0.05351	T	0.99	.	0.5716	0.00696	0.3297:0.2654:0.197:0.2079	.	576;576	Q7LBE3;B1AVM8	S26A9_HUMAN;.	K	576	ENSP00000341682:R576K;ENSP00000356103:R576K;ENSP00000356102:R576K	ENSP00000341682:R576K	R	-	2	0	SLC26A9	204158879	0.000000	0.05858	0.000000	0.03702	0.644000	0.38419	-1.251000	0.02882	-1.357000	0.02180	0.655000	0.94253	AGA		0.517	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934		28	78	0	0	0	0	28	78				
CR1	1378	broad.mit.edu	37	1	207787831	207787831	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:207787831G>T	ENST00000367049.4	+	40	6658	c.6658G>T	c.(6658-6660)Gaa>Taa	p.E2220*	CR1_ENST00000367051.1_Nonsense_Mutation_p.E1770*|CR1_ENST00000367053.1_Nonsense_Mutation_p.E1770*|CR1_ENST00000367052.1_Nonsense_Mutation_p.E1770*|CR1_ENST00000400960.2_Nonsense_Mutation_p.E1770*	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1770					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.E2220*(6)|p.E1775*(6)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TCCAGTGTGTGAACGTGAGTA	0.408																																						uc001hfy.2		NA																	12	Substitution - Nonsense(12)		kidney(8)|endometrium(4)	ovary(3)	3						c.(5308-5310)GAA>TAA		complement receptor 1 isoform F precursor							131.0	122.0	125.0					1																	207787831		1887	4127	6014	SO:0001587	stop_gained	1378				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity	g.chr1:207787831G>T	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6658G>T	1.37:g.207787831G>T	ENSP00000356016:p.Glu2220*		Somatic				CR1_uc001hfx.2_Nonsense_Mutation_p.E2220*	p.E1770*	NM_000573	NP_000564	WXS	Illumina HiSeq	Unspecified	P17927	CR1_HUMAN			32	5448	+			1770			Extracellular (Potential).|Sushi 27.		Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Nonsense_Mutation	SNP	ENST00000367049.4	37	c.5308G>T	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	45	12.061806	0.99632	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	12.9543	0.58418	0.0:0.0:1.0:0.0	.	.	.	.	X	1770;1770;1770;1770;2220	.	ENSP00000356016:E2220X	E	+	1	0	CR1	205854454	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	2.536000	0.45693	2.316000	0.78162	0.436000	0.28706	GAA		0.408	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		5	45	1	0	8.13e-05	8.38e-05	5	45				
CAPN2	824	broad.mit.edu	37	1	223958200	223958200	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:223958200G>A	ENST00000295006.5	+	18	2185	c.1876G>A	c.(1876-1878)Gaa>Aaa	p.E626K	CAPN2_ENST00000433674.2_Missense_Mutation_p.E548K|CAPN2_ENST00000474026.1_3'UTR	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	626	Domain IV.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		GAATTCCTATGAAATGCGGAA	0.393																																						uc001hob.3		NA																	0				lung(3)|breast(1)|skin(1)	5						c.(1876-1878)GAA>AAA		calpain 2 isoform 1							95.0	88.0	90.0					1																	223958200		2203	4300	6503	SO:0001583	missense	824				proteolysis	cytoplasm|plasma membrane		g.chr1:223958200G>A	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.1876G>A	1.37:g.223958200G>A	ENSP00000295006:p.Glu626Lys		Somatic				CAPN2_uc010puy.1_Missense_Mutation_p.E548K|CAPN2_uc001hoc.2_Missense_Mutation_p.E207K	p.E626K	NM_001748	NP_001739	WXS	Illumina HiSeq	Unspecified	P17655	CAN2_HUMAN		GBM - Glioblastoma multiforme(131;0.109)	18	2100	+			626			Domain IV.|EF-hand 2.|2.		A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	ENST00000295006.5	37	c.1876G>A	CCDS31035.1	.	.	.	.	.	.	.	.	.	.	G	33	5.222375	0.95139	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	T;T	0.53206	0.63;0.63	5.35	5.35	0.76521	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79907	0.4527	H	0.97023	3.925	0.80722	D	1	D;D;D	0.89917	0.992;1.0;1.0	D;D;D	0.91635	0.978;0.999;0.997	D	0.86883	0.2043	10	0.87932	D	0	.	17.2725	0.87106	0.0:0.0:1.0:0.0	.	548;209;626	B7ZA96;B3KUH9;P17655	.;.;CAN2_HUMAN	K	548;626;655	ENSP00000413158:E548K;ENSP00000295006:E626K	ENSP00000295006:E626K	E	+	1	0	CAPN2	222024823	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.298000	0.78815	2.503000	0.84419	0.655000	0.94253	GAA		0.393	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748		4	37	0	0	0	0	4	37				
EXOC8	149371	broad.mit.edu	37	1	231473420	231473420	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:231473420C>T	ENST00000360394.2	-	1	158	c.72G>A	c.(70-72)gcG>gcA	p.A24A	SPRTN_ENST00000008440.9_5'Flank|EXOC8_ENST00000366645.1_Silent_p.A20A|SPRTN_ENST00000391858.4_5'UTR|SPRTN_ENST00000295050.7_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	24					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CGTACAGCCGCGCCTCAAAAC	0.677																																						uc001huq.2		NA																	0				skin(1)	1						c.(70-72)GCG>GCA		exocyst complex 84-kDa subunit							28.0	32.0	31.0					1																	231473420		2173	4259	6432	SO:0001819	synonymous_variant	149371				exocytosis|protein transport	growth cone|nucleus	protein binding	g.chr1:231473420C>T	AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.72G>A	1.37:g.231473420C>T			Somatic				C1orf124_uc001hur.2_5'Flank|C1orf124_uc001hus.2_5'Flank|C1orf124_uc001hut.2_5'Flank	p.A24A	NM_175876	NP_787072	WXS	Illumina HiSeq	Unspecified	Q8IYI6	EXOC8_HUMAN			1	159	-	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)	24					B3KU33|Q5TE82	Silent	SNP	ENST00000360394.2	37	c.72G>A	CCDS1593.1																																																																																				0.677	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_175876		6	50	0	0	0	0	6	50				
SIPA1L2	57568	broad.mit.edu	37	1	232615429	232615429	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:232615429C>T	ENST00000366630.1	-	6	2387	c.2029G>A	c.(2029-2031)Gaa>Aaa	p.E677K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E677K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	677	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.E677K(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				AACATGAGTTCGTAGTCTTTG	0.458																																						uc001hvg.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6						c.(2029-2031)GAA>AAA		signal-induced proliferation-associated 1 like							194.0	210.0	205.0					1																	232615429		2099	4255	6354	SO:0001583	missense	57568				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr1:232615429C>T	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2029G>A	1.37:g.232615429C>T	ENSP00000355589:p.Glu677Lys		Somatic					p.E677K	NM_020808	NP_065859	WXS	Illumina HiSeq	Unspecified	Q9P2F8	SI1L2_HUMAN			5	2187	-		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)	677			Rap-GAP.		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	c.2029G>A	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	C	36	5.651348	0.96714	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.96745	-4.11;-4.11	5.53	5.53	0.82687	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.98893	0.9625	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99084	1.0838	10	0.62326	D	0.03	-35.4286	19.8228	0.96604	0.0:1.0:0.0:0.0	.	677	Q9P2F8	SI1L2_HUMAN	K	677	ENSP00000355589:E677K;ENSP00000262861:E677K	ENSP00000262861:E677K	E	-	1	0	SIPA1L2	230682052	1.000000	0.71417	0.713000	0.30519	0.984000	0.73092	7.773000	0.85462	2.759000	0.94783	0.650000	0.86243	GAA		0.458	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839		5	57	0	0	0	0	5	57				
GPR137B	7107	broad.mit.edu	37	1	236347168	236347168	+	Missense_Mutation	SNP	G	G	A	rs147708340		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:236347168G>A	ENST00000366592.3	+	5	1019	c.928G>A	c.(928-930)Gtt>Att	p.V310I	GPR137B_ENST00000477559.1_3'UTR	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	310						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CACCTTAGTCGTTTATTTCTT	0.373													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16426	0.0		0.0	False		,,,				2504	0.0					uc001hxq.2		NA																	0					0						c.(928-930)GTT>ATT		G protein-coupled receptor 137B		G	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	146.0	140.0	142.0		928	5.5	0.8	1	dbSNP_134	142	0,8600		0,0,4300	no	missense	GPR137B	NM_003272.3	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	310/400	236347168	2,13004	2203	4300	6503	SO:0001583	missense	7107					integral to plasma membrane|membrane fraction		g.chr1:236347168G>A	AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.928G>A	1.37:g.236347168G>A	ENSP00000355551:p.Val310Ile		Somatic				GPR137B_uc001hxr.1_Missense_Mutation_p.V92I|GPR137B_uc009xge.2_RNA	p.V310I	NM_003272	NP_003263	WXS	Illumina HiSeq	Unspecified	O60478	G137B_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		5	1019	+	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	310			Helical; (Potential).		Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	ENST00000366592.3	37	c.928G>A	CCDS1609.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.40	3.614849	0.66672	4.54E-4	0.0	ENSG00000077585	ENST00000366592;ENST00000391852;ENST00000419162	T;T	0.56941	0.43;0.54	5.47	5.47	0.80525	.	0.122142	0.53938	D	0.000042	T	0.46502	0.1396	L	0.59436	1.845	0.80722	D	1	B;P	0.46578	0.025;0.88	B;B	0.30251	0.006;0.113	T	0.54721	-0.8251	10	0.42905	T	0.14	-14.2688	19.3356	0.94316	0.0:0.0:1.0:0.0	.	173;310	Q5TAF1;O60478	.;G137B_HUMAN	I	310;309;92	ENSP00000355551:V310I;ENSP00000401841:V92I	ENSP00000355551:V310I	V	+	1	0	GPR137B	234413791	1.000000	0.71417	0.822000	0.32727	0.936000	0.57629	7.482000	0.81143	2.578000	0.87016	0.650000	0.86243	GTT		0.373	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092761.1	NM_003272		18	28	0	0	0	0	18	28				
OR6F1	343169	broad.mit.edu	37	1	247875239	247875239	+	Silent	SNP	A	A	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr1:247875239A>C	ENST00000302084.2	-	1	866	c.819T>G	c.(817-819)gcT>gcG	p.A273A	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GGACGTGGACAGCTTTGATCA	0.483																																						uc001idj.1		NA																	0					0						c.(817-819)GCT>GCG		olfactory receptor, family 6, subfamily F,							114.0	111.0	112.0					1																	247875239		2203	4300	6503	SO:0001819	synonymous_variant	343169				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247875239A>C	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.819T>G	1.37:g.247875239A>C			Somatic					p.A273A	NM_001005286	NP_001005286	WXS	Illumina HiSeq	Unspecified	Q8NGZ6	OR6F1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0168)		1	819	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		273			Helical; Name=7; (Potential).		B2RNV6|Q6IF02|Q96R39	Silent	SNP	ENST00000302084.2	37	c.819T>G	CCDS31095.1																																																																																				0.483	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286		43	55	0	0	0	0	43	55				
LARP4B	23185	broad.mit.edu	37	10	882344	882344	+	Splice_Site	SNP	T	T	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:882344T>A	ENST00000316157.3	-	7	789	c.749A>T	c.(748-750)gAa>gTa	p.E250V		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	250	RRM.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						ATTACTTACTTCCACGGGGGT	0.363																																						uc001ifs.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(748-750)GAA>GTA		La ribonucleoprotein domain family, member 4B							125.0	125.0	125.0					10																	882344		2202	4300	6502	SO:0001630	splice_region_variant	23185						nucleotide binding|RNA binding	g.chr10:882344T>A	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.750+1A>T	10.37:g.882344T>A			Somatic					p.E250V	NM_015155	NP_055970	WXS	Illumina HiSeq	Unspecified	Q92615	LAR4B_HUMAN			7	790	-			250			RRM.		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	37	c.749A>T	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.468097	0.84533	.	.	ENSG00000107929	ENST00000316157	T	0.42900	0.96	5.67	5.67	0.87782	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.042431	0.85682	D	0.000000	T	0.70141	0.3190	M	0.89658	3.05	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.77104	-0.2711	10	0.72032	D	0.01	-25.6304	14.4797	0.67573	0.0:0.0:0.0:1.0	.	250	Q92615	LAR4B_HUMAN	V	250	ENSP00000326128:E250V	ENSP00000326128:E250V	E	-	2	0	LARP4B	872344	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	7.887000	0.87295	2.164000	0.68074	0.533000	0.62120	GAA		0.363	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	Missense_Mutation	15	33	0	0	0	0	15	33				
SLC39A12	221074	broad.mit.edu	37	10	18276458	18276458	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:18276458C>T	ENST00000377369.2	+	7	1420	c.1147C>T	c.(1147-1149)Ctg>Ttg	p.L383L	SLC39A12_ENST00000539911.1_Silent_p.L249L|SLC39A12_ENST00000377371.3_Silent_p.L383L|SLC39A12_ENST00000377374.4_Silent_p.L383L	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	383					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GGGCTCCATGCTGGGGACAGC	0.557																																						uc001ipo.2		NA																	0				ovary(1)|breast(1)	2						c.(1147-1149)CTG>TTG		solute carrier family 39 (zinc transporter),							142.0	108.0	120.0					10																	18276458		2203	4300	6503	SO:0001819	synonymous_variant	221074				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity	g.chr10:18276458C>T		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1147C>T	10.37:g.18276458C>T			Somatic				SLC39A12_uc001ipn.2_Silent_p.L383L|SLC39A12_uc001ipp.2_Silent_p.L383L|SLC39A12_uc010qck.1_Silent_p.L249L	p.L383L	NM_001145195	NP_001138667	WXS	Illumina HiSeq	Unspecified	Q504Y0	S39AC_HUMAN			7	1420	+			383			Helical; (Potential).		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Silent	SNP	ENST00000377369.2	37	c.1147C>T	CCDS44362.1																																																																																				0.557	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725		22	40	0	0	0	0	22	40				
PDSS1	23590	broad.mit.edu	37	10	27035305	27035305	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:27035305G>A	ENST00000376215.5	+	12	1204	c.1151G>A	c.(1150-1152)tGc>tAc	p.C384Y	PDSS1_ENST00000376203.5_3'UTR|PDSS1_ENST00000470978.1_3'UTR	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	384					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						CAGCAGTACTGCCATGAAGCA	0.423																																						uc001isv.2		NA																	0					0						c.(1150-1152)TGC>TAC		prenyl diphosphate synthase, subunit 1							136.0	117.0	123.0					10																	27035305		2203	4300	6503	SO:0001583	missense	23590				isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	metal ion binding|protein heterodimerization activity	g.chr10:27035305G>A	AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	ENST00000376215.5:c.1151G>A	10.37:g.27035305G>A	ENSP00000365388:p.Cys384Tyr		Somatic				PDSS1_uc001isw.2_3'UTR|PDSS1_uc010qdf.1_Missense_Mutation_p.C122Y	p.C384Y	NM_014317	NP_055132	WXS	Illumina HiSeq	Unspecified	Q5T2R2	DPS1_HUMAN			12	1197	+			384					Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Missense_Mutation	SNP	ENST00000376215.5	37	c.1151G>A	CCDS31168.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847478	0.71603	.	.	ENSG00000148459	ENST00000376215;ENST00000396343	T	0.61980	0.06	5.54	5.54	0.83059	Terpenoid synthase (2);	0.000000	0.85682	D	0.000000	T	0.64778	0.2629	M	0.66506	2.035	0.80722	D	1	B;P	0.39044	0.431;0.656	B;B	0.37387	0.179;0.248	T	0.70245	-0.4925	10	0.87932	D	0	-26.3154	19.4716	0.94965	0.0:0.0:1.0:0.0	.	122;384	B4DJY1;Q5T2R2	.;DPS1_HUMAN	Y	384;345	ENSP00000365388:C384Y	ENSP00000365388:C384Y	C	+	2	0	PDSS1	27075311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.623000	0.98386	2.585000	0.87301	0.655000	0.94253	TGC		0.423	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047276.1			6	49	0	0	0	0	6	49				
ZNF248	57209	broad.mit.edu	37	10	38121209	38121209	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:38121209C>G	ENST00000395867.3	-	6	1624	c.1074G>C	c.(1072-1074)ggG>ggC	p.G358G	ZNF248_ENST00000357328.4_Silent_p.G358G|ZNF248_ENST00000374648.3_Intron|AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000494133.1_Intron	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						TGAAATTACTCCCATTTTCAT	0.403																																						uc001izd.1		NA																	0				ovary(1)	1						c.(1072-1074)GGG>GGC		zinc finger protein 248							108.0	102.0	104.0					10																	38121209		2203	4299	6502	SO:0001819	synonymous_variant	57209				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:38121209C>G	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1074G>C	10.37:g.38121209C>G			Somatic				ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Silent_p.G358G	p.G358G	NM_021045	NP_066383	WXS	Illumina HiSeq	Unspecified	Q8NDW4	ZN248_HUMAN			6	1573	-			358					Q8NDV8|Q9UMP3	Silent	SNP	ENST00000395867.3	37	c.1074G>C	CCDS7194.1																																																																																				0.403	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045		29	58	0	0	0	0	29	58				
HNRNPF	3185	broad.mit.edu	37	10	43882509	43882509	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:43882509C>T	ENST00000544000.1	-	4	1231	c.824G>A	c.(823-825)aGa>aAa	p.R275K	HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000356053.3_Missense_Mutation_p.R275K|HNRNPF_ENST00000357065.4_Missense_Mutation_p.R275K|HNRNPF_ENST00000443950.2_Missense_Mutation_p.R275K|HNRNPF_ENST00000337970.3_Missense_Mutation_p.R275K	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	275					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						GTCGCCGTATCTGTGGTCATA	0.562																																						uc009xmh.1		NA																	0					0						c.(823-825)AGA>AAA		heterogeneous nuclear ribonucleoprotein F							58.0	52.0	54.0					10																	43882509		2203	4300	6503	SO:0001583	missense	3185				regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding	g.chr10:43882509C>T		CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.824G>A	10.37:g.43882509C>T	ENSP00000438061:p.Arg275Lys		Somatic				HNRNPF_uc001jar.2_Missense_Mutation_p.R275K|HNRNPF_uc001jas.2_Missense_Mutation_p.R275K|HNRNPF_uc001jat.2_Missense_Mutation_p.R275K|HNRNPF_uc001jav.2_Missense_Mutation_p.R275K|HNRNPF_uc001jau.2_Missense_Mutation_p.R275K|uc010qfa.1_Missense_Mutation_p.S64F	p.R275K	NM_001098208	NP_001091678	WXS	Illumina HiSeq	Unspecified	P52597	HNRPF_HUMAN			3	1311	-			275					B3KM84|Q5T0N2|Q96AU2	Missense_Mutation	SNP	ENST00000544000.1	37	c.824G>A	CCDS7204.1	.	.	.	.	.	.	.	.	.	.	C	11.18	1.561695	0.27915	.	.	ENSG00000169813	ENST00000544000;ENST00000443950;ENST00000356053;ENST00000357065;ENST00000337970;ENST00000540544	T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96	4.38	4.38	0.52667	Zinc finger, CHHC-type (1);	0.000000	0.85682	D	0.000000	T	0.06234	0.0161	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.15484	0.013	T	0.12477	-1.0546	10	0.05620	T	0.96	-33.4122	15.2569	0.73593	0.0:1.0:0.0:0.0	.	275	P52597	HNRPF_HUMAN	K	275;275;275;275;275;198	ENSP00000438061:R275K;ENSP00000400433:R275K;ENSP00000348345:R275K;ENSP00000349573:R275K;ENSP00000338477:R275K	ENSP00000338477:R275K	R	-	2	0	HNRNPF	43202515	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.162000	0.64942	2.726000	0.93360	0.655000	0.94253	AGA		0.562	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047705.2			16	11	0	0	0	0	16	11				
TMEM72	643236	broad.mit.edu	37	10	45430193	45430193	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:45430193G>C	ENST00000544540.1	+	4	569	c.85G>C	c.(85-87)Gag>Cag	p.E29Q	TMEM72-AS1_ENST00000450287.2_RNA|RP11-285G1.9_ENST00000425541.2_lincRNA			A0PK05	TMM72_HUMAN	transmembrane protein 72	147						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						GGCCTCCCCAGAGCAGTACAC	0.612																																						uc001jbn.2		NA																	0					0						c.(439-441)GAG>CAG		transmembrane protein 72							90.0	95.0	94.0					10																	45430193		1568	3582	5150	SO:0001583	missense	643236					integral to membrane		g.chr10:45430193G>C	AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.85G>C	10.37:g.45430193G>C	ENSP00000439911:p.Glu29Gln		Somatic				uc001jbk.1_Intron|uc001jbl.2_Intron|TMEM72_uc009xmm.1_Missense_Mutation_p.E29Q	p.E147Q	NM_001123376	NP_001116848	WXS	Illumina HiSeq	Unspecified	A0PK05	TMM72_HUMAN			5	636	+			147					A1L181|Q5T740	Missense_Mutation	SNP	ENST00000544540.1	37	c.439G>C		.	.	.	.	.	.	.	.	.	.	G	18.03	3.533148	0.64972	.	.	ENSG00000187783	ENST00000389583;ENST00000544540	.	.	.	5.28	4.36	0.52297	.	0.221484	0.36932	N	0.002331	T	0.62146	0.2404	M	0.71581	2.175	0.38478	D	0.947639	B	0.24721	0.11	B	0.26770	0.073	T	0.64206	-0.6462	9	0.44086	T	0.13	-33.7727	13.8412	0.63439	0.0:0.1546:0.8454:0.0	.	147	A0PK05	TMM72_HUMAN	Q	147;29	.	ENSP00000374234:E147Q	E	+	1	0	TMEM72	44750199	1.000000	0.71417	0.854000	0.33618	0.833000	0.47200	6.969000	0.76092	1.328000	0.45358	0.563000	0.77884	GAG		0.612	TMEM72-201	KNOWN	basic	protein_coding	protein_coding		NM_001123376		7	83	0	0	0	0	7	83				
OR13A1	79290	broad.mit.edu	37	10	45799279	45799279	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:45799279C>T	ENST00000553795.1	-	4	900	c.592G>A	c.(592-594)Gag>Aag	p.E198K	OR13A1_ENST00000536058.1_Missense_Mutation_p.E198K|OR13A1_ENST00000374401.2_Missense_Mutation_p.E198K	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						GGAGGGACCTCGCAGAAGAAA	0.567																																						uc001jcc.1		NA																	0					0						c.(592-594)GAG>AAG		olfactory receptor, family 13, subfamily A,							53.0	55.0	55.0					10																	45799279		2201	4299	6500	SO:0001583	missense	79290				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr10:45799279C>T	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.592G>A	10.37:g.45799279C>T	ENSP00000451950:p.Glu198Lys		Somatic				OR13A1_uc001jcd.1_Missense_Mutation_p.E194K	p.E198K	NM_001004297	NP_001004297	WXS	Illumina HiSeq	Unspecified	Q8NGR1	O13A1_HUMAN			4	901	-			198			Extracellular (Potential).		Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	37	c.592G>A	CCDS31188.1	.	.	.	.	.	.	.	.	.	.	c	17.22	3.333309	0.60853	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.00202	8.56;8.56;8.56	5.78	3.95	0.45737	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000209	T	0.00496	0.0016	M	0.88512	2.96	0.36337	D	0.859238	P	0.50710	0.938	P	0.55391	0.775	T	0.64445	-0.6406	10	0.87932	D	0	-40.7273	10.5912	0.45310	0.0:0.8439:0.0:0.1561	.	198	Q8NGR1	O13A1_HUMAN	K	198	ENSP00000451950:E198K;ENSP00000438657:E198K;ENSP00000363522:E198K	ENSP00000311379:E198K	E	-	1	0	OR13A1	45119285	1.000000	0.71417	0.957000	0.39632	0.192000	0.23643	5.670000	0.68088	0.805000	0.34159	-0.141000	0.14075	GAG		0.567	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297		17	23	0	0	0	0	17	23				
FAM21C	253725	broad.mit.edu	37	10	46250521	46250521	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:46250521G>A	ENST00000336378.4	+	15	1496	c.1378G>A	c.(1378-1380)Gac>Aac	p.D460N	FAM21C_ENST00000537517.1_Missense_Mutation_p.D436N|FAM21C_ENST00000374362.2_Missense_Mutation_p.D460N|FAM21C_ENST00000359860.4_Missense_Mutation_p.D404N|FAM21C_ENST00000540872.1_Missense_Mutation_p.D460N	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	460	Poly-Asp.				retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						tgatgatgatgacgaCTTTTT	0.498																																						uc001jcu.2		NA																	0				ovary(1)	1						c.(1378-1380)GAC>AAC		hypothetical protein LOC253725							32.0	36.0	35.0					10																	46250521		1859	4099	5958	SO:0001583	missense	253725							g.chr10:46250521G>A		CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1378G>A	10.37:g.46250521G>A	ENSP00000337541:p.Asp460Asn		Somatic				FAM21C_uc001jcs.1_Missense_Mutation_p.D405N|FAM21C_uc001jct.2_Missense_Mutation_p.D460N|FAM21C_uc010qfi.1_Missense_Mutation_p.D436N|FAM21C_uc010qfj.1_5'UTR|FAM21C_uc010qfk.1_5'Flank	p.D460N	NM_015262	NP_056077	WXS	Illumina HiSeq	Unspecified	A8K5W5	A8K5W5_HUMAN			15	1477	+			460					B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	ENST00000336378.4	37	c.1378G>A		.	.	.	.	.	.	.	.	.	.	G	6.200	0.405024	0.11754	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.18	2.24	0.28232	.	0.055857	0.64402	D	0.000002	T	0.55114	0.1900	L	0.60845	1.875	0.32349	N	0.558698	B;D;D;D	0.76494	0.021;0.999;0.999;0.993	B;D;D;D	0.70227	0.027;0.968;0.968;0.951	T	0.58624	-0.7604	9	0.27785	T	0.31	-6.9624	5.4316	0.16456	0.1683:0.0:0.8317:0.0	.	436;460;460;405	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	N	460;460;436;460;460;404;372	.	ENSP00000337541:D460N	D	+	1	0	FAM21C	45570527	0.854000	0.29725	0.143000	0.22291	0.412000	0.31113	2.952000	0.49097	0.637000	0.30526	0.603000	0.83216	GAC		0.498	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				10	13	0	0	0	0	10	13				
LRRC18	474354	broad.mit.edu	37	10	50122006	50122006	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:50122006G>C	ENST00000374160.3	-	1	271	c.195C>G	c.(193-195)atC>atG	p.I65M	LRRC18_ENST00000298124.3_Missense_Mutation_p.I65M|RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000413659.2_Intron|WDFY4_ENST00000325239.5_Intron	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	65						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TGGAGTCAGGGATCTTCCTGA	0.527																																						uc001jhd.2		NA																	0				ovary(1)|pancreas(1)	2						c.(193-195)ATC>ATG		leucine rich repeat containing 18							93.0	82.0	86.0					10																	50122006		2203	4300	6503	SO:0001583	missense	474354					cytoplasm		g.chr10:50122006G>C	AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.195C>G	10.37:g.50122006G>C	ENSP00000363275:p.Ile65Met		Somatic				WDFY4_uc001jha.3_Intron|LRRC18_uc001jhe.1_Missense_Mutation_p.I65M	p.I65M	NM_001006939	NP_001006940	WXS	Illumina HiSeq	Unspecified	Q8N456	LRC18_HUMAN			1	275	-			65			LRR 2.		Q6UY02	Missense_Mutation	SNP	ENST00000374160.3	37	c.195C>G	CCDS31197.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.275381	0.59649	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.59083	0.29;0.29	6.07	0.111	0.14619	.	0.163243	0.53938	D	0.000054	T	0.67730	0.2924	M	0.83118	2.625	0.45490	D	0.998458	D	0.64830	0.994	D	0.63793	0.918	T	0.64002	-0.6509	9	.	.	.	.	3.4834	0.07610	0.366:0.0962:0.4308:0.107	.	65	Q8N456	LRC18_HUMAN	M	65	ENSP00000363275:I65M;ENSP00000298124:I65M	.	I	-	3	3	LRRC18	49792012	0.983000	0.35010	0.995000	0.50966	0.997000	0.91878	0.125000	0.15749	0.098000	0.17522	0.655000	0.94253	ATC		0.527	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939		10	22	0	0	0	0	10	22				
CDH23	64072	broad.mit.edu	37	10	73326583	73326583	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:73326583C>T	ENST00000224721.6	+	6	534	c.529C>T	c.(529-531)Cag>Tag	p.Q177*	CDH23_ENST00000461841.3_Nonsense_Mutation_p.Q217*|CDH23_ENST00000299366.7_Nonsense_Mutation_p.Q217*|CDH23_ENST00000398842.3_Nonsense_Mutation_p.Q172*|CDH23_ENST00000398809.4_Nonsense_Mutation_p.Q172*	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	172	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CTACTCCTTCCAGCCCCCCTC	0.612																																						uc001jrx.3		NA																	0				central_nervous_system(5)|large_intestine(4)|ovary(2)	11						c.(514-516)CAG>TAG		cadherin-like 23 isoform 1 precursor							46.0	51.0	49.0					10																	73326583		2032	4191	6223	SO:0001587	stop_gained	64072				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding	g.chr10:73326583C>T	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.529C>T	10.37:g.73326583C>T	ENSP00000224721:p.Gln177*		Somatic				CDH23_uc001jrw.3_Nonsense_Mutation_p.Q172*|CDH23_uc001jrv.2_Nonsense_Mutation_p.Q167*|CDH23_uc009xql.2_Nonsense_Mutation_p.Q217*	p.Q172*	NM_022124	NP_071407	WXS	Illumina HiSeq	Unspecified	Q9H251	CAD23_HUMAN			7	891	+			172			Cadherin 2.|Extracellular (Potential).		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Nonsense_Mutation	SNP	ENST00000224721.6	37	c.514C>T		.	.	.	.	.	.	.	.	.	.	C	41	9.108613	0.99068	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721;ENST00000416060	.	.	.	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	19.2569	0.93949	0.0:1.0:0.0:0.0	.	.	.	.	X	177;172;172;172;172;177;177;113	.	ENSP00000224721:Q177X	Q	+	1	0	CDH23	72996589	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.456000	0.80751	2.561000	0.86390	0.561000	0.74099	CAG		0.612	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		3	42	0	0	0	0	3	42				
ATAD1	84896	broad.mit.edu	37	10	89536107	89536107	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:89536107C>T	ENST00000308448.7	-	6	1039	c.661G>A	c.(661-663)Gat>Aat	p.D221N	ATAD1_ENST00000541004.1_Missense_Mutation_p.D221N|ATAD1_ENST00000400215.3_Missense_Mutation_p.D163N|ATAD1_ENST00000328142.3_Missense_Mutation_p.D221N	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	221					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		TCCAATCCATCCCAGAGACTC	0.403																																						uc001key.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(661-663)GAT>AAT		ATPase family, AAA domain containing 1							137.0	138.0	138.0					10																	89536107		2203	4300	6503	SO:0001583	missense	84896					peroxisome	ATP binding|nucleoside-triphosphatase activity	g.chr10:89536107C>T	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.661G>A	10.37:g.89536107C>T	ENSP00000339017:p.Asp221Asn		Somatic				ATAD1_uc010qmr.1_Missense_Mutation_p.D163N|ATAD1_uc009xth.1_RNA|ATAD1_uc001kez.1_Missense_Mutation_p.D221N	p.D221N	NM_032810	NP_116199	WXS	Illumina HiSeq	Unspecified	Q8NBU5	ATAD1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)	5	944	-		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)	221					D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	c.661G>A	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	C	35	5.436815	0.96168	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.23	5.23	0.72850	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97839	1.0267	9	.	.	.	-23.5512	19.1788	0.93614	0.0:1.0:0.0:0.0	.	163;221	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	N	221;221;163;221	ENSP00000339017:D221N;ENSP00000339016:D221N;ENSP00000412968:D163N;ENSP00000445500:D221N	.	D	-	1	0	ATAD1	89526087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.463000	0.80869	2.597000	0.87782	0.563000	0.77884	GAT		0.403	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1	NM_032810		41	31	0	0	0	0	41	31				
DNTT	1791	broad.mit.edu	37	10	98064368	98064368	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:98064368C>T	ENST00000371174.2	+	1	216	c.114C>T	c.(112-114)ttC>ttT	p.F38F	RP11-35J23.1_ENST00000454484.2_RNA|DNTT_ENST00000419175.1_Silent_p.F38F			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	38	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		TGGTCGTCTTCATTTTGGAGA	0.542																																						uc001kmf.2		NA																	0				ovary(1)	1						c.(112-114)TTC>TTT		terminal deoxynucleotidyltransferase isoform 1							44.0	50.0	48.0					10																	98064368		2203	4300	6503	SO:0001819	synonymous_variant	1791				DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding	g.chr10:98064368C>T	AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.114C>T	10.37:g.98064368C>T			Somatic				DNTT_uc001kmg.2_Silent_p.F38F	p.F38F	NM_004088	NP_004079	WXS	Illumina HiSeq	Unspecified	P04053	TDT_HUMAN		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)	1	284	+		Colorectal(252;0.0815)|all_hematologic(284;0.224)	38			BRCT.		Q53FH1|Q5W103|Q96E50	Silent	SNP	ENST00000371174.2	37	c.114C>T	CCDS7447.1																																																																																				0.542	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088		13	12	0	0	0	0	13	12				
SMC3	9126	broad.mit.edu	37	10	112360248	112360248	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:112360248C>G	ENST00000361804.4	+	22	2605	c.2479C>G	c.(2479-2481)Cga>Gga	p.R827G		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	827					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TATTATTACTCGAGTAGAGAC	0.328																																						uc001kze.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2479-2481)CGA>GGA		structural maintenance of chromosomes 3							72.0	84.0	80.0					10																	112360248		2203	4300	6503	SO:0001583	missense	9126				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity	g.chr10:112360248C>G	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2479C>G	10.37:g.112360248C>G	ENSP00000354720:p.Arg827Gly		Somatic					p.R827G	NM_005445	NP_005436	WXS	Illumina HiSeq	Unspecified	Q9UQE7	SMC3_HUMAN		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)	22	2605	+		Breast(234;0.0848)|Lung NSC(174;0.238)	827			Potential.		A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	c.2479C>G	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.510535	0.44660	.	.	ENSG00000108055	ENST00000361804	T	0.77489	-1.1	5.81	5.81	0.92471	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	N	0.17474	0.49	0.58432	D	0.999999	B	0.13594	0.008	B	0.16289	0.015	T	0.58515	-0.7623	10	0.25751	T	0.34	.	15.74	0.77887	0.1447:0.8553:0.0:0.0	.	827	Q9UQE7	SMC3_HUMAN	G	827	ENSP00000354720:R827G	ENSP00000354720:R827G	R	+	1	2	SMC3	112350238	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.972000	0.29409	2.749000	0.94314	0.460000	0.39030	CGA		0.328	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445		4	86	0	0	0	0	4	86				
DOCK1	1793	broad.mit.edu	37	10	129224216	129224216	+	Missense_Mutation	SNP	G	G	C	rs192122020	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:129224216G>C	ENST00000280333.6	+	47	4901	c.4792G>C	c.(4792-4794)Gag>Cag	p.E1598Q		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1598	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CGAGAGGATGGAGGCCTGTTT	0.507																																						uc001ljt.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9						c.(4792-4794)GAG>CAG		dedicator of cytokinesis 1							195.0	195.0	195.0					10																	129224216		1982	4160	6142	SO:0001583	missense	1793				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr10:129224216G>C	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4792G>C	10.37:g.129224216G>C	ENSP00000280333:p.Glu1598Gln		Somatic				DOCK1_uc010qun.1_Missense_Mutation_p.E1619Q|DOCK1_uc009yaq.2_Missense_Mutation_p.E593Q	p.E1598Q	NM_001380	NP_001371	WXS	Illumina HiSeq	Unspecified	Q14185	DOCK1_HUMAN		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)	47	4856	+		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)	1598			DHR-2.		A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37	c.4792G>C		.	.	.	.	.	.	.	.	.	.	g	17.61	3.432954	0.62844	.	.	ENSG00000150760	ENST00000280333	T	0.21031	2.03	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	M	0.69185	2.1	0.58432	D	0.999999	B;D;P	0.69078	0.127;0.997;0.83	B;P;B	0.59221	0.198;0.854;0.443	T	0.21759	-1.0236	10	0.48119	T	0.1	.	18.4785	0.90802	0.0:0.0:1.0:0.0	.	1598;1664;1598	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	Q	1598	ENSP00000280333:E1598Q	ENSP00000280333:E1598Q	E	+	1	0	DOCK1	129114206	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	4.543000	0.60684	2.589000	0.87451	0.450000	0.29827	GAG		0.507	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380		27	93	0	0	0	0	27	93				
CYP2E1	1571	broad.mit.edu	37	10	135346344	135346344	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:135346344C>G	ENST00000463117.2	+	7	1069	c.797C>G	c.(796-798)aCc>aGc	p.T266S	CYP2E1_ENST00000252945.3_Missense_Mutation_p.T266S|SPRN_ENST00000541506.1_Intron			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	266					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CGGGACCTCACCGACTGCCTG	0.512									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																													uc001lnj.1		NA																	0				central_nervous_system(3)	3						c.(796-798)ACC>AGC		cytochrome P450, family 2, subfamily E,	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)						60.0	59.0	60.0					10																	135346344		2203	4300	6503	SO:0001583	missense	1571	Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Familial Cancer Database	incl.: Familial Head and Neck Cancer	drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding	g.chr10:135346344C>G	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.797C>G	10.37:g.135346344C>G	ENSP00000440689:p.Thr266Ser		Somatic				CYP2E1_uc001lnk.1_Missense_Mutation_p.T129S|CYP2E1_uc009ybl.1_Missense_Mutation_p.T67S|CYP2E1_uc009ybm.1_5'UTR|CYP2E1_uc001lnl.1_Missense_Mutation_p.T67S	p.T266S	NM_000773	NP_000764	WXS	Illumina HiSeq	Unspecified	P05181	CP2E1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	5	830	+		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	266					Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	ENST00000463117.2	37	c.797C>G	CCDS7686.1	.	.	.	.	.	.	.	.	.	.	C	9.314	1.056341	0.19907	.	.	ENSG00000130649	ENST00000463117;ENST00000252945;ENST00000421586;ENST00000418356	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	4.48	-0.711	0.11230	.	0.256097	0.44097	D	0.000487	T	0.62780	0.2456	L	0.38692	1.165	0.09310	N	1	P;P	0.46327	0.876;0.66	P;B	0.53549	0.729;0.276	T	0.58532	-0.7620	10	0.87932	D	0	.	8.5979	0.33727	0.0:0.4206:0.0:0.5794	.	162;266	Q59EW1;P05181	.;CP2E1_HUMAN	S	266;266;179;129	ENSP00000440689:T266S;ENSP00000252945:T266S;ENSP00000412754:T179S;ENSP00000397299:T129S	ENSP00000252945:T266S	T	+	2	0	CYP2E1	135196334	0.456000	0.25744	0.000000	0.03702	0.040000	0.13550	0.964000	0.29306	-0.113000	0.11958	0.655000	0.94253	ACC		0.512	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051161.2	NM_000773		18	24	0	0	0	0	18	24				
SYCE1	93426	broad.mit.edu	37	10	135370596	135370596	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr10:135370596C>G	ENST00000343131.5	-	7	543	c.439G>C	c.(439-441)Gag>Cag	p.E147Q	SYCE1_ENST00000432597.2_Missense_Mutation_p.E111Q|SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000368517.3_Missense_Mutation_p.E111Q	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	147					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTGTTCTTCTCTTCTTCAATC	0.498																																						uc001lno.2		NA																	0				ovary(1)	1						c.(439-441)GAG>CAG		synaptonemal complex central element protein 1							359.0	343.0	348.0					10																	135370596		2203	4300	6503	SO:0001583	missense	93426				cell division	central element		g.chr10:135370596C>G	AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.439G>C	10.37:g.135370596C>G	ENSP00000341282:p.Glu147Gln		Somatic				CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.E19Q|SYCE1_uc009ybn.2_Missense_Mutation_p.E147Q|SYCE1_uc001lnn.2_Missense_Mutation_p.E111Q	p.E147Q	NM_001143764	NP_001137236	WXS	Illumina HiSeq	Unspecified	Q8N0S2	SYCE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	7	544	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	147			Potential.		B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	ENST00000343131.5	37	c.439G>C	CCDS44501.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.991861	0.54041	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.55052	0.54;3.18;3.18;3.18	4.3	4.3	0.51218	.	0.000000	0.64402	D	0.000002	T	0.65186	0.2667	L	0.50333	1.59	0.29724	N	0.838443	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.996;0.998	T	0.62134	-0.6918	10	0.72032	D	0.01	.	12.5648	0.56304	0.0:1.0:0.0:0.0	.	19;147;111	Q8N0S2-3;Q8N0S2;Q8N0S2-2	.;SYCE1_HUMAN;.	Q	147;111;111;147	ENSP00000303978:E147Q;ENSP00000411779:E111Q;ENSP00000357503:E111Q;ENSP00000341282:E147Q	ENSP00000303978:E147Q	E	-	1	0	SYCE1	135220586	0.933000	0.31639	0.969000	0.41365	0.374000	0.29953	1.587000	0.36622	2.689000	0.91719	0.655000	0.94253	GAG		0.498	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564		14	290	0	0	0	0	14	290				
ATHL1	80162	broad.mit.edu	37	11	294725	294725	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:294725C>G	ENST00000409548.2	+	14	2305	c.2190C>G	c.(2188-2190)ctC>ctG	p.L730L	ATHL1_ENST00000409655.1_Silent_p.L482L|ATHL1_ENST00000409479.1_Silent_p.L757L	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	730					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCGAGTCACTCACTGTGGACC	0.627																																						uc010qvu.1		NA																	0				liver(1)|central_nervous_system(1)|skin(1)	3						c.(2188-2190)CTC>CTG		ATH1, acid trehalase-like 1							74.0	88.0	84.0					11																	294725		2203	4300	6503	SO:0001819	synonymous_variant	80162				carbohydrate metabolic process		hydrolase activity, acting on glycosyl bonds	g.chr11:294725C>G	AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.2190C>G	11.37:g.294725C>G			Somatic				ATHL1_uc001lor.3_Silent_p.L482L|ATHL1_uc001lou.3_Silent_p.L305L|ATHL1_uc001lov.3_Silent_p.L191L	p.L730L	NM_025092	NP_079368	WXS	Illumina HiSeq	Unspecified	Q32M88	ATHL1_HUMAN		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)	14	2305	+		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	730					Q658X8|Q8TEG9|Q9H635	Silent	SNP	ENST00000409548.2	37	c.2190C>G	CCDS31322.2	.	.	.	.	.	.	.	.	.	.	C	1.494	-0.553928	0.03996	.	.	ENSG00000142102	ENST00000397660	.	.	.	2.13	-2.87	0.05700	.	.	.	.	.	T	0.20618	0.0496	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26292	-1.0107	4	.	.	.	.	3.7036	0.08391	0.0:0.3362:0.2262:0.4377	.	.	.	.	D	191	.	.	H	+	1	0	ATHL1	284725	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.403000	0.07214	-0.792000	0.04480	0.462000	0.41574	CAC		0.627	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330164.3	NM_025092		11	178	0	0	0	0	11	178				
SLC25A22	79751	broad.mit.edu	37	11	794488	794488	+	Missense_Mutation	SNP	G	G	A	rs202242484		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:794488G>A	ENST00000320230.5	-	4	653	c.172C>T	c.(172-174)Cgc>Tgc	p.R58C	SLC25A22_ENST00000531214.1_Missense_Mutation_p.R58C	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	58					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCTCGGAGCGGACGGTCTTG	0.692																																					Colon(93;848 1468 3270 23355 49636)	uc001lri.2		NA																	0					0						c.(172-174)CGC>TGC		mitochondrial glutamate carrier 1	L-Glutamic Acid(DB00142)						66.0	43.0	51.0					11																	794488		2199	4297	6496	SO:0001583	missense	79751					integral to membrane|mitochondrial inner membrane|nucleus	L-glutamate transmembrane transporter activity|protein binding|symporter activity	g.chr11:794488G>A	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.172C>T	11.37:g.794488G>A	ENSP00000322020:p.Arg58Cys		Somatic				SLC25A22_uc009yci.2_Missense_Mutation_p.R58C|SLC25A22_uc001lrj.2_Missense_Mutation_p.R58C|SLC25A22_uc009ycj.2_Missense_Mutation_p.R58C	p.R58C	NM_024698	NP_078974	WXS	Illumina HiSeq	Unspecified	Q9H936	GHC1_HUMAN		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	4	514	-		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)	58			Solcar 1.		A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000320230.5	37	c.172C>T	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486366	0.84854	.	.	ENSG00000177542	ENST00000320230;ENST00000531214;ENST00000481290;ENST00000531437;ENST00000533385;ENST00000526152;ENST00000528606;ENST00000527723;ENST00000531514;ENST00000528936;ENST00000456706;ENST00000532484;ENST00000529066;ENST00000531534;ENST00000530360	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4	3.25	3.25	0.37280	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.91737	0.7387	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.984;0.997	D	0.93893	0.7181	10	0.87932	D	0	-18.8225	13.7531	0.62919	0.0:0.0:1.0:0.0	.	58;58	E9PJY0;Q9H936	.;GHC1_HUMAN	C	58;58;83;58;58;58;58;58;58;58;58;58;58;58;58	ENSP00000322020:R58C;ENSP00000437236:R58C;ENSP00000431829:R83C;ENSP00000435862:R58C;ENSP00000434287:R58C;ENSP00000436745:R58C;ENSP00000437045:R58C;ENSP00000434479:R58C;ENSP00000433780:R58C;ENSP00000432817:R58C;ENSP00000392749:R58C;ENSP00000431466:R58C;ENSP00000433028:R58C;ENSP00000435402:R58C;ENSP00000434850:R58C	ENSP00000322020:R58C	R	-	1	0	SLC25A22	784488	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	7.223000	0.78033	1.822000	0.53115	0.436000	0.28706	CGC		0.692	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257107.2			4	11	0	0	0	0	4	11				
SYT8	90019	broad.mit.edu	37	11	1858629	1858629	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:1858629C>G	ENST00000381968.3	+	9	1302	c.1174C>G	c.(1174-1176)Ctt>Gtt	p.L392V	TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|SYT8_ENST00000341958.3_Missense_Mutation_p.L378V|TNNI2_ENST00000381911.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	392					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCAGCCCCGCCTTCGCCTGCG	0.726																																						uc001lue.1		NA																	0				ovary(1)	1						c.(1174-1176)CTT>GTT		synaptotagmin VIII							21.0	23.0	22.0					11																	1858629		2195	4290	6485	SO:0001583	missense	90019					acrosomal vesicle|integral to membrane|plasma membrane|synaptic vesicle	transporter activity	g.chr11:1858629C>G	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1174C>G	11.37:g.1858629C>G	ENSP00000371394:p.Leu392Val		Somatic				SYT8_uc001lud.2_Missense_Mutation_p.L392V|SYT8_uc001luf.1_Missense_Mutation_p.L378V|TNNI2_uc010qxc.1_5'Flank|TNNI2_uc010qxd.1_5'Flank|TNNI2_uc010qxe.1_5'Flank	p.L392V	NM_138567	NP_612634	WXS	Illumina HiSeq	Unspecified	Q8NBV8	SYT8_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	9	1302	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	392			Cytoplasmic (Potential).		A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	c.1174C>G	CCDS7726.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	0.024|0.024	-1.389706|-1.389706	0.01185|0.01185	.|.	.|.	ENSG00000149043|ENSG00000149043	ENST00000381968;ENST00000341958|ENST00000381978	T;T|.	0.11277|.	2.79;2.82|.	0.158|0.158	-0.317|-0.317	0.12736|0.12736	.|.	.|.	.|.	.|.	.|.	T|T	0.19765|0.19765	0.0475|0.0475	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	0.999998|0.999998	B;B|.	0.23854|.	0.092;0.092|.	B;B|.	0.14578|.	0.011;0.011|.	T|T	0.23261|0.23261	-1.0193|-1.0193	8|4	0.72032|.	D|.	0.01|.	.|.	.|.	.|.	.|.	.|.	392;378|.	Q8NBV8;A6NCR4|.	SYT8_HUMAN;.|.	V|R	392;378|390	ENSP00000371394:L392V;ENSP00000343691:L378V|.	ENSP00000343691:L378V|.	L|P	+|+	1|2	0|0	SYT8|SYT8	1815205|1815205	0.041000|0.041000	0.20044|0.20044	0.133000|0.133000	0.22050|0.22050	0.019000|0.019000	0.09904|0.09904	-0.932000|-0.932000	0.03963|0.03963	-0.983000|-0.983000	0.03511|0.03511	-0.974000|-0.974000	0.02594|0.02594	CTT|CCT		0.726	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4			9	7	0	0	0	0	9	7				
SYT9	143425	broad.mit.edu	37	11	7335110	7335110	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:7335110C>G	ENST00000318881.6	+	3	1219	c.982C>G	c.(982-984)Cta>Gta	p.L328V	SYT9_ENST00000396716.2_Missense_Mutation_p.L296V	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	328					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		GGATCACTTCCTAGACTTGGC	0.478																																						uc001mfe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(982-984)CTA>GTA		synaptotagmin IX							179.0	174.0	176.0					11																	7335110		2201	4296	6497	SO:0001583	missense	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7335110C>G	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.982C>G	11.37:g.7335110C>G	ENSP00000324419:p.Leu328Val		Somatic				SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	p.L328V	NM_175733	NP_783860	WXS	Illumina HiSeq	Unspecified	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	3	1219	+			328			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000318881.6	37	c.982C>G	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643761	0.29246	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.59772	0.24;0.26	5.97	1.1	0.20463	C2 calcium-dependent membrane targeting (1);	0.233842	0.30492	N	0.009503	T	0.47875	0.1469	L	0.58583	1.82	0.35211	D	0.775169	B	0.14438	0.01	B	0.15870	0.014	T	0.45498	-0.9257	9	.	.	.	.	8.8571	0.35234	0.0:0.2957:0.0:0.7043	.	328	Q86SS6	SYT9_HUMAN	V	296;328	ENSP00000379944:L296V;ENSP00000324419:L328V	.	L	+	1	2	SYT9	7291686	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	2.222000	0.42926	-0.047000	0.13423	-0.937000	0.02696	CTA		0.478	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733		46	77	0	0	0	0	46	77				
NRIP3	56675	broad.mit.edu	37	11	9007292	9007292	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:9007292G>A	ENST00000309166.3	-	4	641	c.528C>T	c.(526-528)ggC>ggT	p.G176G	NRIP3_ENST00000531090.1_Intron	NM_020645.2	NP_065696.1	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	176							aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|lung(4)|skin(1)|stomach(1)	7				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		GGCGGAGGGAGCCCAGTGTGA	0.542																																						uc001mhg.2		NA																	0					0						c.(526-528)GGC>GGT		nuclear receptor interacting protein 3							152.0	149.0	150.0					11																	9007292		2201	4296	6497	SO:0001819	synonymous_variant	56675				proteolysis		aspartic-type endopeptidase activity	g.chr11:9007292G>A	AJ400877	CCDS31422.1	11p15.3	2008-02-05	2003-09-03	2003-09-05	ENSG00000175352	ENSG00000175352			1167	protein-coding gene	gene with protein product		613125	"""chromosome 11 open reading frame 14"""	C11orf14		11528127	Standard	NM_020645		Approved		uc001mhg.2	Q9NQ35	OTTHUMG00000165680	ENST00000309166.3:c.528C>T	11.37:g.9007292G>A			Somatic				NRIP3_uc010rbu.1_Intron	p.G176G	NM_020645	NP_065696	WXS	Illumina HiSeq	Unspecified	Q9NQ35	NRIP3_HUMAN		Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)	4	642	-			176					Q86WD9	Silent	SNP	ENST00000309166.3	37	c.528C>T	CCDS31422.1																																																																																				0.542	NRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385774.1	NM_020645		34	40	0	0	0	0	34	40				
CSRP3	8048	broad.mit.edu	37	11	19209824	19209824	+	Missense_Mutation	SNP	G	G	A	rs397516851		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:19209824G>A	ENST00000533783.1	-	4	380	c.140C>T	c.(139-141)aCg>aTg	p.T47M	CSRP3_ENST00000265968.3_Missense_Mutation_p.T47M	NM_003476.4	NP_003467.1	P50461	CSRP3_HUMAN	cysteine and glycine-rich protein 3 (cardiac LIM protein)	47	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue development (GO:0048738)|cardiac myofibril assembly (GO:0055003)|cellular calcium ion homeostasis (GO:0006874)|detection of muscle stretch (GO:0035995)|protein localization to organelle (GO:0033365)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)	cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)	actinin binding (GO:0042805)|structural constituent of muscle (GO:0008307)|telethonin binding (GO:0031433)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	10						CGCGACTGTCGTGCTGTCAAG	0.557																																						uc001mpk.2		NA																	0					0						c.(139-141)ACG>ATG		cysteine and glycine-rich protein 3							106.0	97.0	100.0					11																	19209824		2199	4293	6492	SO:0001583	missense	8048				cell differentiation|skeletal muscle tissue development	cytoskeleton|nucleus	protein binding|zinc ion binding	g.chr11:19209824G>A	U20324	CCDS7848.1	11p15.1	2014-09-17				ENSG00000129170			2472	protein-coding gene	gene with protein product		600824				7490106	Standard	NM_003476		Approved	CLP, MLP, CMD1M	uc001mpk.3	P50461		ENST00000533783.1:c.140C>T	11.37:g.19209824G>A	ENSP00000431813:p.Thr47Met		Somatic					p.T47M	NM_003476	NP_003467	WXS	Illumina HiSeq	Unspecified	P50461	CSRP3_HUMAN			3	257	-			47			LIM zinc-binding 1.		Q9P131	Missense_Mutation	SNP	ENST00000533783.1	37	c.140C>T	CCDS7848.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335091	0.81801	.	.	ENSG00000129170	ENST00000265968;ENST00000533783	D;D	0.91295	-2.82;-2.82	5.64	5.64	0.86602	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.96188	0.8757	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.96024	0.9011	10	0.54805	T	0.06	-7.9875	19.3105	0.94186	0.0:0.0:1.0:0.0	.	47	P50461	CSRP3_HUMAN	M	47	ENSP00000265968:T47M;ENSP00000431813:T47M	ENSP00000265968:T47M	T	-	2	0	CSRP3	19166400	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.756000	0.98918	2.664000	0.90586	0.655000	0.94253	ACG		0.557	CSRP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394484.1	NM_003476		37	50	0	0	0	0	37	50				
HARBI1	283254	broad.mit.edu	37	11	46625165	46625165	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:46625165G>A	ENST00000326737.3	-	3	1212	c.965C>T	c.(964-966)cCg>cTg	p.P322L		NM_173811.3	NP_776172.1	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	322						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclease activity (GO:0004518)			large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	3						CTCCTCTTCCGGGGGCTGTTC	0.512																																						uc001ncy.2		NA																	0					0						c.(964-966)CCG>CTG		harbinger transposase derived 1							77.0	74.0	75.0					11																	46625165		2201	4299	6500	SO:0001583	missense	283254					cytoplasm|nucleus	metal ion binding|nuclease activity	g.chr11:46625165G>A	AK057237	CCDS7920.1	11p11.2	2008-07-10	2008-07-01	2008-07-01	ENSG00000180423	ENSG00000180423			26522	protein-coding gene	gene with protein product		615086	"""chromosome 11 open reading frame 77"""	C11orf77		15169610, 18339812	Standard	NM_173811		Approved	FLJ32675	uc001ncy.3	Q96MB7	OTTHUMG00000166537	ENST00000326737.3:c.965C>T	11.37:g.46625165G>A	ENSP00000317743:p.Pro322Leu		Somatic					p.P322L	NM_173811	NP_776172	WXS	Illumina HiSeq	Unspecified	Q96MB7	HARB1_HUMAN			3	1213	-			322					D3DQP9	Missense_Mutation	SNP	ENST00000326737.3	37	c.965C>T	CCDS7920.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205404	0.58234	.	.	ENSG00000180423	ENST00000326737	.	.	.	5.96	5.05	0.67936	.	0.559081	0.18733	N	0.132687	T	0.44030	0.1274	N	0.24115	0.695	0.49915	D	0.999833	B	0.09022	0.002	B	0.01281	0.0	T	0.24905	-1.0147	9	0.21014	T	0.42	-12.1066	14.9888	0.71371	0.0678:0.0:0.9322:0.0	.	322	Q96MB7	HARB1_HUMAN	L	322	.	ENSP00000317743:P322L	P	-	2	0	HARBI1	46581741	0.992000	0.36948	0.972000	0.41901	0.960000	0.62799	2.695000	0.47043	1.535000	0.49220	0.655000	0.94253	CCG		0.512	HARBI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390291.1	NM_173811		21	29	0	0	0	0	21	29				
PTPRJ	5795	broad.mit.edu	37	11	48166647	48166647	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:48166647C>G	ENST00000418331.2	+	14	3234	c.2882C>G	c.(2881-2883)tCa>tGa	p.S961*		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	961					contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						AGTCGCTACTCAGATGCTGTT	0.537																																						uc001ngp.3		NA																	0				breast(3)|kidney(3)|ovary(1)|skin(1)	8						c.(2881-2883)TCA>TGA		protein tyrosine phosphatase, receptor type, J							163.0	143.0	149.0					11																	48166647		2201	4298	6499	SO:0001587	stop_gained	5795				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity	g.chr11:48166647C>G	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.2882C>G	11.37:g.48166647C>G	ENSP00000400010:p.Ser961*		Somatic					p.S961*	NM_002843	NP_002834	WXS	Illumina HiSeq	Unspecified	Q12913	PTPRJ_HUMAN			14	3237	+			961			Extracellular (Potential).		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Nonsense_Mutation	SNP	ENST00000418331.2	37	c.2882C>G	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	C	44	11.122612	0.99518	.	.	ENSG00000149177	ENST00000418331	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.7041	0.69176	0.0:1.0:0.0:0.0	.	.	.	.	X	961	.	ENSP00000400010:S961X	S	+	2	0	PTPRJ	48123223	0.975000	0.34042	0.056000	0.19401	0.518000	0.34316	4.402000	0.59722	2.523000	0.85059	0.655000	0.94253	TCA		0.537	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1			9	107	0	0	0	0	9	107				
OR4S2	219431	broad.mit.edu	37	11	55419207	55419207	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:55419207C>T	ENST00000312422.2	+	1	828	c.828C>T	c.(826-828)atC>atT	p.I276I		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				ACACCATTATCACTCCCATGT	0.408																																						uc001nhs.1		NA																	0				skin(2)|ovary(1)	3						c.(826-828)ATC>ATT		olfactory receptor, family 4, subfamily S,							159.0	145.0	150.0					11																	55419207		2182	4036	6218	SO:0001819	synonymous_variant	219431				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55419207C>T	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.828C>T	11.37:g.55419207C>T			Somatic					p.I276I	NM_001004059	NP_001004059	WXS	Illumina HiSeq	Unspecified	Q8NH73	OR4S2_HUMAN			1	828	+		all_epithelial(135;0.0748)	276			Helical; Name=7; (Potential).		Q6IF72	Silent	SNP	ENST00000312422.2	37	c.828C>T	CCDS31505.1																																																																																				0.408	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059		6	161	0	0	0	0	6	161				
AHNAK	79026	broad.mit.edu	37	11	62297223	62297223	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:62297223C>G	ENST00000378024.4	-	5	4940	c.4666G>C	c.(4666-4668)Gaa>Caa	p.E1556Q	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1556					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCTGGAGCTTCAAGATTCACA	0.458																																						uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(4666-4668)GAA>CAA		AHNAK nucleoprotein isoform 1							115.0	125.0	122.0					11																	62297223		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62297223C>G	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.4666G>C	11.37:g.62297223C>G	ENSP00000367263:p.Glu1556Gln		Somatic				AHNAK_uc001ntk.1_Intron	p.E1556Q	NM_001620	NP_001611	WXS	Illumina HiSeq	Unspecified	Q09666	AHNK_HUMAN			5	4966	-		Melanoma(852;0.155)	1556					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.4666G>C	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	14.96	2.691802	0.48097	.	.	ENSG00000124942	ENST00000378024	T	0.01279	5.06	4.49	4.49	0.54785	.	.	.	.	.	T	0.06600	0.0169	M	0.74258	2.255	0.33147	D	0.545215	D	0.61697	0.99	D	0.62955	0.909	T	0.40098	-0.9581	9	0.19147	T	0.46	.	15.9802	0.80102	0.0:1.0:0.0:0.0	.	1556	Q09666	AHNK_HUMAN	Q	1556	ENSP00000367263:E1556Q	ENSP00000367263:E1556Q	E	-	1	0	AHNAK	62053799	0.892000	0.30473	0.992000	0.48379	0.781000	0.44180	1.488000	0.35551	2.051000	0.60960	0.298000	0.19748	GAA		0.458	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		54	109	0	0	0	0	54	109				
CATSPER1	117144	broad.mit.edu	37	11	65789074	65789074	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:65789074C>G	ENST00000312106.5	-	4	1721	c.1584G>C	c.(1582-1584)ctG>ctC	p.L528L		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	528					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						GGGTCTGCATCAGCAAGAAGT	0.632																																						uc001ogt.2		NA																	0				ovary(2)	2						c.(1582-1584)CTG>CTC		sperm-associated cation channel 1							73.0	74.0	74.0					11																	65789074		2201	4296	6497	SO:0001819	synonymous_variant	117144				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding	g.chr11:65789074C>G	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1584G>C	11.37:g.65789074C>G			Somatic					p.L528L	NM_053054	NP_444282	WXS	Illumina HiSeq	Unspecified	Q8NEC5	CTSR1_HUMAN			4	1722	-			528			Helical; Name=Segment S3; (Potential).		Q96P76	Silent	SNP	ENST00000312106.5	37	c.1584G>C	CCDS8127.1																																																																																				0.632	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054		9	6	0	0	0	0	9	6				
SUV420H1	51111	broad.mit.edu	37	11	67941319	67941319	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:67941319C>G	ENST00000304363.4	-	6	958	c.605G>C	c.(604-606)aGa>aCa	p.R202T	SUV420H1_ENST00000405515.1_Missense_Mutation_p.R202T|SUV420H1_ENST00000401547.2_Missense_Mutation_p.R202T|SUV420H1_ENST00000402789.1_Missense_Mutation_p.R202T|SUV420H1_ENST00000402185.2_Missense_Mutation_p.R179T	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	202	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TGATGAGTATCTATTACATGG	0.284																																						uc001onm.1		NA																	0				ovary(2)|kidney(1)	3						c.(604-606)AGA>ACA		suppressor of variegation 4-20 homolog 1 isoform							106.0	100.0	102.0					11																	67941319		2198	4292	6490	SO:0001583	missense	51111				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr11:67941319C>G	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.605G>C	11.37:g.67941319C>G	ENSP00000305899:p.Arg202Thr		Somatic				SUV420H1_uc009yse.1_5'UTR|SUV420H1_uc001onn.1_Missense_Mutation_p.R30T|SUV420H1_uc009ysf.2_5'UTR|SUV420H1_uc001ono.1_Missense_Mutation_p.R202T|SUV420H1_uc001onp.2_Missense_Mutation_p.R202T|SUV420H1_uc010rqa.1_Missense_Mutation_p.R179T|SUV420H1_uc001onq.2_Missense_Mutation_p.R202T	p.R202T	NM_017635	NP_060105	WXS	Illumina HiSeq	Unspecified	Q4FZB7	SV421_HUMAN			6	861	-			202			SET.		B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	c.605G>C	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.032139	0.93575	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185;ENST00000533271	T;T;T;T;T;D	0.86297	1.0;1.0;1.0;1.0;1.0;-2.1	5.33	5.33	0.75918	SET domain (1);	0.000000	0.85682	D	0.000000	D	0.93733	0.7997	M	0.79614	2.46	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.989;1.0	D;D;D;D	0.97110	1.0;0.999;0.985;0.998	D	0.94092	0.7354	10	0.87932	D	0	-31.6932	19.3925	0.94590	0.0:1.0:0.0:0.0	.	179;202;202;202	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	T	202;202;202;202;179;30	ENSP00000305899:R202T;ENSP00000385965:R202T;ENSP00000385640:R202T;ENSP00000385005:R202T;ENSP00000384724:R179T;ENSP00000433589:R30T	ENSP00000305899:R202T	R	-	2	0	SUV420H1	67697895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.752000	0.85141	2.669000	0.90835	0.591000	0.81541	AGA		0.284	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635		22	34	0	0	0	0	22	34				
C11orf24	53838	broad.mit.edu	37	11	68029521	68029521	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:68029521G>A	ENST00000304271.6	-	4	1344	c.942C>T	c.(940-942)atC>atT	p.I314I	C11orf24_ENST00000533310.1_Intron|C11orf24_ENST00000530166.1_5'Flank	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	314	Pro-rich.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						CCATCTCAGGGATTGGGCTGG	0.667																																					NSCLC(21;855 905 4198 36694)	uc001onr.3		NA																	0					0						c.(940-942)ATC>ATT		hypothetical protein LOC53838 precursor							65.0	59.0	61.0					11																	68029521		2200	4294	6494	SO:0001819	synonymous_variant	53838					integral to membrane		g.chr11:68029521G>A	AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.942C>T	11.37:g.68029521G>A			Somatic				C11orf24_uc001ons.2_Silent_p.I314I	p.I314I	NM_022338	NP_071733	WXS	Illumina HiSeq	Unspecified	Q96F05	CK024_HUMAN			4	1384	-			314			Extracellular (Potential).|Pro-rich.		Q9H2K4	Silent	SNP	ENST00000304271.6	37	c.942C>T	CCDS8180.1																																																																																				0.667	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338		10	34	0	0	0	0	10	34				
AQP11	282679	broad.mit.edu	37	11	77301533	77301533	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:77301533G>A	ENST00000313578.3	+	1	854	c.496G>A	c.(496-498)Gcg>Acg	p.A166T	AQP11_ENST00000528638.1_Intron	NM_173039.2	NP_766627.1	Q8NBQ7	AQP11_HUMAN	aquaporin 11	166					endosomal lumen acidification (GO:0048388)|protein homooligomerization (GO:0051260)|proximal tubule development (GO:0072014)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			kidney(2)|large_intestine(1)|lung(5)	8	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			CTTGCTCAAAGCGGTCATCAC	0.567																																						uc001oyj.2		NA																	0					0						c.(496-498)GCG>ACG		aquaporin 11							112.0	105.0	107.0					11																	77301533		2200	4292	6492	SO:0001583	missense	282679					cell surface|integral to membrane	transporter activity	g.chr11:77301533G>A	AB028147	CCDS8251.1	11q13.5	2008-02-05			ENSG00000178301	ENSG00000178301		"""Ion channels / Aquaporins"""	19940	protein-coding gene	gene with protein product		609914				16107722	Standard	NM_173039		Approved		uc001oyj.3	Q8NBQ7	OTTHUMG00000165194	ENST00000313578.3:c.496G>A	11.37:g.77301533G>A	ENSP00000318770:p.Ala166Thr		Somatic				AQP11_uc009yuu.2_Intron	p.A166T	NM_173039	NP_766627	WXS	Illumina HiSeq	Unspecified	Q8NBQ7	AQP11_HUMAN	Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)		1	854	+	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		166			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000313578.3	37	c.496G>A	CCDS8251.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815718	0.90790	.	.	ENSG00000178301	ENST00000313578	T	0.50001	0.76	5.54	5.54	0.83059	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	T	0.70064	0.3181	M	0.71581	2.175	0.58432	D	0.999992	D	0.89917	1.0	D	0.85130	0.997	T	0.72157	-0.4375	10	0.72032	D	0.01	-9.9208	19.4839	0.95022	0.0:0.0:1.0:0.0	.	166	Q8NBQ7	AQP11_HUMAN	T	166	ENSP00000318770:A166T	ENSP00000318770:A166T	A	+	1	0	AQP11	76979181	1.000000	0.71417	0.991000	0.47740	0.500000	0.33767	6.076000	0.71267	2.606000	0.88127	0.491000	0.48974	GCG		0.567	AQP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382582.1	NM_173039		30	14	0	0	0	0	30	14				
CCDC90B	60492	broad.mit.edu	37	11	82985036	82985036	+	Splice_Site	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:82985036C>G	ENST00000529689.1	-	5	861		c.e5-1		CCDC90B_ENST00000529073.1_Splice_Site|CCDC90B_ENST00000455220.2_Splice_Site|CCDC90B_ENST00000525503.1_Splice_Site|CCDC90B_ENST00000529611.1_Splice_Site			Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Acute lymphoblastic leukemia(157;0.103)				TTTTCATTTTCTAGGTACAGG	0.284																																						uc001pae.2		NA																	0					0						c.e5-1		coiled-coil domain containing 90B precursor							80.0	79.0	79.0					11																	82985036		2202	4292	6494	SO:0001630	splice_region_variant	60492					integral to membrane|mitochondrion|mitochondrion		g.chr11:82985036C>G	BC048795	CCDS8266.1, CCDS66190.1, CCDS66191.1	11q14.1	2006-10-23			ENSG00000137500	ENSG00000137500			28108	protein-coding gene	gene with protein product						11230166	Standard	XM_005274154		Approved	MDS025, MDS011	uc001pae.3	Q9GZT6	OTTHUMG00000167078	ENST00000529689.1:c.427-1G>C	11.37:g.82985036C>G			Somatic				CCDC90B_uc001pac.2_Splice_Site_p.K42_splice|CCDC90B_uc001pad.2_Splice_Site_p.K42_splice|CCDC90B_uc001paf.2_Splice_Site_p.K134_splice	p.K143_splice	NM_021825	NP_068597	WXS	Illumina HiSeq	Unspecified	Q9GZT6	CC90B_HUMAN			5	789	-		Acute lymphoblastic leukemia(157;0.103)						A8K8I4|B3KP87|B4E3L2|Q3B781|Q9GZU6	Splice_Site	SNP	ENST00000529689.1	37	c.427_splice	CCDS8266.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262834	0.80358	.	.	ENSG00000137500	ENST00000529689;ENST00000455220;ENST00000525503;ENST00000529611;ENST00000527495;ENST00000529073	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC90B	82662684	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.640000	0.74319	2.894000	0.99253	0.591000	0.81541	.		0.284	CCDC90B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392940.2	NM_021825	Intron	6	5	0	0	0	0	6	5				
MSANTD4	84437	broad.mit.edu	37	11	105880399	105880399	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:105880399C>G	ENST00000301919.4	-	3	2316	c.901G>C	c.(901-903)Gag>Cag	p.E301Q	MSANTD4_ENST00000529805.1_5'UTR	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	301						nucleus (GO:0005634)											CGTTCTCGCTCAAGTTTTAAC	0.408																																						uc001piy.2		NA																	0				breast(1)	1						c.(901-903)GAG>CAG		hypothetical protein LOC84437							160.0	144.0	150.0					11																	105880399		2201	4298	6499	SO:0001583	missense	84437					nucleus		g.chr11:105880399C>G	AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.901G>C	11.37:g.105880399C>G	ENSP00000304713:p.Glu301Gln		Somatic				KIAA1826_uc001piz.2_Missense_Mutation_p.E301Q	p.E301Q	NM_032424	NP_115800	WXS	Illumina HiSeq	Unspecified	Q8NCY6	K1826_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)	3	1074	-		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)	301			Potential.		Q96JK1|Q96JZ3|Q9H2N4	Missense_Mutation	SNP	ENST00000301919.4	37	c.901G>C	CCDS31663.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102813	0.76983	.	.	ENSG00000170903	ENST00000301919	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	L	0.29908	0.895	0.53688	D	0.999971	P	0.51653	0.947	D	0.65140	0.932	T	0.64377	-0.6422	9	0.39692	T	0.17	-18.1965	19.1309	0.93406	0.0:1.0:0.0:0.0	.	301	Q8NCY6	K1826_HUMAN	Q	301	.	ENSP00000304713:E301Q	E	-	1	0	KIAA1826	105385609	1.000000	0.71417	0.997000	0.53966	0.750000	0.42670	6.817000	0.75252	2.587000	0.87381	0.491000	0.48974	GAG		0.408	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424		6	74	0	0	0	0	6	74				
OR10G8	219869	broad.mit.edu	37	11	123900988	123900988	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr11:123900988T>C	ENST00000431524.1	+	1	692	c.659T>C	c.(658-660)aTc>aCc	p.I220T		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TATGTGTCCATCGTCTGTTCC	0.542																																						uc001pzp.1		NA																	0				ovary(1)|skin(1)	2						c.(658-660)ATC>ACC		olfactory receptor, family 10, subfamily G,							174.0	150.0	158.0					11																	123900988		2201	4299	6500	SO:0001583	missense	219869				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123900988T>C	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.659T>C	11.37:g.123900988T>C	ENSP00000389072:p.Ile220Thr		Somatic					p.I220T	NM_001004464	NP_001004464	WXS	Illumina HiSeq	Unspecified	Q8NGN5	O10G8_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)	1	659	+		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	220			Cytoplasmic (Potential).		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	c.659T>C	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	T	8.929	0.963081	0.18583	.	.	ENSG00000234560	ENST00000431524	T	0.00402	7.56	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000142	T	0.00936	0.0031	H	0.96142	3.775	0.38043	D	0.93553	B	0.24675	0.109	B	0.34931	0.192	T	0.12192	-1.0557	10	0.87932	D	0	.	11.0743	0.48021	0.0:0.0:0.0:1.0	.	220	Q8NGN5	O10G8_HUMAN	T	220	ENSP00000389072:I220T	ENSP00000389072:I220T	I	+	2	0	OR10G8	123406198	1.000000	0.71417	0.750000	0.31169	0.015000	0.08874	5.283000	0.65621	1.319000	0.45190	0.455000	0.32223	ATC		0.542	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464		29	11	0	0	0	0	29	11				
DCP1B	196513	broad.mit.edu	37	12	2061703	2061703	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:2061703G>C	ENST00000280665.6	-	7	1482	c.1403C>G	c.(1402-1404)tCt>tGt	p.S468C	DCP1B_ENST00000541700.1_5'Flank|DCP1B_ENST00000397173.4_Missense_Mutation_p.S366C|DCP1B_ENST00000540622.1_Missense_Mutation_p.S342C	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	468					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			TGGCCGGTTAGAGGCATGCAG	0.537																																						uc001qjx.1		NA																	0				skin(1)	1						c.(1402-1404)TCT>TGT		decapping enzyme Dcp1b							93.0	95.0	94.0					12																	2061703		2203	4300	6503	SO:0001583	missense	196513				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding	g.chr12:2061703G>C	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.1403C>G	12.37:g.2061703G>C	ENSP00000280665:p.Ser468Cys		Somatic				DCP1B_uc010sdy.1_Missense_Mutation_p.S366C	p.S468C	NM_152640	NP_689853	WXS	Illumina HiSeq	Unspecified	Q8IZD4	DCP1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00193)		7	1483	-			468					B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	37	c.1403C>G	CCDS31727.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246928	0.39697	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.19806	2.12;2.14;2.12	4.66	3.75	0.43078	.	1.455700	0.03726	N	0.252675	T	0.26521	0.0648	L	0.47716	1.5	0.09310	N	1	P;P	0.49358	0.923;0.871	B;B	0.43916	0.436;0.436	T	0.21793	-1.0235	10	0.56958	D	0.05	-0.0023	9.1132	0.36741	0.0:0.1607:0.6729:0.1664	.	366;468	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	C	468;366;342	ENSP00000280665:S468C;ENSP00000380358:S366C;ENSP00000444374:S342C	ENSP00000280665:S468C	S	-	2	0	DCP1B	1931964	0.009000	0.17119	0.001000	0.08648	0.034000	0.12701	1.761000	0.38440	1.132000	0.42129	0.609000	0.83330	TCT		0.537	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640		6	67	0	0	0	0	6	67				
TAS2R46	259292	broad.mit.edu	37	12	11214516	11214516	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:11214516C>T	ENST00000533467.1	-	1	377	c.378G>A	c.(376-378)aaG>aaA	p.K126K	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	126					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GAACAACACTCTTAACTCTCC	0.348																																						uc001qzp.1		NA																	0				ovary(1)	1						c.(376-378)AAG>AAA		taste receptor, type 2, member 46							93.0	97.0	96.0					12																	11214516		2023	4207	6230	SO:0001819	synonymous_variant	259292				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity	g.chr12:11214516C>T	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.378G>A	12.37:g.11214516C>T			Somatic				PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	p.K126K	NM_176887	NP_795368	WXS	Illumina HiSeq	Unspecified	P59540	T2R46_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)	1	378	-			126			Cytoplasmic (Potential).		P59548|Q645X6	Silent	SNP	ENST00000533467.1	37	c.378G>A	CCDS53748.1																																																																																				0.348	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887		33	59	0	0	0	0	33	59				
GRIN2B	2904	broad.mit.edu	37	12	13764753	13764753	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:13764753C>T	ENST00000609686.1	-	8	1895	c.1686G>A	c.(1684-1686)atG>atA	p.M562I		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	562					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCATCACAAACATCATCACCC	0.478																																						uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(1684-1686)ATG>ATA		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						140.0	121.0	127.0					12																	13764753		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13764753C>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1686G>A	12.37:g.13764753C>T	ENSP00000477455:p.Met562Ile		Somatic					p.M562I	NM_000834	NP_000825	WXS	Illumina HiSeq	Unspecified	Q13224	NMDE2_HUMAN			8	1865	-			562			Helical; (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.1686G>A	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171519	0.78452	.	.	ENSG00000150086	ENST00000279593	T	0.45276	0.9	6.09	6.09	0.99107	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.33990	0.0882	N	0.05351	-0.065	0.80722	D	1	B	0.23490	0.086	B	0.33121	0.158	T	0.28459	-1.0043	10	0.87932	D	0	.	20.6949	0.99706	0.0:1.0:0.0:0.0	.	562	Q13224	NMDE2_HUMAN	I	562	ENSP00000279593:M562I	ENSP00000279593:M562I	M	-	3	0	GRIN2B	13656020	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.778000	0.85637	2.899000	0.99337	0.655000	0.94253	ATG		0.478	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			7	67	0	0	0	0	7	67				
SLC38A2	54407	broad.mit.edu	37	12	46760703	46760703	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:46760703C>T	ENST00000256689.5	-	7	951	c.507G>A	c.(505-507)gtG>gtA	p.V169V	SLC38A2_ENST00000547252.1_5'UTR|SLC38A2_ENST00000551374.1_5'Flank	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	169					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		ACTCATATTTCACTATGAAGA	0.388																																					Ovarian(9;448 492 8335 28722 40361)	uc001rpg.2		NA																	0				urinary_tract(1)|skin(1)	2						c.(505-507)GTG>GTA		solute carrier family 38, member 2							87.0	83.0	84.0					12																	46760703		2203	4300	6503	SO:0001819	synonymous_variant	54407				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity	g.chr12:46760703C>T	AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.507G>A	12.37:g.46760703C>T			Somatic				SLC38A2_uc010sli.1_5'Flank|SLC38A2_uc001rph.2_Silent_p.V69V	p.V169V	NM_018976	NP_061849	WXS	Illumina HiSeq	Unspecified	Q96QD8	S38A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)	7	947	-	Lung SC(27;0.192)|Renal(347;0.236)		169			Helical; (Potential).		Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Silent	SNP	ENST00000256689.5	37	c.507G>A	CCDS8749.1																																																																																				0.388	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404226.1			14	37	0	0	0	0	14	37				
GPD1	2819	broad.mit.edu	37	12	50500130	50500130	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:50500130C>T	ENST00000301149.3	+	4	652	c.420C>T	c.(418-420)ctC>ctT	p.L140L	GPD1_ENST00000547190.1_3'UTR|GPD1_ENST00000548814.1_Silent_p.L117L	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	140					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GGGAGCGCCTCGGCATCCCCA	0.617																																					NSCLC(141;1402 1905 9497 13391 44868)	uc001rvz.2		NA																	0					0						c.(418-420)CTC>CTT		glycerol-3-phosphate dehydrogenase 1 (soluble)	NADH(DB00157)						73.0	61.0	65.0					12																	50500130		2203	4300	6503	SO:0001819	synonymous_variant	2819				glycerol-3-phosphate catabolic process|triglyceride biosynthetic process	cytosol|glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|protein homodimerization activity	g.chr12:50500130C>T		CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.420C>T	12.37:g.50500130C>T			Somatic				GPD1_uc001rwa.2_Silent_p.L117L	p.L140L	NM_005276	NP_005267	WXS	Illumina HiSeq	Unspecified	P21695	GPDA_HUMAN			4	453	+			140					F8W1L5|Q8N1B0	Silent	SNP	ENST00000301149.3	37	c.420C>T	CCDS8799.1																																																																																				0.617	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406018.1			11	10	0	0	0	0	11	10				
NPFF	8620	broad.mit.edu	37	12	53899914	53899914	+	IGR	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:53899914C>T	ENST00000267017.3	-	0	592				TARBP2_ENST00000266987.2_Silent_p.I361I|TARBP2_ENST00000552857.1_3'UTR|TARBP2_ENST00000394357.2_Silent_p.I340I|TARBP2_ENST00000456234.2_Silent_p.I340I	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						ACCTCAAGATCATGGCAGGCA	0.617																																						uc001sdo.2		NA																	0				central_nervous_system(1)	1						c.(1081-1083)ATC>ATT		TAR RNA binding protein 2 isoform a							36.0	36.0	36.0					12																	53899914		2203	4300	6503	SO:0001628	intergenic_variant	6895				miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding	g.chr12:53899914C>T	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53899914C>T			Somatic				TARBP2_uc001sdp.2_Silent_p.I340I|TARBP2_uc001sdq.2_Silent_p.I217I|TARBP2_uc001sdr.2_Silent_p.I217I|TARBP2_uc001sds.2_3'UTR|TARBP2_uc001sdt.2_Silent_p.I340I|TARBP2_uc001sdu.2_Silent_p.I217I|TARBP2_uc001sdv.2_RNA	p.I361I	NM_134323	NP_599150	WXS	Illumina HiSeq	Unspecified	Q15633	TRBP2_HUMAN			9	1571	+			361			Sufficient for interaction with DICER1.|DRBM 3.|Sufficient for interaction with PRKRA.		Q3SXL4	Silent	SNP	ENST00000267017.3	37	c.1083C>T	CCDS8862.1																																																																																				0.617	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717		7	21	0	0	0	0	7	21				
HOXC13	3229	broad.mit.edu	37	12	54332775	54332775	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:54332775G>A	ENST00000243056.3	+	1	241	c.85G>A	c.(85-87)Ggc>Agc	p.G29S	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	29	Gly-rich.				anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						gagcggcatcggcggcggcgg	0.697			T	NUP98	AML																																	uc001sei.2		NA		Dom	yes		12	12q13.3	3229	T	homeo box C13			L	NUP98		AML		0				breast(1)	1						c.(85-87)GGC>AGC		homeobox C13							3.0	3.0	3.0					12																	54332775		1916	3835	5751	SO:0001583	missense	3229					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54332775G>A		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.85G>A	12.37:g.54332775G>A	ENSP00000243056:p.Gly29Ser		Somatic				HOXC13_uc010sop.1_RNA	p.G29S	NM_017410	NP_059106	WXS	Illumina HiSeq	Unspecified	P31276	HXC13_HUMAN			1	200	+			29			Gly-rich.		Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	ENST00000243056.3	37	c.85G>A	CCDS8865.1	.	.	.	.	.	.	.	.	.	.	G	8.326	0.825376	0.16749	.	.	ENSG00000123364	ENST00000243056	D	0.92647	-3.08	0.413	0.413	0.16401	.	.	.	.	.	D	0.87704	0.6244	N	0.08118	0	0.18873	N	0.999984	D	0.67145	0.996	P	0.59703	0.862	T	0.78814	-0.2056	8	0.46703	T	0.11	.	.	.	.	.	29	P31276	HXC13_HUMAN	S	29	ENSP00000243056:G29S	ENSP00000243056:G29S	G	+	1	0	HOXC13	52619042	0.499000	0.26083	0.989000	0.46669	0.426000	0.31534	0.000000	0.12993	0.447000	0.26695	0.175000	0.17021	GGC		0.697	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358865.2			5	5	0	0	0	0	5	5				
MYO1A	4640	broad.mit.edu	37	12	57430774	57430774	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:57430774C>T	ENST00000442789.2	-	21	2444	c.2157G>A	c.(2155-2157)ctG>ctA	p.L719L	MYO1A_ENST00000476795.1_5'Flank|MYO1A_ENST00000544473.1_Silent_p.L557L|MYO1A_ENST00000300119.3_Silent_p.L719L	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	719	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						TCTTTCGCATCAGTTGGTAGT	0.522																																						uc001smw.3		NA																	0				skin(4)|ovary(2)|urinary_tract(1)	7						c.(2155-2157)CTG>CTA		myosin IA							111.0	109.0	110.0					12																	57430774		2203	4300	6503	SO:0001819	synonymous_variant	4640				sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr12:57430774C>T	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.2157G>A	12.37:g.57430774C>T			Somatic				MYO1A_uc010sqz.1_Silent_p.L557L|MYO1A_uc009zpd.2_Silent_p.L719L	p.L719L	NM_005379	NP_005370	WXS	Illumina HiSeq	Unspecified	Q9UBC5	MYO1A_HUMAN			20	2400	-			719			IQ 1.		Q9UQD7	Silent	SNP	ENST00000442789.2	37	c.2157G>A	CCDS8929.1																																																																																				0.522	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379		37	64	0	0	0	0	37	64				
CRADD	8738	broad.mit.edu	37	12	94244018	94244018	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:94244018C>T	ENST00000542893.2	+	3	889	c.571C>T	c.(571-573)Ccc>Tcc	p.P191S	CRADD_ENST00000548483.1_Intron|CRADD_ENST00000332896.3_Missense_Mutation_p.P191S|CRADD_ENST00000548330.1_3'UTR|CRADD_ENST00000541813.1_Intron			P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with death domain	191					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic signaling pathway (GO:2001235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death domain binding (GO:0070513)|protease binding (GO:0002020)|protein binding, bridging (GO:0030674)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)	8						GGAGGTGGACCCCTCGCTGCT	0.632																																						uc001tda.2		NA																	0				ovary(1)	1						c.(571-573)CCC>TCC		CASP2 and RIPK1 domain containing adaptor with							40.0	41.0	41.0					12																	94244018		2201	4297	6498	SO:0001583	missense	8738				apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging	g.chr12:94244018C>T	U84388	CCDS9048.1	12q21.33-q23.1	2008-08-04				ENSG00000169372			2340	protein-coding gene	gene with protein product	"""RIP-associated ICH1/CED3-homologous protein with death domain"""	603454				8985253, 9044836	Standard	NM_003805		Approved	RAIDD	uc001tda.3	P78560		ENST00000542893.2:c.571C>T	12.37:g.94244018C>T	ENSP00000439068:p.Pro191Ser		Somatic				CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	p.P191S	NM_003805	NP_003796	WXS	Illumina HiSeq	Unspecified	P78560	CRADD_HUMAN			3	675	+			191					B7Z2Q5	Missense_Mutation	SNP	ENST00000542893.2	37	c.571C>T	CCDS9048.1	.	.	.	.	.	.	.	.	.	.	C	9.636	1.137740	0.21123	.	.	ENSG00000169372	ENST00000332896;ENST00000542893	T;T	0.42513	0.97;0.97	5.76	4.86	0.63082	Death (1);DEATH-like (1);	0.104775	0.64402	D	0.000002	T	0.41994	0.1183	M	0.66939	2.045	0.80722	D	1	B	0.27166	0.17	B	0.34536	0.185	T	0.37596	-0.9699	10	0.41790	T	0.15	-13.0885	6.8195	0.23849	0.1467:0.7136:0.0:0.1398	.	191	P78560	CRADD_HUMAN	S	191	ENSP00000327647:P191S;ENSP00000439068:P191S	ENSP00000327647:P191S	P	+	1	0	CRADD	92768149	0.999000	0.42202	0.987000	0.45799	0.087000	0.18053	2.438000	0.44837	1.417000	0.47077	0.563000	0.77884	CCC		0.632	CRADD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408515.1	NM_003805		11	26	0	0	0	0	11	26				
CCDC63	160762	broad.mit.edu	37	12	111318961	111318961	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:111318961G>A	ENST00000308208.5	+	7	956	c.714G>A	c.(712-714)caG>caA	p.Q238Q	CCDC63_ENST00000545036.1_Silent_p.Q198Q|CCDC63_ENST00000550317.1_3'UTR|CCDC63_ENST00000552694.1_Silent_p.Q159Q	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	238										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						AAGACCGCCAGAAGAAGGACA	0.557																																						uc001trv.1		NA																	0				skin(6)|ovary(1)|pancreas(1)	8						c.(712-714)CAG>CAA		coiled-coil domain containing 63							72.0	60.0	64.0					12																	111318961		2203	4300	6503	SO:0001819	synonymous_variant	160762							g.chr12:111318961G>A	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.714G>A	12.37:g.111318961G>A			Somatic				CCDC63_uc009zvt.1_Missense_Mutation_p.E93K|CCDC63_uc010sye.1_Silent_p.Q198Q|CCDC63_uc001trw.1_Silent_p.Q153Q	p.Q238Q	NM_152591	NP_689804	WXS	Illumina HiSeq	Unspecified	Q8NA47	CCD63_HUMAN			7	909	+			238			Potential.		B4DY03|Q0P603|Q6P2E1	Silent	SNP	ENST00000308208.5	37	c.714G>A	CCDS9151.1																																																																																				0.557	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591		3	21	0	0	0	0	3	21				
KSR2	283455	broad.mit.edu	37	12	117968797	117968797	+	Missense_Mutation	SNP	G	G	A	rs374020752		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:117968797G>A	ENST00000339824.5	-	12	2478	c.1751C>T	c.(1750-1752)aCg>aTg	p.T584M	KSR2_ENST00000302438.5_Missense_Mutation_p.T281M|KSR2_ENST00000425217.1_Missense_Mutation_p.T555M|KSR2_ENST00000545002.1_5'UTR			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	584					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCGGGTCGGCGTCTCCGGCAC	0.562																																						uc001two.2		NA																	0				lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15						c.(1663-1665)ACG>ATG		kinase suppressor of ras 2		G	MET/THR	0,3842		0,0,1921	89.0	103.0	98.0		1664	5.1	1.0	12		98	1,8257		0,1,4128	no	missense	KSR2	NM_173598.4	81	0,1,6049	AA,AG,GG		0.0121,0.0,0.0083	benign	555/922	117968797	1,12099	1921	4129	6050	SO:0001583	missense	283455				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity	g.chr12:117968797G>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1751C>T	12.37:g.117968797G>A	ENSP00000339952:p.Thr584Met		Somatic					p.T555M	NM_173598	NP_775869	WXS	Illumina HiSeq	Unspecified	Q6VAB6	KSR2_HUMAN			12	1719	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		584					A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37	c.1664C>T		.	.	.	.	.	.	.	.	.	.	G	12.88	2.070599	0.36566	0.0	1.21E-4	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;D	0.86297	-1.19;-1.19;-2.1	5.13	5.13	0.70059	.	0.662759	0.16095	N	0.229865	T	0.77651	0.4162	L	0.34521	1.04	0.37092	D	0.899471	P	0.43633	0.813	B	0.30572	0.117	T	0.81614	-0.0853	10	0.45353	T	0.12	.	12.3426	0.55103	0.0777:0.0:0.9223:0.0	.	584	Q6VAB6	KSR2_HUMAN	M	555;584;281;256	ENSP00000389715:T555M;ENSP00000339952:T584M;ENSP00000305466:T281M	ENSP00000305466:T281M	T	-	2	0	KSR2	116453180	1.000000	0.71417	0.991000	0.47740	0.671000	0.39405	6.062000	0.71155	2.540000	0.85666	0.650000	0.86243	ACG		0.562	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598		45	72	0	0	0	0	45	72				
SRRM4	84530	broad.mit.edu	37	12	119568510	119568510	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:119568510G>A	ENST00000267260.4	+	8	1030	c.642G>A	c.(640-642)ggG>ggA	p.G214G	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	214	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CTGAGGAAGGGCAGAAGTCCC	0.652																																						uc001txa.1		NA																	0				ovary(2)	2						c.(640-642)GGG>GGA		KIAA1853 protein							18.0	23.0	21.0					12																	119568510		1898	4099	5997	SO:0001819	synonymous_variant	84530				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding	g.chr12:119568510G>A	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.642G>A	12.37:g.119568510G>A			Somatic					p.G214G	NM_194286	NP_919262	WXS	Illumina HiSeq	Unspecified	A7MD48	SRRM4_HUMAN			8	934	+			214			Ser-rich.		A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Silent	SNP	ENST00000267260.4	37	c.642G>A	CCDS44994.1																																																																																				0.652	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286		5	4	0	0	0	0	5	4				
UBC	7316	broad.mit.edu	37	12	125397967	125397967	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr12:125397967C>G	ENST00000538617.1	-	3	667	c.351G>C	c.(349-351)caG>caC	p.Q117H	UBC_ENST00000339647.5_Missense_Mutation_p.Q117H|UBC_ENST00000536769.1_Missense_Mutation_p.Q117H|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000536661.1_5'Flank|UBC_ENST00000546120.1_Intron			P0CG48	UBC_HUMAN	ubiquitin C	497	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.G111fs*15(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		AGATCAACCTCTGCTGGTCAG	0.547																																						uc001ugs.3		NA																	1	Deletion - Frameshift(1)		ovary(1)	ovary(2)	2						c.(349-351)CAG>CAC		ubiquitin C							189.0	175.0	180.0					12																	125397967		2203	4300	6503	SO:0001583	missense	7316				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	g.chr12:125397967C>G		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.351G>C	12.37:g.125397967C>G	ENSP00000443053:p.Gln117His		Somatic				UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Missense_Mutation_p.Q117H|UBC_uc001ugt.2_Missense_Mutation_p.Q117H|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_5'UTR	p.Q117H	NM_021009	NP_066289	WXS	Illumina HiSeq	Unspecified	P0CG48	UBC_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)	2	799	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		117			Ubiquitin-like 2.		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000538617.1	37	c.351G>C		.	.	.	.	.	.	.	.	.	.	-	17.23	3.337813	0.60963	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000538617;ENST00000339647;ENST00000540351;ENST00000541645;ENST00000535131;ENST00000546271;ENST00000540700;ENST00000535859	D;D;D;D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	4.12	4.12	0.48240	Ubiquitin supergroup (1);Ubiquitin conserved site (1);Ubiquitin (2);	0.000000	0.56097	U	0.000022	D	0.93406	0.7897	H	0.97852	4.09	0.80722	D	1	P;P;D	0.56746	0.934;0.919;0.977	P;P;P	0.59288	0.855;0.773;0.855	D	0.95949	0.8953	10	0.87932	D	0	.	15.327	0.74172	0.0:1.0:0.0:0.0	.	206;117;117	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	H	117	ENSP00000441543:Q117H;ENSP00000443053:Q117H;ENSP00000344818:Q117H;ENSP00000442800:Q117H;ENSP00000445337:Q117H;ENSP00000439492:Q117H;ENSP00000438289:Q117H;ENSP00000441238:Q117H;ENSP00000437452:Q117H	ENSP00000344818:Q117H	Q	-	3	2	UBC	123963920	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.792000	0.55476	2.011000	0.59026	0.650000	0.86243	CAG		0.547	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009		60	112	0	0	0	0	60	112				
USPL1	10208	broad.mit.edu	37	13	31233392	31233392	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr13:31233392G>C	ENST00000255304.4	+	9	3520	c.3178G>C	c.(3178-3180)Gat>Cat	p.D1060H		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	1060					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		GATGAAGACTGATATTTTCGA	0.378																																					Ovarian(60;318 1180 1554 28110 31601)	uc001utc.2		NA																	0				pancreas(2)|skin(1)	3						c.(3178-3180)GAT>CAT		ubiquitin specific peptidase like 1							89.0	91.0	90.0					13																	31233392		2202	4300	6502	SO:0001583	missense	10208				ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity	g.chr13:31233392G>C	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.3178G>C	13.37:g.31233392G>C	ENSP00000255304:p.Asp1060His		Somatic				USPL1_uc001utd.2_Missense_Mutation_p.D731H|USPL1_uc001ute.1_Missense_Mutation_p.D731H	p.D1060H	NM_005800	NP_005791	WXS	Illumina HiSeq	Unspecified	Q5W0Q7	USPL1_HUMAN		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)	9	3610	+		Lung SC(185;0.0257)|Breast(139;0.203)	1060					Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	37	c.3178G>C	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269413	0.59540	.	.	ENSG00000132952	ENST00000255304	T	0.51071	0.72	5.62	4.76	0.60689	.	0.168389	0.41712	D	0.000822	T	0.64571	0.2610	M	0.61703	1.905	0.38210	D	0.940452	D	0.76494	0.999	D	0.68765	0.96	T	0.71484	-0.4579	10	0.87932	D	0	-29.7502	14.1095	0.65113	0.0:0.0:0.8496:0.1504	.	1060	Q5W0Q7	USPL1_HUMAN	H	1060	ENSP00000255304:D1060H	ENSP00000255304:D1060H	D	+	1	0	USPL1	30131392	1.000000	0.71417	0.985000	0.45067	0.713000	0.41058	6.165000	0.71891	1.328000	0.45358	0.557000	0.71058	GAT		0.378	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800		7	56	0	0	0	0	7	56				
COG3	83548	broad.mit.edu	37	13	46092895	46092895	+	Splice_Site	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr13:46092895A>G	ENST00000349995.5	+	18	2042		c.e18-1			NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3						ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		TTTGTTTCACAGATGCAGCAT	0.398																																					Ovarian(150;1048 1859 18083 21577 42700)	uc001vak.2		NA																	0				breast(1)|skin(1)	2						c.e18-2		component of golgi transport complex 3							125.0	117.0	120.0					13																	46092895		2203	4300	6503	SO:0001630	splice_region_variant	83548				ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity	g.chr13:46092895A>G	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1931-1A>G	13.37:g.46092895A>G			Somatic				COG3_uc010tfv.1_Splice_Site_p.D481_splice|COG3_uc010aci.2_Splice_Site_p.D420_splice	p.D644_splice	NM_031431	NP_113619	WXS	Illumina HiSeq	Unspecified	Q96JB2	COG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)	18	2032	+		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)						B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Splice_Site	SNP	ENST00000349995.5	37	c.1931_splice	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982435	0.74474	.	.	ENSG00000136152	ENST00000349995	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9872	0.80168	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COG3	44990896	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.695000	0.91298	2.367000	0.80283	0.528000	0.53228	.		0.398	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		Intron	6	56	0	0	0	0	6	56				
LCP1	3936	broad.mit.edu	37	13	46732751	46732751	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr13:46732751C>G	ENST00000398576.2	-	7	652	c.264G>C	c.(262-264)aaG>aaC	p.K88N	LCP1_ENST00000323076.2_Missense_Mutation_p.K88N|LCP1_ENST00000460190.1_5'Flank			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	88					actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TTCTAAAGGTCTTGGCAACAT	0.398			T	BCL6	NHL																																	uc001vaz.3		NA		Dom	yes		13	13q14.1-q14.3	3936	T	lymphocyte cytosolic protein 1 (L-plastin)			L	BCL6		NHL 		0				lung(4)|ovary(3)	7						c.(262-264)AAG>AAC		L-plastin							152.0	136.0	142.0					13																	46732751		2203	4300	6503	SO:0001583	missense	3936				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding	g.chr13:46732751C>G	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.264G>C	13.37:g.46732751C>G	ENSP00000381581:p.Lys88Asn		Somatic				LCP1_uc001vba.3_Missense_Mutation_p.K88N	p.K88N	NM_002298	NP_002289	WXS	Illumina HiSeq	Unspecified	P13796	PLSL_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)	4	390	-		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	88					B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	ENST00000398576.2	37	c.264G>C	CCDS9403.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639663	0.67244	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000416500	T;T;T	0.09538	2.97;2.97;2.97	5.62	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.25865	0.0630	M	0.77820	2.39	0.80722	D	1	D	0.56746	0.977	P	0.59825	0.864	T	0.01884	-1.1254	10	0.33141	T	0.24	-27.7282	9.921	0.41464	0.0:0.7734:0.0:0.2266	.	88	P13796	PLSL_HUMAN	N	88	ENSP00000315757:K88N;ENSP00000381581:K88N;ENSP00000408052:K88N	ENSP00000315757:K88N	K	-	3	2	LCP1	45630752	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.881000	0.28173	1.473000	0.48159	0.655000	0.94253	AAG		0.398	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044800.3	NM_002298		13	38	0	0	0	0	13	38				
ARHGEF7	8874	broad.mit.edu	37	13	111919901	111919901	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr13:111919901C>G	ENST00000375741.2	+	10	1270	c.1020C>G	c.(1018-1020)ccC>ccG	p.P340P	ARHGEF7_ENST00000483189.1_3'UTR|ARHGEF7_ENST00000370623.3_Silent_p.P247P|ARHGEF7_ENST00000317133.5_Silent_p.P319P|ARHGEF7_ENST00000375723.1_Silent_p.P162P|ARHGEF7_ENST00000375736.4_Silent_p.P162P|ARHGEF7_ENST00000478679.1_Silent_p.P84P|ARHGEF7_ENST00000544132.1_Missense_Mutation_p.R43G|ARHGEF7_ENST00000426073.2_Silent_p.P162P|ARHGEF7_ENST00000218789.5_Silent_p.P162P|ARHGEF7_ENST00000375739.2_Silent_p.P290P|ARHGEF7_ENST00000375737.5_Silent_p.P237P	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	340	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P162P(1)|p.P319P(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CCAGGTTGCCCGAAGCTCAGC	0.453																																						uc001vrs.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(1018-1020)CCC>CCG		PAK-interacting exchange factor beta isoform c							141.0	125.0	130.0					13																	111919901		2203	4300	6503	SO:0001819	synonymous_variant	8874				apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr13:111919901C>G	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1020C>G	13.37:g.111919901C>G			Somatic				ARHGEF7_uc001vrr.2_Silent_p.P319P|ARHGEF7_uc001vrt.2_Silent_p.P290P|ARHGEF7_uc010tjn.1_RNA|ARHGEF7_uc001vru.1_Silent_p.P162P|ARHGEF7_uc001vrv.3_Silent_p.P162P|ARHGEF7_uc001vrw.3_Silent_p.P162P|ARHGEF7_uc001vrx.3_Silent_p.P162P|ARHGEF7_uc010tjo.1_Silent_p.P237P|ARHGEF7_uc010tjp.1_Silent_p.P84P|ARHGEF7_uc010agn.1_Silent_p.P84P	p.P340P	NM_001113511	NP_001106983	WXS	Illumina HiSeq	Unspecified	Q14155	ARHG7_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.188)		10	1270	+	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		340			DH.		B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000375741.2	37	c.1020C>G	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	C	6.529	0.465780	0.12402	.	.	ENSG00000102606	ENST00000544132	.	.	.	4.55	-4.0	0.04057	.	.	.	.	.	T	0.31638	0.0803	.	.	.	0.27513	N	0.951637	.	.	.	.	.	.	T	0.41106	-0.9527	5	0.87932	D	0	.	1.5301	0.02533	0.2338:0.1409:0.1121:0.5132	.	.	.	.	G	43	.	ENSP00000445384:R43G	R	+	1	2	ARHGEF7	110717902	0.011000	0.17503	0.974000	0.42286	0.424000	0.31475	-1.092000	0.03366	-0.894000	0.03925	-1.417000	0.01113	CGA		0.453	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511		33	130	0	0	0	0	33	130				
ATP11A	23250	broad.mit.edu	37	13	113481013	113481013	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr13:113481013C>G	ENST00000487903.1	+	12	1117	c.1029C>G	c.(1027-1029)ctC>ctG	p.L343L	ATP11A_ENST00000375630.2_Silent_p.L343L|ATP11A_ENST00000375645.3_Silent_p.L343L|ATP11A_ENST00000283558.8_Silent_p.L343L			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	343					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TGCAGTTCCTCAAGGCATTCA	0.537																																						uc001vsi.3		NA																	0				large_intestine(2)|ovary(2)	4						c.(1027-1029)CTC>CTG		ATPase, class VI, type 11A isoform a							101.0	91.0	94.0					13																	113481013		2203	4300	6503	SO:0001819	synonymous_variant	23250				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr13:113481013C>G	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1029C>G	13.37:g.113481013C>G			Somatic				ATP11A_uc001vsj.3_Silent_p.L343L|ATP11A_uc001vsm.1_Silent_p.L219L	p.L343L	NM_015205	NP_056020	WXS	Illumina HiSeq	Unspecified	P98196	AT11A_HUMAN			12	1117	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)	343			Extracellular (Potential).		Q5VXT2	Silent	SNP	ENST00000487903.1	37	c.1029C>G	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	C	0.194	-1.050963	0.01981	.	.	ENSG00000068650	ENST00000418678	.	.	.	5.05	4.2	0.49525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4591	0.11657	0.0:0.5988:0.2026:0.1986	.	.	.	.	X	318	.	.	S	+	2	0	ATP11A	112529014	0.995000	0.38212	0.878000	0.34440	0.001000	0.01503	0.871000	0.28023	1.103000	0.41568	-0.312000	0.09012	TCA		0.537	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		19	89	0	0	0	0	19	89				
RNASE10	338879	broad.mit.edu	37	14	20978796	20978796	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:20978796A>T	ENST00000328444.5	+	1	185	c.166A>T	c.(166-168)Act>Tct	p.T56S	RNASE10_ENST00000430083.1_Missense_Mutation_p.T84S	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	56					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		AGCTGAGGCCACTGAGGAGGG	0.537																																						uc010tlj.1		NA																	0					0						c.(166-168)ACT>TCT		ribonuclease, RNase A family, 10 (non-active)							103.0	104.0	104.0					14																	20978796		2203	4300	6503	SO:0001583	missense	338879					extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:20978796A>T		CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.166A>T	14.37:g.20978796A>T	ENSP00000333358:p.Thr56Ser		Somatic				RNASE10_uc001vxp.2_Missense_Mutation_p.T84S	p.T56S	NM_001012975	NP_001012993	WXS	Illumina HiSeq	Unspecified	Q5GAN6	RNS10_HUMAN	Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)	1	166	+	all_cancers(95;0.00123)		56					A2RUQ3|B4DKY4	Missense_Mutation	SNP	ENST00000328444.5	37	c.166A>T	CCDS32035.1	.	.	.	.	.	.	.	.	.	.	A	6.083	0.383636	0.11524	.	.	ENSG00000182545	ENST00000430083;ENST00000328444	T;T	0.21361	2.01;2.02	4.29	0.557	0.17260	.	0.752070	0.11490	N	0.558797	T	0.13114	0.0318	L	0.34521	1.04	0.09310	N	1	B;B	0.21905	0.062;0.062	B;B	0.14023	0.01;0.01	T	0.29852	-0.9998	10	0.72032	D	0.01	-24.9147	2.3615	0.04308	0.528:0.0:0.2599:0.2121	.	56;84	Q5GAN6;B4DKY4	RNS10_HUMAN;.	S	84;56	ENSP00000392996:T84S;ENSP00000333358:T56S	ENSP00000333358:T56S	T	+	1	0	RNASE10	20048636	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	1.574000	0.36482	0.081000	0.16988	-0.250000	0.11733	ACT		0.537	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411088.1	XM_292225		24	33	0	0	0	0	24	33				
MMP14	4323	broad.mit.edu	37	14	23310776	23310776	+	Missense_Mutation	SNP	C	C	T	rs139231227		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:23310776C>T	ENST00000311852.6	+	2	446	c.185C>T	c.(184-186)tCa>tTa	p.S62L	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	62					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	CAGTCACTCTCAGCGGCCATC	0.557																																						uc001whc.2		NA																	0					0						c.(184-186)TCA>TTA		matrix metalloproteinase 14 preproprotein		C	LEU/SER	0,4406		0,0,2203	114.0	87.0	96.0		185	5.6	1.0	14	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	missense	MMP14	NM_004995.2	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	62/583	23310776	1,13005	2203	4300	6503	SO:0001583	missense	4323					extracellular matrix|integral to plasma membrane|melanosome	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr14:23310776C>T		CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.185C>T	14.37:g.23310776C>T	ENSP00000308208:p.Ser62Leu		Somatic					p.S62L	NM_004995	NP_004986	WXS	Illumina HiSeq	Unspecified	P50281	MMP14_HUMAN		GBM - Glioblastoma multiforme(265;0.00551)	2	419	+	all_cancers(95;9.47e-05)		62					A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	ENST00000311852.6	37	c.185C>T	CCDS9577.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590329	0.86851	0.0	1.16E-4	ENSG00000157227	ENST00000311852;ENST00000548761	T;T	0.36520	1.25;1.25	5.64	5.64	0.86602	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.251229	0.40908	D	0.000988	T	0.47173	0.1431	M	0.73372	2.23	0.33042	D	0.531635	P	0.37015	0.578	P	0.46208	0.507	T	0.57831	-0.7743	10	0.29301	T	0.29	.	13.4388	0.61101	0.1571:0.8429:0.0:0.0	.	62	P50281	MMP14_HUMAN	L	62;68	ENSP00000308208:S62L;ENSP00000446989:S68L	ENSP00000308208:S62L	S	+	2	0	MMP14	22380616	0.046000	0.20272	1.000000	0.80357	0.995000	0.86356	2.484000	0.45242	2.654000	0.90174	0.650000	0.86243	TCA		0.557	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071660.3	NM_004995		3	20	0	0	0	0	3	20				
FOXG1	2290	broad.mit.edu	37	14	29237831	29237831	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:29237831C>T	ENST00000313071.4	+	1	1545	c.1346C>T	c.(1345-1347)tCg>tTg	p.S449L	FOXG1_ENST00000382535.3_Missense_Mutation_p.S449L	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	449				QAPST -> AGPPRP (in Ref. 1; CAA52240 and 2; CAA55038). {ECO:0000305}.|ST -> RP (in Ref. 1; CAA52239). {ECO:0000305}.	aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CAGGCCCCCTCGACCCTGCCC	0.582																																						uc001wqe.2		NA																	0				ovary(2)|lung(2)	4						c.(1345-1347)TCG>TTG		forkhead box G1							62.0	61.0	61.0					14																	29237831		2203	4300	6503	SO:0001583	missense	2290				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr14:29237831C>T		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1346C>T	14.37:g.29237831C>T	ENSP00000339004:p.Ser449Leu		Somatic					p.S449L	NM_005249	NP_005240	WXS	Illumina HiSeq	Unspecified	P55316	FOXG1_HUMAN	LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)	1	1545	+			449	ST -> RP (in Ref. 1; CAA52239).|QAPST -> AGPPRP (in Ref. 1; CAA52240 and 2; CAA55038).				A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	c.1346C>T	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.868118	0.32977	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93659	-3.26;-3.26	4.14	3.22	0.36961	.	0.137457	0.49916	U	0.000122	D	0.82761	0.5107	N	0.14661	0.345	0.45216	D	0.998222	P	0.47545	0.897	B	0.30943	0.122	T	0.81113	-0.1080	10	0.33141	T	0.24	.	13.2956	0.60294	0.1598:0.8402:0.0:0.0	.	449	P55316	FOXG1_HUMAN	L	449	ENSP00000371975:S449L;ENSP00000339004:S449L	ENSP00000339004:S449L	S	+	2	0	FOXG1	28307582	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	7.253000	0.78320	0.823000	0.34589	0.491000	0.48974	TCG		0.582	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3			22	37	0	0	0	0	22	37				
ARHGAP5	394	broad.mit.edu	37	14	32560615	32560615	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:32560615A>G	ENST00000345122.3	+	2	1055	c.740A>G	c.(739-741)gAt>gGt	p.D247G	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.D247G|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.D247G|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.D247G	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	247					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CAAATGTTGGATAAAACTCGT	0.343																																					NSCLC(9;77 350 3443 29227 41353)	uc001wrl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(739-741)GAT>GGT		Rho GTPase activating protein 5 isoform b							106.0	117.0	113.0					14																	32560615		2203	4298	6501	SO:0001583	missense	394				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding	g.chr14:32560615A>G	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.740A>G	14.37:g.32560615A>G	ENSP00000371897:p.Asp247Gly		Somatic				ARHGAP5_uc001wrm.2_Missense_Mutation_p.D247G|ARHGAP5_uc001wrn.2_Missense_Mutation_p.D247G|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	p.D247G	NM_001173	NP_001025226	WXS	Illumina HiSeq	Unspecified	Q13017	RHG05_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)	2	979	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		247					A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	c.740A>G	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.091384	0.55968	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.90352	0.6981	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91619	0.5309	10	0.72032	D	0.01	.	16.1081	0.81237	1.0:0.0:0.0:0.0	.	247;247	Q13017-2;Q13017	.;RHG05_HUMAN	G	247	ENSP00000452222:D247G;ENSP00000441692:D247G;ENSP00000371897:D247G;ENSP00000393307:D247G	ENSP00000371897:D247G	D	+	2	0	ARHGAP5	31630366	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.194000	0.70268	0.533000	0.62120	GAT		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		55	92	0	0	0	0	55	92				
AKAP6	9472	broad.mit.edu	37	14	33004796	33004796	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:33004796A>G	ENST00000280979.4	+	3	531	c.361A>G	c.(361-363)Atc>Gtc	p.I121V	AKAP6_ENST00000557354.1_Missense_Mutation_p.I121V|AKAP6_ENST00000557272.1_Missense_Mutation_p.I121V	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	121					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGTTGAGCAAATCCATGCCCT	0.473																																					Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(361-363)ATC>GTC		A-kinase anchor protein 6							156.0	134.0	142.0					14																	33004796		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33004796A>G	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.361A>G	14.37:g.33004796A>G	ENSP00000280979:p.Ile121Val		Somatic				AKAP6_uc010aml.2_Missense_Mutation_p.I118V	p.I121V	NM_004274	NP_004265	WXS	Illumina HiSeq	Unspecified	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	3	531	+	Breast(36;0.0388)|Prostate(35;0.15)		121					A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.361A>G	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.581156	0.86748	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.28069	2.89;1.64;1.63	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.54046	0.1834	M	0.66939	2.045	0.53005	D	0.99996	D;D	0.59357	0.985;0.985	D;D	0.67548	0.952;0.952	T	0.56854	-0.7910	10	0.87932	D	0	-11.8458	16.1416	0.81528	1.0:0.0:0.0:0.0	.	121;121	A7E242;Q13023	.;AKAP6_HUMAN	V	121	ENSP00000280979:I121V;ENSP00000450531:I121V;ENSP00000451247:I121V	ENSP00000280979:I121V	I	+	1	0	AKAP6	32074547	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.207000	0.95064	2.209000	0.71365	0.482000	0.46254	ATC		0.473	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		30	63	0	0	0	0	30	63				
RALGAPA1	253959	broad.mit.edu	37	14	36103865	36103865	+	Silent	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:36103865A>G	ENST00000389698.3	-	32	4782	c.4392T>C	c.(4390-4392)ttT>ttC	p.F1464F	RALGAPA1_ENST00000258840.6_Silent_p.F1511F|RALGAPA1_ENST00000382366.3_Silent_p.F1477F|RALGAPA1_ENST00000307138.6_Silent_p.F1464F	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1464	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCAAATGCATAAAAGGATCAT	0.423																																						uc001wti.2		NA																	0				ovary(3)|breast(1)	4						c.(4390-4392)TTT>TTC		Ral GTPase activating protein, alpha subunit 1							65.0	62.0	63.0					14																	36103865		2203	4299	6502	SO:0001819	synonymous_variant	253959				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity	g.chr14:36103865A>G	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.4392T>C	14.37:g.36103865A>G			Somatic				RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Silent_p.F1464F|RALGAPA1_uc010tpv.1_Silent_p.F1477F|RALGAPA1_uc010tpw.1_Silent_p.F1511F	p.F1464F	NM_014990	NP_055805	WXS	Illumina HiSeq	Unspecified	Q6GYQ0	RGPA1_HUMAN			32	4783	-			1464			Minimal domain that binds to TCF3/E12 (By similarity).		A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	ENST00000389698.3	37	c.4392T>C	CCDS32065.1																																																																																				0.423	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022		16	35	0	0	0	0	16	35				
FRMD6	122786	broad.mit.edu	37	14	52156612	52156612	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:52156612A>G	ENST00000344768.5	+	2	254	c.58A>G	c.(58-60)Att>Gtt	p.I20V	FRMD6_ENST00000356218.4_Missense_Mutation_p.I20V|FRMD6_ENST00000395718.2_Missense_Mutation_p.I20V|RNA5SP385_ENST00000515947.1_RNA			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	20	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					CAGTGTGTGCATTTTCCTTCC	0.433																																						uc001wzd.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(58-60)ATT>GTT		FERM domain containing 6							106.0	89.0	94.0					14																	52156612		2203	4300	6503	SO:0001583	missense	122786					cytoskeleton|mitochondrion|plasma membrane	binding	g.chr14:52156612A>G	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.58A>G	14.37:g.52156612A>G	ENSP00000343899:p.Ile20Val		Somatic				FRMD6_uc001wzb.2_Missense_Mutation_p.I20V|FRMD6_uc001wzc.2_Missense_Mutation_p.I20V	p.I20V	NM_152330	NP_689543	WXS	Illumina HiSeq	Unspecified	Q96NE9	FRMD6_HUMAN			2	343	+	all_epithelial(31;0.0163)|Breast(41;0.089)		20			FERM.		D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	ENST00000344768.5	37	c.58A>G	CCDS58318.1	.	.	.	.	.	.	.	.	.	.	A	4.175	0.031139	0.08101	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554778	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.87	5.87	0.94306	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.052602	0.85682	D	0.000000	T	0.22475	0.0542	N	0.00368	-1.59	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.14023	0.01;0.006	T	0.42783	-0.9431	10	0.02654	T	1	.	9.7147	0.40268	0.9218:0.0:0.0782:0.0	.	20;20	Q96NE9;Q96NE9-2	FRMD6_HUMAN;.	V	20	ENSP00000348550:I20V;ENSP00000379068:I20V;ENSP00000343899:I20V;ENSP00000452122:I20V	ENSP00000343899:I20V	I	+	1	0	FRMD6	51226362	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	6.474000	0.73578	2.243000	0.73865	0.482000	0.46254	ATT		0.433	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330		23	21	0	0	0	0	23	21				
PTGDR	5729	broad.mit.edu	37	14	52741596	52741596	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:52741596C>T	ENST00000306051.2	+	2	1096	c.994C>T	c.(994-996)Cgg>Tgg	p.R332W	PTGDR_ENST00000553372.1_3'UTR	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	332			R -> Q (in dbSNP:rs41312506). {ECO:0000269|Ref.3}.		adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	TCCAGTATTTCGGATATTTTT	0.413																																						uc001wzq.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(994-996)CGG>TGG		prostaglandin D2 receptor	Nedocromil(DB00716)																																			SO:0001583	missense	5729					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding	g.chr14:52741596C>T	U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	ENST00000306051.2:c.994C>T	14.37:g.52741596C>T	ENSP00000303424:p.Arg332Trp		Somatic					p.R332W	NM_000953	NP_000944	WXS	Illumina HiSeq	Unspecified	Q13258	PD2R_HUMAN			2	1096	+	Breast(41;0.0639)|all_epithelial(31;0.0887)		332			Cytoplasmic (Potential).		G3V5L3|Q13250|Q13251|Q1ZZ52	Missense_Mutation	SNP	ENST00000306051.2	37	c.994C>T	CCDS9707.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788721	0.70337	.	.	ENSG00000168229	ENST00000306051	T	0.58358	0.34	5.2	5.2	0.72013	.	0.000000	0.43919	D	0.000514	T	0.55847	0.1946	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66081	-0.6012	10	0.87932	D	0	-20.0312	18.2013	0.89839	0.0:1.0:0.0:0.0	.	332	Q13258	PD2R_HUMAN	W	332	ENSP00000303424:R332W	ENSP00000303424:R332W	R	+	1	2	PTGDR	51811346	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	2.263000	0.43293	2.814000	0.96858	0.655000	0.94253	CGG		0.413	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276889.1	NM_000953		11	13	0	0	0	0	11	13				
RTN1	6252	broad.mit.edu	37	14	60072193	60072193	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:60072193G>A	ENST00000267484.5	-	5	2340	c.2005C>T	c.(2005-2007)Cag>Tag	p.Q669*	RTN1_ENST00000395090.1_Nonsense_Mutation_p.Q86*|RTN1_ENST00000342503.4_Nonsense_Mutation_p.Q101*|RTN1_ENST00000557422.1_Intron	NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	669	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		ATCTGCTCCTGAGAAAGGGTG	0.517																																						uc001xen.1		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(2005-2007)CAG>TAG		reticulon 1 isoform A							92.0	83.0	86.0					14																	60072193		2203	4300	6503	SO:0001587	stop_gained	6252				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity	g.chr14:60072193G>A	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.2005C>T	14.37:g.60072193G>A	ENSP00000267484:p.Gln669*		Somatic				RTN1_uc001xem.1_Nonsense_Mutation_p.Q249*|RTN1_uc001xek.1_Nonsense_Mutation_p.Q101*|RTN1_uc001xel.1_RNA|RTN1_uc010apl.1_Nonsense_Mutation_p.Q86*	p.Q669*	NM_021136	NP_066959	WXS	Illumina HiSeq	Unspecified	Q16799	RTN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0968)	5	2214	-			669			Reticulon.		Q16800|Q16801|Q5BKZ4|Q9BQ59	Nonsense_Mutation	SNP	ENST00000267484.5	37	c.2005C>T	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	G	40	8.000760	0.98605	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000395090;ENST00000342503;ENST00000433623	.	.	.	5.68	5.68	0.88126	.	0.159668	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.8407	0.96681	0.0:0.0:1.0:0.0	.	.	.	.	X	249;669;86;101;595	.	ENSP00000267484:Q669X	Q	-	1	0	RTN1	59141946	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.005000	0.88553	2.699000	0.92147	0.549000	0.68633	CAG		0.517	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			13	35	0	0	0	0	13	35				
ZBTB1	22890	broad.mit.edu	37	14	64988268	64988268	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:64988268A>T	ENST00000554015.1	+	4	477	c.46A>T	c.(46-48)Aac>Tac	p.N16Y	ZBTB1_ENST00000394712.2_Missense_Mutation_p.N16Y|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Missense_Mutation_p.N16Y			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	16					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		GCAGCTAAACAACCAAAGAGA	0.393																																						uc001xhh.3		NA																	0				skin(1)	1						c.(46-48)AAC>TAC		zinc finger and BTB domain containing 1 isoform							100.0	95.0	97.0					14																	64988268		2203	4300	6503	SO:0001583	missense	22890				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr14:64988268A>T	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.46A>T	14.37:g.64988268A>T	ENSP00000451000:p.Asn16Tyr		Somatic				ZBTB1_uc010aqg.2_Missense_Mutation_p.N16Y|ZBTB1_uc001xhi.2_Missense_Mutation_p.N16Y	p.N16Y	NM_001123329	NP_001116801	WXS	Illumina HiSeq	Unspecified	Q9Y2K1	ZBTB1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)	4	477	+		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)	16					A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	c.46A>T	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.033956	0.75504	.	.	ENSG00000126804	ENST00000553583;ENST00000556965;ENST00000554015;ENST00000358738;ENST00000394712;ENST00000555321	T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;1.97	5.92	5.92	0.95590	BTB/POZ (1);BTB/POZ fold (2);	0.177372	0.41194	D	0.000924	T	0.74794	0.3763	L	0.41710	1.295	0.53005	D	0.999966	D;D	0.65815	0.992;0.995	P;D	0.64321	0.735;0.924	T	0.77281	-0.2646	10	0.87932	D	0	-26.4592	16.3782	0.83418	1.0:0.0:0.0:0.0	.	16;16	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	Y	16	ENSP00000451584:N16Y;ENSP00000450689:N16Y;ENSP00000451000:N16Y;ENSP00000351587:N16Y;ENSP00000378201:N16Y;ENSP00000451332:N16Y	ENSP00000351587:N16Y	N	+	1	0	ZBTB1	64058021	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	7.327000	0.79147	2.277000	0.76020	0.528000	0.53228	AAC		0.393	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1			26	42	0	0	0	0	26	42				
RDH11	51109	broad.mit.edu	37	14	68151825	68151825	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:68151825G>C	ENST00000381346.4	-	6	871	c.761C>G	c.(760-762)tCc>tGc	p.S254C	RP11-1012A1.4_ENST00000553306.1_Missense_Mutation_p.P85A|RP11-1012A1.4_ENST00000554493.1_5'UTR|RDH11_ENST00000428130.2_Missense_Mutation_p.S184C|RDH11_ENST00000553384.1_Missense_Mutation_p.S241C	NM_001252650.1|NM_016026.3	NP_001239579.1|NP_057110.3	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11 (all-trans/9-cis/11-cis)	254					adaptation of rhodopsin mediated signaling (GO:0016062)|phototransduction, visible light (GO:0007603)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|photoreceptor inner segment (GO:0001917)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)	12				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	GATGAAAAAGGAGAAAAGCCA	0.493																																						uc001xjv.3		NA																	0				ovary(1)	1						c.(760-762)TCC>TGC		retinol dehydrogenase 11	Vitamin A(DB00162)						103.0	88.0	93.0					14																	68151825		2203	4300	6503	SO:0001583	missense	51109				retinol metabolic process|steroid metabolic process	endoplasmic reticulum membrane|integral to membrane	binding|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity	g.chr14:68151825G>C	AF151840	CCDS32104.1, CCDS58326.1	14q24.1	2013-10-15	2006-05-09		ENSG00000072042	ENSG00000072042	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	17964	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 1"", ""androgen-regulated short-chain dehydrogenase/reductase 1"""	607849	"""retinol dehydrogenase 11 (all-trans and 9-cis)"""			12226107, 8018917, 19027726	Standard	NM_016026		Approved	MDT1, SDR7C1, ARSDR1	uc001xjv.4	Q8TC12	OTTHUMG00000171196	ENST00000381346.4:c.761C>G	14.37:g.68151825G>C	ENSP00000370750:p.Ser254Cys		Somatic				RDH11_uc001xjw.3_Missense_Mutation_p.S241C|RDH11_uc001xjx.3_Missense_Mutation_p.S184C	p.S254C	NM_016026	NP_057110	WXS	Illumina HiSeq	Unspecified	Q8TC12	RDH11_HUMAN		all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	6	851	-			254			Cytoplasmic (Potential).		A6NDK3|A8K062|B2RB26|B4DDW0|Q0QD40|Q6IAH5|Q9NRW0|Q9Y391	Missense_Mutation	SNP	ENST00000381346.4	37	c.761C>G	CCDS32104.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676816	0.67928	.	.	ENSG00000072042	ENST00000381346;ENST00000553384;ENST00000428130;ENST00000554035;ENST00000557273	D;D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56;-2.32	5.07	4.16	0.48862	NAD(P)-binding domain (1);	0.000000	0.43260	D	0.000582	D	0.93552	0.7942	M	0.89478	3.035	0.24554	N	0.994002	D;D;D	0.61697	0.988;0.99;0.983	P;P;P	0.61003	0.533;0.882;0.682	D	0.87259	0.2278	10	0.38643	T	0.18	.	11.0546	0.47911	0.0872:0.0:0.9128:0.0	.	184;241;254	B4DDW0;Q8TC12-2;Q8TC12	.;.;RDH11_HUMAN	C	254;241;184;140;167	ENSP00000370750:S254C;ENSP00000452079:S241C;ENSP00000416395:S184C;ENSP00000450802:S140C;ENSP00000450651:S167C	ENSP00000370750:S254C	S	-	2	0	RDH11	67221578	1.000000	0.71417	0.951000	0.38953	0.958000	0.62258	3.646000	0.54396	1.316000	0.45131	0.591000	0.81541	TCC		0.493	RDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412257.3			4	64	0	0	0	0	4	64				
RDH12	145226	broad.mit.edu	37	14	68196078	68196078	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:68196078C>G	ENST00000551171.1	+	8	1153	c.829C>G	c.(829-831)Ctg>Gtg	p.L277V	RDH12_ENST00000267502.3_Missense_Mutation_p.L277V|RDH12_ENST00000539142.1_Missense_Mutation_p.L277V	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	277					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	CCTGGAGCCCCTGAGTGGCAA	0.642																																						uc001xjz.3		NA																	0				ovary(1)	1						c.(829-831)CTG>GTG		retinol dehydrogenase 12	Vitamin A(DB00162)						40.0	43.0	42.0					14																	68196078		2203	4300	6503	SO:0001583	missense	145226				photoreceptor cell maintenance|response to stimulus|retinol metabolic process	intracellular	binding|retinol dehydrogenase activity	g.chr14:68196078C>G	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.829C>G	14.37:g.68196078C>G	ENSP00000449079:p.Leu277Val		Somatic					p.L277V	NM_152443	NP_689656	WXS	Illumina HiSeq	Unspecified	Q96NR8	RDH12_HUMAN		all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	8	1153	+			277					B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	37	c.829C>G	CCDS9787.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821639	0.50633	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	T;T;T	0.62232	0.04;0.04;0.04	5.74	3.91	0.45181	NAD(P)-binding domain (1);	0.288111	0.35151	N	0.003410	T	0.38532	0.1044	N	0.20328	0.56	0.80722	D	1	B	0.20368	0.044	B	0.19946	0.027	T	0.21381	-1.0247	10	0.02654	T	1	.	7.5481	0.27778	0.0:0.6867:0.169:0.1443	.	277	Q96NR8	RDH12_HUMAN	V	277	ENSP00000449079:L277V;ENSP00000267502:L277V;ENSP00000438715:L277V	ENSP00000267502:L277V	L	+	1	2	RDH12	67265831	0.733000	0.28132	1.000000	0.80357	0.994000	0.84299	1.058000	0.30504	0.762000	0.33152	0.655000	0.94253	CTG		0.642	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1			5	86	0	0	0	0	5	86				
SIPA1L1	26037	broad.mit.edu	37	14	72138364	72138364	+	Silent	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:72138364T>C	ENST00000555818.1	+	8	3132	c.2784T>C	c.(2782-2784)agT>agC	p.S928S	SIPA1L1_ENST00000537413.1_Silent_p.S403S|SIPA1L1_ENST00000381232.3_Silent_p.S928S|SIPA1L1_ENST00000358550.2_Silent_p.S928S	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	928					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CAGTGGGTAGTTTTATTAACA	0.398																																						uc001xms.2		NA																	0				ovary(3)|breast(1)	4						c.(2782-2784)AGT>AGC		signal-induced proliferation-associated 1 like							65.0	63.0	63.0					14																	72138364		2203	4300	6503	SO:0001819	synonymous_variant	26037				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity	g.chr14:72138364T>C	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2784T>C	14.37:g.72138364T>C			Somatic				SIPA1L1_uc001xmt.2_Silent_p.S928S|SIPA1L1_uc001xmu.2_Silent_p.S928S|SIPA1L1_uc001xmv.2_Silent_p.S928S|SIPA1L1_uc010ttm.1_Silent_p.S403S	p.S928S	NM_015556	NP_056371	WXS	Illumina HiSeq	Unspecified	O43166	SI1L1_HUMAN		all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)	8	3132	+			928					J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	c.2784T>C	CCDS9807.1																																																																																				0.398	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556		53	35	0	0	0	0	53	35				
RGS6	9628	broad.mit.edu	37	14	72939626	72939626	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:72939626C>G	ENST00000553530.1	+	9	790	c.583C>G	c.(583-585)Caa>Gaa	p.Q195E	RGS6_ENST00000554782.1_Missense_Mutation_p.Q56E|RGS6_ENST00000343854.6_Missense_Mutation_p.Q195E|RGS6_ENST00000553525.1_Missense_Mutation_p.Q195E|RGS6_ENST00000404301.2_Missense_Mutation_p.Q195E|RGS6_ENST00000402788.2_Missense_Mutation_p.Q195E|RGS6_ENST00000355512.6_Missense_Mutation_p.Q195E|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000407322.4_Missense_Mutation_p.Q195E|RGS6_ENST00000406236.4_Missense_Mutation_p.Q195E|RGS6_ENST00000434263.2_Missense_Mutation_p.Q126E|RGS6_ENST00000556437.1_Missense_Mutation_p.Q195E|RGS6_ENST00000555571.1_Missense_Mutation_p.Q195E	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	195					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TTTGGATAGTCAAGAACGAGC	0.363																																					Ovarian(143;1926 2468 21071 48641)	uc001xna.3		NA																	0				upper_aerodigestive_tract(1)|lung(1)|skin(1)	3						c.(583-585)CAA>GAA		regulator of G-protein signalling 6							141.0	159.0	153.0					14																	72939626		2203	4300	6503	SO:0001583	missense	9628				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity	g.chr14:72939626C>G	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.583C>G	14.37:g.72939626C>G	ENSP00000452331:p.Gln195Glu		Somatic				RGS6_uc010ttn.1_Missense_Mutation_p.Q195E|RGS6_uc001xmx.3_Missense_Mutation_p.Q195E|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.Q195E|RGS6_uc010ttp.1_Missense_Mutation_p.Q126E|RGS6_uc001xmz.1_Missense_Mutation_p.Q56E|RGS6_uc010arg.2_RNA	p.Q195E	NM_004296	NP_004287	WXS	Illumina HiSeq	Unspecified	P49758	RGS6_HUMAN		all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)	9	1106	+			195					C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	c.583C>G	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707527	0.89018	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.49139	0.96;0.84;0.84;0.96;0.85;0.97;0.99;0.98;0.84;0.79;0.94;1.11	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.73055	0.3538	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.65815	0.989;0.985;0.989;0.995	D;D;D;D	0.74348	0.983;0.918;0.983;0.935	T	0.75975	-0.3128	10	0.87932	D	0	-12.8305	19.6166	0.95636	0.0:1.0:0.0:0.0	.	126;195;200;195	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	E	195;195;195;195;195;195;195;195;195;195;167;126;56;56	ENSP00000451030:Q195E;ENSP00000450936:Q195E;ENSP00000452331:Q195E;ENSP00000451855:Q195E;ENSP00000347699:Q195E;ENSP00000385243:Q195E;ENSP00000384218:Q195E;ENSP00000384612:Q195E;ENSP00000383953:Q195E;ENSP00000341199:Q195E;ENSP00000412144:Q126E;ENSP00000451912:Q56E	ENSP00000341199:Q195E	Q	+	1	0	RGS6	72009379	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.137000	0.77295	2.735000	0.93741	0.650000	0.86243	CAA		0.363	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2			11	219	0	0	0	0	11	219				
SPTLC2	9517	broad.mit.edu	37	14	78028787	78028787	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:78028787G>C	ENST00000216484.2	-	6	995	c.802C>G	c.(802-804)Ctg>Gtg	p.L268V		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	268					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	CTGGCTCCCAGAACCAGTGAT	0.453																																						uc001xub.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(802-804)CTG>GTG		serine palmitoyltransferase, long chain base	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)						114.0	98.0	103.0					14																	78028787		2203	4300	6503	SO:0001583	missense	9517					integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups	g.chr14:78028787G>C	AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.802C>G	14.37:g.78028787G>C	ENSP00000216484:p.Leu268Val		Somatic					p.L268V	NM_004863	NP_004854	WXS	Illumina HiSeq	Unspecified	O15270	SPTC2_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	6	990	-			268					Q16685	Missense_Mutation	SNP	ENST00000216484.2	37	c.802C>G	CCDS9865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.77|17.77	3.471872|3.471872	0.63737|0.63737	.|.	.|.	ENSG00000100596|ENSG00000100596	ENST00000216484|ENST00000554901	D|.	0.90069|.	-2.61|.	5.74|5.74	4.86|4.86	0.63082|0.63082	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72843|0.72843	0.3511|0.3511	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.73404|0.73404	-0.3993|-0.3993	10|5	0.17369|.	T|.	0.5|.	-7.8429|-7.8429	15.0807|15.0807	0.72113|0.72113	0.068:0.0:0.932:0.0|0.068:0.0:0.932:0.0	.|.	268|.	O15270|.	SPTC2_HUMAN|.	V|C	268|204	ENSP00000216484:L268V|.	ENSP00000216484:L268V|.	L|S	-|-	1|2	2|0	SPTLC2|SPTLC2	77098540|77098540	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.654000|0.654000	0.38779|0.38779	4.621000|4.621000	0.61233|0.61233	1.578000|1.578000	0.49821|0.49821	-0.253000|-0.253000	0.11424|0.11424	CTG|TCT		0.453	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863		32	42	0	0	0	0	32	42				
TDP1	55775	broad.mit.edu	37	14	90446954	90446954	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:90446954G>C	ENST00000335725.4	+	8	1112	c.862G>C	c.(862-864)Gac>Cac	p.D288H	TDP1_ENST00000393452.3_Missense_Mutation_p.D288H|TDP1_ENST00000555880.1_Missense_Mutation_p.D288H|TDP1_ENST00000357382.3_Missense_Mutation_p.D49H|TDP1_ENST00000393454.2_Missense_Mutation_p.D288H	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	288					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		CATCCATGCTGACTGGCACCA	0.453								Repair of DNA-protein crosslinks																														uc001xxy.2		NA																	0				ovary(2)	2						c.(862-864)GAC>CAC	Repair_of_DNA-protein_crosslinks	tyrosyl-DNA phosphodiesterase 1							100.0	91.0	94.0					14																	90446954		2203	4300	6503	SO:0001583	missense	55775				cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding	g.chr14:90446954G>C	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.862G>C	14.37:g.90446954G>C	ENSP00000337353:p.Asp288His		Somatic				TDP1_uc010atm.2_RNA|TDP1_uc001xxz.2_Missense_Mutation_p.D288H|TDP1_uc010atn.2_Missense_Mutation_p.D288H|TDP1_uc001xya.2_Missense_Mutation_p.D49H|TDP1_uc001xyb.2_RNA|TDP1_uc010ato.2_Missense_Mutation_p.D288H	p.D288H	NM_018319	NP_060789	WXS	Illumina HiSeq	Unspecified	Q9NUW8	TYDP1_HUMAN		COAD - Colon adenocarcinoma(157;0.23)	8	1161	+		all_cancers(154;0.185)	288					Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Missense_Mutation	SNP	ENST00000335725.4	37	c.862G>C	CCDS9888.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.498983	0.64298	.	.	ENSG00000042088	ENST00000393452;ENST00000393454;ENST00000553617;ENST00000335725;ENST00000357382;ENST00000555880	T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.86518	0.5952	H	0.95187	3.635	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.89274	0.3607	10	0.87932	D	0	-11.2052	20.239	0.98366	0.0:0.0:1.0:0.0	.	288;288;49;288	G3V2F4;E7EPD8;Q86TV8;Q9NUW8	.;.;.;TYDP1_HUMAN	H	288;288;189;288;49;288	ENSP00000377098:D288H;ENSP00000377099:D288H;ENSP00000450708:D189H;ENSP00000337353:D288H;ENSP00000349952:D49H;ENSP00000450628:D288H	ENSP00000337353:D288H	D	+	1	0	TDP1	89516707	1.000000	0.71417	0.971000	0.41717	0.386000	0.30323	9.217000	0.95160	2.884000	0.98904	0.655000	0.94253	GAC		0.453	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319		8	42	0	0	0	0	8	42				
NRDE2	55051	broad.mit.edu	37	14	90783141	90783141	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:90783141G>C	ENST00000354366.3	-	3	420	c.188C>G	c.(187-189)tCa>tGa	p.S63*	NRDE2_ENST00000357904.3_Intron|NRDE2_ENST00000557106.1_5'UTR	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	63																	TGAAGACTCTGATTTCAGATG	0.284																																						uc001xyi.1		NA																	0				ovary(2)|lung(1)	3						c.(187-189)TCA>TGA		hypothetical protein LOC55051 isoform 1							40.0	41.0	41.0					14																	90783141		2203	4300	6503	SO:0001587	stop_gained	55051						protein binding	g.chr14:90783141G>C	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.188C>G	14.37:g.90783141G>C	ENSP00000346335:p.Ser63*		Somatic				C14orf102_uc001xyj.1_Intron	p.S63*	NM_017970	NP_060440	WXS	Illumina HiSeq	Unspecified	Q9H7Z3	CN102_HUMAN		COAD - Colon adenocarcinoma(157;0.218)	3	219	-		all_cancers(154;0.118)	63			Potential.		B4DH71|Q4G0A7|Q9NWH6	Nonsense_Mutation	SNP	ENST00000354366.3	37	c.188C>G	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852670	0.91355	.	.	ENSG00000119720	ENST00000354366	.	.	.	5.51	5.51	0.81932	.	0.320377	0.26200	N	0.025756	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-4.6411	16.499	0.84253	0.0:0.0:1.0:0.0	.	.	.	.	X	63	.	ENSP00000346335:S63X	S	-	2	0	C14orf102	89852894	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	2.848000	0.48278	2.736000	0.93811	0.655000	0.94253	TCA		0.284	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970		11	50	0	0	0	0	11	50				
PRIMA1	145270	broad.mit.edu	37	14	94245530	94245530	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr14:94245530G>C	ENST00000393140.1	-	3	323	c.221C>G	c.(220-222)tCc>tGc	p.S74C	PRIMA1_ENST00000393143.1_Missense_Mutation_p.S74C|PRIMA1_ENST00000316227.3_Missense_Mutation_p.S74C	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	74					establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		ACCTggggcggagaggagtct	0.647																																						uc001ybw.1		NA																	0				large_intestine(1)|skin(1)	2						c.(220-222)TCC>TGC		proline rich membrane anchor 1 precursor							11.0	11.0	11.0					14																	94245530		2168	4240	6408	SO:0001583	missense	145270				neurotransmitter catabolic process	cell junction|integral to membrane|synapse		g.chr14:94245530G>C		CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.221C>G	14.37:g.94245530G>C	ENSP00000376848:p.Ser74Cys		Somatic				PRIMA1_uc001ybx.1_RNA	p.S74C	NM_178013	NP_821092	WXS	Illumina HiSeq	Unspecified	Q86XR5	PRIMA_HUMAN		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)	3	263	-		all_cancers(154;0.127)	74			Extracellular (Potential).		Q86XR6	Missense_Mutation	SNP	ENST00000393140.1	37	c.221C>G	CCDS9912.1	.	.	.	.	.	.	.	.	.	.	g	10.63	1.405535	0.25378	.	.	ENSG00000175785	ENST00000393140;ENST00000393143;ENST00000316227	.	.	.	4.63	4.63	0.57726	.	0.395857	0.20340	N	0.094257	T	0.46073	0.1374	L	0.27053	0.805	0.30481	N	0.772399	D	0.60160	0.987	P	0.59889	0.865	T	0.46148	-0.9212	9	0.45353	T	0.12	-25.7661	13.0054	0.58701	0.0:0.0:1.0:0.0	.	74	Q86XR5	PRIMA_HUMAN	C	74	.	ENSP00000320948:S74C	S	-	2	0	PRIMA1	93315283	0.950000	0.32346	0.967000	0.41034	0.662000	0.39071	1.527000	0.35975	2.140000	0.66376	0.556000	0.70494	TCC		0.647	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280658.1	NM_178013		3	7	0	0	0	0	3	7				
MAGEL2	54551	broad.mit.edu	37	15	23890666	23890666	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:23890666G>A	ENST00000532292.1	-	1	509	c.415C>T	c.(415-417)Cgc>Tgc	p.R139C		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	22					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GGGGCCCTGCGCTCCTTCGAG	0.577																																						uc001ywj.3		NA																	0					0						c.(415-417)CGC>TGC		MAGE-like protein 2							28.0	30.0	30.0					15																	23890666		1934	4131	6065	SO:0001583	missense	54551							g.chr15:23890666G>A	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.415C>T	15.37:g.23890666G>A	ENSP00000433433:p.Arg139Cys		Somatic					p.R139C	NM_019066	NP_061939	WXS	Illumina HiSeq	Unspecified				all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)	1	510	-		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)							Missense_Mutation	SNP	ENST00000532292.1	37	c.415C>T																																																																																					0.577	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066		10	15	0	0	0	0	10	15				
NPAP1	23742	broad.mit.edu	37	15	24923324	24923324	+	Silent	SNP	T	T	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:24923324T>A	ENST00000329468.2	+	1	2784	c.2310T>A	c.(2308-2310)ccT>ccA	p.P770P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	770					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GAGCCACCCCTCAACCCAAAT	0.562																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2308-2310)CCT>CCA		hypothetical protein LOC23742							114.0	131.0	125.0					15																	24923324		2203	4300	6503	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923324T>A	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2310T>A	15.37:g.24923324T>A			Somatic					p.P770P	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	2784	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	770						Silent	SNP	ENST00000329468.2	37	c.2310T>A	CCDS10015.1																																																																																				0.562	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		55	112	0	0	0	0	55	112				
TP53BP1	7158	broad.mit.edu	37	15	43708450	43708450	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:43708450G>C	ENST00000263801.3	-	22	5083	c.4831C>G	c.(4831-4833)Ctt>Gtt	p.L1611V	TP53BP1_ENST00000450115.2_Missense_Mutation_p.L1616V|TP53BP1_ENST00000382039.3_Missense_Mutation_p.L1566V|TP53BP1_ENST00000382044.4_Missense_Mutation_p.L1616V	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1611					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GCCTTTGTAAGAGGTGTTACT	0.483								Other conserved DNA damage response genes																														uc001zrs.2		NA																	0				ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7						c.(4831-4833)CTT>GTT	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	tumor protein p53 binding protein 1 isoform 3							154.0	132.0	139.0					15																	43708450		2201	4298	6499	SO:0001583	missense	7158				double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity	g.chr15:43708450G>C	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.4831C>G	15.37:g.43708450G>C	ENSP00000263801:p.Leu1611Val		Somatic				TP53BP1_uc010udp.1_Missense_Mutation_p.L1611V|TP53BP1_uc001zrq.3_Missense_Mutation_p.L1616V|TP53BP1_uc001zrr.3_Missense_Mutation_p.L1616V|TP53BP1_uc010udq.1_Missense_Mutation_p.L1616V|TP53BP1_uc001zrp.2_Missense_Mutation_p.L28V	p.L1611V	NM_005657	NP_005648	WXS	Illumina HiSeq	Unspecified	Q12888	TP53B_HUMAN		GBM - Glioblastoma multiforme(94;1.59e-06)	22	4979	-		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)	1611					F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	c.4831C>G	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194342	0.78902	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.04809	3.55;3.55;3.64;3.56	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.13072	0.0317	L	0.53249	1.67	0.45733	D	0.998634	D;D;D;D	0.76494	0.997;0.999;0.999;0.999	D;P;D;D	0.72625	0.978;0.824;0.915;0.915	T	0.06789	-1.0807	10	0.02654	T	1	-2.4904	14.1363	0.65289	0.0719:0.0:0.9281:0.0	.	1616;1611;1616;1616	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	V	1611;1616;1566;1616	ENSP00000263801:L1611V;ENSP00000371475:L1616V;ENSP00000371470:L1566V;ENSP00000393497:L1616V	ENSP00000263801:L1611V	L	-	1	0	TP53BP1	41495742	1.000000	0.71417	0.956000	0.39512	0.976000	0.68499	5.335000	0.65929	2.785000	0.95823	0.591000	0.81541	CTT		0.483	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			5	75	0	0	0	0	5	75				
SLC27A2	11001	broad.mit.edu	37	15	50494767	50494767	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:50494767G>A	ENST00000267842.5	+	3	1004	c.772G>A	c.(772-774)Gat>Aat	p.D258N	SLC27A2_ENST00000380902.4_Intron|SLC27A2_ENST00000544960.1_Missense_Mutation_p.D23N	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	258					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		GAAGGCAGATGATGTCATCTA	0.428																																						uc001zxw.2		NA																	0				ovary(1)|skin(1)	2						c.(772-774)GAT>AAT		solute carrier family 27 (fatty acid							234.0	187.0	203.0					15																	50494767		2196	4295	6491	SO:0001583	missense	11001				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity	g.chr15:50494767G>A	D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.772G>A	15.37:g.50494767G>A	ENSP00000267842:p.Asp258Asn		Somatic				SLC27A2_uc010bes.2_Intron|SLC27A2_uc001zxx.2_Missense_Mutation_p.D23N	p.D258N	NM_003645	NP_003636	WXS	Illumina HiSeq	Unspecified	O14975	S27A2_HUMAN		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)	3	1004	+		all_lung(180;0.00177)	258			Lumenal (Potential).		A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	ENST00000267842.5	37	c.772G>A	CCDS10133.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659891	0.88154	.	.	ENSG00000140284	ENST00000267842;ENST00000544960	T;T	0.59502	0.26;0.26	5.64	4.72	0.59763	AMP-dependent synthetase/ligase (1);	0.046437	0.85682	D	0.000000	T	0.81192	0.4771	M	0.93720	3.45	0.58432	D	0.999998	D	0.76494	0.999	D	0.77557	0.99	D	0.86040	0.1519	10	0.87932	D	0	.	13.6596	0.62359	0.0:0.0:0.844:0.1559	.	258	O14975	S27A2_HUMAN	N	258;23	ENSP00000267842:D258N;ENSP00000444549:D23N	ENSP00000267842:D258N	D	+	1	0	SLC27A2	48282059	1.000000	0.71417	0.282000	0.24776	0.860000	0.49131	7.115000	0.77110	1.362000	0.46000	0.650000	0.86243	GAT		0.428	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254539.2	NM_003645		7	89	0	0	0	0	7	89				
TRPM7	54822	broad.mit.edu	37	15	50940979	50940979	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:50940979C>G	ENST00000313478.7	-	4	507	c.226G>C	c.(226-228)Gaa>Caa	p.E76Q	TRPM7_ENST00000560955.1_Missense_Mutation_p.E76Q	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	76					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GACCATTCTTCTATTGCCTGA	0.413																																						uc001zyt.3		NA																	0				ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10						c.(226-228)GAA>CAA		transient receptor potential cation channel,							162.0	148.0	153.0					15																	50940979		1861	4111	5972	SO:0001583	missense	54822				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity	g.chr15:50940979C>G	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.226G>C	15.37:g.50940979C>G	ENSP00000320239:p.Glu76Gln		Somatic				TRPM7_uc010bew.1_Missense_Mutation_p.E76Q	p.E76Q	NM_017672	NP_060142	WXS	Illumina HiSeq	Unspecified	Q96QT4	TRPM7_HUMAN		all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)	4	490	-			76			Cytoplasmic (Potential).		Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	c.226G>C	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809821	0.90707	.	.	ENSG00000092439	ENST00000313478	T	0.63255	-0.03	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.77552	0.4147	M	0.69358	2.11	0.58432	D	0.999996	D	0.76494	0.999	D	0.75484	0.986	T	0.81061	-0.1103	10	0.87932	D	0	-17.203	17.1315	0.86727	0.0:1.0:0.0:0.0	.	76	Q96QT4	TRPM7_HUMAN	Q	76	ENSP00000320239:E76Q	ENSP00000320239:E76Q	E	-	1	0	TRPM7	48728271	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	5.487000	0.66863	2.282000	0.76494	0.591000	0.81541	GAA		0.413	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672		36	95	0	0	0	0	36	95				
MYO5C	55930	broad.mit.edu	37	15	52515861	52515861	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:52515861C>T	ENST00000261839.7	-	29	3668	c.3507G>A	c.(3505-3507)ttG>ttA	p.L1169L		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1169						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		CTTTGAAGTTCAAAGCTTCAA	0.398																																						uc010bff.2		NA																	0				ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14						c.(3505-3507)TTG>TTA		myosin VC							119.0	111.0	114.0					15																	52515861		1847	4090	5937	SO:0001819	synonymous_variant	55930					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity	g.chr15:52515861C>T	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3507G>A	15.37:g.52515861C>T			Somatic				MYO5C_uc010uga.1_RNA	p.L1169L	NM_018728	NP_061198	WXS	Illumina HiSeq	Unspecified	Q9NQX4	MYO5C_HUMAN		all cancers(107;0.0137)	29	3644	-			1169			Potential.		Q6P1W8	Silent	SNP	ENST00000261839.7	37	c.3507G>A	CCDS42036.1																																																																																				0.398	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728		19	39	0	0	0	0	19	39				
WDR72	256764	broad.mit.edu	37	15	53994481	53994481	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:53994481G>C	ENST00000396328.1	-	12	1658	c.1419C>G	c.(1417-1419)ctC>ctG	p.L473L	WDR72_ENST00000360509.5_Silent_p.L473L|WDR72_ENST00000557913.1_Silent_p.L470L|WDR72_ENST00000559418.1_Silent_p.L483L	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	473										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		ATTTCGAAGAGAGACCATGTG	0.378																																						uc002acj.2		NA																	0				lung(1)|skin(1)	2						c.(1417-1419)CTC>CTG		WD repeat domain 72							127.0	121.0	123.0					15																	53994481		2194	4293	6487	SO:0001819	synonymous_variant	256764							g.chr15:53994481G>C	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.1419C>G	15.37:g.53994481G>C			Somatic				WDR72_uc010bfi.1_Silent_p.L473L	p.L473L	NM_182758	NP_877435	WXS	Illumina HiSeq	Unspecified	Q3MJ13	WDR72_HUMAN		all cancers(107;0.0511)	12	1461	-			473			WD 6.		Q7Z3I3|Q8N8X2	Silent	SNP	ENST00000396328.1	37	c.1419C>G	CCDS10151.1																																																																																				0.378	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758		6	98	0	0	0	0	6	98				
CCPG1	9236	broad.mit.edu	37	15	55653023	55653023	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:55653023C>G	ENST00000310958.6	-	8	1246	c.948G>C	c.(946-948)aaG>aaC	p.K316N	CCPG1_ENST00000569205.1_Missense_Mutation_p.K316N|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000442196.3_Missense_Mutation_p.K316N|CCPG1_ENST00000425574.3_Intron	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	316					cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		CTTTTTCTTCCTTCTCCAAGG	0.358																																						uc002acv.1		NA																	0				ovary(1)	1						c.(946-948)AAG>AAC		cell cycle progression 1 isoform 2							96.0	89.0	91.0					15																	55653023		1818	4080	5898	SO:0001583	missense	9236				cell cycle	integral to membrane		g.chr15:55653023C>G	AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.948G>C	15.37:g.55653023C>G	ENSP00000311656:p.Lys316Asn		Somatic				CCPG1_uc002acy.2_Missense_Mutation_p.K316N|CCPG1_uc002acu.1_Missense_Mutation_p.K172N|CCPG1_uc002acw.1_Missense_Mutation_p.K41N|CCPG1_uc002acx.2_Intron|CCPG1_uc010bfk.1_Missense_Mutation_p.K316N|CCPG1_uc002acz.1_Missense_Mutation_p.K316N	p.K316N	NM_020739	NP_065790	WXS	Illumina HiSeq	Unspecified	Q9ULG6	CCPG1_HUMAN		all cancers(107;0.0354)	8	1113	-			316			Potential.|Lumenal (Potential).		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	ENST00000310958.6	37	c.948G>C	CCDS42039.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977490	0.53720	.	.	ENSG00000256061	ENST00000310958;ENST00000442196	T;T	0.36157	1.27;1.27	5.72	3.76	0.43208	.	0.371393	0.33382	N	0.004971	T	0.54224	0.1845	M	0.65975	2.015	0.49582	D	0.999809	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.992;0.999;0.999	T	0.56709	-0.7934	10	0.72032	D	0.01	.	9.3602	0.38190	0.0:0.752:0.0:0.248	.	316;316;316;172	A8K9T0;Q9ULG6-4;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	N	316	ENSP00000311656:K316N;ENSP00000403400:K316N	ENSP00000311656:K316N	K	-	3	2	DYX1C1	53440315	0.987000	0.35691	1.000000	0.80357	0.965000	0.64279	0.140000	0.16056	1.459000	0.47892	0.650000	0.86243	AAG		0.358	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748		3	54	0	0	0	0	3	54				
VPS13C	54832	broad.mit.edu	37	15	62258317	62258317	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:62258317G>A	ENST00000261517.5	-	30	3089	c.3016C>T	c.(3016-3018)Caa>Taa	p.Q1006*	VPS13C_ENST00000395898.3_Nonsense_Mutation_p.Q963*|VPS13C_ENST00000249837.3_Nonsense_Mutation_p.Q963*|VPS13C_ENST00000395896.4_Nonsense_Mutation_p.Q1006*	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AAAGCAGTTTGAAAACTAGGT	0.308																																						uc002agz.2		NA																	0				ovary(2)	2						c.(3016-3018)CAA>TAA		vacuolar protein sorting 13C protein isoform 2A							62.0	63.0	62.0					15																	62258317		2201	4292	6493	SO:0001587	stop_gained	54832				protein localization			g.chr15:62258317G>A	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3016C>T	15.37:g.62258317G>A	ENSP00000261517:p.Gln1006*		Somatic				VPS13C_uc002aha.2_Nonsense_Mutation_p.Q963*|VPS13C_uc002ahb.1_Nonsense_Mutation_p.Q1006*|VPS13C_uc002ahc.1_Nonsense_Mutation_p.Q963*	p.Q1006*	NM_020821	NP_065872	WXS	Illumina HiSeq	Unspecified	Q709C8	VP13C_HUMAN			30	3090	-			1006						Nonsense_Mutation	SNP	ENST00000261517.5	37	c.3016C>T	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	41	8.918377	0.99002	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	.	.	.	5.43	5.43	0.79202	.	0.158313	0.42964	D	0.000631	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	14.4398	0.67309	0.0:0.0:0.8526:0.1474	.	.	.	.	X	963;1006;1006;1006	.	ENSP00000249837:Q963X	Q	-	1	0	VPS13C	60045609	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.607000	0.61133	2.701000	0.92244	0.561000	0.74099	CAA		0.308	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		14	22	0	0	0	0	14	22				
TLN2	83660	broad.mit.edu	37	15	63017195	63017195	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:63017195G>C	ENST00000561311.1	+	26	3377	c.3147G>C	c.(3145-3147)ccG>ccC	p.P1049P	TLN2_ENST00000306829.6_Silent_p.P1049P			Q9Y4G6	TLN2_HUMAN	talin 2	1049	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CTTGTGGTCCGATGGAAATCG	0.493																																						uc002alb.3		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						c.(3145-3147)CCG>CCC		talin 2							67.0	64.0	65.0					15																	63017195		2203	4300	6503	SO:0001819	synonymous_variant	83660				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	g.chr15:63017195G>C	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3147G>C	15.37:g.63017195G>C			Somatic					p.P1049P	NM_015059	NP_055874	WXS	Illumina HiSeq	Unspecified	Q9Y4G6	TLN2_HUMAN			24	3147	+			1049			Ala-rich.		A6NLB8	Silent	SNP	ENST00000561311.1	37	c.3147G>C	CCDS32261.1																																																																																				0.493	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2			16	24	0	0	0	0	16	24				
DIS3L	115752	broad.mit.edu	37	15	66601162	66601162	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:66601162G>T	ENST00000319212.4	+	4	588	c.538G>T	c.(538-540)Gta>Tta	p.V180L	DIS3L_ENST00000441424.2_Missense_Mutation_p.V46L|DIS3L_ENST00000319194.5_Missense_Mutation_p.V97L	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	180					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AACAGAAGGAGTATTCGTGAT	0.398																																						uc010ujm.1		NA																	0				ovary(2)	2						c.(538-540)GTA>TTA		DIS3 mitotic control homolog (S.							216.0	181.0	193.0					15																	66601162		2201	4299	6500	SO:0001583	missense	115752				rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding	g.chr15:66601162G>T		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.538G>T	15.37:g.66601162G>T	ENSP00000321711:p.Val180Leu		Somatic				DIS3L_uc010ujl.1_5'UTR|DIS3L_uc002app.2_Missense_Mutation_p.V97L|DIS3L_uc002apq.2_Missense_Mutation_p.V180L|DIS3L_uc010bho.2_Missense_Mutation_p.V46L	p.V180L	NM_001143688	NP_001137160	WXS	Illumina HiSeq	Unspecified	Q8TF46	DI3L1_HUMAN			4	553	+			180					Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	c.538G>T	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578030	0.65878	.	.	ENSG00000166938	ENST00000319194;ENST00000441424;ENST00000319212;ENST00000525109;ENST00000532580;ENST00000530615	T;T;T;T	0.51325	2.02;0.96;2.02;0.71	5.96	5.03	0.67393	.	0.054829	0.64402	N	0.000001	T	0.39682	0.1087	L	0.35723	1.085	0.58432	D	0.999999	P;P	0.40638	0.714;0.725	B;B	0.41374	0.113;0.355	T	0.14587	-1.0467	10	0.09590	T	0.72	-22.3765	16.0837	0.81023	0.0:0.134:0.866:0.0	.	180;180	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	L	97;46;180;46;97;97	ENSP00000321583:V97L;ENSP00000388980:V46L;ENSP00000321711:V180L;ENSP00000432125:V46L	ENSP00000321583:V97L	V	+	1	0	DIS3L	64388216	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.407000	0.66363	1.472000	0.48140	0.655000	0.94253	GTA		0.398	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375		33	58	1	0	1.84e-18	1.96e-18	33	58				
LRRC49	54839	broad.mit.edu	37	15	71302304	71302304	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:71302304C>T	ENST00000260382.5	+	13	1826	c.1566C>T	c.(1564-1566)ttC>ttT	p.F522F	LRRC49_ENST00000560158.2_Silent_p.F210F|LRRC49_ENST00000560369.1_Silent_p.F527F|LRRC49_ENST00000544974.2_Silent_p.F512F|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000443425.2_Silent_p.F478F|LRRC49_ENST00000560691.1_Silent_p.F228F	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	522						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TAAGCCATTTCAGTATGCAGA	0.318																																						uc002asw.2		NA																	0				ovary(1)	1						c.(1564-1566)TTC>TTT		leucine rich repeat containing 49							70.0	71.0	71.0					15																	71302304		2199	4297	6496	SO:0001819	synonymous_variant	54839					cytoplasm|microtubule		g.chr15:71302304C>T		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1566C>T	15.37:g.71302304C>T			Somatic				LRRC49_uc002asu.2_Silent_p.F512F|LRRC49_uc002asx.2_Silent_p.F478F|LRRC49_uc010ukf.1_Silent_p.F527F|LRRC49_uc002asy.2_Silent_p.F228F|LRRC49_uc002asz.2_Silent_p.F494F	p.F522F	NM_017691	NP_060161	WXS	Illumina HiSeq	Unspecified	Q8IUZ0	LRC49_HUMAN			13	1813	+			522					B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Silent	SNP	ENST00000260382.5	37	c.1566C>T	CCDS32282.1																																																																																				0.318	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691		17	22	0	0	0	0	17	22				
CCDC33	80125	broad.mit.edu	37	15	74536424	74536424	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:74536424C>T	ENST00000398814.3	+	2	551	c.120C>T	c.(118-120)acC>acT	p.T40T	CCDC33_ENST00000321288.5_Silent_p.T243T	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	243										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TCATGGTCACCCTCCATGGGG	0.607																																						uc002axo.2		NA																	0				ovary(3)|skin(2)	5						c.(118-120)ACC>ACT		coiled-coil domain containing 33 isoform 1							64.0	70.0	68.0					15																	74536424		2004	4156	6160	SO:0001819	synonymous_variant	80125						protein binding	g.chr15:74536424C>T	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.120C>T	15.37:g.74536424C>T			Somatic					p.T40T	NM_025055	NP_079331	WXS	Illumina HiSeq	Unspecified	Q8N5R6	CCD33_HUMAN			2	514	+			243			C2.		A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	ENST00000398814.3	37	c.120C>T	CCDS42058.1																																																																																				0.607	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791		20	31	0	0	0	0	20	31				
MTHFS	10588	broad.mit.edu	37	15	80181621	80181621	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:80181621C>G	ENST00000258874.3	-	2	253	c.193G>C	c.(193-195)Gaa>Caa	p.E65Q	MTHFS_ENST00000559722.1_5'UTR|ST20-MTHFS_ENST00000494999.1_5'UTR|ST20-MTHFS_ENST00000479961.1_Missense_Mutation_p.E41Q	NM_006441.3	NP_006432.1	P49914	MTHFS_HUMAN	5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)	65					formate metabolic process (GO:0015942)|tetrahydrofolate metabolic process (GO:0046653)	cytoplasm (GO:0005737)	5-formyltetrahydrofolate cyclo-ligase activity (GO:0030272)|ATP binding (GO:0005524)|folic acid binding (GO:0005542)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|liver(1)	5				all cancers(203;0.00467)		ATGATCTCTTCTGTCTCAATT	0.408																																						uc002bex.3		NA																	0					0						c.(193-195)GAA>CAA		5,10-methenyltetrahydrofolate synthetase							180.0	156.0	164.0					15																	80181621		2203	4300	6503	SO:0001583	missense	10588				folic acid-containing compound biosynthetic process|formate metabolic process|tetrahydrofolate metabolic process	cytosol|Golgi apparatus|plasma membrane	5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|folic acid binding	g.chr15:80181621C>G	L38928	CCDS10311.1	15q24.3	2014-05-15			ENSG00000136371	ENSG00000136371	6.3.3.2		7437	protein-coding gene	gene with protein product		604197				8522195	Standard	NM_006441		Approved	HsT19268	uc002bex.4	P49914	OTTHUMG00000144174	ENST00000258874.3:c.193G>C	15.37:g.80181621C>G	ENSP00000258874:p.Glu65Gln		Somatic					p.E65Q	NM_006441	NP_006432	WXS	Illumina HiSeq	Unspecified	P49914	MTHFS_HUMAN		all cancers(203;0.00467)	2	233	-			65					H3BQ75	Missense_Mutation	SNP	ENST00000258874.3	37	c.193G>C	CCDS10311.1	.	.	.	.	.	.	.	.	.	.	C	9.901	1.206937	0.22205	.	.	ENSG00000136371	ENST00000258874	T	0.42131	0.98	5.32	3.3	0.37823	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.230210	0.43919	D	0.000513	T	0.29093	0.0723	L	0.52573	1.65	0.09310	N	0.999999	B	0.29646	0.253	B	0.21708	0.036	T	0.13791	-1.0496	10	0.11485	T	0.65	-14.2251	7.6628	0.28413	0.2955:0.63:0.0:0.0745	.	65	P49914	MTHFS_HUMAN	Q	65	ENSP00000258874:E65Q	ENSP00000258874:E65Q	E	-	1	0	MTHFS	77968676	0.320000	0.24616	0.548000	0.28192	0.670000	0.39368	0.811000	0.27198	1.227000	0.43598	0.650000	0.86243	GAA		0.408	MTHFS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291374.2	NM_006441		30	45	0	0	0	0	30	45				
AGBL1	123624	broad.mit.edu	37	15	86697725	86697725	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr15:86697725G>C	ENST00000441037.2	+	3	284	c.189G>C	c.(187-189)agG>agC	p.R63S	AGBL1_ENST00000421325.2_Missense_Mutation_p.R63S	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	63					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TTCTGGCCAGGAAGAACCTAT	0.478																																						uc002blz.1		NA																	0					0						c.(187-189)AGG>AGC		ATP/GTP binding protein-like 1							94.0	97.0	96.0					15																	86697725		1974	4145	6119	SO:0001583	missense	123624				C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding	g.chr15:86697725G>C	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.189G>C	15.37:g.86697725G>C	ENSP00000413001:p.Arg63Ser		Somatic					p.R63S	NM_152336	NP_689549	WXS	Illumina HiSeq	Unspecified	Q96MI9	CBPC4_HUMAN			3	269	+			63					A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	c.189G>C	CCDS58398.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592960	0.66219	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.62639	0.01	5.4	2.53	0.30540	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.74442	0.3717	M	0.74258	2.255	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.72947	-0.4137	9	0.87932	D	0	-14.5215	7.8942	0.29697	0.2522:0.0:0.7478:0.0	.	63	Q96MI9	CBPC4_HUMAN	S	92;63	ENSP00000397173:R63S	ENSP00000397173:R63S	R	+	3	2	AGBL1	84498729	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	1.594000	0.36697	0.358000	0.24211	0.650000	0.86243	AGG		0.478	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336		7	15	0	0	0	0	7	15				
SLX4	84464	broad.mit.edu	37	16	3656527	3656527	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:3656527C>T	ENST00000294008.3	-	3	1348	c.708G>A	c.(706-708)gcG>gcA	p.A236A		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	236	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TTTCTTCCCGCGCAGCCTCGA	0.512								Direct reversal of damage																														uc002cvp.2		NA																	0					0						c.(706-708)GCG>GCA	Direct_reversal_of_damage|Homologous_recombination	BTB (POZ) domain containing 12							226.0	223.0	224.0					16																	3656527		2197	4300	6497	SO:0001819	synonymous_variant	84464	Fanconi_Anemia			DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding	g.chr16:3656527C>T	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.708G>A	16.37:g.3656527C>T			Somatic				BTBD12_uc002cvq.1_Silent_p.A236A	p.A236A	NM_032444	NP_115820	WXS	Illumina HiSeq	Unspecified	Q8IY92	SLX4_HUMAN			3	1335	-			236			Interaction with C20orf94, ERCC4 and MSH2.		Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	37	c.708G>A	CCDS10506.2																																																																																				0.512	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444		69	122	0	0	0	0	69	122				
DNAJA3	9093	broad.mit.edu	37	16	4491549	4491549	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:4491549C>G	ENST00000262375.6	+	4	680	c.603C>G	c.(601-603)ttC>ttG	p.F201L	DNAJA3_ENST00000431375.2_Missense_Mutation_p.F48L|DNAJA3_ENST00000355296.4_Missense_Mutation_p.F201L	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	201					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						TTGGAGATTTCCAGACCGTGT	0.443																																						uc002cwk.2		NA																	0				ovary(2)|breast(2)	4						c.(601-603)TTC>TTG		DnaJ (Hsp40) homolog, subfamily A, member 3							67.0	67.0	67.0					16																	4491549		2197	4300	6497	SO:0001583	missense	9093				activation of caspase activity|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of cell proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|neuromuscular junction development|positive regulation of apoptosis|positive regulation of protein ubiquitination|protein folding|protein folding|protein stabilization|response to heat|response to interferon-gamma	cytosol|mitochondrial matrix|mitochondrial nucleoid|nucleus	ATP binding|heat shock protein binding|interferon-gamma receptor binding|metal ion binding|NF-kappaB binding|protein kinase binding	g.chr16:4491549C>G	AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.603C>G	16.37:g.4491549C>G	ENSP00000262375:p.Phe201Leu		Somatic				DNAJA3_uc002cwl.2_Missense_Mutation_p.F201L|DNAJA3_uc010uxk.1_Missense_Mutation_p.F48L	p.F201L	NM_005147	NP_005138	WXS	Illumina HiSeq	Unspecified	Q96EY1	DNJA3_HUMAN			4	628	+			201					B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	ENST00000262375.6	37	c.603C>G	CCDS10515.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047668	0.55110	.	.	ENSG00000103423	ENST00000262375;ENST00000355296;ENST00000431375	T;T;T	0.66638	-0.22;-0.21;0.94	5.77	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.53626	0.1808	L	0.58302	1.8	0.52501	D	0.999951	B;B;B	0.19200	0.022;0.004;0.034	B;B;B	0.21917	0.011;0.007;0.037	T	0.42932	-0.9422	10	0.02654	T	1	-16.2269	6.9062	0.24311	0.0:0.6634:0.1273:0.2093	.	48;201;201	E7ES32;Q96EY1-2;Q96EY1	.;.;DNJA3_HUMAN	L	201;201;48	ENSP00000262375:F201L;ENSP00000347445:F201L;ENSP00000393970:F48L	ENSP00000262375:F201L	F	+	3	2	DNAJA3	4431550	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.191000	0.32138	1.461000	0.47929	0.456000	0.33151	TTC		0.443	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1			14	40	0	0	0	0	14	40				
NAGPA	51172	broad.mit.edu	37	16	5081854	5081854	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:5081854C>T	ENST00000312251.3	-	3	593	c.574G>A	c.(574-576)Gag>Aag	p.E192K	RP11-165E7.1_ENST00000588778.1_RNA|ALG1_ENST00000588623.1_5'Flank|NAGPA_ENST00000381955.3_Missense_Mutation_p.E192K|NAGPA_ENST00000564922.1_5'UTR	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	192					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	AATGGGTTCTCAGTGTCCAGC	0.557																																						uc002cyg.2		NA																	0					0						c.(574-576)GAG>AAG		N-acetylglucosamine-1-phosphodiester	N-Acetyl-D-glucosamine(DB00141)						145.0	130.0	135.0					16																	5081854		2197	4300	6497	SO:0001583	missense	51172				carbohydrate metabolic process|lysosome organization|protein modification process|protein targeting to lysosome	Golgi cisterna membrane|integral to membrane	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity	g.chr16:5081854C>T	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.574G>A	16.37:g.5081854C>T	ENSP00000310998:p.Glu192Lys		Somatic				ALG1_uc002cyj.2_5'Flank|NAGPA_uc010buc.2_5'Flank|NAGPA_uc002cyf.2_Missense_Mutation_p.E50K|NAGPA_uc002cyh.2_RNA|NAGPA_uc002cyi.2_Intron|NAGPA_uc010uxx.1_3'UTR	p.E192K	NM_016256	NP_057340	WXS	Illumina HiSeq	Unspecified	Q9UK23	NAGPA_HUMAN			3	595	-			192			Lumenal (Potential).		B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	37	c.574G>A	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.805926	0.31961	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.29142	1.58;1.78	4.67	-1.56	0.08532	.	0.704916	0.13964	N	0.350629	T	0.14313	0.0346	N	0.16862	0.45	0.09310	N	1	B;B	0.25667	0.131;0.0	B;B	0.19666	0.026;0.002	T	0.25537	-1.0129	10	0.22706	T	0.39	-3.3835	7.1628	0.25672	0.1074:0.5259:0.0:0.3666	.	192;192	Q9UK23;Q9UK23-2	NAGPA_HUMAN;.	K	192	ENSP00000310998:E192K;ENSP00000371381:E192K	ENSP00000310998:E192K	E	-	1	0	NAGPA	5021855	0.001000	0.12720	0.054000	0.19295	0.974000	0.67602	0.964000	0.29306	-0.147000	0.11254	0.555000	0.69702	GAG		0.557	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256		8	93	0	0	0	0	8	93				
RRN3	54700	broad.mit.edu	37	16	15180300	15180300	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:15180300G>C	ENST00000198767.6	-	4	347	c.264C>G	c.(262-264)atC>atG	p.I88M	RRN3_ENST00000540462.1_5'Flank|RRN3_ENST00000327307.7_Missense_Mutation_p.I55M|RRN3_ENST00000429751.2_Intron|RRN3_ENST00000563559.1_Missense_Mutation_p.I88M|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000564131.1_Missense_Mutation_p.I88M	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	88					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GCCAGTTGATGATCTGGTCAT	0.303																																						uc002dde.2		NA																	0				ovary(1)	1						c.(262-264)ATC>ATG		RRN3 RNA polymerase I transcription factor							45.0	51.0	49.0					16																	15180300		2189	4279	6468	SO:0001583	missense	54700				regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm		g.chr16:15180300G>C	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.264C>G	16.37:g.15180300G>C	ENSP00000198767:p.Ile88Met		Somatic				PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Translation_Start_Site|RRN3_uc010uzq.1_Intron|RRN3_uc002ddf.1_Missense_Mutation_p.I88M	p.I88M	NM_018427	NP_060897	WXS	Illumina HiSeq	Unspecified	Q9NYV6	RRN3_HUMAN			4	332	-			88					A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	c.264C>G	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	10.66	1.412104	0.25465	.	.	ENSG00000085721	ENST00000198767;ENST00000327307	T;T	0.44482	0.92;0.92	4.46	2.45	0.29901	.	0.311546	0.28958	N	0.013589	T	0.35307	0.0927	L	0.39566	1.225	0.80722	D	1	B;B	0.28820	0.224;0.019	B;B	0.39503	0.301;0.07	T	0.16129	-1.0413	10	0.51188	T	0.08	.	4.3415	0.11112	0.0857:0.1554:0.5982:0.1606	.	88;88	Q3MHU9;Q9NYV6	.;RRN3_HUMAN	M	88;55	ENSP00000198767:I88M;ENSP00000318484:I55M	ENSP00000198767:I88M	I	-	3	3	RRN3	15087801	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	1.060000	0.30530	0.420000	0.25954	0.462000	0.41574	ATC		0.303	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427		4	73	0	0	0	0	4	73				
SMG1	23049	broad.mit.edu	37	16	18887543	18887543	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:18887543T>A	ENST00000446231.2	-	13	2205	c.1793A>T	c.(1792-1794)aAg>aTg	p.K598M	SMG1_ENST00000389467.3_Missense_Mutation_p.K598M|SMG1_ENST00000565224.1_Missense_Mutation_p.K572M			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	598	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CACATGATTCTTAAAAGCCTC	0.373																																						uc002dfm.2		NA																	0				breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						c.(1792-1794)AAG>ATG		PI-3-kinase-related kinase SMG-1							55.0	54.0	55.0					16																	18887543		1805	4068	5873	SO:0001583	missense	23049				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr16:18887543T>A	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.1793A>T	16.37:g.18887543T>A	ENSP00000402515:p.Lys598Met		Somatic				SMG1_uc010bwb.2_Missense_Mutation_p.K458M	p.K598M	NM_015092	NP_055907	WXS	Illumina HiSeq	Unspecified	Q96Q15	SMG1_HUMAN			13	2156	-			598			Interaction with SMG8 and SMG9.		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	c.1793A>T	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	t	13.65	2.299215	0.40694	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.47528	0.84;0.84	5.34	4.25	0.50352	Armadillo-type fold (1);	0.289372	0.27518	U	0.019011	T	0.22666	0.0547	N	0.08118	0	0.20307	N	0.999912	P	0.39576	0.679	B	0.31751	0.135	T	0.10268	-1.0637	10	0.62326	D	0.03	.	7.1814	0.25774	0.0:0.0734:0.1485:0.7781	.	598	Q96Q15	SMG1_HUMAN	M	598	ENSP00000402515:K598M;ENSP00000374118:K598M	ENSP00000374118:K598M	K	-	2	0	SMG1	18795044	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	2.100000	0.41777	0.859000	0.35456	-0.494000	0.04653	AAG		0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092		28	62	0	0	0	0	28	62				
C16orf62	57020	broad.mit.edu	37	16	19663399	19663399	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:19663399G>T	ENST00000251143.5	+	26	2220	c.2208G>T	c.(2206-2208)caG>caT	p.Q736H	C16orf62_ENST00000417362.2_Missense_Mutation_p.Q643H|C16orf62_ENST00000542263.1_Missense_Mutation_p.Q732H|C16orf62_ENST00000544275.1_3'UTR|C16orf62_ENST00000438132.3_Missense_Mutation_p.Q825H|C16orf62_ENST00000543152.1_Missense_Mutation_p.Q485H|C16orf62_ENST00000448695.1_Missense_Mutation_p.Q586H			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	736						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TGGCCAACCAGTGCCTCTCCC	0.542																																						uc002dgn.1		NA																	0				ovary(1)	1						c.(2206-2208)CAG>CAT		hypothetical protein LOC57020							125.0	90.0	102.0					16																	19663399		2197	4300	6497	SO:0001583	missense	57020					integral to membrane		g.chr16:19663399G>T		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2208G>T	16.37:g.19663399G>T	ENSP00000251143:p.Gln736His		Somatic				C16orf62_uc002dgo.1_Missense_Mutation_p.Q643H|C16orf62_uc002dgp.1_Missense_Mutation_p.Q485H	p.Q736H	NM_020314	NP_064710	WXS	Illumina HiSeq	Unspecified	Q7Z3J2	CP062_HUMAN			26	2220	+			736					A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	37	c.2208G>T		.	.	.	.	.	.	.	.	.	.	G	26.1	4.701625	0.88924	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	M	0.64170	1.965	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.80764	0.991;0.994	T	0.63047	-0.6724	9	.	.	.	-30.4957	18.0345	0.89296	0.0:0.0:1.0:0.0	.	732;736	F5H7K1;Q7Z3J2	.;CP062_HUMAN	H	825;732;736;643;586	ENSP00000400815:Q825H;ENSP00000442468:Q732H;ENSP00000251143:Q736H;ENSP00000395973:Q643H;ENSP00000398009:Q586H	.	Q	+	3	2	C16orf62	19570900	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.119000	0.94362	2.865000	0.98341	0.655000	0.94253	CAG		0.542	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314		7	6	1	0	5.18e-06	5.38e-06	7	6				
USP31	57478	broad.mit.edu	37	16	23116857	23116857	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:23116857G>C	ENST00000219689.7	-	5	993	c.994C>G	c.(994-996)Cac>Gac	p.H332D		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CTCATGCAGTGAGAACATTTG	0.438																																						uc002dll.2		NA																	0				ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10						c.(994-996)CAC>GAC		ubiquitin specific peptidase 31							115.0	93.0	101.0					16																	23116857		2197	4300	6497	SO:0001583	missense	57478				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr16:23116857G>C	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.994C>G	16.37:g.23116857G>C	ENSP00000219689:p.His332Asp		Somatic					p.H332D	NM_020718	NP_065769	WXS	Illumina HiSeq	Unspecified	Q70CQ4	UBP31_HUMAN		GBM - Glioblastoma multiforme(48;0.0187)	5	994	-			332					B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	c.994C>G	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750682	0.69533	.	.	ENSG00000103404	ENST00000219689	T	0.08102	3.13	4.69	4.69	0.59074	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.122893	0.53938	D	0.000057	T	0.17534	0.0421	M	0.64080	1.96	0.80722	D	1	P	0.44877	0.845	P	0.49252	0.604	T	0.01500	-1.1339	10	0.33940	T	0.23	-13.3742	16.637	0.85061	0.0:0.0:1.0:0.0	.	332	Q70CQ4	UBP31_HUMAN	D	332	ENSP00000219689:H332D	ENSP00000219689:H332D	H	-	1	0	USP31	23024358	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.430000	0.80321	2.157000	0.67596	0.655000	0.94253	CAC		0.438	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718		10	33	0	0	0	0	10	33				
COG7	91949	broad.mit.edu	37	16	23436072	23436072	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:23436072A>T	ENST00000307149.5	-	7	1192	c.1007T>A	c.(1006-1008)cTa>cAa	p.L336Q		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	336					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		ATGTTTACGTAGGTGGGGGAG	0.557																																						uc002dlo.2		NA																	0					0						c.(1006-1008)CTA>CAA		component of oligomeric golgi complex 7							97.0	104.0	102.0					16																	23436072		2197	4300	6497	SO:0001583	missense	91949				intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding	g.chr16:23436072A>T	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1007T>A	16.37:g.23436072A>T	ENSP00000305442:p.Leu336Gln		Somatic					p.L336Q	NM_153603	NP_705831	WXS	Illumina HiSeq	Unspecified	P83436	COG7_HUMAN		GBM - Glioblastoma multiforme(48;0.0401)	7	1195	-			336					Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	37	c.1007T>A	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	A	7.060	0.566192	0.13560	.	.	ENSG00000168434	ENST00000307149	T	0.45668	0.89	5.31	-1.62	0.08372	.	0.607735	0.17413	N	0.175133	T	0.26231	0.0640	L	0.34521	1.04	0.20074	N	0.999936	B	0.10296	0.003	B	0.12837	0.008	T	0.29549	-1.0008	10	0.12766	T	0.61	-0.4271	11.3055	0.49332	0.4662:0.0:0.5338:0.0	.	336	P83436	COG7_HUMAN	Q	336	ENSP00000305442:L336Q	ENSP00000305442:L336Q	L	-	2	0	COG7	23343573	0.730000	0.28100	0.004000	0.12327	0.486000	0.33341	2.373000	0.44266	-0.145000	0.11294	0.482000	0.46254	CTA		0.557	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1			31	59	0	0	0	0	31	59				
CORO1A	11151	broad.mit.edu	37	16	30199516	30199516	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:30199516C>G	ENST00000219150.5	+	9	1316	c.1011C>G	c.(1009-1011)ttC>ttG	p.F337L	CORO1A_ENST00000570045.1_Missense_Mutation_p.F337L|CORO1A_ENST00000565497.1_Missense_Mutation_p.F337L	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	337					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						CCCACAGGTTCTACAAGCTGC	0.662																																						uc002dww.2		NA																	0					0						c.(1009-1011)TTC>TTG		coronin, actin binding protein, 1A							82.0	72.0	75.0					16																	30199516		2197	4300	6497	SO:0001583	missense	11151				cell-substrate adhesion|innate immune response|leukocyte chemotaxis|negative regulation of actin nucleation|phagolysosome assembly|positive chemotaxis|regulation of cell shape|uropod organization	actin filament|cortical actin cytoskeleton|lamellipodium|phagocytic cup|phagocytic vesicle membrane	actin filament binding|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein homodimerization activity	g.chr16:30199516C>G	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.1011C>G	16.37:g.30199516C>G	ENSP00000219150:p.Phe337Leu		Somatic				uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CORO1A_uc010bzq.2_Missense_Mutation_p.F337L|CORO1A_uc010bzr.2_Missense_Mutation_p.F337L|CORO1A_uc002dwx.2_Missense_Mutation_p.F231L|CORO1A_uc002dwy.1_3'UTR|LOC606724_uc002dwz.1_5'Flank	p.F337L	NM_007074	NP_009005	WXS	Illumina HiSeq	Unspecified	P31146	COR1A_HUMAN			9	1133	+			337			WD 7.		B2RBL1|Q2YD73	Missense_Mutation	SNP	ENST00000219150.5	37	c.1011C>G	CCDS10673.1	.	.	.	.	.	.	.	.	.	.	.	14.72	2.619989	0.46736	.	.	ENSG00000102879	ENST00000219150	T	0.28255	1.62	5.74	4.79	0.61399	Domain of unknown function DUF1900 (1);	0.208186	0.51477	D	0.000095	T	0.28599	0.0708	L	0.52573	1.65	0.48040	D	0.999571	B	0.06786	0.001	B	0.19946	0.027	T	0.05716	-1.0868	10	0.37606	T	0.19	-8.765	10.6822	0.45821	0.0:0.8458:0.0:0.1542	.	337	P31146	COR1A_HUMAN	L	337	ENSP00000219150:F337L	ENSP00000219150:F337L	F	+	3	2	CORO1A	30107017	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	0.928000	0.28831	1.442000	0.47568	0.549000	0.68633	TTC		0.662	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074		3	39	0	0	0	0	3	39				
ZNF423	23090	broad.mit.edu	37	16	49559375	49559375	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:49559375C>T	ENST00000561648.1	-	6	3661	c.3608G>A	c.(3607-3609)tGc>tAc	p.C1203Y	ZNF423_ENST00000262383.2_Missense_Mutation_p.C1203Y|ZNF423_ENST00000563137.2_Missense_Mutation_p.C1143Y|ZNF423_ENST00000567169.1_Missense_Mutation_p.C1086Y|ZNF423_ENST00000562520.1_Missense_Mutation_p.C1143Y|ZNF423_ENST00000562871.1_Missense_Mutation_p.C1143Y|ZNF423_ENST00000535559.1_Missense_Mutation_p.C1086Y	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1203					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CATCTGGTTGCACAGCTTACA	0.572																																						uc002efs.2		NA																	0				ovary(1)|lung(1)|kidney(1)|pancreas(1)	4						c.(3607-3609)TGC>TAC		zinc finger protein 423							117.0	98.0	104.0					16																	49559375		2199	4300	6499	SO:0001583	missense	23090				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr16:49559375C>T	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3608G>A	16.37:g.49559375C>T	ENSP00000455426:p.Cys1203Tyr		Somatic				ZNF423_uc010vgn.1_Missense_Mutation_p.C1086Y	p.C1203Y	NM_015069	NP_055884	WXS	Illumina HiSeq	Unspecified	Q2M1K9	ZN423_HUMAN			7	3906	-		all_cancers(37;0.0155)	1203			C2H2-type 28.		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	c.3608G>A	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644664	0.87859	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.58652	0.32;0.32	5.38	5.38	0.77491	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	D	0.85418	0.5692	H	0.97240	3.965	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.90645	0.4578	9	.	.	.	-19.24	19.1396	0.93443	0.0:1.0:0.0:0.0	.	1203	Q2M1K9	ZN423_HUMAN	Y	1203;1086	ENSP00000262383:C1203Y;ENSP00000442321:C1086Y	.	C	-	2	0	ZNF423	48116876	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.521000	0.84997	0.462000	0.41574	TGC		0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069		4	22	0	0	0	0	4	22				
NUP93	9688	broad.mit.edu	37	16	56875739	56875739	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:56875739C>T	ENST00000308159.5	+	21	2464	c.2343C>T	c.(2341-2343)cgC>cgT	p.R781R	NUP93_ENST00000542526.1_Silent_p.R658R|NUP93_ENST00000569842.1_Silent_p.R781R|NUP93_ENST00000564887.1_Silent_p.R658R	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	781					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TCGAGGACCGCGACTCTGTAA	0.512																																					Colon(33;610 796 1305 1705 38917)	uc002eka.2		NA																	0				ovary(1)|lung(1)	2						c.(2341-2343)CGC>CGT		nucleoporin 93kDa							95.0	83.0	87.0					16																	56875739		2198	4300	6498	SO:0001819	synonymous_variant	9688				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr16:56875739C>T	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.2343C>T	16.37:g.56875739C>T			Somatic				NUP93_uc002ekb.2_Silent_p.R658R|NUP93_uc010vhi.1_Silent_p.R658R	p.R781R	NM_014669	NP_055484	WXS	Illumina HiSeq	Unspecified	Q8N1F7	NUP93_HUMAN			21	2464	+			781					B3KPQ8|Q14705	Silent	SNP	ENST00000308159.5	37	c.2343C>T	CCDS10769.1																																																																																				0.512	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669		21	10	0	0	0	0	21	10				
CDH11	1009	broad.mit.edu	37	16	65032599	65032599	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr16:65032599G>A	ENST00000268603.4	-	4	1004	c.389C>T	c.(388-390)gCg>gTg	p.A130V	CDH11_ENST00000394156.3_Missense_Mutation_p.A130V|CDH11_ENST00000566827.1_Missense_Mutation_p.A4V	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	130	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCTGTCCACCGCCTGAGCCAT	0.527			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																												uc002eoi.2		NA		Dom	yes		16	16q22.1	1009	T	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""			M	USP6		aneurysmal bone cysts		0				lung(10)|ovary(3)|skin(1)	14						c.(388-390)GCG>GTG		cadherin 11, type 2 preproprotein							154.0	115.0	128.0					16																	65032599		2203	4300	6503	SO:0001583	missense	1009				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr16:65032599G>A	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.389C>T	16.37:g.65032599G>A	ENSP00000268603:p.Ala130Val	TSP Lung(24;0.17)	Somatic				CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.A130V|CDH11_uc010vin.1_Missense_Mutation_p.A4V|CDH11_uc010vio.1_Missense_Mutation_p.A130V	p.A130V	NM_001797	NP_001788	WXS	Illumina HiSeq	Unspecified	P55287	CAD11_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.205)	4	823	-		Ovarian(137;0.0973)	130			Extracellular (Potential).|Cadherin 1.		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	c.389C>T	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816675	0.90790	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390;ENST00000536902	T;T	0.66099	-0.19;-0.19	5.77	5.77	0.91146	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.79736	0.4497	M	0.74467	2.265	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;P	0.83275	0.996;0.785	T	0.76583	-0.2906	10	0.37606	T	0.19	.	19.335	0.94312	0.0:0.0:1.0:0.0	.	130;130	P55287-2;P55287	.;CAD11_HUMAN	V	130;130;113;130	ENSP00000268603:A130V;ENSP00000377711:A130V	ENSP00000268603:A130V	A	-	2	0	CDH11	63590100	1.000000	0.71417	0.982000	0.44146	0.967000	0.64934	6.043000	0.71004	2.884000	0.98904	0.655000	0.94253	GCG		0.527	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664		17	7	0	0	0	0	17	7				
MYO1C	4641	broad.mit.edu	37	17	1373933	1373933	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:1373933G>T	ENST00000575158.1	-	22	2334	c.2158C>A	c.(2158-2160)Ctc>Atc	p.L720I	MYO1C_ENST00000545534.2_Missense_Mutation_p.L731I|MYO1C_ENST00000359786.5_Missense_Mutation_p.L755I|MYO1C_ENST00000438665.2_Missense_Mutation_p.L736I|MYO1C_ENST00000361007.2_Missense_Mutation_p.L720I			Q12965	MYO1E_HUMAN	myosin IC	716	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Myosin tail. {ECO:0000255}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TTCACCCGGAGGAATTTCTGC	0.622																																						uc002fsp.2		NA																	0					0						c.(2263-2265)CTC>ATC		myosin IC isoform a							21.0	21.0	21.0					17																	1373933		2203	4300	6503	SO:0001583	missense	4641				mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:1373933G>T	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.2158C>A	17.37:g.1373933G>T	ENSP00000459174:p.Leu720Ile		Somatic				MYO1C_uc002fsn.2_Missense_Mutation_p.L736I|MYO1C_uc002fso.2_Missense_Mutation_p.L720I|MYO1C_uc010vqj.1_Missense_Mutation_p.L720I|MYO1C_uc010vqk.1_Missense_Mutation_p.L731I	p.L755I	NM_001080779	NP_001074248	WXS	Illumina HiSeq	Unspecified	O00159	MYO1C_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	22	2483	-			755			IQ 1.		Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	c.2263C>A	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458874	0.43634	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	4.93	3.89	0.44902	.	0.125913	0.53938	D	0.000055	T	0.66096	0.2755	L	0.60845	1.875	0.26989	N	0.965191	P;P;P	0.41848	0.589;0.763;0.534	B;B;B	0.42163	0.378;0.378;0.26	T	0.64170	-0.6470	10	0.56958	D	0.05	.	8.9569	0.35823	0.1747:0.0:0.8253:0.0	.	731;755;736	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	I	755;736;736;720;731;720	ENSP00000352834:L755I;ENSP00000412197:L736I;ENSP00000354283:L720I;ENSP00000437685:L731I	ENSP00000352834:L755I	L	-	1	0	MYO1C	1320683	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	3.059000	0.49947	2.574000	0.86865	0.650000	0.86243	CTC		0.622	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2			10	21	1	0	0.000219431	0.000225544	10	21				
ZZEF1	23140	broad.mit.edu	37	17	3928237	3928237	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:3928237C>T	ENST00000381638.2	-	43	7192	c.7068G>A	c.(7066-7068)ctG>ctA	p.L2356L		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2356							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						ACAATCCTTTCAGGGCCAGGG	0.493																																						uc002fxe.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(7066-7068)CTG>CTA		zinc finger, ZZ type with EF hand domain 1							117.0	114.0	115.0					17																	3928237		2203	4300	6503	SO:0001819	synonymous_variant	23140						calcium ion binding|zinc ion binding	g.chr17:3928237C>T	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7068G>A	17.37:g.3928237C>T			Somatic				ZZEF1_uc002fxh.2_Silent_p.L670L|ZZEF1_uc002fxi.2_Silent_p.L591L	p.L2356L	NM_015113	NP_055928	WXS	Illumina HiSeq	Unspecified	O43149	ZZEF1_HUMAN			43	7132	-			2356					A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	37	c.7068G>A	CCDS11043.1																																																																																				0.493	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113		8	108	0	0	0	0	8	108				
POLR2A	5430	broad.mit.edu	37	17	7404130	7404130	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:7404130G>A	ENST00000322644.6	+	11	2243	c.1844G>A	c.(1843-1845)aGt>aAt	p.S615N		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	615					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GATGAAGACAGTGGCCCTTAC	0.547																																						uc002ghf.3		NA																	0				pancreas(1)	1						c.(1843-1845)AGT>AAT		DNA-directed RNA polymerase II A							145.0	129.0	134.0					17																	7404130		2203	4300	6503	SO:0001583	missense	5430				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding	g.chr17:7404130G>A			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.1844G>A	17.37:g.7404130G>A	ENSP00000314949:p.Ser615Asn		Somatic					p.S615N	NM_000937	NP_000928	WXS	Illumina HiSeq	Unspecified	P24928	RPB1_HUMAN			11	2078	+		Prostate(122;0.173)	615					A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	c.1844G>A	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902572	0.52227	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.71341	-0.56	5.96	4.98	0.66077	RNA polymerase Rpb1, domain 3 (1);	0.000000	0.85682	D	0.000000	T	0.55641	0.1933	N	0.16130	0.375	0.80722	D	1	B	0.12630	0.006	B	0.17098	0.017	T	0.49570	-0.8926	10	0.29301	T	0.29	.	16.0657	0.80870	0.0:0.1347:0.8652:0.0	.	615	P24928	RPB1_HUMAN	N	571;615	ENSP00000314949:S615N	ENSP00000314949:S615N	S	+	2	0	SLC35G6	7344854	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	6.080000	0.71299	1.513000	0.48852	0.585000	0.79938	AGT		0.547	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937		98	7	0	0	0	0	98	7				
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	C	T	rs112431538		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:7577085C>T	ENST00000269305.4	-	8	1042	c.853G>A	c.(853-855)Gag>Aag	p.E285K	TP53_ENST00000455263.2_Missense_Mutation_p.E285K|TP53_ENST00000420246.2_Missense_Mutation_p.E285K|TP53_ENST00000445888.2_Missense_Mutation_p.E285K|TP53_ENST00000359597.4_Missense_Mutation_p.E285K|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	285	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:1694291}.|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E285K(111)|p.E285*(24)|p.0?(8)|p.E285Q(4)|p.?(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.E285fs*20(1)|p.E285fs*13(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTCTTCCTCTGTGCGCCGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		165	Substitution - Missense(115)|Substitution - Nonsense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)	urinary_tract(53)|breast(18)|large_intestine(15)|lung(11)|upper_aerodigestive_tract(10)|stomach(8)|haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(6)|oesophagus(6)|liver(6)|skin(5)|prostate(4)|bone(4)|biliary_tract(3)|ovary(3)|adrenal_gland(1)|soft_tissue(1)|eye(1)|pancreas(1)|thyroid(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM995136	TP53	M	rs112431538	c.(853-855)GAG>AAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							91.0	78.0	82.0					17																	7577085		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577085C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.853G>A	17.37:g.7577085C>T	ENSP00000269305:p.Glu285Lys	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E285K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E153K|TP53_uc010cng.1_Missense_Mutation_p.E153K|TP53_uc002gii.1_Missense_Mutation_p.E153K|TP53_uc010cnh.1_Missense_Mutation_p.E285K|TP53_uc010cni.1_Missense_Mutation_p.E285K|TP53_uc002gij.2_Missense_Mutation_p.E285K	p.E285K	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1047	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	285		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.853G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703759	0.88924	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.89904	3.07	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.994;0.983;0.994;0.998	D	0.96661	0.9489	10	0.87932	D	0	-38.0538	15.807	0.78520	0.0:1.0:0.0:0.0	.	285;285;285;285	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	285;285;285;285;285;274;153	ENSP00000352610:E285K;ENSP00000269305:E285K;ENSP00000398846:E285K;ENSP00000391127:E285K;ENSP00000391478:E285K;ENSP00000425104:E153K	ENSP00000269305:E285K	E	-	1	0	TP53	7517810	1.000000	0.71417	0.900000	0.35374	0.716000	0.41182	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		28	9	0	0	0	0	28	9				
DNAH2	146754	broad.mit.edu	37	17	7735024	7735024	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:7735024C>G	ENST00000572933.1	+	82	14117	c.12657C>G	c.(12655-12657)gtC>gtG	p.V4219V	DNAH2_ENST00000389173.2_Silent_p.V4219V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	4219					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTCTCATCGTCATGTCTACAA	0.488																																						uc002giu.1		NA																	0				ovary(6)|skin(6)|central_nervous_system(1)	13						c.(12655-12657)GTC>GTG		dynein heavy chain domain 3							185.0	159.0	168.0					17																	7735024		2203	4300	6503	SO:0001819	synonymous_variant	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7735024C>G	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.12657C>G	17.37:g.7735024C>G			Somatic				DNAH2_uc010cnm.1_Silent_p.V1157V	p.V4219V	NM_020877	NP_065928	WXS	Illumina HiSeq	Unspecified	Q9P225	DYH2_HUMAN			81	12671	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	4219					A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	c.12657C>G	CCDS32551.1																																																																																				0.488	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		11	48	0	0	0	0	11	48				
NCOR1	9611	broad.mit.edu	37	17	16024584	16024584	+	Splice_Site	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:16024584C>T	ENST00000268712.3	-	16	1892		c.e16-1		NCOR1_ENST00000583226.1_Splice_Site|NCOR1_ENST00000395851.1_Splice_Site|NCOR1_ENST00000395848.1_Splice_Site	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1						CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGTATTTTCTCTGGACACAAA	0.383																																						uc002gpo.2		NA																	0				upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5						c.e16-1		nuclear receptor co-repressor 1							77.0	77.0	77.0					17																	16024584		2203	4298	6501	SO:0001630	splice_region_variant	9611				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding	g.chr17:16024584C>T	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1635-1G>A	17.37:g.16024584C>T			Somatic				NCOR1_uc002gpn.2_Splice_Site_p.K545_splice|NCOR1_uc002gpp.1_Splice_Site_p.K436_splice|NCOR1_uc002gpr.2_Splice_Site_p.K436_splice	p.K545_splice	NM_006311	NP_006302	WXS	Illumina HiSeq	Unspecified	O75376	NCOR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)	16	1875	-								B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Splice_Site	SNP	ENST00000268712.3	37	c.1635_splice	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406546	0.83230	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395848	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0512	0.93046	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NCOR1	15965309	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.436000	0.80404	2.735000	0.93741	0.655000	0.94253	.		0.383	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	Intron	5	132	0	0	0	0	5	132				
MYO15A	51168	broad.mit.edu	37	17	18023707	18023707	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:18023707C>G	ENST00000205890.5	+	2	1931	c.1593C>G	c.(1591-1593)ttC>ttG	p.F531L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	531					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCCACCCTTTCTGGGGCTTCC	0.706																																						uc010vxh.1		NA																	0				skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(1591-1593)TTC>TTG		myosin XV							18.0	24.0	22.0					17																	18023707		1953	4119	6072	SO:0001583	missense	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18023707C>G	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1593C>G	17.37:g.18023707C>G	ENSP00000205890:p.Phe531Leu		Somatic					p.F531L	NM_016239	NP_057323	WXS	Illumina HiSeq	Unspecified	Q9UKN7	MYO15_HUMAN			2	1931	+	all_neural(463;0.228)		531			Myosin head-like.		B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	c.1593C>G	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383514	0.42207	.	.	ENSG00000091536	ENST00000205890	T	0.36699	1.24	4.95	2.89	0.33648	.	.	.	.	.	T	0.18130	0.0435	N	0.12182	0.205	0.28700	N	0.904145	B	0.02656	0.0	B	0.04013	0.001	T	0.29027	-1.0025	9	0.11794	T	0.64	.	8.2695	0.31836	0.0:0.8032:0.0:0.1968	.	531	Q9UKN7	MYO15_HUMAN	L	531	ENSP00000205890:F531L	ENSP00000205890:F531L	F	+	3	2	MYO15A	17964432	0.991000	0.36638	0.929000	0.37066	0.837000	0.47467	0.226000	0.17776	0.452000	0.26830	0.448000	0.29417	TTC		0.706	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		4	9	0	0	0	0	4	9				
SHMT1	6470	broad.mit.edu	37	17	18238931	18238931	+	Silent	SNP	A	A	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:18238931A>C	ENST00000316694.3	-	8	1007	c.873T>G	c.(871-873)ctT>ctG	p.L291L	SHMT1_ENST00000352886.6_Intron|SHMT1_ENST00000354098.3_Intron|SHMT1_ENST00000539052.1_Silent_p.L153L	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	291					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CAGAATTGATAAGAGACTCCA	0.502																																						uc002gta.2		NA																	0				ovary(1)	1						c.(871-873)CTT>CTG		serine hydroxymethyltransferase 1 (soluble)	Glycine(DB00145)|Mimosine(DB01055)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)						208.0	204.0	205.0					17																	18238931		2203	4300	6503	SO:0001819	synonymous_variant	6470				carnitine biosynthetic process|folic acid metabolic process|L-serine catabolic process|one-carbon metabolic process|purine base biosynthetic process	cytosol|nucleus	glycine hydroxymethyltransferase activity|protein homodimerization activity|pyridoxal phosphate binding	g.chr17:18238931A>C		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.873T>G	17.37:g.18238931A>C			Somatic				SHMT1_uc002gsz.2_Silent_p.L66L|SHMT1_uc002gtb.2_Intron|SHMT1_uc010cqb.2_Silent_p.L291L|SHMT1_uc010vxt.1_Silent_p.L153L|SHMT1_uc002gtc.1_5'Flank|SHMT1_uc002gtd.1_Silent_p.L291L	p.L291L	NM_004169	NP_004160	WXS	Illumina HiSeq	Unspecified	P34896	GLYC_HUMAN			8	1063	-			291					B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Silent	SNP	ENST00000316694.3	37	c.873T>G	CCDS11196.1																																																																																				0.502	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169		102	92	0	0	0	0	102	92				
TRIM16L	147166	broad.mit.edu	37	17	18638380	18638380	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:18638380G>T	ENST00000449552.2	+	7	2138	c.654G>T	c.(652-654)gaG>gaT	p.E218D	TRIM16L_ENST00000571708.1_Missense_Mutation_p.E218D|TRIM16L_ENST00000414850.2_Missense_Mutation_p.R131I|TRIM16L_ENST00000395672.2_Missense_Mutation_p.E218D|TRIM16L_ENST00000572555.1_Missense_Mutation_p.E218D|TRIM16L_ENST00000395671.4_Missense_Mutation_p.E218D|TRIM16L_ENST00000395902.3_Missense_Mutation_p.E272D			Q309B1	TR16L_HUMAN	tripartite motif containing 16-like	218	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	9						TTGAGGTGGAGATCTTCGGGG	0.587																																						uc002gug.1		NA																	0					0						c.(652-654)GAG>GAT		tripartite motif-containing 16-like							39.0	38.0	38.0					17																	18638380		2203	4297	6500	SO:0001583	missense	147166					cytoplasm		g.chr17:18638380G>T	DQ232882	CCDS32588.1	17p11.2	2011-02-10	2011-01-25		ENSG00000108448	ENSG00000108448			32670	protein-coding gene	gene with protein product			"""tripartite motif-containing 16-like"""				Standard	XM_005256479		Approved	TRIM70	uc002gui.1	Q309B1	OTTHUMG00000059050	ENST00000449552.2:c.654G>T	17.37:g.18638380G>T	ENSP00000461386:p.Glu218Asp		Somatic				TRIM16L_uc010vyf.1_Missense_Mutation_p.E272D|TRIM16L_uc002guh.1_Missense_Mutation_p.E218D|TRIM16L_uc010cqg.1_Missense_Mutation_p.E320D|TRIM16L_uc002gui.1_Missense_Mutation_p.E218D|TRIM16L_uc010vyg.1_Missense_Mutation_p.E218D|TRIM16L_uc010vyh.1_Missense_Mutation_p.R131I	p.E218D	NM_001037330	NP_001032407	WXS	Illumina HiSeq	Unspecified	Q309B1	TR16L_HUMAN			10	1341	+			218			B30.2/SPRY.		A0PK10|B2RUW6|B4DQK2|B4DWQ8	Missense_Mutation	SNP	ENST00000449552.2	37	c.654G>T	CCDS32588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	8.858|8.858	0.946252|0.946252	0.18356|0.18356	.|.	.|.	ENSG00000108448|ENSG00000108448	ENST00000395902;ENST00000395672;ENST00000395671|ENST00000414850	T;T;T|.	0.70986|.	-0.53;-0.53;-0.53|.	3.54|3.54	3.54|3.54	0.40534|0.40534	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);|.	0.196309|.	0.42172|.	U|.	0.000759|.	T|T	0.32194|0.32194	0.0821|0.0821	L|L	0.33792|0.33792	1.035|1.035	0.31744|0.31744	N|N	0.635462|0.635462	B;B;B|P	0.25521|0.47677	0.089;0.128;0.091|0.899	B;B;B|B	0.28849|0.39258	0.095;0.052;0.058|0.295	T|T	0.47509|0.47509	-0.9112|-0.9112	10|8	0.45353|0.87932	T|D	0.12|0	-17.3676|-17.3676	12.6621|12.6621	0.56820|0.56820	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	272;434;218|131	B4DE22;B3KMJ2;Q309B1|B4DWQ8	.;.;TR16L_HUMAN|.	D|I	272;218;218|131	ENSP00000379239:E272D;ENSP00000379031:E218D;ENSP00000379030:E218D|.	ENSP00000379030:E218D|ENSP00000403648:R131I	E|R	+|+	3|2	2|0	TRIM16L|TRIM16L	18579105|18579105	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.473000|0.473000	0.32948|0.32948	1.277000|1.277000	0.33167|0.33167	1.817000|1.817000	0.53016|0.53016	0.194000|0.194000	0.17425|0.17425	GAG|AGA		0.587	TRIM16L-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130670.3	NM_001037330		42	2	1	0	1.42e-22	1.52e-22	42	2				
ATAD5	79915	broad.mit.edu	37	17	29220591	29220591	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:29220591G>C	ENST00000321990.4	+	21	5098	c.4720G>C	c.(4720-4722)Gat>Cat	p.D1574H		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1574					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GGTAATATTAGATGATAGTGA	0.358																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(4720-4722)GAT>CAT		ATPase family, AAA domain containing 5							41.0	45.0	44.0					17																	29220591		2202	4298	6500	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29220591G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4720G>C	17.37:g.29220591G>C	ENSP00000313171:p.Asp1574His		Somatic					p.D1574H	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			21	5066	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	1574					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.4720G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110009	0.56398	.	.	ENSG00000176208	ENST00000321990	T	0.07567	3.18	6.08	6.08	0.98989	.	0.547445	0.21001	N	0.081876	T	0.26448	0.0646	M	0.64997	1.995	0.42812	D	0.993965	D	0.89917	1.0	D	0.79108	0.992	T	0.00056	-1.2176	10	0.87932	D	0	.	13.8168	0.63297	0.0695:0.0:0.9305:0.0	.	1574	Q96QE3	ATAD5_HUMAN	H	1574	ENSP00000313171:D1574H	ENSP00000313171:D1574H	D	+	1	0	ATAD5	26244717	1.000000	0.71417	0.992000	0.48379	0.401000	0.30781	2.989000	0.49393	2.894000	0.99253	0.591000	0.81541	GAT		0.358	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		11	46	0	0	0	0	11	46				
ATAD5	79915	broad.mit.edu	37	17	29221718	29221718	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:29221718G>C	ENST00000321990.4	+	22	5812	c.5434G>C	c.(5434-5436)Gaa>Caa	p.E1812Q	TEFM_ENST00000579183.1_5'Flank	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1812					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GAAGCTAAAAGAACAAGGAAA	0.303																																						uc002hfs.1		NA																	0				ovary(3)	3						c.(5434-5436)GAA>CAA		ATPase family, AAA domain containing 5							55.0	53.0	53.0					17																	29221718		2202	4300	6502	SO:0001583	missense	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29221718G>C		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.5434G>C	17.37:g.29221718G>C	ENSP00000313171:p.Glu1812Gln		Somatic					p.E1812Q	NM_024857	NP_079133	WXS	Illumina HiSeq	Unspecified	Q96QE3	ATAD5_HUMAN			22	5780	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	1812					Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	c.5434G>C	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238279	0.79800	.	.	ENSG00000176208	ENST00000321990	T	0.11063	2.81	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.34803	0.0910	M	0.70275	2.135	0.53688	D	0.99997	D	0.89917	1.0	D	0.83275	0.996	T	0.00995	-1.1487	10	0.40728	T	0.16	.	19.5896	0.95503	0.0:0.0:1.0:0.0	.	1812	Q96QE3	ATAD5_HUMAN	Q	1812	ENSP00000313171:E1812Q	ENSP00000313171:E1812Q	E	+	1	0	ATAD5	26245844	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.246000	0.72405	2.632000	0.89209	0.585000	0.79938	GAA		0.303	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		7	36	0	0	0	0	7	36				
FBXL20	84961	broad.mit.edu	37	17	37421664	37421664	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:37421664G>A	ENST00000264658.6	-	13	1236	c.976C>T	c.(976-978)Cga>Tga	p.R326*	FBXL20_ENST00000583610.1_Nonsense_Mutation_p.R326*|FBXL20_ENST00000577399.1_Nonsense_Mutation_p.R328*|FBXL20_ENST00000394294.3_Nonsense_Mutation_p.R294*	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	326					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			ACTTGAAGTCGAGGACAGTGT	0.338																																						uc010wed.1		NA																	0				ovary(1)	1						c.(976-978)CGA>TGA		F-box and leucine-rich repeat protein 20							117.0	108.0	111.0					17																	37421664		2203	4300	6503	SO:0001587	stop_gained	84961					cytoplasm		g.chr17:37421664G>A	BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.976C>T	17.37:g.37421664G>A	ENSP00000264658:p.Arg326*		Somatic				FBXL20_uc002hrt.2_Nonsense_Mutation_p.R326*|FBXL20_uc010cvu.2_Nonsense_Mutation_p.R294*	p.R326*	NM_032875	NP_116264	WXS	Illumina HiSeq	Unspecified	Q96IG2	FXL20_HUMAN	LUAD - Lung adenocarcinoma(14;0.146)		13	1197	-			326			LRR 10.		A8K729|Q38J52	Nonsense_Mutation	SNP	ENST00000264658.6	37	c.976C>T	CCDS32640.1	.	.	.	.	.	.	.	.	.	.	G	37	6.355243	0.97498	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	.	.	.	5.61	4.56	0.56223	.	0.121655	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1147	0.72392	0.0:0.0:0.7713:0.2287	.	.	.	.	X	326;294	.	ENSP00000264658:R326X	R	-	1	2	FBXL20	34675190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.863000	0.56016	2.646000	0.89796	0.563000	0.77884	CGA		0.338	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875		16	101	0	0	0	0	16	101				
MED1	5469	broad.mit.edu	37	17	37565028	37565028	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:37565028G>A	ENST00000300651.6	-	17	3669	c.3446C>T	c.(3445-3447)tCt>tTt	p.S1149F	CTB-131K11.1_ENST00000582842.1_RNA|MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CTTCCCCCCAGACTGGGATGA	0.478										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	0				lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(3445-3447)TCT>TTT		mediator complex subunit 1							63.0	62.0	63.0					17																	37565028		2203	4300	6503	SO:0001583	missense	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37565028G>A	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3446C>T	17.37:g.37565028G>A	ENSP00000300651:p.Ser1149Phe	HNSCC(31;0.082)	Somatic				MED1_uc010wee.1_Missense_Mutation_p.S977F|MED1_uc002hru.2_Intron	p.S1149F	NM_004774	NP_004765	WXS	Illumina HiSeq	Unspecified	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	3658	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	1149			Ser-rich.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	c.3446C>T	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289739	0.23478	.	.	ENSG00000125686	ENST00000300651	T	0.35789	1.29	5.35	4.37	0.52481	.	.	.	.	.	T	0.39306	0.1073	N	0.19112	0.55	0.42950	D	0.994373	D	0.62365	0.991	P	0.55161	0.77	T	0.45977	-0.9224	9	0.72032	D	0.01	-4.1532	16.48	0.84156	0.0:0.1312:0.8688:0.0	.	1149	Q15648	MED1_HUMAN	F	1149	ENSP00000300651:S1149F	ENSP00000300651:S1149F	S	-	2	0	MED1	34818554	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.589000	0.74080	1.609000	0.50190	-0.175000	0.13238	TCT		0.478	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		9	74	0	0	0	0	9	74				
MED1	5469	broad.mit.edu	37	17	37565889	37565889	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:37565889C>T	ENST00000300651.6	-	17	2808	c.2585G>A	c.(2584-2586)gGa>gAa	p.G862E	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GAAATCTACTCCATCATGAAA	0.388										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	0				lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(2584-2586)GGA>GAA		mediator complex subunit 1							73.0	76.0	75.0					17																	37565889		2202	4299	6501	SO:0001583	missense	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37565889C>T	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2585G>A	17.37:g.37565889C>T	ENSP00000300651:p.Gly862Glu	HNSCC(31;0.082)	Somatic				MED1_uc010wee.1_Missense_Mutation_p.G690E|MED1_uc002hru.2_Intron	p.G862E	NM_004774	NP_004765	WXS	Illumina HiSeq	Unspecified	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	2797	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	862			Interaction with ESR1.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	c.2585G>A	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.108941	0.56398	.	.	ENSG00000125686	ENST00000300651	T	0.33438	1.41	6.03	6.03	0.97812	.	.	.	.	.	T	0.18800	0.0451	N	0.14661	0.345	0.51767	D	0.999931	P	0.38922	0.651	B	0.30401	0.115	T	0.06285	-1.0835	9	0.15066	T	0.55	-6.3437	20.5666	0.99351	0.0:1.0:0.0:0.0	.	862	Q15648	MED1_HUMAN	E	862	ENSP00000300651:G862E	ENSP00000300651:G862E	G	-	2	0	MED1	34819415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.458000	0.73509	2.854000	0.98071	0.655000	0.94253	GGA		0.388	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		31	223	0	0	0	0	31	223				
KRT26	353288	broad.mit.edu	37	17	38928008	38928008	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:38928008C>G	ENST00000335552.4	-	1	406	c.358G>C	c.(358-360)Gag>Cag	p.E120Q		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				TCACATTTCTCGTACCAGCCC	0.498																																						uc002hvf.2		NA																	0					0						c.(358-360)GAG>CAG		keratin 26							115.0	113.0	114.0					17																	38928008		2203	4300	6503	SO:0001583	missense	353288					intermediate filament	structural molecule activity	g.chr17:38928008C>G	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.358G>C	17.37:g.38928008C>G	ENSP00000334798:p.Glu120Gln		Somatic					p.E120Q	NM_181539	NP_853517	WXS	Illumina HiSeq	Unspecified	Q7Z3Y9	K1C26_HUMAN			1	404	-		Breast(137;0.00526)	120			Rod.|Linker 1.			Missense_Mutation	SNP	ENST00000335552.4	37	c.358G>C	CCDS11374.1	.	.	.	.	.	.	.	.	.	.	C	5.645	0.303621	0.10678	.	.	ENSG00000186393	ENST00000335552	D	0.89050	-2.46	5.72	3.7	0.42460	Filament (1);	0.198121	0.35320	N	0.003282	D	0.85818	0.5785	L	0.60957	1.885	0.09310	N	1	B	0.28880	0.226	B	0.38755	0.281	T	0.69993	-0.4994	10	0.10111	T	0.7	.	8.1907	0.31366	0.0:0.62:0.2434:0.1366	.	120	Q7Z3Y9	K1C26_HUMAN	Q	120	ENSP00000334798:E120Q	ENSP00000334798:E120Q	E	-	1	0	KRT26	36181534	0.000000	0.05858	0.364000	0.25888	0.296000	0.27459	-0.078000	0.11375	0.860000	0.35481	-0.156000	0.13503	GAG		0.498	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539		10	104	0	0	0	0	10	104				
WNK4	65266	broad.mit.edu	37	17	40932738	40932738	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:40932738G>C	ENST00000246914.5	+	1	43	c.22G>C	c.(22-24)Gag>Cag	p.E8Q		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	8					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCCGGCCACGGAGACCACCGT	0.711																																					Esophageal Squamous(6;201 374 4964 23855 42828)	uc002ibj.2		NA																	0				ovary(3)|skin(3)|stomach(1)	7						c.(22-24)GAG>CAG		WNK lysine deficient protein kinase 4							22.0	24.0	23.0					17																	40932738		2181	4265	6446	SO:0001583	missense	65266				intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity	g.chr17:40932738G>C	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.22G>C	17.37:g.40932738G>C	ENSP00000246914:p.Glu8Gln		Somatic				WNK4_uc010wgx.1_5'UTR|WNK4_uc002ibk.1_5'Flank	p.E8Q	NM_032387	NP_115763	WXS	Illumina HiSeq	Unspecified	Q96J92	WNK4_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.0749)	1	43	+		Breast(137;0.000143)	8					B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	c.22G>C	CCDS11439.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310005	0.40895	.	.	ENSG00000126562	ENST00000246914	T	0.71222	-0.55	4.41	4.41	0.53225	.	0.443404	0.18961	N	0.126393	T	0.57403	0.2051	L	0.29908	0.895	0.09310	N	1	B	0.23058	0.079	B	0.22386	0.039	T	0.43972	-0.9358	10	0.25106	T	0.35	-14.4723	12.3539	0.55163	0.0:0.0:1.0:0.0	.	8	Q96J92	WNK4_HUMAN	Q	8	ENSP00000246914:E8Q	ENSP00000246914:E8Q	E	+	1	0	WNK4	38186264	0.791000	0.28800	0.030000	0.17652	0.010000	0.07245	3.069000	0.50026	2.275000	0.75901	0.313000	0.20887	GAG		0.711	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1			9	6	0	0	0	0	9	6				
CACNA1G	8913	broad.mit.edu	37	17	48678415	48678416	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:48678415_48678416CC>TT	ENST00000359106.5	+	19	3795_3796	c.3795_3796CC>TT	c.(3793-3798)ttCCgc>ttTTgc	p.R1266C	CACNA1G_ENST00000505165.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000354983.4_Missense_Mutation_p.R1243C|CACNA1G_ENST00000442258.2_Missense_Mutation_p.R1243C|CACNA1G_ENST00000515165.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000515411.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000502264.1_Missense_Mutation_p.R1243C|CACNA1G_ENST00000429973.2_Missense_Mutation_p.R1266C|CACNA1G_ENST00000503485.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000515765.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000510115.1_Missense_Mutation_p.R1243C|CACNA1G_ENST00000513964.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000507609.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000360761.4_Missense_Mutation_p.R1243C|CACNA1G_ENST00000513689.2_Missense_Mutation_p.R1266C|CACNA1G_ENST00000507336.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000507896.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000352832.5_Missense_Mutation_p.R1243C|CACNA1G_ENST00000358244.5_Missense_Mutation_p.R1243C|CACNA1G_ENST00000507510.2_Missense_Mutation_p.R1266C|CACNA1G_ENST00000510366.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000416767.4_Missense_Mutation_p.R1266C|CACNA1G_ENST00000514181.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000514717.1_Missense_Mutation_p.R1243C|CACNA1G_ENST00000512389.1_Missense_Mutation_p.R1266C|CACNA1G_ENST00000514079.1_Missense_Mutation_p.R1266C	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1266					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGGCAGGTTCCGCCTCCTGTG	0.639																																						uc002irk.1		NA																	0				breast(1)	1						c.(3793-3798)TTCCGC>TTTTGC		voltage-dependent calcium channel alpha 1G	Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)																																			SO:0001583	missense	8913				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr17:48678415_48678416CC>TT	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	Exception_encountered	17.37:g.48678415_48678416delinsTT	ENSP00000352011:p.Arg1266Cys		Somatic				CACNA1G_uc002iri.1_Missense_Mutation_p.R1266C|CACNA1G_uc002irj.1_Missense_Mutation_p.R1243C|CACNA1G_uc002irl.1_Missense_Mutation_p.R1243C|CACNA1G_uc002irm.1_Missense_Mutation_p.R1243C|CACNA1G_uc002irn.1_Missense_Mutation_p.R1243C|CACNA1G_uc002iro.1_Missense_Mutation_p.R1243C|CACNA1G_uc002irp.1_Missense_Mutation_p.R1266C|CACNA1G_uc002irq.1_Missense_Mutation_p.R1243C|CACNA1G_uc002irr.1_Missense_Mutation_p.R1266C|CACNA1G_uc002irs.1_Missense_Mutation_p.R1266C|CACNA1G_uc002irt.1_Missense_Mutation_p.R1266C|CACNA1G_uc002irv.1_Missense_Mutation_p.R1266C|CACNA1G_uc002irw.1_Missense_Mutation_p.R1243C|CACNA1G_uc002iru.1_Missense_Mutation_p.R1243C|CACNA1G_uc002irx.1_Missense_Mutation_p.R1179C|CACNA1G_uc002iry.1_Missense_Mutation_p.R1179C|CACNA1G_uc002irz.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isa.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isb.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isc.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isd.1_Missense_Mutation_p.R1179C|CACNA1G_uc002ise.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isf.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isg.1_Missense_Mutation_p.R1179C|CACNA1G_uc002ish.1_Missense_Mutation_p.R1179C|CACNA1G_uc002isi.1_Missense_Mutation_p.R1156C|CACNA1G_uc002isj.2_5'UTR	p.R1266C	NM_018896	NP_061496	WXS	Illumina HiSeq	Unspecified	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		19	4167_4168	+	Breast(11;6.7e-17)		1266			Cytoplasmic (Potential).|III.		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	DNP	ENST00000359106.5	37	c.3795_3796CC>TT	CCDS45730.1																																																																																				0.639	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896		3	47	0	0	0	0	3	47				
SPAG9	9043	broad.mit.edu	37	17	49057213	49057213	+	Silent	SNP	G	G	C	rs149696370		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:49057213G>C	ENST00000262013.7	-	26	3511	c.3303C>G	c.(3301-3303)ggC>ggG	p.G1101G	SPAG9_ENST00000510283.1_Silent_p.G944G|SPAG9_ENST00000505279.1_Silent_p.G1091G|SPAG9_ENST00000357122.4_Silent_p.G1087G	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	1101					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			AGACCCACACGCCATCCCCCA	0.473																																						uc002itc.2		NA																	0				lung(4)|breast(1)	5						c.(3301-3303)GGC>GGG		sperm associated antigen 9 isoform 1							199.0	160.0	173.0					17																	49057213		2203	4300	6503	SO:0001819	synonymous_variant	9043				positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm		g.chr17:49057213G>C	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.3303C>G	17.37:g.49057213G>C			Somatic				SPAG9_uc002itb.2_Silent_p.G1087G|SPAG9_uc002itd.2_Silent_p.G1091G|SPAG9_uc002ita.2_Silent_p.G944G	p.G1101G	NM_001130528	NP_001124000	WXS	Illumina HiSeq	Unspecified	O60271	JIP4_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.24e-07)		26	3512	-			1101					A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	ENST00000262013.7	37	c.3303C>G	CCDS45740.1																																																																																				0.473	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971		26	14	0	0	0	0	26	14				
CSH2	1443	broad.mit.edu	37	17	61949939	61949939	+	Missense_Mutation	SNP	C	C	A	rs568921116		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:61949939C>A	ENST00000392886.2	-	4	605	c.454G>T	c.(454-456)Ggg>Tgg	p.G152W	CSH2_ENST00000345366.7_Intron|CSH2_ENST00000336844.5_Missense_Mutation_p.G152W|CSH2_ENST00000560142.1_Missense_Mutation_p.G95W	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2	152						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|lung(3)	6						ACCCTCACCCCCATCAGCGTT	0.582																																						uc002jch.2		NA																	0					0						c.(454-456)GGG>TGG		chorionic somatomammotropin hormone 2 isoform 1							69.0	65.0	66.0					17																	61949939		2203	4300	6503	SO:0001583	missense	1443				female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding	g.chr17:61949939C>A	V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.454G>T	17.37:g.61949939C>A	ENSP00000376623:p.Gly152Trp		Somatic				CSH2_uc002jcg.2_Intron|CSH2_uc002jci.2_Missense_Mutation_p.G152W|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Missense_Mutation_p.G152W	p.G152W	NM_020991	NP_066271	WXS	Illumina HiSeq	Unspecified	P01243	CSH_HUMAN			4	569	-			152					P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	ENST00000392886.2	37	c.454G>T	CCDS42369.1	.	.	.	.	.	.	.	.	.	.	g	2.162	-0.391991	0.04932	.	.	ENSG00000213218	ENST00000336844;ENST00000392886	T;D	0.86956	0.9;-2.19	3.7	0.526	0.17078	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.410296	0.25419	N	0.030815	D	0.83783	0.5329	L	0.55103	1.725	0.80722	D	1	B;B;B	0.26258	0.001;0.145;0.001	B;B;B	0.34038	0.003;0.174;0.003	T	0.78417	-0.2212	10	0.52906	T	0.07	.	10.6939	0.45888	0.0:0.1446:0.7142:0.1412	.	152;152;152	P01243;A6NIT4;A8K6C2	CSH_HUMAN;.;.	W	152	ENSP00000338816:G152W;ENSP00000376623:G152W	ENSP00000338816:G152W	G	-	1	0	CSH2	59303671	0.997000	0.39634	1.000000	0.80357	0.012000	0.07955	0.472000	0.22116	0.240000	0.21263	-2.720000	0.00132	GGG		0.582	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417657.1	NM_020991		14	84	1	0	8.6e-14	9.13e-14	14	84				
PRKCA	5578	broad.mit.edu	37	17	64299066	64299066	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:64299066G>C	ENST00000413366.3	+	1	123	c.97G>C	c.(97-99)Gag>Cag	p.E33Q	PRKCA_ENST00000583361.1_3'UTR	NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	33					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.E33K(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GAACGTGCACGAGGTGAAGGA	0.627																																						uc002jfp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(97-99)GAG>CAG		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)						109.0	93.0	98.0					17																	64299066		2203	4300	6503	SO:0001583	missense	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64299066G>C		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.97G>C	17.37:g.64299066G>C	ENSP00000408695:p.Glu33Gln		Somatic				PRKCA_uc002jfo.1_5'UTR	p.E33Q	NM_002737	NP_002728	WXS	Illumina HiSeq	Unspecified	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		1	141	+			33					B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	c.97G>C	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	G	7.644	0.681396	0.14907	.	.	ENSG00000154229	ENST00000413366	D	0.82167	-1.58	3.33	1.17	0.20885	.	0.000000	0.52532	U	0.000068	T	0.75376	0.3841	M	0.73962	2.25	0.44899	D	0.997916	P	0.37708	0.606	B	0.33121	0.158	T	0.65446	-0.6166	10	0.14656	T	0.56	.	7.198	0.25864	0.1025:0.1726:0.7249:0.0	.	33	P17252	KPCA_HUMAN	Q	33	ENSP00000408695:E33Q	ENSP00000408695:E33Q	E	+	1	0	PRKCA	61729528	1.000000	0.71417	0.046000	0.18839	0.899000	0.52679	5.436000	0.66538	-0.029000	0.13827	0.205000	0.17691	GAG		0.627	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			21	40	0	0	0	0	21	40				
HELZ	9931	broad.mit.edu	37	17	65119122	65119122	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:65119122G>C	ENST00000358691.5	-	26	3760	c.3594C>G	c.(3592-3594)gtC>gtG	p.V1198V	HELZ_ENST00000580168.1_Silent_p.V1199V	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1198						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCCCTCCATAGACAGCAGGTA	0.408																																						uc010wqk.1		NA																	0				ovary(1)|pancreas(1)	2						c.(3595-3597)GTC>GTG		helicase with zinc finger domain							124.0	115.0	118.0					17																	65119122		1860	4098	5958	SO:0001819	synonymous_variant	9931							g.chr17:65119122G>C	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.3594C>G	17.37:g.65119122G>C			Somatic				HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Silent_p.V1198V	p.V1199V	NM_014877	NP_055692	WXS	Illumina HiSeq	Unspecified					26	3784	-	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)							I6L9H4	Silent	SNP	ENST00000358691.5	37	c.3597C>G	CCDS42374.1																																																																																				0.408	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877		9	86	0	0	0	0	9	86				
QRICH2	84074	broad.mit.edu	37	17	74287156	74287156	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:74287156C>G	ENST00000262765.5	-	4	3333	c.3154G>C	c.(3154-3156)Gat>Cat	p.D1052H		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1052										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TGCTCCTCATCCAGATCCTTC	0.527																																						uc002jrd.1		NA																	0				ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						c.(3154-3156)GAT>CAT		glutamine rich 2							115.0	110.0	112.0					17																	74287156		2203	4300	6503	SO:0001583	missense	84074						protein binding	g.chr17:74287156C>G	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3154G>C	17.37:g.74287156C>G	ENSP00000262765:p.Asp1052His		Somatic				QRICH2_uc010wsz.1_Missense_Mutation_p.D978H|QRICH2_uc010dgw.1_Intron	p.D1052H	NM_032134	NP_115510	WXS	Illumina HiSeq	Unspecified	Q9H0J4	QRIC2_HUMAN			4	3334	-			1052					A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	c.3154G>C	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.031556	0.54790	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.57107	2.51;0.42	5.54	2.49	0.30216	.	.	.	.	.	T	0.58119	0.2100	L	0.32530	0.975	0.31008	N	0.719513	D;D	0.89917	1.0;0.999	D;D	0.72075	0.976;0.943	T	0.58797	-0.7573	9	0.72032	D	0.01	-8.7969	8.6475	0.34013	0.0:0.7591:0.0:0.2409	.	1052;1052	B5MD94;Q9H0J4	.;QRIC2_HUMAN	H	1052;60;1052	ENSP00000262765:D1052H;ENSP00000394461:D60H	ENSP00000262765:D1052H	D	-	1	0	QRICH2	71798751	1.000000	0.71417	0.044000	0.18714	0.020000	0.10135	1.262000	0.32992	0.309000	0.22966	-0.300000	0.09419	GAT		0.527	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134		32	63	0	0	0	0	32	63				
ENPP7	339221	broad.mit.edu	37	17	77710865	77710865	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:77710865G>A	ENST00000328313.5	+	4	1273	c.1052G>A	c.(1051-1053)gGg>gAg	p.G351E		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TTCAACAATGGGGAGCACGGC	0.602																																						uc002jxa.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1051-1053)GGG>GAG		ectonucleotide pyrophosphatase/phosphodiesterase							92.0	76.0	82.0					17																	77710865		2203	4300	6503	SO:0001583	missense	339221				negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity	g.chr17:77710865G>A	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.1052G>A	17.37:g.77710865G>A	ENSP00000332656:p.Gly351Glu		Somatic					p.G351E	NM_178543	NP_848638	WXS	Illumina HiSeq	Unspecified	Q6UWV6	ENPP7_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		4	1072	+			351						Missense_Mutation	SNP	ENST00000328313.5	37	c.1052G>A	CCDS11763.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260028	0.80246	.	.	ENSG00000182156	ENST00000328313	D	0.81821	-1.54	3.4	3.4	0.38934	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.060586	0.64402	D	0.000003	D	0.92205	0.7528	H	0.95611	3.695	0.80722	D	1	D	0.67145	0.996	D	0.76575	0.988	D	0.94758	0.7933	10	0.87932	D	0	-26.5716	15.3183	0.74099	0.0:0.0:1.0:0.0	.	351	Q6UWV6	ENPP7_HUMAN	E	351	ENSP00000332656:G351E	ENSP00000332656:G351E	G	+	2	0	ENPP7	75325460	1.000000	0.71417	0.993000	0.49108	0.849000	0.48306	9.412000	0.97347	1.897000	0.54924	0.561000	0.74099	GGG		0.602	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543		28	6	0	0	0	0	28	6				
RNF213	57674	broad.mit.edu	37	17	78321903	78321903	+	Silent	SNP	G	G	A	rs556455090		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:78321903G>A	ENST00000582970.1	+	29	9911	c.9768G>A	c.(9766-9768)tcG>tcA	p.S3256S	RNF213_ENST00000508628.2_Silent_p.S3305S|RNF213_ENST00000336301.6_Silent_p.S1329S	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3256					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGGCCAAATCGATCCTGCTGA	0.642																																						uc002jyh.1		NA																	0				ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(3985-3987)TCG>TCA		ring finger protein 213							65.0	52.0	56.0					17																	78321903		2203	4300	6503	SO:0001819	synonymous_variant	57674							g.chr17:78321903G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9768G>A	17.37:g.78321903G>A			Somatic					p.S1329S	NM_020914	NP_065965	WXS	Illumina HiSeq	Unspecified	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	4210	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	c.3987G>A	CCDS58606.1																																																																																				0.642	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		37	6	0	0	0	0	37	6				
ZNF750	79755	broad.mit.edu	37	17	80789425	80789425	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr17:80789425G>C	ENST00000269394.3	-	2	1739	c.906C>G	c.(904-906)taC>taG	p.Y302*	TBCD_ENST00000355528.4_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	302					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Y302Y(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TGTAGTGATCGTATGTGGCTG	0.547																																						uc002kga.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	central_nervous_system(1)	1						c.(904-906)TAC>TAG		zinc finger protein 750							182.0	195.0	191.0					17																	80789425		2203	4300	6503	SO:0001587	stop_gained	79755					intracellular	zinc ion binding	g.chr17:80789425G>C	AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.906C>G	17.37:g.80789425G>C	ENSP00000269394:p.Tyr302*		Somatic				TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	p.Y302*	NM_024702	NP_078978	WXS	Illumina HiSeq	Unspecified	Q32MQ0	ZN750_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)		2	1217	-	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	302					Q9H899	Nonsense_Mutation	SNP	ENST00000269394.3	37	c.906C>G	CCDS11819.1	.	.	.	.	.	.	.	.	.	.	G	37	6.042502	0.97231	.	.	ENSG00000141579	ENST00000269394	.	.	.	5.34	-10.1	0.00402	.	0.099352	0.44483	D	0.000445	.	.	.	.	.	.	0.33100	D	0.539059	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.8223	19.206	0.93730	0.8138:0.0:0.1862:0.0	.	.	.	.	X	302	.	.	Y	-	3	2	ZNF750	78382714	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-1.440000	0.02412	-2.364000	0.00607	-3.170000	0.00057	TAC		0.547	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439074.2	NM_024702		115	31	0	0	0	0	115	31				
COLEC12	81035	broad.mit.edu	37	18	346848	346848	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr18:346848C>T	ENST00000400256.3	-	5	981	c.774G>A	c.(772-774)ctG>ctA	p.L258L		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	258					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CTTTCTCCTTCAGCCAATCCG	0.512																																						uc002kkm.2		NA																	0				ovary(1)|pancreas(1)	2						c.(772-774)CTG>CTA		collectin sub-family member 12							108.0	94.0	99.0					18																	346848		2203	4300	6503	SO:0001819	synonymous_variant	81035				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity	g.chr18:346848C>T	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.774G>A	18.37:g.346848C>T			Somatic					p.L258L	NM_130386	NP_569057	WXS	Illumina HiSeq	Unspecified	Q5KU26	COL12_HUMAN			5	989	-		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)	258			Potential.|Extracellular (Potential).		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	37	c.774G>A	CCDS32782.1																																																																																				0.512	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1			9	30	0	0	0	0	9	30				
CTAGE1	64693	broad.mit.edu	37	18	19995601	19995601	+	5'Flank	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr18:19995601G>T	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.P725Q			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AAAACCTCTCGGTAAATAGAC	0.498																																						uc002ktv.1		NA																	0				ovary(1)	1						c.(2173-2175)CCG>CAG		cutaneous T-cell lymphoma-associated antigen 1							37.0	42.0	40.0					18																	19995601		2079	4225	6304	SO:0001631	upstream_gene_variant	64693					integral to membrane		g.chr18:19995601G>T	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995601G>T	Exception_encountered		Somatic					p.P725Q	NM_172241	NP_758441	WXS	Illumina HiSeq	Unspecified	Q96RT6	CTGE2_HUMAN			1	2278	-	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)		725			Pro-rich.		B0YIZ3	Missense_Mutation	SNP	ENST00000525417.1	37	c.2174C>A		.	.	.	.	.	.	.	.	.	.	G	8.390	0.839557	0.16891	.	.	ENSG00000212710	ENST00000391403	T	0.54479	0.57	0.614	-0.837	0.10766	.	.	.	.	.	T	0.67411	0.2890	M	0.81802	2.56	0.09310	N	1	D	0.71674	0.998	D	0.75484	0.986	T	0.55995	-0.8052	7	.	.	.	.	.	.	.	.	725	Q96RT6	CTGE2_HUMAN	Q	725	ENSP00000375220:P725Q	.	P	-	2	0	CTAGE1	18249599	0.464000	0.25807	0.015000	0.15790	0.001000	0.01503	0.342000	0.19926	-0.389000	0.07786	-0.708000	0.03648	CCG		0.498	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241		22	26	1	0	5.26e-13	5.57e-13	22	26				
TRAPPC8	22878	broad.mit.edu	37	18	29437875	29437875	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr18:29437875T>C	ENST00000283351.4	-	20	3151	c.2816A>G	c.(2815-2817)aAt>aGt	p.N939S	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.N885S	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	939					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTTGCTGACATTGACAAATTC	0.378																																						uc002kxc.3		NA																	0					0						c.(2815-2817)AAT>AGT		hypothetical protein LOC22878							143.0	153.0	150.0					18																	29437875		2203	4300	6503	SO:0001583	missense	22878				ER to Golgi vesicle-mediated transport	cis-Golgi network		g.chr18:29437875T>C	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2816A>G	18.37:g.29437875T>C	ENSP00000283351:p.Asn939Ser		Somatic				KIAA1012_uc002kxb.3_Missense_Mutation_p.N885S|KIAA1012_uc002kxd.3_Intron	p.N939S	NM_014939	NP_055754	WXS	Illumina HiSeq	Unspecified	Q9Y2L5	TPPC8_HUMAN			20	3180	-			939					A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	c.2816A>G	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141797	0.37825	.	.	ENSG00000153339	ENST00000283351	T	0.56103	0.48	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.74658	0.3745	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79453	-0.1797	10	0.87932	D	0	.	15.3658	0.74519	0.0:0.0:0.0:1.0	.	939	Q9Y2L5	TPPC8_HUMAN	S	939	ENSP00000283351:N939S	ENSP00000283351:N939S	N	-	2	0	TRAPPC8	27691873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.407000	0.80029	2.087000	0.62958	0.460000	0.39030	AAT		0.378	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939		58	98	0	0	0	0	58	98				
SETBP1	26040	broad.mit.edu	37	18	42532870	42532870	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr18:42532870C>T	ENST00000282030.5	+	4	3861	c.3565C>T	c.(3565-3567)Cgg>Tgg	p.R1189W		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1189						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCTGAGCGAGCGGCTGAGTAG	0.552									Schinzel-Giedion syndrome																													uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(3565-3567)CGG>TGG		SET binding protein 1 isoform a							63.0	72.0	69.0					18																	42532870		2203	4300	6503	SO:0001583	missense	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42532870C>T	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3565C>T	18.37:g.42532870C>T	ENSP00000282030:p.Arg1189Trp		Somatic					p.R1189W	NM_015559	NP_056374	WXS	Illumina HiSeq	Unspecified	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	3861	+			1189					A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	c.3565C>T	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722554	0.48728	.	.	ENSG00000152217	ENST00000282030	T	0.72615	-0.67	6.04	5.17	0.71159	.	0.058300	0.64402	D	0.000004	T	0.76104	0.3941	L	0.32530	0.975	0.36592	D	0.874183	D	0.89917	1.0	D	0.70935	0.971	T	0.82210	-0.0570	10	0.72032	D	0.01	.	13.6272	0.62173	0.4185:0.5815:0.0:0.0	.	1189	Q9Y6X0	SETBP_HUMAN	W	1189	ENSP00000282030:R1189W	ENSP00000282030:R1189W	R	+	1	2	SETBP1	40786868	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.499000	0.45372	1.559000	0.49555	0.561000	0.74099	CGG		0.552	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		3	43	0	0	0	0	3	43				
CDH7	1005	broad.mit.edu	37	18	63489364	63489364	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr18:63489364C>A	ENST00000397968.2	+	5	1099	c.673C>A	c.(673-675)Cag>Aag	p.Q225K	CDH7_ENST00000323011.3_Missense_Mutation_p.Q225K|CDH7_ENST00000536984.2_Missense_Mutation_p.Q225K	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	225	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GGCTAAAGACCAGTATTTGCT	0.403																																						uc002ljz.2		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(673-675)CAG>AAG		cadherin 7, type 2 preproprotein							146.0	113.0	124.0					18																	63489364		2203	4300	6503	SO:0001583	missense	1005				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:63489364C>A	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.673C>A	18.37:g.63489364C>A	ENSP00000381058:p.Gln225Lys		Somatic				CDH7_uc002lka.2_Missense_Mutation_p.Q225K|CDH7_uc002lkb.2_Missense_Mutation_p.Q225K	p.Q225K	NM_033646	NP_387450	WXS	Illumina HiSeq	Unspecified	Q9ULB5	CADH7_HUMAN			5	998	+		Esophageal squamous(42;0.129)	225			Extracellular (Potential).|Cadherin 2.		Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	c.673C>A	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535866	0.64972	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.51325	0.71;0.71;0.71	5.01	5.01	0.66863	Cadherin (5);Cadherin-like (1);	0.141328	0.47852	D	0.000205	T	0.23133	0.0559	N	0.02379	-0.575	0.80722	D	1	B;P	0.38335	0.066;0.627	B;B	0.27262	0.019;0.078	T	0.28459	-1.0043	10	0.49607	T	0.09	.	18.69	0.91580	0.0:1.0:0.0:0.0	.	225;225	F5H5X9;Q9ULB5	.;CADH7_HUMAN	K	225	ENSP00000319166:Q225K;ENSP00000443030:Q225K;ENSP00000381058:Q225K	ENSP00000319166:Q225K	Q	+	1	0	CDH7	61640344	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.435000	0.52849	2.473000	0.83533	0.591000	0.81541	CAG		0.403	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		18	34	1	0	5.35e-07	5.59e-07	18	34				
CTDP1	9150	broad.mit.edu	37	18	77513778	77513778	+	Silent	SNP	C	C	T	rs376904820		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr18:77513778C>T	ENST00000299543.7	+	13	3021	c.2874C>T	c.(2872-2874)aaC>aaT	p.N958N	CTDP1_ENST00000075430.7_3'UTR	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	958					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CGGAGCTCAACGACCTCATGT	0.687																																						uc002lnh.1		NA																	0					0						c.(2872-2874)AAC>AAT		CTD (carboxy-terminal domain, RNA polymerase II,		C	,,	1,4403	2.1+/-5.4	0,1,2201	31.0	32.0	31.0		2517,2874,	-5.8	0.0	18		31	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,utr-3	CTDP1	NM_001202504.1,NM_004715.4,NM_048368.3	,,	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	,,	839/843,958/962,	77513778	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	9150				positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity	g.chr18:77513778C>T	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.2874C>T	18.37:g.77513778C>T			Somatic				CTDP1_uc002lni.1_3'UTR|CTDP1_uc010drd.1_3'UTR	p.N958N	NM_004715	NP_004706	WXS	Illumina HiSeq	Unspecified	Q9Y5B0	CTDP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)	13	3021	+		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)	958					A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Silent	SNP	ENST00000299543.7	37	c.2874C>T	CCDS12017.1																																																																																				0.687	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715		9	13	0	0	0	0	9	13				
APC2	10297	broad.mit.edu	37	19	1462153	1462153	+	Silent	SNP	C	C	T	rs375055768		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:1462153C>T	ENST00000535453.1	+	13	3543	c.1830C>T	c.(1828-1830)ctC>ctT	p.L610L	APC2_ENST00000233607.2_Silent_p.L610L|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000238483.4_Silent_p.L336L|CTB-25B13.12_ENST00000588225.1_RNA			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCCAGCCTCGTCGCCACCC	0.692																																						uc002lsr.1		NA																	0				breast(3)|pancreas(1)	4						c.(1828-1830)CTC>CTT		adenomatosis polyposis coli 2		C		0,4402		0,0,2201	25.0	21.0	23.0		1830	-0.8	1.0	19		23	1,8597		0,1,4298	no	coding-synonymous	APC2	NM_005883.2		0,1,6499	TT,TC,CC		0.0116,0.0,0.0077		610/2304	1462153	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	10297				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding	g.chr19:1462153C>T		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1830C>T	19.37:g.1462153C>T			Somatic				APC2_uc002lss.1_Silent_p.L192L|APC2_uc002lst.1_Silent_p.L610L|APC2_uc002lsu.1_Silent_p.L609L|C19orf25_uc010xgn.1_Intron	p.L610L	NM_005883	NP_005874	WXS	Illumina HiSeq	Unspecified	O95996	APC2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	14	2038	+		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)	610					C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	ENST00000535453.1	37	c.1830C>T	CCDS12068.1																																																																																				0.692	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883		4	5	0	0	0	0	4	5				
ADAMTSL5	339366	broad.mit.edu	37	19	1510410	1510410	+	Missense_Mutation	SNP	G	G	C	rs149832091		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:1510410G>C	ENST00000413997.2	-	4	238	c.239C>G	c.(238-240)cCg>cGg	p.P80R	CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000330475.4_Missense_Mutation_p.P70R|ADAMTSL5_ENST00000590562.1_5'UTR|ADAMTSL5_ENST00000395467.2_5'UTR			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	80	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCCAGCACGGTTCTTCCCC	0.672																																						uc002ltd.2		NA																	0					0						c.(208-210)CCG>CGG		ADAMTS-like 5 precursor							38.0	37.0	37.0					19																	1510410		2203	4299	6502	SO:0001583	missense	339366					proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr19:1510410G>C	BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.239C>G	19.37:g.1510410G>C	ENSP00000399364:p.Pro80Arg		Somatic				ADAMTSL5_uc010dsl.2_5'UTR|ADAMTSL5_uc010xgq.1_Missense_Mutation_p.P80R	p.P70R	NM_213604	NP_998769	WXS	Illumina HiSeq	Unspecified	Q6ZMM2	ATL5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	4	653	-		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)	70			TSP type-1.		B4DXK7|Q8IW95	Missense_Mutation	SNP	ENST00000413997.2	37	c.209C>G		.	.	.	.	.	.	.	.	.	.	G	0.008	-1.892175	0.00522	.	.	ENSG00000185761	ENST00000413997;ENST00000330475	T;T	0.03441	3.93;3.93	3.66	-3.1	0.05315	.	0.750628	0.12461	N	0.466910	T	0.02807	0.0084	L	0.41573	1.285	0.09310	N	0.999994	B;B	0.16603	0.018;0.01	B;B	0.17433	0.018;0.012	T	0.43972	-0.9358	10	0.25106	T	0.35	.	4.6326	0.12509	0.4452:0.1584:0.3964:0.0	.	80;70	B4DXK7;Q6ZMM2	.;ATL5_HUMAN	R	80;70	ENSP00000399364:P80R;ENSP00000327608:P70R	ENSP00000327608:P70R	P	-	2	0	ADAMTSL5	1461410	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-0.707000	0.05041	-0.424000	0.07382	0.455000	0.32223	CCG		0.672	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding		XM_294919		4	12	0	0	0	0	4	12				
S1PR4	8698	broad.mit.edu	37	19	3179237	3179237	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:3179237G>A	ENST00000246115.3	+	1	502	c.447G>A	c.(445-447)cgG>cgA	p.R149R	S1PR4_ENST00000591346.1_3'UTR	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	149					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						CCATGGTGCGGCCGGTGGCCG	0.692																																					GBM(82;318 1638 33279 49708)	uc002lxg.2		NA																	0				lung(1)|skin(1)	2						c.(445-447)CGG>CGA		sphingosine-1-phosphate receptor 4 precursor							32.0	37.0	35.0					19																	3179237		2195	4283	6478	SO:0001819	synonymous_variant	8698				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity	g.chr19:3179237G>A	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.447G>A	19.37:g.3179237G>A			Somatic					p.R149R	NM_003775	NP_003766	WXS	Illumina HiSeq	Unspecified	O95977	S1PR4_HUMAN			1	472	+			149			Cytoplasmic (By similarity).		D6W612	Silent	SNP	ENST00000246115.3	37	c.447G>A	CCDS12105.1																																																																																				0.692	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1	NM_003775		4	66	0	0	0	0	4	66				
PLIN3	10226	broad.mit.edu	37	19	4859609	4859609	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:4859609G>A	ENST00000221957.4	-	4	517	c.341C>T	c.(340-342)aCg>aTg	p.T114M	PLIN3_ENST00000585479.1_Missense_Mutation_p.T114M|PLIN3_ENST00000592528.1_Missense_Mutation_p.T114M	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	114					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	TACCTTCTCCGTGGGCTGCTG	0.572																																						uc002mbj.2		NA																	0					0						c.(340-342)ACG>ATG		mannose 6 phosphate receptor binding protein 1	Galsulfase(DB01279)|Idursulfase(DB01271)						102.0	89.0	94.0					19																	4859609		2203	4300	6503	SO:0001583	missense	10226				vesicle-mediated transport	endosome membrane|Golgi apparatus|lipid particle	protein binding	g.chr19:4859609G>A	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.341C>T	19.37:g.4859609G>A	ENSP00000221957:p.Thr114Met		Somatic				PLIN3_uc002mbk.2_Missense_Mutation_p.T114M|PLIN3_uc002mbl.3_Missense_Mutation_p.T114M	p.T114M	NM_005817	NP_005808	WXS	Illumina HiSeq	Unspecified	O60664	PLIN3_HUMAN			4	518	-			114					A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	c.341C>T	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013582	0.75161	.	.	ENSG00000105355	ENST00000221957	T	0.06687	3.27	4.2	1.9	0.25705	.	0.606674	0.16535	U	0.210183	T	0.16214	0.0390	L	0.47190	1.495	0.09310	N	1	D;D	0.65815	0.993;0.995	P;P	0.60173	0.795;0.87	T	0.03086	-1.1074	10	0.87932	D	0	-28.1049	8.9408	0.35729	0.095:0.2461:0.6588:0.0	.	114;114	O60664-3;O60664	.;PLIN3_HUMAN	M	114	ENSP00000221957:T114M	ENSP00000221957:T114M	T	-	2	0	PLIN3	4810609	0.977000	0.34250	0.026000	0.17262	0.876000	0.50452	6.086000	0.71352	0.969000	0.38237	0.462000	0.41574	ACG		0.572	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817		21	29	0	0	0	0	21	29				
MUC16	94025	broad.mit.edu	37	19	9085082	9085082	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:9085082C>T	ENST00000397910.4	-	1	6936	c.6733G>A	c.(6733-6735)Gag>Aag	p.E2245K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2245	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAATACTCTCAGCCCCATCT	0.448																																						uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(6733-6735)GAG>AAG		mucin 16							99.0	96.0	97.0					19																	9085082		1966	4158	6124	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9085082C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6733G>A	19.37:g.9085082C>T	ENSP00000381008:p.Glu2245Lys		Somatic					p.E2245K	NM_024690	NP_078966	WXS	Illumina HiSeq	Unspecified	Q8WXI7	MUC16_HUMAN			1	6937	-			2245			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.6733G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	3.638	-0.074065	0.07184	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	0.225	0.225	0.15325	.	.	.	.	.	T	0.03434	0.0099	N	0.08118	0	.	.	.	P	0.49696	0.927	P	0.56563	0.801	T	0.45862	-0.9232	7	0.87932	D	0	.	.	.	.	.	2245	B5ME49	.	K	2245	ENSP00000381008:E2245K	ENSP00000381008:E2245K	E	-	1	0	MUC16	8946082	0.021000	0.18746	0.019000	0.16419	0.020000	0.10135	0.673000	0.25203	0.300000	0.22699	0.305000	0.20034	GAG		0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		11	19	0	0	0	0	11	19				
ZNF699	374879	broad.mit.edu	37	19	9407596	9407596	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:9407596C>G	ENST00000591998.1	-	6	712	c.484G>C	c.(484-486)Gag>Cag	p.E162Q	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Missense_Mutation_p.E162Q			Q32M78	ZN699_HUMAN	zinc finger protein 699	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TAGATGTTCTCTACCATATGA	0.299																																						uc002mlc.1		NA																	0					0						c.(484-486)GAG>CAG		zinc finger protein 699							27.0	24.0	25.0					19																	9407596		1815	4072	5887	SO:0001583	missense	374879				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9407596C>G	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.484G>C	19.37:g.9407596C>G	ENSP00000467723:p.Glu162Gln		Somatic					p.E162Q	NM_198535	NP_940937	WXS	Illumina HiSeq	Unspecified	Q32M78	ZN699_HUMAN			5	484	-			162					Q8N9A1	Missense_Mutation	SNP	ENST00000591998.1	37	c.484G>C	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	C	9.024	0.985558	0.18889	.	.	ENSG00000196110	ENST00000308650	T	0.20332	2.08	3.14	3.14	0.36123	.	0.234463	0.22041	N	0.065446	T	0.25457	0.0619	M	0.70595	2.14	0.09310	N	1	P	0.36065	0.535	B	0.36608	0.229	T	0.21759	-1.0236	10	0.59425	D	0.04	.	12.5085	0.55995	0.0:1.0:0.0:0.0	.	162	Q32M78	ZN699_HUMAN	Q	162	ENSP00000311596:E162Q	ENSP00000311596:E162Q	E	-	1	0	ZNF699	9268596	0.033000	0.19621	0.022000	0.16811	0.005000	0.04900	0.837000	0.27558	2.061000	0.61500	0.555000	0.69702	GAG		0.299	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535		5	18	0	0	0	0	5	18				
MAN2B1	4125	broad.mit.edu	37	19	12776599	12776599	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:12776599C>T	ENST00000456935.2	-	2	220	c.180G>A	c.(178-180)ccG>ccA	p.P60P	MAN2B1_ENST00000221363.4_Silent_p.P60P|CTD-2192J16.24_ENST00000597961.1_Silent_p.P57P|WDR83_ENST00000418543.3_5'Flank	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	60					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCAGCATGTTCGGCTGCACTG	0.547																																						uc002mub.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(178-180)CCG>CCA		mannosidase, alpha, class 2B, member 1							119.0	91.0	100.0					19																	12776599		2203	4300	6503	SO:0001819	synonymous_variant	4125				protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding	g.chr19:12776599C>T		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.180G>A	19.37:g.12776599C>T			Somatic				MAN2B1_uc010dyv.1_Silent_p.P60P|WDR83_uc002mue.3_5'Flank|WDR83_uc002muc.2_5'Flank	p.P60P	NM_000528	NP_000519	WXS	Illumina HiSeq	Unspecified	O00754	MA2B1_HUMAN			2	256	-			60					G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	37	c.180G>A	CCDS32919.1																																																																																				0.547	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1			15	33	0	0	0	0	15	33				
DHPS	1725	broad.mit.edu	37	19	12790281	12790281	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:12790281C>T	ENST00000210060.7	-	5	803	c.668G>A	c.(667-669)tGg>tAg	p.W223*	DHPS_ENST00000599481.1_5'Flank|DHPS_ENST00000594424.1_Nonsense_Mutation_p.W181*|DHPS_ENST00000351660.5_Nonsense_Mutation_p.W223*	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	223					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						CTTCTGGGCCCAGTAATACAC	0.512																																						uc002muh.1		NA																	0				central_nervous_system(1)	1						c.(667-669)TGG>TAG		deoxyhypusine synthase isoform a	Sulfadoxine(DB01299)						191.0	176.0	181.0					19																	12790281		2203	4300	6503	SO:0001587	stop_gained	1725				peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|post-translational protein modification|spermidine catabolic process to deoxyhypusine, using deoxyhypusine synthase|translation	cytosol	deoxyhypusine synthase activity|protein binding	g.chr19:12790281C>T	U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.668G>A	19.37:g.12790281C>T	ENSP00000210060:p.Trp223*		Somatic				DHPS_uc002muf.1_Nonsense_Mutation_p.W100*|DHPS_uc002mug.1_Nonsense_Mutation_p.W181*|DHPS_uc002mui.1_Nonsense_Mutation_p.W223*|DHPS_uc002muj.1_Nonsense_Mutation_p.W223*|DHPS_uc002muk.1_RNA|DHPS_uc010xmn.1_RNA	p.W223*	NM_001930	NP_001921	WXS	Illumina HiSeq	Unspecified	P49366	DHYS_HUMAN			5	765	-			223					A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Nonsense_Mutation	SNP	ENST00000210060.7	37	c.668G>A	CCDS12276.1	.	.	.	.	.	.	.	.	.	.	C	37	6.409225	0.97542	.	.	ENSG00000095059	ENST00000210060;ENST00000351660	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.478	16.7416	0.85461	0.0:1.0:0.0:0.0	.	.	.	.	X	223	.	ENSP00000210060:W223X	W	-	2	0	DHPS	12651281	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.372000	0.79612	2.542000	0.85734	0.558000	0.71614	TGG		0.512	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462708.1	NM_001930		72	98	0	0	0	0	72	98				
CC2D1A	54862	broad.mit.edu	37	19	14038078	14038078	+	Splice_Site	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:14038078G>T	ENST00000318003.7	+	22	2557	c.2316G>T	c.(2314-2316)gaG>gaT	p.E772D	CC2D1A_ENST00000589606.1_Splice_Site_p.E772D	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	772					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			AGATCCTTGAGGTGAGAGGTG	0.547																																						uc002mxo.2		NA																	0					0						c.(2314-2316)GAG>GAT		coiled-coil and C2 domain containing 1A							103.0	124.0	117.0					19																	14038078		2164	4252	6416	SO:0001630	splice_region_variant	54862				positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity	g.chr19:14038078G>T	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.2316+1G>T	19.37:g.14038078G>T			Somatic				CC2D1A_uc002mxp.2_Missense_Mutation_p.E772D|CC2D1A_uc010dzh.2_Missense_Mutation_p.E341D|CC2D1A_uc002mxq.1_3'UTR	p.E772D	NM_017721	NP_060191	WXS	Illumina HiSeq	Unspecified	Q6P1N0	C2D1A_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)		22	2615	+			772					Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	ENST00000318003.7	37	c.2316G>T	CCDS42512.1	.	.	.	.	.	.	.	.	.	.	g	17.95	3.514016	0.64522	.	.	ENSG00000132024	ENST00000318003;ENST00000254346	T	0.19938	2.11	5.18	5.18	0.71444	C2 calcium/lipid-binding domain, CaLB (1);	0.059374	0.64402	D	0.000004	T	0.29288	0.0729	L	0.27053	0.805	0.80722	D	1	B;D;P	0.71674	0.33;0.998;0.809	B;D;B	0.77557	0.134;0.99;0.326	T	0.02505	-1.1149	10	0.20046	T	0.44	-32.5788	11.7043	0.51590	0.0869:0.0:0.9131:0.0	.	394;772;772	Q9NX28;Q6P1N0-2;Q6P1N0	.;.;C2D1A_HUMAN	D	772;395	ENSP00000313601:E772D	ENSP00000254346:E395D	E	+	3	2	CC2D1A	13899078	1.000000	0.71417	0.998000	0.56505	0.717000	0.41224	2.960000	0.49161	2.404000	0.81709	0.491000	0.48974	GAG		0.547	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721	Missense_Mutation	3	48	1	0	6.4e-05	6.61e-05	3	48				
NDUFA13	51079	broad.mit.edu	37	19	19626011	19626011	+	5'Flank	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:19626011A>G	ENST00000507754.4	+	0	0				TSSK6_ENST00000585580.3_Missense_Mutation_p.F76L|CTC-260F20.3_ENST00000555938.1_5'Flank|YJEFN3_ENST00000608404.1_5'Flank|NDUFA13_ENST00000252576.5_5'Flank|TSSK6_ENST00000360913.3_Missense_Mutation_p.F76L|NDUFA13_ENST00000512771.3_5'Flank|NDUFA13_ENST00000503283.1_5'Flank|NDUFA13_ENST00000428459.2_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						ATGAACTCGAAGACGTGCACG	0.667																																						uc002nmr.2		NA																	0				stomach(1)	1						c.(226-228)TTC>CTC		testis-specific serine kinase 6							62.0	55.0	57.0					19																	19626011		2203	4300	6503	SO:0001631	upstream_gene_variant	83983				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:19626011A>G	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211		19.37:g.19626011A>G	Exception_encountered		Somatic				TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	p.F76L	NM_032037	NP_114426	WXS	Illumina HiSeq	Unspecified	Q9BXA6	TSSK6_HUMAN			1	459	-			76			Protein kinase.		B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	ENST00000507754.4	37	c.226T>C	CCDS12404.2	.	.	.	.	.	.	.	.	.	.	A	12.58	1.980044	0.34942	.	.	ENSG00000178093	ENST00000360913	T	0.21191	2.02	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43919	U	0.000504	T	0.11793	0.0287	N	0.10733	0.035	0.41198	D	0.986358	B	0.06786	0.001	B	0.13407	0.009	T	0.06534	-1.0821	10	0.72032	D	0.01	.	10.8494	0.46761	1.0:0.0:0.0:0.0	.	76	Q9BXA6	TSSK6_HUMAN	L	76	ENSP00000354168:F76L	ENSP00000354168:F76L	F	-	1	0	TSSK6	19487011	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	2.418000	0.44662	1.825000	0.53177	0.254000	0.18369	TTC		0.667	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6	NM_015965		11	26	0	0	0	0	11	26				
ZNF91	7644	broad.mit.edu	37	19	23544721	23544721	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:23544721C>G	ENST00000300619.7	-	4	1265	c.1060G>C	c.(1060-1062)Gaa>Caa	p.E354Q	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.E322Q	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	354					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGCCACATTCTTTACATTTG	0.368																																						uc002nre.2		NA																	0					0						c.(1060-1062)GAA>CAA		zinc finger protein 91							41.0	43.0	42.0					19																	23544721		2011	4188	6199	SO:0001583	missense	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23544721C>G	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1060G>C	19.37:g.23544721C>G	ENSP00000300619:p.Glu354Gln		Somatic				ZNF91_uc010xrj.1_Missense_Mutation_p.E322Q	p.E354Q	NM_003430	NP_003421	WXS	Illumina HiSeq	Unspecified	Q05481	ZNF91_HUMAN			4	1173	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	354			C2H2-type 8.		A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.1060G>C	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	0.102	-1.150813	0.01700	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.07444	3.19;3.19	1.65	-3.29	0.05017	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05090	0.0136	N	0.12502	0.225	0.09310	N	1	P;B	0.51240	0.943;0.005	P;B	0.46172	0.506;0.008	T	0.35126	-0.9801	9	0.37606	T	0.19	.	6.2188	0.20669	0.0:0.4216:0.4278:0.1507	.	322;354	Q05481-2;Q05481	.;ZNF91_HUMAN	Q	354;322	ENSP00000300619:E354Q;ENSP00000380272:E322Q	ENSP00000300619:E354Q	E	-	1	0	ZNF91	23336561	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-2.084000	0.01363	-0.553000	0.06158	0.162000	0.16502	GAA		0.368	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		14	32	0	0	0	0	14	32				
ZNF536	9745	broad.mit.edu	37	19	30935350	30935350	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:30935350G>A	ENST00000355537.3	+	2	1028	c.881G>A	c.(880-882)cGc>cAc	p.R294H		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	294					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGCCACATCCGCATCTTGCAC	0.647																																						uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(880-882)CGC>CAC		zinc finger protein 536							53.0	58.0	57.0					19																	30935350		2203	4300	6503	SO:0001583	missense	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:30935350G>A		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.881G>A	19.37:g.30935350G>A	ENSP00000347730:p.Arg294His		Somatic				ZNF536_uc010edd.1_Missense_Mutation_p.R294H	p.R294H	NM_014717	NP_055532	WXS	Illumina HiSeq	Unspecified	O15090	ZN536_HUMAN			2	1019	+	Esophageal squamous(110;0.0834)		294			C2H2-type 3.		A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	c.881G>A	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023254	0.35701	.	.	ENSG00000198597	ENST00000355537	T	0.33865	1.39	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	L	0.45352	1.415	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.51996	-0.8634	10	0.52906	T	0.07	-38.6797	19.8172	0.96573	0.0:0.0:1.0:0.0	.	294;294	A7E228;O15090	.;ZN536_HUMAN	H	294	ENSP00000347730:R294H	ENSP00000347730:R294H	R	+	2	0	ZNF536	35627190	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.833000	0.99426	2.702000	0.92279	0.491000	0.48974	CGC		0.647	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		33	45	0	0	0	0	33	45				
FCGBP	8857	broad.mit.edu	37	19	40363228	40363228	+	Missense_Mutation	SNP	C	C	T	rs200275847	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:40363228C>T	ENST00000221347.6	-	32	14849	c.14842G>A	c.(14842-14844)Gag>Aag	p.E4948K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4948	VWFD 12. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTTCGGCCCTCGGCGGTCACC	0.662													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16684	0.001		0.0	False		,,,				2504	0.0					uc002omp.3		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(14842-14844)GAG>AAG		Fc fragment of IgG binding protein precursor							27.0	32.0	30.0					19																	40363228		2202	4299	6501	SO:0001583	missense	8857					extracellular region	protein binding	g.chr19:40363228C>T	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14842G>A	19.37:g.40363228C>T	ENSP00000221347:p.Glu4948Lys		Somatic					p.E4948K	NM_003890	NP_003881	WXS	Illumina HiSeq	Unspecified	Q9Y6R7	FCGBP_HUMAN	Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)		32	14850	-	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		4948			VWFD 12.		O95784	Missense_Mutation	SNP	ENST00000221347.6	37	c.14842G>A	CCDS12546.1	3	0.0013736263736263737	2	0.0040650406504065045	0	0.0	1	0.0017482517482517483	0	0.0	C	11.80	1.745670	0.30955	.	.	ENSG00000090920	ENST00000221347	T	0.60040	0.22	5.05	5.05	0.67936	von Willebrand factor, type D domain (3);	0.072924	0.51477	U	0.000090	T	0.67822	0.2934	L	0.46819	1.47	0.30438	N	0.776529	D	0.89917	1.0	D	0.76575	0.988	T	0.64622	-0.6364	10	0.33141	T	0.24	.	13.7765	0.63057	0.0:1.0:0.0:0.0	.	4948	Q9Y6R7	FCGBP_HUMAN	K	4948	ENSP00000221347:E4948K	ENSP00000221347:E4948K	E	-	1	0	FCGBP	45055068	0.013000	0.17824	0.950000	0.38849	0.289000	0.27227	1.125000	0.31332	2.636000	0.89361	0.313000	0.20887	GAG		0.662	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890		10	13	0	0	0	0	10	13				
ZNF226	7769	broad.mit.edu	37	19	44680376	44680376	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:44680376C>T	ENST00000590089.1	+	7	1328	c.961C>T	c.(961-963)Cat>Tat	p.H321Y	ZNF226_ENST00000454662.2_Missense_Mutation_p.H321Y|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000337433.5_Missense_Mutation_p.H321Y			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				TCAGGGCGCTCATCTACAGAC	0.428																																					Pancreas(115;581 1665 13228 19278 50070)	uc002oyp.2		NA																	0					0						c.(961-963)CAT>TAT		zinc finger protein 226 isoform a							75.0	80.0	79.0					19																	44680376		2163	4282	6445	SO:0001583	missense	7769				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44680376C>T	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.961C>T	19.37:g.44680376C>T	ENSP00000465121:p.His321Tyr		Somatic				ZNF226_uc002oyq.2_Missense_Mutation_p.H204Y|ZNF226_uc002oyr.2_Missense_Mutation_p.H204Y|ZNF226_uc010ejg.2_3'UTR|ZNF226_uc002oys.2_Missense_Mutation_p.H321Y|ZNF226_uc002oyt.2_Missense_Mutation_p.H321Y	p.H321Y	NM_001032373	NP_001027545	WXS	Illumina HiSeq	Unspecified	Q9NYT6	ZN226_HUMAN			6	1105	+		Prostate(69;0.0352)|all_neural(266;0.202)	321			C2H2-type 3.		Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	37	c.961C>T	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.456442	0.00173	.	.	ENSG00000167380	ENST00000536276;ENST00000337433;ENST00000454662	T;T	0.13089	2.62;2.62	3.88	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.813564	0.10055	N	0.721745	T	0.09379	0.0231	L	0.45051	1.395	0.09310	N	1	P	0.37612	0.602	B	0.38296	0.27	T	0.17806	-1.0357	10	0.02654	T	1	.	3.018	0.06066	0.1778:0.5481:0.173:0.1012	.	321	Q9NYT6	ZN226_HUMAN	Y	29;321;321	ENSP00000336719:H321Y;ENSP00000393265:H321Y	ENSP00000336719:H321Y	H	+	1	0	ZNF226	49372216	0.000000	0.05858	0.026000	0.17262	0.038000	0.13279	-0.950000	0.03889	0.998000	0.38996	-0.123000	0.14984	CAT		0.428	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1			5	38	0	0	0	0	5	38				
ZNF320	162967	broad.mit.edu	37	19	53385154	53385154	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:53385154C>T	ENST00000595635.1	-	8	726	c.225G>A	c.(223-225)caG>caA	p.Q75Q	ZNF320_ENST00000391781.2_Silent_p.Q75Q|ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TTGCTTGTCTCTGCAATGTCC	0.393																																						uc002qag.2		NA																	0					0						c.(223-225)CAG>CAA		zinc finger protein 320							162.0	158.0	160.0					19																	53385154		2203	4300	6503	SO:0001819	synonymous_variant	162967				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53385154C>T	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.225G>A	19.37:g.53385154C>T			Somatic				ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Silent_p.Q21Q|ZNF320_uc002qai.2_Silent_p.Q75Q	p.Q75Q	NM_207333	NP_997216	WXS	Illumina HiSeq	Unspecified	A2RRD8	ZN320_HUMAN		GBM - Glioblastoma multiforme(134;0.0534)	4	416	-			75			KRAB.		Q8NDR6	Silent	SNP	ENST00000595635.1	37	c.225G>A	CCDS33095.1																																																																																				0.393	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333		11	149	0	0	0	0	11	149				
ZNF347	84671	broad.mit.edu	37	19	53652521	53652521	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:53652521C>G	ENST00000334197.7	-	3	183	c.115G>C	c.(115-117)Gag>Cag	p.E39Q	ZNF347_ENST00000601469.2_Missense_Mutation_p.E39Q|ZNF347_ENST00000452676.2_Missense_Mutation_p.E39Q|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	39	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		CTATAATTCTCCAACATCACG	0.517																																					Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NA																	0					0						c.(115-117)GAG>CAG		zinc finger protein 347							118.0	122.0	120.0					19																	53652521		2203	4300	6503	SO:0001583	missense	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53652521C>G	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.115G>C	19.37:g.53652521C>G	ENSP00000334146:p.Glu39Gln		Somatic				ZNF347_uc010eql.1_Missense_Mutation_p.E39Q|ZNF347_uc002qbc.1_Missense_Mutation_p.E39Q	p.E39Q	NM_032584	NP_115973	WXS	Illumina HiSeq	Unspecified	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	3	184	-			39			KRAB.		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	c.115G>C	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	C	9.571	1.121048	0.20877	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.04317	3.65;3.65	2.22	1.1	0.20463	Krueppel-associated box (4);	.	.	.	.	T	0.28267	0.0698	H	0.96208	3.785	0.21355	N	0.999714	D;D	0.67145	0.996;0.995	D;D	0.75484	0.986;0.95	T	0.05517	-1.0880	9	0.87932	D	0	.	8.3309	0.32187	0.0:0.7526:0.2474:0.0	.	39;39	G5E9N4;Q96SE7	.;ZN347_HUMAN	Q	39	ENSP00000334146:E39Q;ENSP00000405218:E39Q	ENSP00000334146:E39Q	E	-	1	0	ZNF347	58344333	0.943000	0.32029	0.599000	0.28851	0.012000	0.07955	2.670000	0.46833	0.248000	0.21435	-0.499000	0.04595	GAG		0.517	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584		41	71	0	0	0	0	41	71				
NLRP7	199713	broad.mit.edu	37	19	55451377	55451377	+	Silent	SNP	G	G	A	rs545679560	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:55451377G>A	ENST00000590030.1	-	3	850	c.810C>T	c.(808-810)tgC>tgT	p.C270C	NLRP7_ENST00000588756.1_Silent_p.C270C|NLRP7_ENST00000448121.2_Silent_p.C270C|NLRP7_ENST00000340844.2_Silent_p.C270C|NLRP7_ENST00000328092.5_Silent_p.C270C|NLRP7_ENST00000446217.1_Silent_p.C298C|NLRP7_ENST00000592784.1_Silent_p.C270C			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	270	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CCCAGTCCCCGCAGATGTCCT	0.592													.|||	3	0.000599042	0.0	0.0	5008	,	,		18896	0.0		0.0	False		,,,				2504	0.0031					uc002qih.3		NA																	0				large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(808-810)TGC>TGT		NACHT, leucine rich repeat and PYD containing 7							61.0	63.0	62.0					19																	55451377		2203	4300	6503	SO:0001819	synonymous_variant	199713						ATP binding	g.chr19:55451377G>A	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.810C>T	19.37:g.55451377G>A			Somatic				NLRP7_uc002qig.3_Silent_p.C270C|NLRP7_uc002qii.3_Silent_p.C270C|NLRP7_uc010esk.2_Silent_p.C270C|NLRP7_uc010esl.2_Silent_p.C298C	p.C270C	NM_206828	NP_996611	WXS	Illumina HiSeq	Unspecified	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	4	886	-			270			NACHT.		E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	37	c.810C>T	CCDS33109.1																																																																																				0.592	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		28	38	0	0	0	0	28	38				
U2AF2	11338	broad.mit.edu	37	19	56166482	56166482	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:56166482C>T	ENST00000308924.4	+	1	52	c.12C>T	c.(10-12)ttC>ttT	p.F4F	U2AF2_ENST00000450554.2_Silent_p.F4F			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	4	Required for interaction with PRPF19. {ECO:0000269|PubMed:21536736}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TGTCGGACTTCGACGAGTTCG	0.692																																						uc002qlu.2		NA																	0				ovary(1)	1						c.(10-12)TTC>TTT		U2 (RNU2) small nuclear RNA auxiliary factor 2							19.0	25.0	23.0					19																	56166482		2193	4270	6463	SO:0001819	synonymous_variant	11338				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding	g.chr19:56166482C>T	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.12C>T	19.37:g.56166482C>T			Somatic				U2AF2_uc002qlt.2_Silent_p.F4F	p.F4F	NM_007279	NP_009210	WXS	Illumina HiSeq	Unspecified	P26368	U2AF2_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)	1	1067	+		Colorectal(82;0.00244)|Ovarian(87;0.133)	4					Q96HC5	Silent	SNP	ENST00000308924.4	37	c.12C>T	CCDS12933.1																																																																																				0.692	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279		6	15	0	0	0	0	6	15				
SNTG2	54221	broad.mit.edu	37	2	1251141	1251141	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:1251141G>A	ENST00000308624.5	+	12	1060	c.931G>A	c.(931-933)Gac>Aac	p.D311N	SNTG2_ENST00000407292.1_Missense_Mutation_p.D184N	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	311	PH.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CCAAGGAGCTGACTCCTCTCA	0.502																																						uc002qwq.2		NA																	0				ovary(1)|large_intestine(1)|breast(1)	3						c.(931-933)GAC>AAC		syntrophin, gamma 2							65.0	67.0	66.0					2																	1251141		2043	4201	6244	SO:0001583	missense	54221				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding	g.chr2:1251141G>A	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.931G>A	2.37:g.1251141G>A	ENSP00000311837:p.Asp311Asn		Somatic				SNTG2_uc010ewi.2_Missense_Mutation_p.D184N	p.D311N	NM_018968	NP_061841	WXS	Illumina HiSeq	Unspecified	Q9NY99	SNTG2_HUMAN		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)	12	1059	+	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)	311			PH.		Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	c.931G>A	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	1.050	-0.676016	0.03378	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.68479	1.63;-0.33	5.47	3.66	0.41972	Pleckstrin homology domain (1);	2.351570	0.01624	N	0.023157	T	0.57989	0.2091	L	0.29908	0.895	0.19945	N	0.999946	B;B	0.18461	0.028;0.006	B;B	0.20184	0.028;0.004	T	0.40683	-0.9550	10	0.10636	T	0.68	.	11.5491	0.50711	0.1497:0.0:0.8503:0.0	.	184;311	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	N	311;184	ENSP00000311837:D311N;ENSP00000385020:D184N	ENSP00000311837:D311N	D	+	1	0	SNTG2	1233692	0.915000	0.31059	0.003000	0.11579	0.021000	0.10359	2.290000	0.43531	0.657000	0.30906	0.650000	0.86243	GAC		0.502	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968		11	22	0	0	0	0	11	22				
GREB1	9687	broad.mit.edu	37	2	11733135	11733135	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:11733135G>A	ENST00000381486.2	+	11	1879	c.1579G>A	c.(1579-1581)Gag>Aag	p.E527K	GREB1_ENST00000234142.5_Missense_Mutation_p.E527K	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	527						integral component of membrane (GO:0016021)		p.E527K(2)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTCCCTGGCCGAGGGCCTCTC	0.667																																					Ovarian(39;850 945 2785 23371 33093)	uc002rbk.1		NA																	2	Substitution - Missense(2)		breast(1)|skin(1)	ovary(1)	1						c.(1579-1581)GAG>AAG		growth regulation by estrogen in breast cancer 1							24.0	26.0	25.0					2																	11733135		2117	4217	6334	SO:0001583	missense	9687					integral to membrane		g.chr2:11733135G>A		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.1579G>A	2.37:g.11733135G>A	ENSP00000370896:p.Glu527Lys		Somatic				GREB1_uc002rbo.1_Missense_Mutation_p.E161K	p.E527K	NM_014668	NP_055483	WXS	Illumina HiSeq	Unspecified	Q4ZG55	GREB1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)	11	1879	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		527					A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	c.1579G>A	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752894	0.89753	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000432985	T;T;T	0.51325	3.03;3.03;0.71	4.83	4.83	0.62350	.	0.152547	0.43919	D	0.000507	T	0.65964	0.2742	M	0.71036	2.16	0.53688	D	0.999977	D;D	0.76494	0.995;0.999	P;P	0.61132	0.654;0.884	T	0.71290	-0.4637	10	0.72032	D	0.01	-10.3192	17.9242	0.88977	0.0:0.0:1.0:0.0	.	161;527	C9JIG0;Q4ZG55	.;GREB1_HUMAN	K	527;527;161	ENSP00000370896:E527K;ENSP00000234142:E527K;ENSP00000403886:E161K	ENSP00000234142:E527K	E	+	1	0	GREB1	11650586	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.140000	0.64807	2.211000	0.71520	0.591000	0.81541	GAG		0.667	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668		3	11	0	0	0	0	3	11				
ITSN2	50618	broad.mit.edu	37	2	24480764	24480764	+	Missense_Mutation	SNP	G	G	A	rs547842218	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:24480764G>A	ENST00000355123.4	-	23	3324	c.2881C>T	c.(2881-2883)Cgg>Tgg	p.R961W	ITSN2_ENST00000361999.3_Missense_Mutation_p.R934W|ITSN2_ENST00000406921.3_Missense_Mutation_p.R961W	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	961					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACTCTTCCCGTTTTACTTCA	0.403													G|||	2	0.000399361	0.0	0.0	5008	,	,		20128	0.0		0.0	False		,,,				2504	0.002					uc002rfe.2		NA																	0				kidney(2)|ovary(1)|central_nervous_system(1)	4						c.(2881-2883)CGG>TGG		intersectin 2 isoform 1							112.0	106.0	108.0					2																	24480764		2203	4300	6503	SO:0001583	missense	50618				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chr2:24480764G>A	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2881C>T	2.37:g.24480764G>A	ENSP00000347244:p.Arg961Trp		Somatic				ITSN2_uc002rff.2_Missense_Mutation_p.R934W|ITSN2_uc002rfg.2_Missense_Mutation_p.R961W|ITSN2_uc002rfh.1_RNA	p.R961W	NM_006277	NP_006268	WXS	Illumina HiSeq	Unspecified	Q9NZM3	ITSN2_HUMAN			23	3139	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		961					O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	c.2881C>T	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089250	0.36855	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.60424	0.19;0.19;0.19;0.66	4.84	1.73	0.24493	.	0.704599	0.10807	U	0.632031	T	0.39989	0.1099	N	0.08118	0	0.21527	N	0.999657	D;P;P	0.57257	0.979;0.947;0.912	B;B;B	0.43123	0.409;0.219;0.109	T	0.34576	-0.9823	10	0.66056	D	0.02	.	13.183	0.59666	0.0:0.0:0.2944:0.7056	.	961;934;961	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	W	934;961;934;961	ENSP00000354561:R934W;ENSP00000347244:R961W;ENSP00000370250:R934W;ENSP00000384499:R961W	ENSP00000347244:R961W	R	-	1	2	ITSN2	24334268	0.000000	0.05858	0.236000	0.24074	0.995000	0.86356	0.467000	0.22035	0.696000	0.31696	0.644000	0.83932	CGG		0.403	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277		27	43	0	0	0	0	27	43				
ITSN2	50618	broad.mit.edu	37	2	24494796	24494796	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:24494796C>A	ENST00000355123.4	-	19	2539	c.2096G>T	c.(2095-2097)gGa>gTa	p.G699V	ITSN2_ENST00000361999.3_Missense_Mutation_p.G672V|ITSN2_ENST00000406921.3_Missense_Mutation_p.G699V|SCARNA21_ENST00000515996.1_RNA	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	699					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					gttttcttttccttgctttgc	0.299																																						uc002rfe.2		NA																	0				kidney(2)|ovary(1)|central_nervous_system(1)	4						c.(2095-2097)GGA>GTA		intersectin 2 isoform 1							46.0	42.0	43.0					2																	24494796		2199	4294	6493	SO:0001583	missense	50618				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity	g.chr2:24494796C>A	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2096G>T	2.37:g.24494796C>A	ENSP00000347244:p.Gly699Val		Somatic				ITSN2_uc002rff.2_Missense_Mutation_p.G672V|ITSN2_uc002rfg.2_Missense_Mutation_p.G699V	p.G699V	NM_006277	NP_006268	WXS	Illumina HiSeq	Unspecified	Q9NZM3	ITSN2_HUMAN			19	2354	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		699			Potential.		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	c.2096G>T	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523766	0.27299	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.59224	1.55;0.28;1.55;0.72	4.59	1.75	0.24633	.	52.943400	0.01054	U	0.004522	T	0.49830	0.1580	L	0.36672	1.1	0.45899	D	0.998741	B;B;B	0.25904	0.137;0.042;0.025	B;B;B	0.31191	0.125;0.078;0.036	T	0.33879	-0.9851	10	0.27785	T	0.31	.	5.7676	0.18235	0.0:0.6452:0.166:0.1887	.	699;672;699	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	V	672;699;672;699	ENSP00000354561:G672V;ENSP00000347244:G699V;ENSP00000370250:G672V;ENSP00000384499:G699V	ENSP00000347244:G699V	G	-	2	0	ITSN2	24348300	0.971000	0.33674	1.000000	0.80357	0.989000	0.77384	-0.125000	0.10579	0.611000	0.30052	0.462000	0.41574	GGA		0.299	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277		16	5	1	0	1.36e-06	1.42e-06	16	5				
PLB1	151056	broad.mit.edu	37	2	28812554	28812554	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:28812554G>A	ENST00000327757.5	+	28	1977	c.1933G>A	c.(1933-1935)Gac>Aac	p.D645N	PLB1_ENST00000422425.2_Missense_Mutation_p.D634N|PLB1_ENST00000329020.6_Missense_Mutation_p.D333N	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	645	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.D634N(1)|p.D645N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					AGGATTGCCTGACAACTCTTT	0.498																																						uc002rmb.1		NA																	2	Substitution - Missense(2)		endometrium(2)	ovary(4)|large_intestine(2)|skin(2)|breast(1)	9						c.(1933-1935)GAC>AAC		phospholipase B1 precursor							91.0	84.0	87.0					2																	28812554		2203	4300	6503	SO:0001583	missense	151056				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	g.chr2:28812554G>A		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1933G>A	2.37:g.28812554G>A	ENSP00000330442:p.Asp645Asn		Somatic				PLB1_uc010ezj.1_Missense_Mutation_p.D634N|PLB1_uc002rmc.2_Missense_Mutation_p.D333N|PLB1_uc002rmd.1_Missense_Mutation_p.D155N	p.D645N	NM_153021	NP_694566	WXS	Illumina HiSeq	Unspecified	Q6P1J6	PLB1_HUMAN			28	1933	+	Acute lymphoblastic leukemia(172;0.155)		645			4 X 308-326 AA approximate repeats.|2.|Extracellular (Potential).		A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	c.1933G>A	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275895	0.80580	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.99	5.99	0.97316	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	1.0;0.992;1.0;0.981	D;D;D;D	0.97110	1.0;0.918;0.999;0.966	T	0.64356	-0.6427	10	0.32370	T	0.25	-36.1174	17.3945	0.87441	0.0:0.0:1.0:0.0	.	634;645;333;645	Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6	.;.;.;PLB1_HUMAN	N	645;634;355;333	ENSP00000330442:D645N;ENSP00000416440:D634N;ENSP00000392493:D355N;ENSP00000330729:D333N	ENSP00000330442:D645N	D	+	1	0	PLB1	28666058	1.000000	0.71417	0.874000	0.34290	0.289000	0.27227	8.313000	0.89978	2.840000	0.97914	0.655000	0.94253	GAC		0.498	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			7	72	0	0	0	0	7	72				
C2orf71	388939	broad.mit.edu	37	2	29294945	29294945	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:29294945C>G	ENST00000331664.5	-	1	2182	c.2183G>C	c.(2182-2184)aGa>aCa	p.R728T		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	728					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GACGGATGTTCTGGTGGGACA	0.547																																						uc002rmt.1		NA																	0				skin(1)	1						c.(2182-2184)AGA>ACA		hypothetical protein LOC388939							92.0	89.0	90.0					2																	29294945		2021	4190	6211	SO:0001583	missense	388939				response to stimulus|visual perception	photoreceptor outer segment		g.chr2:29294945C>G		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2183G>C	2.37:g.29294945C>G	ENSP00000332809:p.Arg728Thr		Somatic					p.R728T	NM_001029883	NP_001025054	WXS	Illumina HiSeq	Unspecified	A6NGG8	CB071_HUMAN			1	2183	-			728						Missense_Mutation	SNP	ENST00000331664.5	37	c.2183G>C	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900677	0.72754	.	.	ENSG00000179270	ENST00000331664	T	0.28666	1.6	5.7	5.7	0.88788	.	0.061993	0.64402	D	0.000011	T	0.57989	0.2091	M	0.71581	2.175	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.53208	-0.8471	10	0.72032	D	0.01	-23.3475	19.8336	0.96646	0.0:1.0:0.0:0.0	.	728	A6NGG8	CB071_HUMAN	T	728	ENSP00000332809:R728T	ENSP00000332809:R728T	R	-	2	0	C2orf71	29148449	1.000000	0.71417	0.973000	0.42090	0.970000	0.65996	3.795000	0.55499	2.685000	0.91497	0.555000	0.69702	AGA		0.547	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883		5	80	0	0	0	0	5	80				
PRKD3	23683	broad.mit.edu	37	2	37520323	37520323	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:37520323G>C	ENST00000379066.1	-	3	1142	c.380C>G	c.(379-381)tCa>tGa	p.S127*	PRKD3_ENST00000234179.2_Nonsense_Mutation_p.S127*			O94806	KPCD3_HUMAN	protein kinase D3	127					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				TTCATCTGCTGAGGTAATCAG	0.408																																					Melanoma(80;621 1355 8613 11814 51767)	uc002rqd.2		NA																	0				lung(2)|ovary(1)|central_nervous_system(1)	4						c.(379-381)TCA>TGA		protein kinase D3							135.0	125.0	129.0					2																	37520323		2203	4300	6503	SO:0001587	stop_gained	23683				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr2:37520323G>C	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.380C>G	2.37:g.37520323G>C	ENSP00000368356:p.Ser127*		Somatic				PRKD3_uc002rqf.1_Nonsense_Mutation_p.S127*	p.S127*	NM_005813	NP_005804	WXS	Illumina HiSeq	Unspecified	O94806	KPCD3_HUMAN			2	935	-		all_hematologic(82;0.21)	127					D6W587|Q53TR7|Q8NEL8	Nonsense_Mutation	SNP	ENST00000379066.1	37	c.380C>G	CCDS1789.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326444	0.95708	.	.	ENSG00000115825	ENST00000379066;ENST00000234179;ENST00000443187	.	.	.	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-15.994	19.5806	0.95465	0.0:0.0:1.0:0.0	.	.	.	.	X	127;127;23	.	ENSP00000234179:S127X	S	-	2	0	PRKD3	37373827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.686000	0.91538	0.650000	0.86243	TCA		0.408	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813		6	76	0	0	0	0	6	76				
TMEM178A	130733	broad.mit.edu	37	2	39944277	39944277	+	Silent	SNP	C	C	T	rs199548184		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:39944277C>T	ENST00000281961.2	+	4	836	c.780C>T	c.(778-780)tgC>tgT	p.C260C	TMEM178A_ENST00000482239.1_3'UTR	NM_152390.2	NP_689603.2	Q8NBL3	T178A_HUMAN	transmembrane protein 178A	260						integral component of membrane (GO:0016021)											CCATCTTTTGCGCCTGGTGCA	0.493													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16118	0.0		0.0	False		,,,				2504	0.0					uc002rrt.2		NA																	0					0						c.(778-780)TGC>TGT		transmembrane protein 178 precursor		C	,	1,4405	2.1+/-5.4	0,1,2202	225.0	202.0	210.0		234,780	-5.6	0.8	2		210	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TMEM178	NM_001167959.1,NM_152390.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	78/116,260/298	39944277	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	130733					integral to membrane		g.chr2:39944277C>T	BC029530	CCDS1804.1	2p22.1	2012-06-29	2012-06-29	2012-06-29	ENSG00000152154	ENSG00000152154			28517	protein-coding gene	gene with protein product			"""transmembrane protein 178"""	TMEM178		12975309	Standard	NM_001167959		Approved	MGC33926	uc002rrt.3	Q8NBL3	OTTHUMG00000128591	ENST00000281961.2:c.780C>T	2.37:g.39944277C>T			Somatic				TMEM178_uc010fam.1_Silent_p.C214C	p.C260C	NM_152390	NP_689603	WXS	Illumina HiSeq	Unspecified	Q8NBL3	TM178_HUMAN			4	805	+		all_hematologic(82;0.248)	260			Helical; (Potential).		Q6UWI6|Q8N6N4	Silent	SNP	ENST00000281961.2	37	c.780C>T	CCDS1804.1																																																																																				0.493	TMEM178A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250445.2	NM_152390		55	71	0	0	0	0	55	71				
GKN1	56287	broad.mit.edu	37	2	69206027	69206027	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:69206027C>T	ENST00000377938.2	+	4	334	c.271C>T	c.(271-273)Caa>Taa	p.Q91*		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	91	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)				breast(2)|large_intestine(4)|lung(5)	11						CAGACTCTTTCAAAAGAAGAC	0.433																																						uc002sfc.2		NA																	0				breast(1)	1						c.(271-273)CAA>TAA		18 kDa antrum mucosa protein precursor							80.0	73.0	75.0					2																	69206027		2203	4300	6503	SO:0001587	stop_gained	56287				digestion|positive regulation of cell division	extracellular region		g.chr2:69206027C>T	AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.271C>T	2.37:g.69206027C>T	ENSP00000367172:p.Gln91*		Somatic					p.Q91*	NM_019617	NP_062563	WXS	Illumina HiSeq	Unspecified	Q9NS71	GKN1_HUMAN			4	334	+			91			BRICHOS.		Q8IUA9	Nonsense_Mutation	SNP	ENST00000377938.2	37	c.271C>T	CCDS1891.2	.	.	.	.	.	.	.	.	.	.	C	5.902	0.350493	0.11182	.	.	ENSG00000169605	ENST00000377938	.	.	.	5.61	-11.2	0.00127	.	6.772150	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	11.0974	0.9969	0.01469	0.3686:0.2555:0.1781:0.1978	.	.	.	.	X	91	.	ENSP00000367172:Q91X	Q	+	1	0	GKN1	69059531	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-1.650000	0.01991	-3.557000	0.00141	-0.188000	0.12872	CAA		0.433	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617		4	53	0	0	0	0	4	53				
POLR1A	25885	broad.mit.edu	37	2	86302279	86302279	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:86302279G>A	ENST00000263857.6	-	12	1863	c.1485C>T	c.(1483-1485)tcC>tcT	p.S495S	POLR1A_ENST00000409681.1_Silent_p.S495S			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	495					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TGATGACCATGGAGGCTCCTG	0.602																																						uc002sqs.2		NA																	0				ovary(2)|skin(1)	3						c.(1483-1485)TCC>TCT		DNA-directed RNA polymerase I A							36.0	38.0	37.0					2																	86302279		2029	4186	6215	SO:0001819	synonymous_variant	25885				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding	g.chr2:86302279G>A	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.1485C>T	2.37:g.86302279G>A			Somatic					p.S495S	NM_015425	NP_056240	WXS	Illumina HiSeq	Unspecified	O95602	RPA1_HUMAN			12	1864	-			495					B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	ENST00000263857.6	37	c.1485C>T	CCDS42706.1																																																																																				0.602	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425		20	6	0	0	0	0	20	6				
AFF3	3899	broad.mit.edu	37	2	100266105	100266105	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:100266105G>A	ENST00000409236.2	-	11	1279	c.1167C>T	c.(1165-1167)ctC>ctT	p.L389L	AFF3_ENST00000409579.1_Silent_p.L414L|AFF3_ENST00000356421.2_Silent_p.L414L|AFF3_ENST00000317233.4_Silent_p.L389L			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	389					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						AGAGAGCGCGGAGAGCCGTTC	0.363																																						uc002tag.2		NA																	0				ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						c.(1165-1167)CTC>CTT		AF4/FMR2 family, member 3 isoform 1							87.0	101.0	97.0					2																	100266105		2203	4300	6503	SO:0001819	synonymous_variant	3899				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr2:100266105G>A	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1167C>T	2.37:g.100266105G>A			Somatic				AFF3_uc002taf.2_Silent_p.L414L|AFF3_uc010fiq.1_Silent_p.L389L|AFF3_uc010yvr.1_Silent_p.L542L|AFF3_uc002tah.1_Silent_p.L414L	p.L389L	NM_002285	NP_002276	WXS	Illumina HiSeq	Unspecified	P51826	AFF3_HUMAN			12	1403	-			389					B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	37	c.1167C>T	CCDS42723.1																																																																																				0.363	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285		8	76	0	0	0	0	8	76				
FOXD4L1	200350	broad.mit.edu	37	2	114257406	114257406	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:114257406C>T	ENST00000306507.5	+	1	746	c.573C>T	c.(571-573)ttC>ttT	p.F191F		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	191					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						AGGACATGTTCGACAATGGCA	0.652																																						uc002tjw.3		NA																	0					0						c.(571-573)TTC>TTT		forkhead box D4-like 1							30.0	39.0	36.0					2																	114257406		2004	3869	5873	SO:0001819	synonymous_variant	200350				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr2:114257406C>T	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.573C>T	2.37:g.114257406C>T			Somatic					p.F191F	NM_012184	NP_036316	WXS	Illumina HiSeq	Unspecified	Q9NU39	FX4L1_HUMAN			1	746	+			191			Fork-head.		B3KWN1|B9EGF3	Silent	SNP	ENST00000306507.5	37	c.573C>T	CCDS2117.1																																																																																				0.652	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1	NM_012184		13	180	0	0	0	0	13	180				
TMEM177	80775	broad.mit.edu	37	2	120439145	120439145	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:120439145C>G	ENST00000424086.1	+	2	1189	c.716C>G	c.(715-717)tCt>tGt	p.S239C	TMEM177_ENST00000272521.6_Missense_Mutation_p.S239C|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000409951.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.S239C	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	239						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					GCCTCCCTCTCTGCAGCCTAT	0.607																																						uc010flg.1		NA																	0				ovary(1)	1						c.(715-717)TCT>TGT		transmembrane protein 177							54.0	51.0	52.0					2																	120439145		2203	4300	6503	SO:0001583	missense	80775					integral to membrane		g.chr2:120439145C>G	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.716C>G	2.37:g.120439145C>G	ENSP00000402661:p.Ser239Cys		Somatic				TMEM177_uc002tme.2_Intron|TMEM177_uc002tmc.1_Missense_Mutation_p.S239C|TMEM177_uc002tmd.2_Missense_Mutation_p.S239C|TMEM177_uc010flh.2_Intron	p.S239C	NM_001105198	NP_001098668	WXS	Illumina HiSeq	Unspecified	Q53S58	TM177_HUMAN			2	1189	+	Colorectal(110;0.196)		239					Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	c.716C>G	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905609	0.33628	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000415646	T;T;T	0.50548	0.74;0.74;0.74	4.81	2.86	0.33363	.	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	M	0.79475	2.455	0.48511	D	0.99966	D	0.89917	1.0	D	0.68943	0.961	T	0.70575	-0.4834	10	0.72032	D	0.01	-8.2299	12.1366	0.53974	0.3046:0.6954:0.0:0.0	.	239	Q53S58	TM177_HUMAN	C	239;239;239;206	ENSP00000385966:S239C;ENSP00000402661:S239C;ENSP00000272521:S239C	ENSP00000272521:S239C	S	+	2	0	TMEM177	120155615	1.000000	0.71417	0.227000	0.23927	0.067000	0.16453	7.154000	0.77437	1.148000	0.42385	-0.335000	0.08231	TCT		0.607	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577		16	33	0	0	0	0	16	33				
NEB	4703	broad.mit.edu	37	2	152398055	152398055	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:152398055C>T	ENST00000172853.10	-	108	15632	c.15485G>A	c.(15484-15486)aGa>aAa	p.R5162K	NEB_ENST00000604864.1_Missense_Mutation_p.R6863K|NEB_ENST00000397345.3_Missense_Mutation_p.R6863K|NEB_ENST00000603639.1_Missense_Mutation_p.R6863K|NEB_ENST00000409198.1_Missense_Mutation_p.R5162K|NEB_ENST00000427231.2_Missense_Mutation_p.R6863K			P20929	NEBU_HUMAN	nebulin	5162					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCCTGCAGCTCTGTAGACCAG	0.433																																						uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(15484-15486)AGA>AAA		nebulin isoform 3							125.0	119.0	121.0					2																	152398055		1945	4160	6105	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152398055C>T	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.15485G>A	2.37:g.152398055C>T	ENSP00000172853:p.Arg5162Lys		Somatic				NEB_uc002txr.2_Missense_Mutation_p.R1585K	p.R5162K	NM_004543	NP_004534	WXS	Illumina HiSeq	Unspecified	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	108	15676	-			5162			Nebulin 140.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.15485G>A		.	.	.	.	.	.	.	.	.	.	C	22.2	4.255618	0.80135	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.06068	3.38;3.38;3.35;3.36;3.38	5.43	5.43	0.79202	.	0.042173	0.85682	D	0.000000	T	0.07052	0.0179	N	0.04746	-0.17	0.47153	D	0.999332	B;P	0.42203	0.376;0.773	B;P	0.50270	0.145;0.636	T	0.56914	-0.7900	10	0.15499	T	0.54	.	18.2196	0.89897	0.0:1.0:0.0:0.0	.	5162;1593	P20929;Q14215	NEBU_HUMAN;.	K	5162;6863;6863;1211;1593;5162	ENSP00000386259:R5162K;ENSP00000380505:R6863K;ENSP00000416578:R6863K;ENSP00000410961:R1593K;ENSP00000172853:R5162K	ENSP00000172853:R5162K	R	-	2	0	NEB	152106301	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.303000	0.51858	2.552000	0.86080	0.563000	0.77884	AGA		0.433	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		7	90	0	0	0	0	7	90				
BAZ2B	29994	broad.mit.edu	37	2	160194092	160194092	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:160194092C>T	ENST00000392783.2	-	32	6141	c.5646G>A	c.(5644-5646)cgG>cgA	p.R1882R	BAZ2B_ENST00000355831.2_Silent_p.R1848R|BAZ2B_ENST00000392782.1_Silent_p.R1846R|BAZ2B_ENST00000343439.5_Silent_p.R1782R	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1882					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TTTCAATGTTCCGCTCCAAAT	0.488																																						uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.(5644-5646)CGG>CGA		bromodomain adjacent to zinc finger domain, 2B							153.0	151.0	151.0					2																	160194092		1941	4138	6079	SO:0001819	synonymous_variant	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160194092C>T	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5646G>A	2.37:g.160194092C>T			Somatic				BAZ2B_uc002uap.2_Silent_p.R1846R	p.R1882R	NM_013450	NP_038478	WXS	Illumina HiSeq	Unspecified	Q9UIF8	BAZ2B_HUMAN			32	5998	-			1882					D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Silent	SNP	ENST00000392783.2	37	c.5646G>A	CCDS2209.2																																																																																				0.488	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			37	84	0	0	0	0	37	84				
XIRP2	129446	broad.mit.edu	37	2	168107133	168107133	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:168107133G>T	ENST00000409195.1	+	9	9320	c.9231G>T	c.(9229-9231)gaG>gaT	p.E3077D	XIRP2_ENST00000409273.1_Missense_Mutation_p.E2855D|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E3077D|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2902					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTGCCAAAGAGAAAACAGTAC	0.353																																						uc002udx.2		NA																	0				skin(7)|ovary(6)|pancreas(1)	14						c.(9229-9231)GAG>GAT		xin actin-binding repeat containing 2 isoform 1							80.0	76.0	77.0					2																	168107133		1890	4117	6007	SO:0001583	missense	129446				actin cytoskeleton organization	cell junction	actin binding	g.chr2:168107133G>T	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9231G>T	2.37:g.168107133G>T	ENSP00000386840:p.Glu3077Asp		Somatic				XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2902D|XIRP2_uc010fpq.2_Missense_Mutation_p.E2855D|XIRP2_uc010fpr.2_Intron	p.E3077D	NM_152381	NP_689594	WXS	Illumina HiSeq	Unspecified	A4UGR9	XIRP2_HUMAN			8	9249	+			2902					A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	c.9231G>T	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	6.424	0.446348	0.12223	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.03441	3.94;3.94;3.93	5.78	3.34	0.38264	.	0.105692	0.64402	D	0.000008	T	0.03915	0.0110	L	0.60455	1.87	0.44834	D	0.997847	B;P;B	0.40638	0.433;0.725;0.275	B;B;B	0.34418	0.089;0.182;0.067	T	0.49466	-0.8937	10	0.48119	T	0.1	-16.2625	5.0984	0.14747	0.6619:0.1502:0.1879:0.0	.	2902;2902;2855	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	D	3077;3077;2855;491	ENSP00000386840:E3077D;ENSP00000295237:E3077D;ENSP00000387255:E2855D	ENSP00000295237:E3077D	E	+	3	2	XIRP2	167815379	0.987000	0.35691	0.998000	0.56505	0.169000	0.22640	0.551000	0.23361	0.414000	0.25790	-0.484000	0.04775	GAG		0.353	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381		55	18	1	0	1.28e-28	1.38e-28	55	18				
ZAK	51776	broad.mit.edu	37	2	174131080	174131080	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:174131080G>C	ENST00000375213.3	+	20	2083	c.2005G>C	c.(2005-2007)Gag>Cag	p.E669Q	MLK7-AS1_ENST00000423106.2_RNA|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000409176.2_Missense_Mutation_p.E669Q	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		669					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										CACCTCTTCAGAGAGGGGTCG	0.458																																						uc002uhz.2		NA																	0				lung(3)|stomach(1)|ovary(1)|skin(1)	6						c.(2005-2007)GAG>CAG		MLK-related kinase isoform 1							90.0	93.0	92.0					2																	174131080		1914	4132	6046	SO:0001583	missense	51776				activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding	g.chr2:174131080G>C																												ENST00000375213.3:c.2005G>C	2.37:g.174131080G>C	ENSP00000364361:p.Glu669Gln		Somatic				uc002uib.2_Intron	p.E669Q	NM_016653	NP_057737	WXS	Illumina HiSeq	Unspecified	Q9NYL2	MLTK_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.176)		20	2205	+			669					B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	ENST00000375213.3	37	c.2005G>C	CCDS42777.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564792	0.65651	.	.	ENSG00000091436	ENST00000409176;ENST00000375213	T;T	0.78707	-1.2;-1.2	5.66	5.66	0.87406	.	0.048035	0.85682	D	0.000000	T	0.75831	0.3903	L	0.32530	0.975	0.80722	D	1	P	0.52577	0.954	P	0.46452	0.517	T	0.78874	-0.2032	10	0.72032	D	0.01	.	19.7487	0.96260	0.0:0.0:1.0:0.0	.	669	Q9NYL2	MLTK_HUMAN	Q	669	ENSP00000387259:E669Q;ENSP00000364361:E669Q	ENSP00000364361:E669Q	E	+	1	0	AC013461.1	173839326	1.000000	0.71417	0.742000	0.31022	0.729000	0.41735	8.344000	0.90055	2.676000	0.91093	0.591000	0.81541	GAG		0.458	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255401.1			17	61	0	0	0	0	17	61				
TTN	7273	broad.mit.edu	37	2	179413442	179413442	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:179413442C>G	ENST00000591111.1	-	289	88212	c.87988G>C	c.(87988-87990)Gat>Cat	p.D29330H	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D30971H|TTN_ENST00000342992.6_Missense_Mutation_p.D28403H|TTN_ENST00000460472.2_Missense_Mutation_p.D21906H|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D22031H|TTN_ENST00000342175.6_Missense_Mutation_p.D22098H|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29330	Ig-like 134.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTATGGATATCAGCCCGAAGG	0.478																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(85207-85209)GAT>CAT		titin isoform N2-A							126.0	121.0	123.0					2																	179413442		1968	4148	6116	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179413442C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.87988G>C	2.37:g.179413442C>G	ENSP00000465570:p.Asp29330His		Somatic				uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D22098H|TTN_uc010zfi.1_Missense_Mutation_p.D22031H|TTN_uc010zfj.1_Missense_Mutation_p.D21906H	p.D28403H	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		288	85431	-			29330					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.85207G>C		.	.	.	.	.	.	.	.	.	.	C	14.78	2.637062	0.47049	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.22	5.22	0.72569	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66187	0.2764	N	0.05554	-0.025	0.53688	D	0.999975	D;D;D;D	0.59767	0.986;0.986;0.986;0.986	P;P;P;P	0.61533	0.89;0.89;0.89;0.89	T	0.74902	-0.3506	9	0.87932	D	0	.	19.1459	0.93467	0.0:1.0:0.0:0.0	.	21906;22031;22098;29330	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	28403;21906;22098;22031;21903	ENSP00000343764:D28403H;ENSP00000434586:D21906H;ENSP00000340554:D22098H;ENSP00000352154:D22031H	ENSP00000340554:D22098H	D	-	1	0	TTN	179121688	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.042000	0.57347	2.577000	0.86979	0.563000	0.77884	GAT		0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		5	73	0	0	0	0	5	73				
TRAK2	66008	broad.mit.edu	37	2	202285154	202285154	+	Missense_Mutation	SNP	G	G	A	rs146913241	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:202285154G>A	ENST00000332624.3	-	2	505	c.77C>T	c.(76-78)tCg>tTg	p.S26L	TRAK2_ENST00000430254.1_Missense_Mutation_p.S26L|TRAK2_ENST00000451703.1_5'UTR	NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	26					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						GATGCTCTCCGAGTCTCTGTG	0.398																																						uc002uyb.3		NA																	0					0						c.(76-78)TCG>TTG		trafficking protein, kinesin binding 2		G	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	176.0	162.0	167.0		77	4.8	1.0	2	dbSNP_134	167	1,8599	1.2+/-3.3	0,1,4299	no	missense	TRAK2	NM_015049.2	145	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	26/915	202285154	2,13004	2203	4300	6503	SO:0001583	missense	66008					early endosome|plasma membrane	GABA receptor binding	g.chr2:202285154G>A	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.77C>T	2.37:g.202285154G>A	ENSP00000328875:p.Ser26Leu		Somatic				TRAK2_uc002uyc.2_Missense_Mutation_p.S26L	p.S26L	NM_015049	NP_055864	WXS	Illumina HiSeq	Unspecified	O60296	TRAK2_HUMAN			2	523	-			26					E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Missense_Mutation	SNP	ENST00000332624.3	37	c.77C>T	CCDS2347.1	.	.	.	.	.	.	.	.	.	.	G	6.724	0.502253	0.12822	2.27E-4	1.16E-4	ENSG00000115993	ENST00000332624;ENST00000430254;ENST00000440597	T;T	0.31247	3.25;1.5	4.76	4.76	0.60689	.	0.146245	0.32106	N	0.006565	T	0.34077	0.0885	N	0.19112	0.55	0.80722	D	1	D;B	0.64830	0.994;0.001	P;B	0.61201	0.885;0.001	T	0.03017	-1.1082	10	0.23891	T	0.37	.	13.2087	0.59813	0.0:0.0:1.0:0.0	.	26;26	E7EV21;O60296	.;TRAK2_HUMAN	L	26	ENSP00000328875:S26L;ENSP00000409333:S26L	ENSP00000328875:S26L	S	-	2	0	TRAK2	201993399	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.830000	0.39131	2.481000	0.83766	0.558000	0.71614	TCG		0.398	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049		11	88	0	0	0	0	11	88				
ILKAP	80895	broad.mit.edu	37	2	239079271	239079271	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr2:239079271C>T	ENST00000254654.3	-	12	1260	c.1085G>A	c.(1084-1086)cGc>cAc	p.R362H		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	362	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TGCTTCGTAGCGGGCGTCGGC	0.612																																						uc002vxv.2		NA																	0				ovary(3)	3						c.(1084-1086)CGC>CAC		integrin-linked kinase-associated protein							43.0	43.0	43.0					2																	239079271		2203	4300	6503	SO:0001583	missense	80895					cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding	g.chr2:239079271C>T	AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.1085G>A	2.37:g.239079271C>T	ENSP00000254654:p.Arg362His		Somatic				ILKAP_uc010zns.1_Missense_Mutation_p.R294H|ILKAP_uc002vxw.2_Missense_Mutation_p.R242H	p.R362H	NM_030768	NP_110395	WXS	Illumina HiSeq	Unspecified	Q9H0C8	ILKAP_HUMAN		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)	12	1215	-		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	362			PP2C-like.		B3KM39	Missense_Mutation	SNP	ENST00000254654.3	37	c.1085G>A	CCDS2526.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719602	0.48728	.	.	ENSG00000132323	ENST00000254654	T	0.17213	2.29	5.69	5.69	0.88448	Protein phosphatase 2C-like (5);	0.112628	0.64402	D	0.000012	T	0.15825	0.0381	L	0.42632	1.34	0.44852	D	0.997862	B	0.31125	0.309	B	0.33042	0.157	T	0.05582	-1.0876	10	0.12766	T	0.61	-0.4038	13.5499	0.61726	0.156:0.844:0.0:0.0	.	362	Q9H0C8	ILKAP_HUMAN	H	362	ENSP00000254654:R362H	ENSP00000254654:R362H	R	-	2	0	ILKAP	238744010	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	2.581000	0.46077	2.688000	0.91661	0.563000	0.77884	CGC		0.612	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768		20	27	0	0	0	0	20	27				
SIRPD	128646	broad.mit.edu	37	20	1517864	1517864	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:1517864C>G	ENST00000381623.3	-	3	1703	c.514G>C	c.(514-516)Gag>Cag	p.E172Q	SIRPD_ENST00000381621.1_Missense_Mutation_p.E173Q			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	172						extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CTGTTTCTCTCAGGCAGGGCC	0.602																																						uc002wfi.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(514-516)GAG>CAG		signal-regulatory protein delta precursor							145.0	128.0	134.0					20																	1517864		2203	4300	6503	SO:0001583	missense	128646					extracellular region		g.chr20:1517864C>G	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.514G>C	20.37:g.1517864C>G	ENSP00000371036:p.Glu172Gln		Somatic					p.E172Q	NM_178460	NP_848555	WXS	Illumina HiSeq	Unspecified	Q9H106	SIRPD_HUMAN			3	558	-			172					B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	c.514G>C	CCDS13018.1	.	.	.	.	.	.	.	.	.	.	C	6.073	0.381725	0.11524	.	.	ENSG00000125900	ENST00000381623;ENST00000381621	T;T	0.01998	4.51;4.56	2.97	1.02	0.19986	.	.	.	.	.	T	0.01695	0.0054	N	0.08118	0	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.50004	-0.8878	9	0.52906	T	0.07	.	5.0795	0.14649	0.0:0.7175:0.0:0.2825	.	172	Q9H106	SIRPD_HUMAN	Q	172;173	ENSP00000371036:E172Q;ENSP00000371034:E173Q	ENSP00000371034:E173Q	E	-	1	0	SIRPD	1465864	0.107000	0.21998	0.135000	0.22099	0.076000	0.17211	0.121000	0.15667	0.293000	0.22520	0.563000	0.77884	GAG		0.602	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460		5	83	0	0	0	0	5	83				
SLC4A11	83959	broad.mit.edu	37	20	3210904	3210904	+	Missense_Mutation	SNP	G	G	A	rs121909388		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:3210904G>A	ENST00000380056.3	-	12	1513	c.1466C>T	c.(1465-1467)tCg>tTg	p.S489L	SLC4A11_ENST00000380059.3_Missense_Mutation_p.S516L|SLC4A11_ENST00000539553.2_Missense_Mutation_p.S473L|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	489	Membrane (bicarbonate transporter).		S -> L (in CHED2; affects protein processing and transport to the cell surface). {ECO:0000269|PubMed:16767101, ECO:0000269|PubMed:17679935}.		bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CTCCTCCGTCGACCTGCCAGG	0.637																																					NSCLC(190;922 2139 10266 10292 38692)	uc002wig.2		NA																	0				ovary(1)	1	GRCh37	CM063151	SLC4A11	M	rs121909388	c.(1465-1467)TCG>TTG		solute carrier family 4 member 11		G	LEU/SER,LEU/SER,LEU/SER	1,4405	2.1+/-5.4	0,1,2202	70.0	64.0	66.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1418,1547,1466	4.2	0.9	20	dbSNP_133	66	0,8600		0,0,4300	no	missense,missense,missense	SLC4A11	NM_001174089.1,NM_001174090.1,NM_032034.3	145,145,145	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	473/876,516/919,489/892	3210904	1,13005	2203	4300	6503	SO:0001583	missense	83959				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity	g.chr20:3210904G>A	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1466C>T	20.37:g.3210904G>A	ENSP00000369396:p.Ser489Leu		Somatic				SLC4A11_uc010zqe.1_Missense_Mutation_p.S516L|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.S473L	p.S489L	NM_032034	NP_114423	WXS	Illumina HiSeq	Unspecified	Q8NBS3	S4A11_HUMAN			12	1514	-			489		S -> L (in CHED2; affects protein processing and transport to the cell surface).	Membrane (bicarbonate transporter).		B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	c.1466C>T	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	G	36	5.600417	0.96614	2.27E-4	0.0	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	T;T;T	0.77358	-1.09;-1.09;-1.09	5.21	4.25	0.50352	Bicarbonate transporter, C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.87301	0.6143	M	0.85041	2.73	0.80722	A	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72338	0.961;0.977;0.977	D	0.88403	0.3016	9	0.32370	T	0.25	.	12.839	0.57790	0.0798:0.0:0.9202:0.0	.	473;516;489	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	L	516;489;473	ENSP00000369399:S516L;ENSP00000369396:S489L;ENSP00000441370:S473L	ENSP00000369396:S489L	S	-	2	0	SLC4A11	3158904	1.000000	0.71417	0.937000	0.37676	0.593000	0.36681	5.412000	0.66392	2.431000	0.82371	0.563000	0.77884	TCG		0.637	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1			14	20	0	0	0	0	14	20				
NKX2-2	4821	broad.mit.edu	37	20	21494272	21494272	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:21494272G>A	ENST00000377142.4	-	1	392	c.36C>T	c.(34-36)gtC>gtT	p.V12V	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	12					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						AGATGTCCTTGACCGAAAACC	0.572																																						uc002wsi.2		NA																	0				pancreas(1)|skin(1)	2						c.(34-36)GTC>GTT		NK2 transcription factor related, locus 2							65.0	65.0	65.0					20																	21494272		2203	4300	6503	SO:0001819	synonymous_variant	4821				brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity	g.chr20:21494272G>A	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.36C>T	20.37:g.21494272G>A			Somatic					p.V12V	NM_002509	NP_002500	WXS	Illumina HiSeq	Unspecified	O95096	NKX22_HUMAN			1	393	-			12						Silent	SNP	ENST00000377142.4	37	c.36C>T	CCDS13145.1																																																																																				0.572	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078278.9			6	51	0	0	0	0	6	51				
BPIFA1	51297	broad.mit.edu	37	20	31829196	31829196	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:31829196G>A	ENST00000354297.4	+	6	658	c.587G>A	c.(586-588)gGc>gAc	p.G196D	BPIFA1_ENST00000375422.2_Missense_Mutation_p.G196D|BPIFA1_ENST00000375413.4_Missense_Mutation_p.G196D	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	196					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										TTCAGACTTGGCCCCCTCCCC	0.542																																						uc002wyv.2		NA																	0					0						c.(586-588)GGC>GAC		palate, lung and nasal epithelium associated							232.0	224.0	227.0					20																	31829196		2203	4300	6503	SO:0001583	missense	51297				innate immune response	extracellular region	lipid binding	g.chr20:31829196G>A	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.587G>A	20.37:g.31829196G>A	ENSP00000346251:p.Gly196Asp		Somatic				PLUNC_uc002wyt.3_Missense_Mutation_p.G196D|PLUNC_uc002wyu.3_Missense_Mutation_p.G196D	p.G196D	NM_130852	NP_570913	WXS	Illumina HiSeq	Unspecified	Q9NP55	PLUNC_HUMAN			6	657	+			196					A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	ENST00000354297.4	37	c.587G>A	CCDS13217.1	.	.	.	.	.	.	.	.	.	.	g	11.84	1.759812	0.31137	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.04360	3.64;3.64;3.64	5.09	-8.27	0.01017	.	1.233700	0.05655	N	0.585796	T	0.04318	0.0119	L	0.44542	1.39	0.09310	N	1	B	0.18610	0.029	B	0.20384	0.029	T	0.41395	-0.9511	10	0.29301	T	0.29	-0.0312	8.417	0.32676	0.0:0.2834:0.2523:0.4643	.	196	Q9NP55	BPIA1_HUMAN	D	196;196;196;182	ENSP00000364571:G196D;ENSP00000346251:G196D;ENSP00000364562:G196D	ENSP00000346251:G196D	G	+	2	0	BPIFA1	31292857	0.000000	0.05858	0.000000	0.03702	0.147000	0.21601	-2.888000	0.00711	-1.228000	0.02568	-0.187000	0.12897	GGC		0.542	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852		97	165	0	0	0	0	97	165				
EIF2S2	8894	broad.mit.edu	37	20	32677564	32677564	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:32677564C>T	ENST00000374980.2	-	9	1195	c.974G>A	c.(973-975)cGa>cAa	p.R325Q		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	325					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						GAGCTGTGCTCGCTTGCCCGT	0.473																																						uc002xaf.2		NA																	0				large_intestine(1)	1						c.(973-975)CGA>CAA		eukaryotic translation initiation factor 2 beta							80.0	69.0	73.0					20																	32677564		2203	4300	6503	SO:0001583	missense	8894					cytosol|eukaryotic translation initiation factor 2 complex	metal ion binding|protein binding|translation initiation factor activity	g.chr20:32677564C>T	M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.974G>A	20.37:g.32677564C>T	ENSP00000364119:p.Arg325Gln		Somatic				EIF2S2_uc002xag.2_Missense_Mutation_p.R322Q|EIF2S2_uc010ges.2_Missense_Mutation_p.R265Q	p.R325Q	NM_003908	NP_003899	WXS	Illumina HiSeq	Unspecified	P20042	IF2B_HUMAN			9	1143	-			325					Q9BVU0|Q9UJE4	Missense_Mutation	SNP	ENST00000374980.2	37	c.974G>A	CCDS13231.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764096	0.89932	.	.	ENSG00000125977	ENST00000374980	T	0.65364	-0.15	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	D	0.83843	0.5342	M	0.90870	3.155	0.80722	D	1	P;D;D	0.64830	0.791;0.994;0.994	B;D;D	0.64042	0.201;0.921;0.921	D	0.85864	0.1412	10	0.87932	D	0	-25.1421	20.8599	0.99761	0.0:1.0:0.0:0.0	.	325;325;325	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	Q	325	ENSP00000364119:R325Q	ENSP00000364119:R325Q	R	-	2	0	EIF2S2	32141225	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.783000	0.85696	2.937000	0.99478	0.650000	0.86243	CGA		0.473	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078765.2	NM_003908		23	40	0	0	0	0	23	40				
LBP	3929	broad.mit.edu	37	20	36993299	36993299	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:36993299G>A	ENST00000217407.2	+	8	975	c.814G>A	c.(814-816)Gaa>Aaa	p.E272K		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	272					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CCTTCCTGAGGAACACAACAA	0.468																																						uc002xic.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(814-816)GAA>AAA		lipopolysaccharide-binding protein precursor							210.0	189.0	196.0					20																	36993299		2203	4300	6503	SO:0001583	missense	3929				acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding	g.chr20:36993299G>A		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.814G>A	20.37:g.36993299G>A	ENSP00000217407:p.Glu272Lys		Somatic					p.E272K	NM_004139	NP_004130	WXS	Illumina HiSeq	Unspecified	P18428	LBP_HUMAN			8	849	+		Myeloproliferative disorder(115;0.00878)	272					B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	ENST00000217407.2	37	c.814G>A	CCDS13304.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695420	0.30052	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.09350	2.99	5.55	1.37	0.22104	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.679823	0.14731	N	0.301733	T	0.10465	0.0256	L	0.49126	1.545	0.09310	N	1	B	0.21452	0.056	B	0.29077	0.098	T	0.31503	-0.9941	10	0.30078	T	0.28	-3.1315	6.4267	0.21773	0.2294:0.1337:0.6369:0.0	.	272	P18428	LBP_HUMAN	K	272	ENSP00000217407:E272K	ENSP00000217407:E272K	E	+	1	0	LBP	36426713	0.728000	0.28080	0.002000	0.10522	0.025000	0.11179	1.729000	0.38115	0.450000	0.26774	0.655000	0.94253	GAA		0.468	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139		45	84	0	0	0	0	45	84				
CHD6	84181	broad.mit.edu	37	20	40050616	40050616	+	Silent	SNP	G	G	C	rs202156642		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:40050616G>C	ENST00000373233.3	-	31	4836	c.4659C>G	c.(4657-4659)ctC>ctG	p.L1553L		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1553					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GAGGGCACTTGAGCACTTGCT	0.562																																						uc002xka.1		NA																	0				ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14						c.(4657-4659)CTC>CTG		chromodomain helicase DNA binding protein 6							73.0	59.0	64.0					20																	40050616		2203	4300	6503	SO:0001819	synonymous_variant	84181				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding	g.chr20:40050616G>C	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4659C>G	20.37:g.40050616G>C			Somatic					p.L1553L	NM_032221	NP_115597	WXS	Illumina HiSeq	Unspecified	Q8TD26	CHD6_HUMAN			31	4837	-		Myeloproliferative disorder(115;0.00425)	1553					Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	c.4659C>G	CCDS13317.1																																																																																				0.562	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			14	39	0	0	0	0	14	39				
RBPJL	11317	broad.mit.edu	37	20	43942191	43942191	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:43942191G>C	ENST00000343694.3	+	7	775	c.703G>C	c.(703-705)Gat>Cat	p.D235H	RBPJL_ENST00000372743.1_Missense_Mutation_p.D235H|RBPJL_ENST00000372741.3_Missense_Mutation_p.D235H	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	235					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				CTCTGTGGAGGATGGGGCCTT	0.597																																						uc002xns.2		NA																	0				ovary(1)	1						c.(703-705)GAT>CAT		recombining binding protein L							89.0	71.0	77.0					20																	43942191		2203	4300	6503	SO:0001583	missense	11317				signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr20:43942191G>C	AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.703G>C	20.37:g.43942191G>C	ENSP00000341243:p.Asp235His		Somatic				RBPJL_uc002xnt.2_Missense_Mutation_p.D235H	p.D235H	NM_014276	NP_055091	WXS	Illumina HiSeq	Unspecified	Q9UBG7	RBPJL_HUMAN			7	775	+		Myeloproliferative disorder(115;0.0122)	235					O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	ENST00000343694.3	37	c.703G>C	CCDS13349.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398461	0.62177	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	T;T;T	0.31247	1.5;1.5;1.5	5.06	3.09	0.35607	Beta-trefoil (2);	0.216594	0.38720	N	0.001592	T	0.28001	0.0690	N	0.19112	0.55	0.38699	D	0.952943	D;P	0.54397	0.966;0.81	P;P	0.52066	0.689;0.573	T	0.06862	-1.0803	10	0.42905	T	0.14	-14.6444	11.0806	0.48057	0.1515:0.0:0.8485:0.0	.	235;235	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	H	235	ENSP00000361828:D235H;ENSP00000361826:D235H;ENSP00000341243:D235H	ENSP00000341243:D235H	D	+	1	0	RBPJL	43375605	1.000000	0.71417	0.901000	0.35422	0.836000	0.47400	3.442000	0.52900	0.700000	0.31782	0.557000	0.71058	GAT		0.597	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276		7	15	0	0	0	0	7	15				
ZNF335	63925	broad.mit.edu	37	20	44577711	44577711	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:44577711C>G	ENST00000322927.2	-	28	4010	c.3910G>C	c.(3910-3912)Gat>Cat	p.D1304H	ZNF335_ENST00000426788.1_Missense_Mutation_p.D1149H	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1304	Gln-rich.				brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				ATGGCAGCATCAGCCACTGCT	0.597																																						uc002xqw.2		NA																	0				skin(3)|ovary(1)	4						c.(3910-3912)GAT>CAT		zinc finger protein 335							47.0	44.0	45.0					20																	44577711		2202	4300	6502	SO:0001583	missense	63925				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:44577711C>G	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3910G>C	20.37:g.44577711C>G	ENSP00000325326:p.Asp1304His		Somatic				ZNF335_uc002xqv.2_Missense_Mutation_p.D416H|ZNF335_uc010zxk.1_Missense_Mutation_p.D1149H	p.D1304H	NM_022095	NP_071378	WXS	Illumina HiSeq	Unspecified	Q9H4Z2	ZN335_HUMAN			28	4033	-		Myeloproliferative disorder(115;0.0122)	1304			Gln-rich.		B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	c.3910G>C	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124983	0.77436	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.21031	2.23;2.03	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.35941	0.0949	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.20042	-1.0287	10	0.87932	D	0	-18.0522	17.8571	0.88767	0.0:1.0:0.0:0.0	.	1149;1304	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	H	1304;1081;1149	ENSP00000325326:D1304H;ENSP00000397098:D1149H	ENSP00000243961:D1081H	D	-	1	0	ZNF335	44011118	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	5.099000	0.64554	2.438000	0.82558	0.561000	0.74099	GAT		0.597	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095		6	32	0	0	0	0	6	32				
CD40	958	broad.mit.edu	37	20	44757575	44757575	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:44757575G>C	ENST00000372285.3	+	9	802	c.730G>C	c.(730-732)Ggc>Cgc	p.G244R	CD40_ENST00000372276.3_3'UTR|CD40_ENST00000489304.1_3'UTR	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	244					B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				CGATCTTCCTGGCTCCAACAC	0.597									Immune Deficiency with Hyper-IgM		OREG0025991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002xrg.1		NA																	0				lung(1)|skin(1)	2						c.(730-732)GGC>CGC		CD40 antigen isoform 1 precursor	Simvastatin(DB00641)						93.0	80.0	85.0					20																	44757575		2203	4300	6503	SO:0001583	missense	958	Immune_Deficiency_with_Hyper-IgM	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	B cell proliferation|cellular response to mechanical stimulus|inflammatory response|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein complex assembly	CD40 receptor complex|extracellular region	enzyme binding|receptor activity	g.chr20:44757575G>C	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.730G>C	20.37:g.44757575G>C	ENSP00000361359:p.Gly244Arg		Somatic	OREG0025991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	926	CD40_uc002xrh.1_3'UTR|CD40_uc002xri.1_3'UTR|CD40_uc002xrj.1_RNA|CD40_uc002xrk.1_RNA|CD40_uc002xrl.1_RNA	p.G244R	NM_001250	NP_001241	WXS	Illumina HiSeq	Unspecified	P25942	TNR5_HUMAN			9	807	+		Myeloproliferative disorder(115;0.0122)	244			Cytoplasmic (Potential).		E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Missense_Mutation	SNP	ENST00000372285.3	37	c.730G>C	CCDS13393.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404760	0.42613	.	.	ENSG00000101017	ENST00000372285	T	0.73681	-0.77	3.39	2.43	0.29744	.	30.515400	0.00447	N	0.000094	T	0.75722	0.3888	L	0.43152	1.355	0.24806	N	0.992672	P	0.52316	0.952	P	0.52267	0.694	T	0.60707	-0.7210	10	0.17369	T	0.5	-7.6774	8.9981	0.36066	0.1078:0.0:0.8922:0.0	.	244	P25942	TNR5_HUMAN	R	244	ENSP00000361359:G244R	ENSP00000361359:G244R	G	+	1	0	CD40	44190982	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.061000	0.11693	0.998000	0.38996	0.491000	0.48974	GGC		0.597	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080376.1	NM_001250		17	28	0	0	0	0	17	28				
ARFGEF2	10564	broad.mit.edu	37	20	47633821	47633821	+	Silent	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:47633821T>C	ENST00000371917.4	+	32	4351	c.4351T>C	c.(4351-4353)Tta>Cta	p.L1451L		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1451					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TACAAATTGCTTAGAAAACTT	0.368																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	uc002xtx.3		NA																	0				breast(3)|upper_aerodigestive_tract(1)	4						c.(4351-4353)TTA>CTA		ADP-ribosylation factor guanine							79.0	76.0	77.0					20																	47633821		2203	4300	6503	SO:0001819	synonymous_variant	10564				exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity	g.chr20:47633821T>C	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.4351T>C	20.37:g.47633821T>C			Somatic				ARFGEF2_uc010zyf.1_Silent_p.L744L	p.L1451L	NM_006420	NP_006411	WXS	Illumina HiSeq	Unspecified	Q9Y6D5	BIG2_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)		32	4503	+			1451					Q5TFT9|Q9NTS1	Silent	SNP	ENST00000371917.4	37	c.4351T>C	CCDS13411.1																																																																																				0.368	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420		23	32	0	0	0	0	23	32				
ZNF217	7764	broad.mit.edu	37	20	52198233	52198233	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr20:52198233G>T	ENST00000371471.2	-	2	1558	c.1133C>A	c.(1132-1134)tCc>tAc	p.S378Y	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.S378Y			O75362	ZN217_HUMAN	zinc finger protein 217	378					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GCCGCACTCGGAGCAGTGAGT	0.607																																						uc002xwq.3		NA																	0				skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6						c.(1132-1134)TCC>TAC		zinc finger protein 217							94.0	97.0	96.0					20																	52198233		2203	4300	6503	SO:0001583	missense	7764				negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr20:52198233G>T	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1133C>A	20.37:g.52198233G>T	ENSP00000360526:p.Ser378Tyr		Somatic				ZNF217_uc010gij.1_Missense_Mutation_p.S370Y	p.S378Y	NM_006526	NP_006517	WXS	Illumina HiSeq	Unspecified	O75362	ZN217_HUMAN	BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)		1	1404	-	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		378			C2H2-type 5.		E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	c.1133C>A	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.559753	0.45590	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.31247	1.5;1.5	5.7	4.76	0.60689	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.701846	0.14237	N	0.332349	T	0.51584	0.1683	M	0.79475	2.455	0.29074	N	0.883089	D	0.53885	0.963	P	0.59948	0.866	T	0.51156	-0.8741	10	0.62326	D	0.03	-13.5683	9.9869	0.41847	0.073:0.1379:0.7891:0.0	.	378	O75362	ZN217_HUMAN	Y	378	ENSP00000360526:S378Y;ENSP00000304308:S378Y	ENSP00000304308:S378Y	S	-	2	0	ZNF217	51631640	0.793000	0.28825	0.209000	0.23619	0.505000	0.33919	3.160000	0.50739	1.419000	0.47118	0.591000	0.81541	TCC		0.607	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526		6	57	1	0	0.00198382	0.00202778	6	57				
KRTAP27-1	643812	broad.mit.edu	37	21	31709900	31709900	+	Silent	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr21:31709900G>T	ENST00000382835.2	-	1	112	c.87C>A	c.(85-87)acC>acA	p.T29T		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	29						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TGTCTTCAAAGGTTATAGGAT	0.468																																						uc002ynx.1		NA																	0				ovary(2)	2						c.(85-87)ACC>ACA		keratin associated protein 27-1							126.0	118.0	121.0					21																	31709900		2203	4300	6503	SO:0001819	synonymous_variant	643812					intermediate filament		g.chr21:31709900G>T	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.87C>A	21.37:g.31709900G>T			Somatic					p.T29T	NM_001077711	NP_001071179	WXS	Illumina HiSeq	Unspecified	Q3LI81	KR271_HUMAN			1	113	-			29						Silent	SNP	ENST00000382835.2	37	c.87C>A	CCDS33532.1																																																																																				0.468	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711		44	99	1	0	7.05e-23	7.56e-23	44	99				
URB1	9875	broad.mit.edu	37	21	33686872	33686872	+	3'UTR	SNP	G	G	T	rs150983600		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr21:33686872G>T	ENST00000382751.3	-	0	7288				MRAP_ENST00000339944.4_Missense_Mutation_p.D73Y|MRAP_ENST00000399786.3_Missense_Mutation_p.D73Y	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)							nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						CTTTAACACAGATGAATCTCT	0.448																																						uc002ypk.2		NA																	0					0						c.(217-219)GAT>TAT		melanocortin 2 receptor accessory protein							84.0	84.0	84.0					21																	33686872		2203	4300	6503	SO:0001624	3_prime_UTR_variant	56246				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding	g.chr21:33686872G>T	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.*357C>A	21.37:g.33686872G>T			Somatic				URB1_uc002ypn.2_3'UTR	p.D73Y	NM_206898	NP_996781	WXS	Illumina HiSeq	Unspecified	Q8TCY5	MRAP_HUMAN			5	404	+			Error:Variant_position_missing_in_Q8TCY5_after_alignment					D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	ENST00000382751.3	37	c.217G>T	CCDS46645.1	.	.	.	.	.	.	.	.	.	.	G	5.258	0.233102	0.09969	.	.	ENSG00000170262	ENST00000399786;ENST00000339944	D;D	0.85955	-2.05;-2.05	2.91	1.08	0.20341	.	.	.	.	.	T	0.75369	0.3840	.	.	.	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.64300	-0.6440	8	0.66056	D	0.02	.	4.3362	0.11087	0.0:0.6255:0.2392:0.1353	.	73	Q8TCY5-2	.	Y	73	ENSP00000382686:D73Y;ENSP00000343661:D73Y	ENSP00000343661:D73Y	D	+	1	0	MRAP	32608743	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.087000	0.11215	0.292000	0.22492	-0.203000	0.12734	GAT		0.448	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139400.2			23	28	1	0	3.29e-13	3.48e-13	23	28				
ZBTB21	49854	broad.mit.edu	37	21	43412300	43412300	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr21:43412300C>G	ENST00000310826.5	-	3	2088	c.1905G>C	c.(1903-1905)ctG>ctC	p.L635L	ZBTB21_ENST00000398511.3_Silent_p.L635L|ZBTB21_ENST00000398505.3_Intron|ZBTB21_ENST00000398499.1_Silent_p.L635L|ZBTB21_ENST00000465968.1_Intron	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	635					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										ACTTAATGATCAGGGCCTTCT	0.458																																						uc002zab.3		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1903-1905)CTG>CTC		zinc finger protein 295 isoform L							69.0	70.0	70.0					21																	43412300		2203	4300	6503	SO:0001819	synonymous_variant	49854				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding	g.chr21:43412300C>G	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.1905G>C	21.37:g.43412300C>G			Somatic				ZNF295_uc002yzz.3_Intron|ZNF295_uc002yzy.3_Silent_p.L635L|ZNF295_uc002zaa.3_Silent_p.L635L	p.L635L	NM_001098402	NP_001091872	WXS	Illumina HiSeq	Unspecified	Q9ULJ3	ZN295_HUMAN			3	2119	-			635					Q5R2W1|Q5R2W2|Q6P4R0	Silent	SNP	ENST00000310826.5	37	c.1905G>C	CCDS13678.1																																																																																				0.458	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727		4	81	0	0	0	0	4	81				
TMPRSS3	64699	broad.mit.edu	37	21	43795836	43795836	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr21:43795836C>T	ENST00000291532.3	-	12	2291	c.1336G>A	c.(1336-1338)Gag>Aag	p.E446K	TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.E530K|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.E445K|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.E443K	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	446	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						TCCATCTGCTCGTGGATCCAG	0.582																																						uc002zbb.2		NA																	0				ovary(2)|breast(1)	3						c.(1336-1338)GAG>AAG		transmembrane protease, serine 3 isoform 1							87.0	81.0	83.0					21																	43795836		2203	4300	6503	SO:0001583	missense	64699				cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity	g.chr21:43795836C>T	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.1336G>A	21.37:g.43795836C>T	ENSP00000291532:p.Glu446Lys		Somatic				TMPRSS3_uc002zay.2_Missense_Mutation_p.E203K|TMPRSS3_uc002zaz.2_Missense_Mutation_p.E319K|TMPRSS3_uc002zba.2_Missense_Mutation_p.E319K|TMPRSS3_uc002zbc.2_Missense_Mutation_p.E445K	p.E446K	NM_024022	NP_076927	WXS	Illumina HiSeq	Unspecified	P57727	TMPS3_HUMAN			12	1537	-			446			Peptidase S1.|Extracellular (Potential).		D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	c.1336G>A	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684825	0.47991	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399	T;D;D;T	0.81739	0.19;-1.53;-1.53;0.19	5.13	5.13	0.70059	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.141330	0.47093	D	0.000257	T	0.79581	0.4470	L	0.46741	1.465	0.27921	N	0.938253	D;P;D	0.67145	0.996;0.824;0.996	P;B;P	0.49301	0.606;0.295;0.557	T	0.74873	-0.3516	9	.	.	.	.	13.5622	0.61795	0.1556:0.8444:0.0:0.0	.	445;446;443	P57727-5;P57727;B7WPR2	.;TMPS3_HUMAN;.	K	446;445;443;530	ENSP00000291532:E446K;ENSP00000411013:E445K;ENSP00000381442:E443K;ENSP00000369762:E530K	.	E	-	1	0	TMPRSS3	42668905	0.769000	0.28531	1.000000	0.80357	0.989000	0.77384	1.339000	0.33885	2.395000	0.81488	0.650000	0.86243	GAG		0.582	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1			37	78	0	0	0	0	37	78				
ATP6V1E1	529	broad.mit.edu	37	22	18083871	18083871	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr22:18083871C>A	ENST00000253413.5	-	5	535	c.353G>T	c.(352-354)gGa>gTa	p.G118V	ATP6V1E1_ENST00000399798.2_Missense_Mutation_p.G96V|ATP6V1E1_ENST00000399796.2_Intron	NM_001696.3	NP_001687.1	P36543	VATE1_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1	118					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	10		all_epithelial(15;0.206)		Lung(27;0.19)		GAGAACCAGTCCATCCAGCAG	0.403																																						uc002zmr.1		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(352-354)GGA>GTA		vacuolar H+ ATPase E1 isoform a							231.0	196.0	208.0					22																	18083871		2203	4300	6503	SO:0001583	missense	529				cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|cytosol|endosome|proton-transporting two-sector ATPase complex, catalytic domain	protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr22:18083871C>A	X76228	CCDS13745.1, CCDS42977.1, CCDS42978.1	22q11.2	2010-04-21	2006-01-13	2002-06-21	ENSG00000131100	ENSG00000131100	3.6.3.14	"""ATPases / V-type"""	857	protein-coding gene	gene with protein product		108746	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1"""	ATP6E, ATP6V1E		8004105, 8250920	Standard	NM_001696		Approved	P31, Vma4, ATP6E2	uc002zmr.1	P36543	OTTHUMG00000059320	ENST00000253413.5:c.353G>T	22.37:g.18083871C>A	ENSP00000253413:p.Gly118Val		Somatic				ATP6V1E1_uc002zms.1_Intron|ATP6V1E1_uc002zmt.1_Missense_Mutation_p.G96V	p.G118V	NM_001696	NP_001687	WXS	Illumina HiSeq	Unspecified	P36543	VATE1_HUMAN		Lung(27;0.19)	5	540	-		all_epithelial(15;0.206)	118					A8MUE4|A8MUN4	Missense_Mutation	SNP	ENST00000253413.5	37	c.353G>T	CCDS13745.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.531035	0.64972	.	.	ENSG00000131100	ENST00000253413;ENST00000399798;ENST00000413576	.	.	.	4.8	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.81221	0.4777	M	0.90595	3.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.84538	0.0637	9	0.72032	D	0.01	-16.7218	12.5321	0.56122	0.0:0.8316:0.1684:0.0	.	96;118	A8MUE4;P36543	.;VATE1_HUMAN	V	118;96;119	.	ENSP00000253413:G118V	G	-	2	0	ATP6V1E1	16463871	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.842000	0.69417	1.114000	0.41781	-0.175000	0.13238	GGA		0.403	ATP6V1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131790.3	NM_001696		41	69	1	0	3.05e-18	3.25e-18	41	69				
SF3A1	10291	broad.mit.edu	37	22	30730681	30730681	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr22:30730681T>C	ENST00000215793.8	-	16	2438	c.2284A>G	c.(2284-2286)Atc>Gtc	p.I762V	SF3A1_ENST00000439242.1_Missense_Mutation_p.I697V	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	762	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TTGATGAAGATACCCTGGAAA	0.537																																						uc003ahl.2		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(2284-2286)ATC>GTC		splicing factor 3a, subunit 1, 120kDa isoform 1							132.0	111.0	118.0					22																	30730681		2203	4300	6503	SO:0001583	missense	10291				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding	g.chr22:30730681T>C	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.2284A>G	22.37:g.30730681T>C	ENSP00000215793:p.Ile762Val		Somatic					p.I762V	NM_005877	NP_005868	WXS	Illumina HiSeq	Unspecified	Q15459	SF3A1_HUMAN			16	2416	-			762			Ubiquitin-like.		E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	c.2284A>G	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329490	0.60743	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.73469	-0.75;-0.75	5.15	5.15	0.70609	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	T	0.74313	0.3700	L	0.39633	1.23	0.80722	D	1	B	0.21381	0.055	B	0.42462	0.388	T	0.67772	-0.5584	10	0.17369	T	0.5	-22.2029	15.2666	0.73666	0.0:0.0:0.0:1.0	.	762	Q15459	SF3A1_HUMAN	V	697;762;659	ENSP00000390336:I697V;ENSP00000215793:I762V	ENSP00000215793:I762V	I	-	1	0	SF3A1	29060681	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.978000	0.88095	2.080000	0.62538	0.459000	0.35465	ATC		0.537	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		26	46	0	0	0	0	26	46				
CSF2RB	1439	broad.mit.edu	37	22	37334191	37334191	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr22:37334191A>T	ENST00000403662.3	+	14	2563	c.2341A>T	c.(2341-2343)Agg>Tgg	p.R781W	CSF2RB_ENST00000406230.1_Missense_Mutation_p.R787W|CSF2RB_ENST00000536485.1_Missense_Mutation_p.R728W|CSF2RB_ENST00000262825.5_Missense_Mutation_p.R787W			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	781					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CAGGTCACCAAGGAACAATCC	0.652																																						uc003aqa.3		NA																	0				skin(2)|pancreas(1)	3						c.(2341-2343)AGG>TGG		colony stimulating factor 2 receptor, beta	Sargramostim(DB00020)						48.0	47.0	48.0					22																	37334191		2203	4300	6503	SO:0001583	missense	1439				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity	g.chr22:37334191A>T	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2341A>T	22.37:g.37334191A>T	ENSP00000384053:p.Arg781Trp		Somatic				CSF2RB_uc003aqc.3_Missense_Mutation_p.R787W	p.R781W	NM_000395	NP_000386	WXS	Illumina HiSeq	Unspecified	P32927	IL3RB_HUMAN			14	2558	+			781			Cytoplasmic (Potential).		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	c.2341A>T	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154698	0.38021	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.91792	-2.4;-2.91;-2.91;-2.91	5.38	-2.75	0.05914	.	2.550470	0.01519	N	0.018261	D	0.86301	0.5900	N	0.08118	0	0.09310	N	1	P;B	0.40515	0.719;0.149	B;B	0.42653	0.394;0.006	T	0.77576	-0.2536	10	0.66056	D	0.02	0.3874	13.3064	0.60355	0.125:0.2696:0.6054:0.0	.	787;781	P32927-2;P32927	.;IL3RB_HUMAN	W	781;781;787;787;728	ENSP00000384053:R781W;ENSP00000262825:R787W;ENSP00000385271:R787W;ENSP00000440003:R728W	ENSP00000262825:R787W	R	+	1	2	CSF2RB	35664137	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.398000	0.07259	-0.609000	0.05724	-1.326000	0.01283	AGG		0.652	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395		15	32	0	0	0	0	15	32				
WNT7B	7477	broad.mit.edu	37	22	46319005	46319005	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr22:46319005G>C	ENST00000339464.4	-	4	1155	c.781C>G	c.(781-783)Cag>Gag	p.Q261E	WNT7B_ENST00000409496.3_Missense_Mutation_p.Q265E|WNT7B_ENST00000410089.1_Missense_Mutation_p.Q245E	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	261					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		ATGGGCTTCTGATAGCTGCGC	0.647																																						uc003bgo.2		NA																	0				lung(1)	1						c.(781-783)CAG>GAG		wingless-type MMTV integration site family,							68.0	61.0	63.0					22																	46319005		2203	4300	6503	SO:0001583	missense	7477				activation of JUN kinase activity|anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|central nervous system vasculogenesis|chorio-allantoic fusion|developmental growth involved in morphogenesis|embryonic placenta morphogenesis|establishment or maintenance of polarity of embryonic epithelium|fibroblast proliferation|forebrain regionalization|inner medullary collecting duct development|lens fiber cell development|lobar bronchus development|lung epithelium development|lung morphogenesis|lung-associated mesenchyme development|mammary gland epithelium development|metanephric collecting duct development|metanephric loop of Henle development|metanephros morphogenesis|negative regulation of smoothened signaling pathway|outer medullary collecting duct development|oxygen homeostasis|positive regulation of JNK cascade|positive regulation of osteoblast differentiation|renal inner medulla development|renal outer medulla development|stem cell proliferation|synapse organization|trachea cartilage morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled binding|signal transducer activity	g.chr22:46319005G>C	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.781C>G	22.37:g.46319005G>C	ENSP00000341032:p.Gln261Glu		Somatic				WNT7B_uc010haa.2_Missense_Mutation_p.Q265E	p.Q261E	NM_058238	NP_478679	WXS	Illumina HiSeq	Unspecified	P56706	WNT7B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)	4	1155	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	261					B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	37	c.781C>G	CCDS33667.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469432	0.43839	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496	T;T;T	0.75821	-0.97;-0.91;-0.97	3.93	3.93	0.45458	.	0.076769	0.56097	U	0.000036	T	0.58595	0.2133	N	0.12471	0.22	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.004	T	0.59107	-0.7516	10	0.62326	D	0.03	.	14.9518	0.71080	0.0:0.0:1.0:0.0	.	265;261	A8K0G1;P56706	.;WNT7B_HUMAN	E	261;245;265	ENSP00000341032:Q261E;ENSP00000386781:Q245E;ENSP00000386546:Q265E	ENSP00000341032:Q261E	Q	-	1	0	WNT7B	44697669	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.397000	0.79903	1.746000	0.51805	0.561000	0.74099	CAG		0.647	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238		7	62	0	0	0	0	7	62				
BRPF1	7862	broad.mit.edu	37	3	9786777	9786777	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:9786777G>C	ENST00000457855.1	+	9	2999	c.2988G>C	c.(2986-2988)cgG>cgC	p.R996R	BRPF1_ENST00000302054.3_Silent_p.R996R|BRPF1_ENST00000433861.2_Silent_p.R901R|BRPF1_ENST00000424362.1_Silent_p.R995R|BRPF1_ENST00000383829.2_Silent_p.R1002R			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	996	Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					GCCTTCCCCGGAGCAGCTCAG	0.557																																						uc003bse.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2986-2988)CGG>CGC		bromodomain and PHD finger-containing protein 1							88.0	74.0	79.0					3																	9786777		2203	4300	6503	SO:0001819	synonymous_variant	7862				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding	g.chr3:9786777G>C	M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.2988G>C	3.37:g.9786777G>C			Somatic				BRPF1_uc003bsf.2_Silent_p.R1002R|BRPF1_uc003bsg.2_Silent_p.R995R|BRPF1_uc011ati.1_Silent_p.R901R	p.R996R	NM_004634	NP_004625	WXS	Illumina HiSeq	Unspecified	P55201	BRPF1_HUMAN			10	3387	+	Medulloblastoma(99;0.227)		996			Required for RUNX1 and RUNX2 transcriptional activation.		B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Silent	SNP	ENST00000457855.1	37	c.2988G>C	CCDS2575.1																																																																																				0.557	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694		11	18	0	0	0	0	11	18				
SLC6A1	6529	broad.mit.edu	37	3	11072889	11072889	+	Silent	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:11072889T>C	ENST00000287766.4	+	13	1771	c.1350T>C	c.(1348-1350)ttT>ttC	p.F450F	SLC6A1_ENST00000536032.1_Silent_p.F272F	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	450					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TCAAACTCTTTGACTACTACT	0.498																																						uc010hdq.2		NA																	0				ovary(1)|skin(1)	2						c.(1348-1350)TTT>TTC		solute carrier family 6 (neurotransmitter	Cocaine(DB00907)|Tiagabine(DB00906)						286.0	265.0	272.0					3																	11072889		2203	4300	6503	SO:0001819	synonymous_variant	6529				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity	g.chr3:11072889T>C		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.1350T>C	3.37:g.11072889T>C			Somatic					p.F450F	NM_003042	NP_003033	WXS	Illumina HiSeq	Unspecified	P30531	SC6A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	13	1761	+		Ovarian(110;0.0392)	450					Q8N4K8	Silent	SNP	ENST00000287766.4	37	c.1350T>C	CCDS2603.1																																																																																				0.498	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042		25	95	0	0	0	0	25	95				
C3orf20	84077	broad.mit.edu	37	3	14799082	14799082	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:14799082C>T	ENST00000253697.3	+	13	2597	c.2145C>T	c.(2143-2145)atC>atT	p.I715I	C3orf20_ENST00000435614.1_Silent_p.I593I|C3orf20_ENST00000412910.1_Silent_p.I593I	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	715						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TGTTTGGGATCATCTCAAGCC	0.637																																						uc003byy.2		NA																	0				ovary(3)|skin(1)	4						c.(2143-2145)ATC>ATT		hypothetical protein LOC84077							39.0	40.0	39.0					3																	14799082		2203	4300	6503	SO:0001819	synonymous_variant	84077					cytoplasm|integral to membrane		g.chr3:14799082C>T	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2145C>T	3.37:g.14799082C>T			Somatic				C3orf20_uc003byz.2_Silent_p.I593I|C3orf20_uc003bza.2_Silent_p.I593I|C3orf20_uc003bzb.1_Silent_p.I216I|C3orf20_uc011avj.1_Silent_p.I42I	p.I715I	NM_032137	NP_115513	WXS	Illumina HiSeq	Unspecified	Q8ND61	CC020_HUMAN			13	2549	+			715					Q7L0U6|Q8NCP2|Q9H0I7	Silent	SNP	ENST00000253697.3	37	c.2145C>T	CCDS33706.1																																																																																				0.637	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		4	28	0	0	0	0	4	28				
KAT2B	8850	broad.mit.edu	37	3	20181763	20181763	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:20181763C>G	ENST00000263754.4	+	13	2366	c.1911C>G	c.(1909-1911)atC>atG	p.I637M	MIR3135A_ENST00000578460.1_RNA	NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	637	N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						TTGGCTATATCAAGGATTATG	0.353																																						uc003cbq.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1909-1911)ATC>ATG		K(lysine) acetyltransferase 2B							76.0	78.0	77.0					3																	20181763		2203	4300	6503	SO:0001583	missense	8850				cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding	g.chr3:20181763C>G	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1911C>G	3.37:g.20181763C>G	ENSP00000263754:p.Ile637Met		Somatic					p.I637M	NM_003884	NP_003875	WXS	Illumina HiSeq	Unspecified	Q92831	KAT2B_HUMAN			13	2357	+			637			N-acetyltransferase.		Q6NSK1	Missense_Mutation	SNP	ENST00000263754.4	37	c.1911C>G	CCDS2634.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419866	0.62622	.	.	ENSG00000114166	ENST00000263754	T	0.50277	0.75	5.23	2.23	0.28157	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70988	-0.4722	10	0.87932	D	0	-20.1881	4.5635	0.12172	0.1545:0.5971:0.0:0.2484	.	637	Q92831	KAT2B_HUMAN	M	637	ENSP00000263754:I637M	ENSP00000263754:I637M	I	+	3	3	KAT2B	20156767	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.016000	0.40971	0.600000	0.29862	0.655000	0.94253	ATC		0.353	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884		5	44	0	0	0	0	5	44				
SCN11A	11280	broad.mit.edu	37	3	38888469	38888469	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:38888469C>G	ENST00000302328.3	-	26	5290	c.5092G>C	c.(5092-5094)Gat>Cat	p.D1698H	SCN11A_ENST00000456224.3_Missense_Mutation_p.D1660H|SCN11A_ENST00000450244.1_Missense_Mutation_p.D1698H	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1698					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTAGGCCATCAGAGCCACCG	0.453																																						uc011ays.1		NA																	0				skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(5092-5094)GAT>CAT		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						141.0	139.0	139.0					3																	38888469		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38888469C>G	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.5092G>C	3.37:g.38888469C>G	ENSP00000307599:p.Asp1698His		Somatic					p.D1698H	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	26	5291	-			1698					A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.5092G>C	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	6.355	0.433584	0.12045	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.96265	-3.96;-3.96;-3.91	5.46	-1.38	0.09027	.	1.415640	0.05625	U	0.580702	D	0.93262	0.7853	L	0.41492	1.28	0.09310	N	1	P	0.41748	0.761	B	0.35971	0.215	D	0.84670	0.0711	10	0.72032	D	0.01	.	13.7431	0.62860	0.0:0.8104:0.0:0.1896	.	1698	Q9UI33	SCNBA_HUMAN	H	1698;1698;1660	ENSP00000307599:D1698H;ENSP00000400945:D1698H;ENSP00000416757:D1660H	ENSP00000307599:D1698H	D	-	1	0	SCN11A	38863473	0.053000	0.20554	0.001000	0.08648	0.028000	0.11728	3.215000	0.51169	-0.533000	0.06323	-0.142000	0.14014	GAT		0.453	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		4	74	0	0	0	0	4	74				
SCN11A	11280	broad.mit.edu	37	3	38941542	38941542	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:38941542G>C	ENST00000302328.3	-	13	2063	c.1865C>G	c.(1864-1866)gCa>gGa	p.A622G	SCN11A_ENST00000444237.2_Missense_Mutation_p.A622G|SCN11A_ENST00000456224.3_Missense_Mutation_p.A622G|SCN11A_ENST00000450244.1_Missense_Mutation_p.A622G	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	622					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCACATTTCTGCTATAAAAAT	0.428																																						uc011ays.1		NA																	0				skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(1864-1866)GCA>GGA		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						64.0	66.0	65.0					3																	38941542		2203	4300	6503	SO:0001583	missense	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38941542G>C	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1865C>G	3.37:g.38941542G>C	ENSP00000307599:p.Ala622Gly		Somatic					p.A622G	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	13	2064	-			622			II.|Helical; Name=S2 of repeat II; (By similarity).		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	c.1865C>G	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059578	0.76074	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96	5.65	3.84	0.44239	Ion transport (1);	0.158528	0.56097	D	0.000030	D	0.96178	0.8754	L	0.53671	1.685	0.39081	D	0.960909	P	0.34757	0.467	B	0.33042	0.157	D	0.96400	0.9296	10	0.72032	D	0.01	.	11.2122	0.48806	0.2009:0.0:0.7991:0.0	.	622	Q9UI33	SCNBA_HUMAN	G	622	ENSP00000307599:A622G;ENSP00000400945:A622G;ENSP00000416757:A622G;ENSP00000408028:A622G	ENSP00000307599:A622G	A	-	2	0	SCN11A	38916546	1.000000	0.71417	0.994000	0.49952	0.944000	0.59088	3.955000	0.56715	1.523000	0.49018	0.650000	0.86243	GCA		0.428	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		3	19	0	0	0	0	3	19				
XCR1	2829	broad.mit.edu	37	3	46062824	46062824	+	Missense_Mutation	SNP	C	C	T	rs184118987	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:46062824C>T	ENST00000309285.3	-	2	972	c.616G>A	c.(616-618)Gtg>Atg	p.V206M	XCR1_ENST00000542109.1_Missense_Mutation_p.V206M	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	206					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		AGGATCTCCACGTAGCAGAAC	0.587																																						uc003cpe.2		NA																	0				ovary(1)	1						c.(616-618)GTG>ATG		XC chemokine receptor 1		C	MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	70.0	61.0	64.0		616,616	2.9	0.8	3		64	0,8600		0,0,4300	yes	missense,missense	XCR1	NM_001024644.1,NM_005283.2	21,21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	206/334,206/334	46062824	1,13005	2203	4300	6503	SO:0001583	missense	2829				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity	g.chr3:46062824C>T		CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.616G>A	3.37:g.46062824C>T	ENSP00000310405:p.Val206Met		Somatic				uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Missense_Mutation_p.V206M	p.V206M	NM_005283	NP_005274	WXS	Illumina HiSeq	Unspecified	P46094	XCR1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)	3	840	-			206			Helical; Name=5; (Potential).			Missense_Mutation	SNP	ENST00000309285.3	37	c.616G>A	CCDS2736.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.182168	0.38511	2.27E-4	0.0	ENSG00000173578	ENST00000309285;ENST00000542109	T;T	0.72394	-0.65;-0.65	5.72	2.92	0.33932	GPCR, rhodopsin-like superfamily (1);	0.648767	0.15138	N	0.278480	T	0.71710	0.3372	L	0.52759	1.655	0.09310	N	1	D	0.62365	0.991	P	0.58266	0.836	T	0.61461	-0.7058	10	0.87932	D	0	.	3.3934	0.07297	0.3094:0.4194:0.0:0.2712	.	206	P46094	XCR1_HUMAN	M	206	ENSP00000310405:V206M;ENSP00000438119:V206M	ENSP00000310405:V206M	V	-	1	0	XCR1	46037828	0.000000	0.05858	0.809000	0.32408	0.364000	0.29643	-1.406000	0.02490	1.406000	0.46857	0.650000	0.86243	GTG		0.587	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257322.2			9	12	0	0	0	0	9	12				
BSN	8927	broad.mit.edu	37	3	49699342	49699342	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:49699342C>G	ENST00000296452.4	+	6	10178	c.10064C>G	c.(10063-10065)tCa>tGa	p.S3355*		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3355					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCCATCTCCTCAAAGCGCAGC	0.572																																						uc003cxe.3		NA																	0				ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						c.(10063-10065)TCA>TGA		bassoon protein							49.0	54.0	52.0					3																	49699342		2203	4300	6503	SO:0001587	stop_gained	8927				synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding	g.chr3:49699342C>G	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10064C>G	3.37:g.49699342C>G	ENSP00000296452:p.Ser3355*		Somatic					p.S3355*	NM_003458	NP_003449	WXS	Illumina HiSeq	Unspecified	Q9UPA5	BSN_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)	6	10178	+			3355					O43161|Q7LGH3	Nonsense_Mutation	SNP	ENST00000296452.4	37	c.10064C>G	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	51	17.482096	0.99887	.	.	ENSG00000164061	ENST00000296452	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-13.6088	18.9713	0.92716	0.0:1.0:0.0:0.0	.	.	.	.	X	3355	.	ENSP00000296452:S3355X	S	+	2	0	BSN	49674346	1.000000	0.71417	0.768000	0.31515	0.995000	0.86356	5.920000	0.70017	2.574000	0.86865	0.561000	0.74099	TCA		0.572	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		3	29	0	0	0	0	3	29				
TEX264	51368	broad.mit.edu	37	3	51708516	51708516	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:51708516G>C	ENST00000415259.1	+	2	1277	c.196G>C	c.(196-198)Gag>Cag	p.E66Q	TEX264_ENST00000416589.1_Missense_Mutation_p.E66Q|TEX264_ENST00000395057.1_Missense_Mutation_p.E66Q|TEX264_ENST00000457573.1_Missense_Mutation_p.E66Q|TEX264_ENST00000341333.5_Missense_Mutation_p.E66Q			Q9Y6I9	TX264_HUMAN	testis expressed 264	66						extracellular vesicular exosome (GO:0070062)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		GCTTTTCACTGAGAGCTGCAG	0.587																																						uc010hls.2		NA																	0					0						c.(196-198)GAG>CAG		testis expressed 264 precursor							66.0	59.0	62.0					3																	51708516		2203	4300	6503	SO:0001583	missense	51368					extracellular region		g.chr3:51708516G>C	AF072733	CCDS2833.1, CCDS74945.1	3p21	2007-03-13	2007-03-13		ENSG00000164081	ENSG00000164081			30247	protein-coding gene	gene with protein product			"""testis expressed gene 264"", ""testis expressed sequence 264"""			12975309	Standard	NM_001243725		Approved	ZSIG11, FLJ13935	uc003dbm.4	Q9Y6I9	OTTHUMG00000156901	ENST00000415259.1:c.196G>C	3.37:g.51708516G>C	ENSP00000396628:p.Glu66Gln		Somatic				TEX264_uc003dbk.3_Missense_Mutation_p.E66Q|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Missense_Mutation_p.E66Q|TEX264_uc003dbm.3_Missense_Mutation_p.E105Q	p.E66Q	NM_001129884	NP_001123356	WXS	Illumina HiSeq	Unspecified	Q9Y6I9	TX264_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)	3	365	+			66					B3KN87|Q9UKD7	Missense_Mutation	SNP	ENST00000415259.1	37	c.196G>C	CCDS2833.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210444	0.79240	.	.	ENSG00000164081	ENST00000419358;ENST00000457573;ENST00000341333;ENST00000412249;ENST00000425781;ENST00000415259;ENST00000395057;ENST00000416589;ENST00000457927;ENST00000444233	T;T;T;T;T;T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45;3.45;3.45;3.45;3.45;3.45	5.23	4.34	0.51931	Regulatory factor, effector, bacterial (1);	0.103030	0.64402	N	0.000003	T	0.10423	0.0255	L	0.61387	1.9	0.52099	D	0.999945	P;B	0.36753	0.568;0.414	B;B	0.36608	0.229;0.168	T	0.02805	-1.1108	10	0.72032	D	0.01	-4.6443	14.7858	0.69803	0.0:0.145:0.855:0.0	.	66;66	Q53GI2;Q9Y6I9	.;TX264_HUMAN	Q	66	ENSP00000408989:E66Q;ENSP00000408186:E66Q;ENSP00000340969:E66Q;ENSP00000393736:E66Q;ENSP00000405783:E66Q;ENSP00000396628:E66Q;ENSP00000378497:E66Q;ENSP00000398802:E66Q;ENSP00000407151:E66Q;ENSP00000415957:E66Q	ENSP00000340969:E66Q	E	+	1	0	TEX264	51683556	1.000000	0.71417	0.826000	0.32828	0.984000	0.73092	7.980000	0.88113	1.182000	0.42928	0.561000	0.74099	GAG		0.587	TEX264-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346530.1	NM_015926		4	39	0	0	0	0	4	39				
RYBP	23429	broad.mit.edu	37	3	72428559	72428559	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:72428559G>A	ENST00000477973.2	-	2	442	c.443C>T	c.(442-444)tCa>tTa	p.S148L		NM_012234.5	NP_036366.3	Q8N488	RYBP_HUMAN	RING1 and YY1 binding protein	0	Interaction with E4TF1B.				apoptotic process (GO:0006915)|histone H2A monoubiquitination (GO:0035518)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			prostate(1)|upper_aerodigestive_tract(1)	2		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)		GCCACCAGCTGAGAATTGATC	0.388																																						uc003dpe.2		NA																	0					0						c.(148-150)CAG>TAG		RING1 and YY1 binding protein							78.0	72.0	74.0					3																	72428559		1836	4073	5909	SO:0001583	missense	23429				apoptosis|histone H2A monoubiquitination|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding	g.chr3:72428559G>A	AF179286		3p14.2	2008-07-18			ENSG00000163602	ENSG00000163602			10480	protein-coding gene	gene with protein product	"""YY1 and E4TF1 associated factor 1"", ""ring1 interactor RYBP"", ""apoptin-associating protein 1"", ""death effector domain-associated factor"""	607535				10369680	Standard	NM_012234		Approved	YEAF1, AAP1, DEDAF	uc003dpe.3	Q8N488	OTTHUMG00000159190	ENST00000477973.2:c.443C>T	3.37:g.72428559G>A	ENSP00000419494:p.Ser148Leu		Somatic					p.Q50*	NM_012234	NP_036366	WXS	Illumina HiSeq	Unspecified	Q8N488	RYBP_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)	2	265	-		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)	60					Q9P2W5|Q9UMW4	Nonsense_Mutation	SNP	ENST00000477973.2	37	c.148C>T		.	.	.	.	.	.	.	.	.	.	G	23.2	4.391211	0.82902	.	.	ENSG00000163602	ENST00000477973	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	D	0.82426	0.5034	.	.	.	.	.	.	.	.	.	.	.	.	T	0.83349	-0.0004	4	0.72032	D	0.01	-10.726	20.2441	0.98394	0.0:0.0:1.0:0.0	.	.	.	.	L	148	.	ENSP00000419494:S148L	S	-	2	0	RYBP	72511249	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.774000	0.95407	0.655000	0.94253	TCA		0.388	RYBP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353762.3	NM_012234		16	18	0	0	0	0	16	18				
DPPA2	151871	broad.mit.edu	37	3	109028157	109028157	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:109028157C>T	ENST00000478945.1	-	4	448	c.202G>A	c.(202-204)Gag>Aag	p.E68K		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	68					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTAAATTGCTCATTTGTTTGA	0.383																																						uc003dxo.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(202-204)GAG>AAG		developmental pluripotency associated 2							107.0	105.0	106.0					3																	109028157		2203	4300	6503	SO:0001583	missense	151871					nucleus	nucleic acid binding	g.chr3:109028157C>T	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.202G>A	3.37:g.109028157C>T	ENSP00000417710:p.Glu68Lys		Somatic					p.E68K	NM_138815	NP_620170	WXS	Illumina HiSeq	Unspecified	Q7Z7J5	DPPA2_HUMAN			4	449	-			68					Q8WVF0	Missense_Mutation	SNP	ENST00000478945.1	37	c.202G>A	CCDS2956.1	.	.	.	.	.	.	.	.	.	.	C	9.088	1.001113	0.19121	.	.	ENSG00000163530	ENST00000478945	T	0.36520	1.25	4.61	2.81	0.32909	.	0.382752	0.22185	N	0.063452	T	0.28134	0.0694	L	0.53249	1.67	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.12041	-1.0563	10	0.23891	T	0.37	-2.9474	6.486	0.22089	0.0:0.7871:0.0:0.2129	.	68	Q7Z7J5	DPPA2_HUMAN	K	68	ENSP00000417710:E68K	ENSP00000417710:E68K	E	-	1	0	DPPA2	110510847	0.000000	0.05858	0.022000	0.16811	0.034000	0.12701	0.119000	0.15626	1.313000	0.45069	-0.258000	0.10820	GAG		0.383	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815		5	112	0	0	0	0	5	112				
MUC13	56667	broad.mit.edu	37	3	124646819	124646819	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:124646819G>C	ENST00000311075.3	-	2	109	c.71C>G	c.(70-72)tCa>tGa	p.S24*	MUC13_ENST00000497378.1_5'UTR	NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	24					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						AGCATCAGCTGAGTTGCCTTG	0.428																																						uc003ehq.1		NA																	0					0						c.(70-72)TCA>TGA		mucin 13, epithelial transmembrane							117.0	101.0	107.0					3																	124646819		2203	4300	6503	SO:0001587	stop_gained	56667					extracellular region|integral to membrane|plasma membrane		g.chr3:124646819G>C	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.71C>G	3.37:g.124646819G>C	ENSP00000312235:p.Ser24*		Somatic					p.S24*	NM_033049	NP_149038	WXS	Illumina HiSeq	Unspecified	Q9H3R2	MUC13_HUMAN			2	95	-			24			Extracellular (Potential).		Q6UWD9|Q9NXT5	Nonsense_Mutation	SNP	ENST00000311075.3	37	c.71C>G		.	.	.	.	.	.	.	.	.	.	G	8.459	0.854976	0.17106	.	.	ENSG00000173702	ENST00000311075	.	.	.	1.44	-0.638	0.11500	.	3.118910	0.01272	N	0.009477	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0073	2.1226	0.03730	0.209:0.0:0.4876:0.3034	.	.	.	.	X	24	.	ENSP00000312235:S24X	S	-	2	0	MUC13	126129509	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.181000	0.09740	-0.227000	0.09884	-0.905000	0.02835	TCA		0.428	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049		5	110	0	0	0	0	5	110				
MSL2	55167	broad.mit.edu	37	3	135870295	135870295	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:135870295G>C	ENST00000309993.2	-	2	2160	c.1428C>G	c.(1426-1428)tgC>tgG	p.C476W	MSL2_ENST00000434835.2_Missense_Mutation_p.C402W	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	476					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						GTTGGCCTCGGCATGTAAGAA	0.478																																						uc003eqx.1		NA																	0				central_nervous_system(1)	1						c.(1426-1428)TGC>TGG		ring finger protein 184 isoform 1							64.0	62.0	63.0					3																	135870295		2203	4300	6503	SO:0001583	missense	55167				histone H4-K16 acetylation	MSL complex	zinc ion binding	g.chr3:135870295G>C	AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.1428C>G	3.37:g.135870295G>C	ENSP00000311827:p.Cys476Trp		Somatic				MSL2_uc011bmb.1_Missense_Mutation_p.C402W	p.C476W	NM_018133	NP_060603	WXS	Illumina HiSeq	Unspecified	Q9HCI7	MSL2_HUMAN			2	2161	-			476					B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	37	c.1428C>G	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.646724	0.47258	.	.	ENSG00000174579	ENST00000309993;ENST00000434835	.	.	.	5.86	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.66567	0.2802	M	0.83953	2.67	0.80722	D	1	D	0.59357	0.985	P	0.50934	0.654	T	0.69525	-0.5122	9	0.87932	D	0	-5.1236	9.1536	0.36978	0.0793:0.0:0.776:0.1447	.	476	Q9HCI7	MSL2_HUMAN	W	476;402	.	ENSP00000311827:C476W	C	-	3	2	MSL2	137352985	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	4.898000	0.63238	0.742000	0.32697	0.563000	0.77884	TGC		0.478	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133		21	48	0	0	0	0	21	48				
A4GNT	51146	broad.mit.edu	37	3	137850006	137850006	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:137850006G>C	ENST00000236709.3	-	2	294	c.93C>G	c.(91-93)ttC>ttG	p.F31L		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	31					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						AAGGCAAACAGAAGAGGCAGC	0.562																																						uc003ers.2		NA																	0				central_nervous_system(1)	1						c.(91-93)TTC>TTG		alpha-1,4-N-acetylglucosaminyltransferase							84.0	84.0	84.0					3																	137850006		2203	4300	6503	SO:0001583	missense	51146				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity	g.chr3:137850006G>C	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.93C>G	3.37:g.137850006G>C	ENSP00000236709:p.Phe31Leu		Somatic					p.F31L	NM_016161	NP_057245	WXS	Illumina HiSeq	Unspecified	Q9UNA3	A4GCT_HUMAN			2	295	-			31			Lumenal (Potential).		Q0VDK1|Q0VDK2	Missense_Mutation	SNP	ENST00000236709.3	37	c.93C>G	CCDS3097.1	.	.	.	.	.	.	.	.	.	.	G	7.429	0.638336	0.14386	.	.	ENSG00000118017	ENST00000236709	D	0.84800	-1.9	5.42	2.14	0.27477	.	0.243142	0.28847	N	0.013959	T	0.78407	0.4278	M	0.62723	1.935	0.25528	N	0.987301	B	0.14805	0.011	B	0.08055	0.003	T	0.58584	-0.7611	10	0.08179	T	0.78	-0.6241	9.7892	0.40695	0.2626:0.0:0.7374:0.0	.	31	Q9UNA3	A4GCT_HUMAN	L	31	ENSP00000236709:F31L	ENSP00000236709:F31L	F	-	3	2	A4GNT	139332696	1.000000	0.71417	0.298000	0.25002	0.492000	0.33523	1.631000	0.37092	0.630000	0.30394	0.561000	0.74099	TTC		0.562	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161		5	90	0	0	0	0	5	90				
COPB2	9276	broad.mit.edu	37	3	139093347	139093347	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:139093347G>A	ENST00000333188.5	-	7	916	c.735C>T	c.(733-735)atC>atT	p.I245I	COPB2_ENST00000507777.1_Silent_p.I216I	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	245					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						CTGAACCTGTGATAATGATTG	0.388																																						uc003etf.3		NA																	0				ovary(2)	2						c.(733-735)ATC>ATT		coatomer protein complex, subunit beta 2 (beta							178.0	162.0	168.0					3																	139093347		2203	4300	6503	SO:0001819	synonymous_variant	9276				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity	g.chr3:139093347G>A	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.735C>T	3.37:g.139093347G>A			Somatic				COPB2_uc011bmv.1_Silent_p.I216I|COPB2_uc010hui.2_Silent_p.I216I|COPB2_uc011bmw.1_Silent_p.I245I	p.I245I	NM_004766	NP_004757	WXS	Illumina HiSeq	Unspecified	P35606	COPB2_HUMAN			7	865	-			245			WD 6.		B4DZI8	Silent	SNP	ENST00000333188.5	37	c.735C>T	CCDS3108.1																																																																																				0.388	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766		33	72	0	0	0	0	33	72				
PTX3	5806	broad.mit.edu	37	3	157160376	157160376	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:157160376G>C	ENST00000295927.3	+	3	899	c.754G>C	c.(754-756)Gag>Cag	p.E252Q	VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000392832.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	252	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GGTGGGTGGAGAGGAGAACAA	0.488																																						uc003fbl.3		NA																	0				central_nervous_system(1)	1						c.(754-756)GAG>CAG		pentraxin 3 precursor							95.0	87.0	89.0					3																	157160376		2203	4300	6503	SO:0001583	missense	5806				inflammatory response	extracellular region		g.chr3:157160376G>C	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.754G>C	3.37:g.157160376G>C	ENSP00000295927:p.Glu252Gln		Somatic				VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	p.E252Q	NM_002852	NP_002843	WXS	Illumina HiSeq	Unspecified	P26022	PTX3_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		3	897	+			252			Pentaxin.		B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	37	c.754G>C	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.479173	0.63849	.	.	ENSG00000163661	ENST00000295927	T	0.58652	0.32	5.71	4.6	0.57074	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.246992	0.47455	D	0.000238	T	0.57873	0.2083	L	0.48642	1.525	0.37673	D	0.923218	P	0.52577	0.954	P	0.50590	0.645	T	0.59236	-0.7492	10	0.27082	T	0.32	-19.6591	12.2778	0.54747	0.101:0.0:0.899:0.0	.	252	P26022	PTX3_HUMAN	Q	252	ENSP00000295927:E252Q	ENSP00000295927:E252Q	E	+	1	0	PTX3	158643070	1.000000	0.71417	0.994000	0.49952	0.738000	0.42128	6.051000	0.71072	1.059000	0.40554	0.655000	0.94253	GAG		0.488	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852		39	78	0	0	0	0	39	78				
SI	6476	broad.mit.edu	37	3	164785231	164785231	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:164785231T>G	ENST00000264382.3	-	6	594	c.532A>C	c.(532-534)Aaa>Caa	p.K178Q		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	178	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTAAACTCTTTTACATACTGA	0.343										HNSCC(35;0.089)																												uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(532-534)AAA>CAA		sucrase-isomaltase	Acarbose(DB00284)						113.0	118.0	116.0					3																	164785231		2203	4298	6501	SO:0001583	missense	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164785231T>G	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.532A>C	3.37:g.164785231T>G	ENSP00000264382:p.Lys178Gln	HNSCC(35;0.089)	Somatic					p.K178Q	NM_001041	NP_001032	WXS	Illumina HiSeq	Unspecified	P14410	SUIS_HUMAN			6	594	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	178			Lumenal.|Isomaltase.		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	c.532A>C	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	t	0.016	-1.533281	0.00951	.	.	ENSG00000090402	ENST00000264382	T	0.14391	2.51	4.92	-5.22	0.02806	Glycoside hydrolase-type carbohydrate-binding (1);	0.706837	0.14960	N	0.288405	T	0.06645	0.0170	N	0.25992	0.78	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44065	-0.9352	10	0.10377	T	0.69	.	9.8655	0.41140	0.0:0.1219:0.5073:0.3708	.	178	P14410	SUIS_HUMAN	Q	178	ENSP00000264382:K178Q	ENSP00000264382:K178Q	K	-	1	0	SI	166267925	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.239000	0.02916	-0.623000	0.05618	-1.638000	0.00776	AAA		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		33	79	0	0	0	0	33	79				
PRKCI	5584	broad.mit.edu	37	3	170011198	170011198	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:170011198G>C	ENST00000295797.4	+	14	1624	c.1319G>C	c.(1318-1320)gGa>gCa	p.G440A		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	440	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	TGGGCTCTTGGAGTGCTCATG	0.393																																						uc003fgs.2		NA																	0				lung(2)|ovary(1)|breast(1)|skin(1)	5						c.(1318-1320)GGA>GCA		protein kinase C, iota							124.0	116.0	119.0					3																	170011198		2203	4300	6503	SO:0001583	missense	5584				anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding	g.chr3:170011198G>C		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.1319G>C	3.37:g.170011198G>C	ENSP00000295797:p.Gly440Ala		Somatic				PRKCI_uc003fgt.2_5'UTR	p.G440A	NM_002740	NP_002731	WXS	Illumina HiSeq	Unspecified	P41743	KPCI_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		14	1557	+	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		440			Protein kinase.		D3DNQ4|Q8WW06	Missense_Mutation	SNP	ENST00000295797.4	37	c.1319G>C	CCDS3212.2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545039	0.86022	.	.	ENSG00000163558	ENST00000295797	T	0.71461	-0.57	4.95	4.95	0.65309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85526	0.5717	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86667	0.1908	9	.	.	.	.	18.5633	0.91108	0.0:0.0:1.0:0.0	.	440	P41743	KPCI_HUMAN	A	440	ENSP00000295797:G440A	.	G	+	2	0	PRKCI	171493892	1.000000	0.71417	0.998000	0.56505	0.836000	0.47400	9.476000	0.97823	2.459000	0.83118	0.650000	0.86243	GGA		0.393	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740		21	71	0	0	0	0	21	71				
MCF2L2	23101	broad.mit.edu	37	3	182923993	182923993	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:182923993G>C	ENST00000328913.3	-	24	3019	c.2722C>G	c.(2722-2724)Ctt>Gtt	p.L908V	MCF2L2_ENST00000473233.1_Missense_Mutation_p.L908V|MCF2L2_ENST00000468976.1_5'UTR	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	908	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CGAATTGAAAGTGTCATCAGC	0.408																																						uc003fli.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)	5						c.(2722-2724)CTT>GTT		Rho family guanine-nucleotide exchange factor							126.0	114.0	118.0					3																	182923993		2203	4300	6503	SO:0001583	missense	23101				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity	g.chr3:182923993G>C	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2722C>G	3.37:g.182923993G>C	ENSP00000328118:p.Leu908Val		Somatic					p.L908V	NM_015078	NP_055893	WXS	Illumina HiSeq	Unspecified	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)		24	2812	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		908			PH.		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	c.2722C>G	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.724184	0.00694	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.11930	2.73;2.73	4.28	2.3	0.28687	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.172658	0.36815	N	0.002386	T	0.04770	0.0129	N	0.05351	-0.065	0.80722	D	1	B	0.17038	0.02	B	0.16289	0.015	T	0.31586	-0.9938	10	0.02654	T	1	.	6.6903	0.23167	0.0:0.1994:0.5946:0.206	.	908	Q86YR7	MF2L2_HUMAN	V	908	ENSP00000328118:L908V;ENSP00000420070:L908V	ENSP00000328118:L908V	L	-	1	0	MCF2L2	184406687	1.000000	0.71417	0.998000	0.56505	0.465000	0.32709	1.709000	0.37909	1.137000	0.42214	0.563000	0.77884	CTT		0.408	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078		8	95	0	0	0	0	8	95				
EIF4A2	1974	broad.mit.edu	37	3	186504984	186504984	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr3:186504984C>G	ENST00000323963.5	+	8	904	c.840C>G	c.(838-840)ctC>ctG	p.L280L	SNORA63_ENST00000363450.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363548.1_RNA|SNORD2_ENST00000459163.1_RNA|SNORA4_ENST00000584302.1_RNA|EIF4A2_ENST00000356531.5_Silent_p.L185L|EIF4A2_ENST00000440191.2_Silent_p.L281L			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	280	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TTATTTTTCTCAATACGAGGC	0.423			T	BCL6	NHL																																	uc003fqs.2		NA		Dom	yes		3	3q27.3	1974	T	"""eukaryotic translation initiation factor 4A, isoform 2"""			L	BCL6		NHL		0				ovary(2)|breast(2)	4						c.(838-840)CTC>CTG		eukaryotic translation initiation factor 4A2							107.0	107.0	107.0					3																	186504984		2203	4300	6503	SO:0001819	synonymous_variant	1974				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity	g.chr3:186504984C>G	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.840C>G	3.37:g.186504984C>G			Somatic				EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Silent_p.L281L|EIF4A2_uc003fqv.2_Silent_p.L185L|EIF4A2_uc003fqw.2_Silent_p.L185L|EIF4A2_uc011bsb.1_Silent_p.L153L|SNORA63_uc010hyw.1_5'Flank|SNORA4_uc010hyx.1_5'Flank	p.L280L	NM_001967	NP_001958	WXS	Illumina HiSeq	Unspecified	Q14240	IF4A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)	8	879	+	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		280			Helicase C-terminal.		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Silent	SNP	ENST00000323963.5	37	c.840C>G	CCDS3282.1																																																																																				0.423	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967		27	139	0	0	0	0	27	139				
ZNF595	152687	broad.mit.edu	37	4	59346	59346	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:59346G>A	ENST00000509152.2	+	2	212	c.27G>A	c.(25-27)gtG>gtA	p.V9V	ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_Silent_p.V9V			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	9	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TCAGGGATGTGGCCATAGAAT	0.413																																						uc003fzv.1		NA																	0					0						c.(25-27)GTG>GTA		zinc finger protein 595							361.0	389.0	380.0					4																	59346		2203	4300	6503	SO:0001819	synonymous_variant	152687				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr4:59346G>A	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.27G>A	4.37:g.59346G>A			Somatic				ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Silent_p.V9V|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_Intron	p.V9V	NM_182524	NP_872330	WXS	Illumina HiSeq	Unspecified	Q7Z3I0	Q7Z3I0_HUMAN		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)	2	183	+		all_cancers(4;0.0738)|all_epithelial(65;0.139)	9						Silent	SNP	ENST00000509152.2	37	c.27G>A																																																																																					0.413	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524		53	173	0	0	0	0	53	173				
JAKMIP1	152789	broad.mit.edu	37	4	6055779	6055779	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:6055779C>T	ENST00000282924.5	-	13	2289	c.1804G>A	c.(1804-1806)Gaa>Aaa	p.E602K	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.E417K|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.E602K|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.E437K|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.E602K	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	602	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCTCTTACTTCGAGTTCTAGC	0.403																																						uc003giu.3		NA																	0				large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						c.(1804-1806)GAA>AAA		janus kinase and microtubule interacting protein							220.0	208.0	212.0					4																	6055779		2203	4300	6503	SO:0001583	missense	152789				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding	g.chr4:6055779C>T	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1804G>A	4.37:g.6055779C>T	ENSP00000282924:p.Glu602Lys		Somatic				JAKMIP1_uc010idb.1_Missense_Mutation_p.E602K|JAKMIP1_uc010idc.1_Missense_Mutation_p.E417K|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Missense_Mutation_p.E437K|JAKMIP1_uc003giv.3_Missense_Mutation_p.E602K|JAKMIP1_uc010ide.2_3'UTR	p.E602K	NM_144720	NP_653321	WXS	Illumina HiSeq	Unspecified	Q96N16	JKIP1_HUMAN			13	2080	-			602			Mediates interaction with TYK2 and GABBR1.|Potential.		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	c.1804G>A	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	C	35	5.416067	0.96092	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.55052	1.34;0.86;1.03;1.03;0.54	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000009	T	0.74390	0.3710	M	0.79123	2.44	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.80764	0.991;0.994;0.994;0.994	T	0.77376	-0.2611	10	0.87932	D	0	.	18.4392	0.90658	0.0:1.0:0.0:0.0	.	437;417;602;602	B4DHZ8;Q96N16-5;Q96N16-2;Q96N16	.;.;.;JKIP1_HUMAN	K	602;417;494;602;602;437	ENSP00000386711:E602K;ENSP00000387042:E417K;ENSP00000282924:E602K;ENSP00000386925:E602K;ENSP00000386745:E437K	ENSP00000282924:E602K	E	-	1	0	JAKMIP1	6106680	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.425000	0.80255	2.593000	0.87608	0.655000	0.94253	GAA		0.403	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720		9	135	0	0	0	0	9	135				
MAN2B2	23324	broad.mit.edu	37	4	6606982	6606982	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:6606982G>A	ENST00000285599.3	+	11	1776	c.1740G>A	c.(1738-1740)ttG>ttA	p.L580L	MAN2B2_ENST00000504960.1_3'UTR|MAN2B2_ENST00000504248.1_Silent_p.L529L	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	580					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						GCAGGTACTTGGTGCCTGTGG	0.612																																						uc003gjf.1		NA																	0				ovary(2)	2						c.(1738-1740)TTG>TTA		mannosidase, alpha, class 2B, member 2							67.0	63.0	65.0					4																	6606982		2203	4300	6503	SO:0001819	synonymous_variant	23324				mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding	g.chr4:6606982G>A	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1740G>A	4.37:g.6606982G>A			Somatic				MAN2B2_uc003gje.1_Silent_p.L580L|MAN2B2_uc011bwf.1_Silent_p.L529L	p.L580L	NM_015274	NP_056089	WXS	Illumina HiSeq	Unspecified	Q9Y2E5	MA2B2_HUMAN			11	1776	+			580					Q66MP2|Q86T67	Silent	SNP	ENST00000285599.3	37	c.1740G>A	CCDS33951.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.294010	0.23564	.	.	ENSG00000013288	ENST00000505907	.	.	.	4.46	1.42	0.22433	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.247	6.6987	0.23213	0.1713:0.1472:0.6815:0.0	.	.	.	.	X	579	.	.	W	+	2	0	MAN2B2	6657883	0.669000	0.27502	0.141000	0.22245	0.463000	0.32649	0.362000	0.20284	0.857000	0.35407	0.491000	0.48974	TGG		0.612	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274		39	7	0	0	0	0	39	7				
SORCS2	57537	broad.mit.edu	37	4	7714493	7714493	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:7714493G>C	ENST00000507866.2	+	15	2011	c.1902G>C	c.(1900-1902)tgG>tgC	p.W634C	SORCS2_ENST00000329016.9_Missense_Mutation_p.W462C	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	634					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GCTCCGATTGGGAGCTGGTCA	0.597																																						uc003gkb.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1900-1902)TGG>TGC		VPS10 domain receptor protein SORCS 2 precursor							55.0	61.0	59.0					4																	7714493		2024	4203	6227	SO:0001583	missense	57537					integral to membrane	neuropeptide receptor activity	g.chr4:7714493G>C	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1902G>C	4.37:g.7714493G>C	ENSP00000422185:p.Trp634Cys		Somatic				SORCS2_uc011bwi.1_Missense_Mutation_p.W462C	p.W634C	NM_020777	NP_065828	WXS	Illumina HiSeq	Unspecified	Q96PQ0	SORC2_HUMAN			15	1902	+			634			Lumenal (Potential).		Q9P2L7	Missense_Mutation	SNP	ENST00000507866.2	37	c.1902G>C	CCDS47008.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906902	0.52333	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.46819	0.86;0.86	3.91	3.91	0.45181	VPS10 (1);	0.000000	0.64402	D	0.000001	T	0.73321	0.3572	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.80910	-0.1171	10	0.87932	D	0	.	14.8411	0.70226	0.0:0.0:1.0:0.0	.	462;634	B5MED8;Q96PQ0	.;SORC2_HUMAN	C	634;462	ENSP00000422185:W634C;ENSP00000329124:W462C	ENSP00000329124:W462C	W	+	3	0	SORCS2	7765393	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	7.660000	0.83776	1.992000	0.58205	0.563000	0.77884	TGG		0.597	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777		18	20	0	0	0	0	18	20				
NSUN7	79730	broad.mit.edu	37	4	40752793	40752793	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:40752793C>A	ENST00000381782.2	+	2	578	c.83C>A	c.(82-84)tCc>tAc	p.S28Y	NSUN7_ENST00000316607.5_Missense_Mutation_p.S28Y	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	28							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CTGCCTCTGTCCGGTGGGAAA	0.527																																						uc003gvj.3		NA																	0					0						c.(82-84)TCC>TAC		NOL1/NOP2/Sun domain family, member 7							80.0	77.0	78.0					4																	40752793		2203	4300	6503	SO:0001583	missense	79730							g.chr4:40752793C>A	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.83C>A	4.37:g.40752793C>A	ENSP00000371201:p.Ser28Tyr		Somatic				NSUN7_uc003gvh.2_Missense_Mutation_p.S28Y|NSUN7_uc003gvi.3_Missense_Mutation_p.S28Y	p.S28Y	NM_024677	NP_078953	WXS	Illumina HiSeq	Unspecified					2	578	+								C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	ENST00000381782.2	37	c.83C>A	CCDS3461.2	.	.	.	.	.	.	.	.	.	.	C	14.04	2.415941	0.42817	.	.	ENSG00000179299	ENST00000381782;ENST00000316607	T;T	0.22945	2.09;1.93	4.63	-0.291	0.12843	.	0.297499	0.24276	N	0.039947	T	0.30293	0.0760	L	0.60455	1.87	0.09310	N	1	P;B;P	0.51537	0.739;0.23;0.946	P;B;P	0.50825	0.448;0.073;0.651	T	0.16660	-1.0395	10	0.66056	D	0.02	-9.0521	8.4171	0.32678	0.2834:0.302:0.4146:0.0	.	28;28;28	Q8NE18;Q8NE18-2;Q8NE18-3	NSUN7_HUMAN;.;.	Y	28	ENSP00000371201:S28Y;ENSP00000319127:S28Y	ENSP00000319127:S28Y	S	+	2	0	NSUN7	40447550	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.530000	0.23036	-0.320000	0.08640	-0.463000	0.05309	TCC		0.527	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677		54	52	1	0	3.68e-26	3.96e-26	54	52				
FRYL	285527	broad.mit.edu	37	4	48581067	48581067	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:48581067G>C	ENST00000503238.1	-	20	2450	c.2451C>G	c.(2449-2451)caC>caG	p.H817Q	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.H817Q|FRYL_ENST00000358350.4_Missense_Mutation_p.H817Q|FRYL_ENST00000507711.1_Missense_Mutation_p.H817Q			O94915	FRYL_HUMAN	FRY-like	817					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CTGTAGAGCAGTGTTTAGGAA	0.393																																						uc003gyh.1		NA																	0				skin(1)	1						c.(2449-2451)CAC>CAG		furry-like							119.0	111.0	113.0					4																	48581067		1845	4094	5939	SO:0001583	missense	285527				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding	g.chr4:48581067G>C	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2451C>G	4.37:g.48581067G>C	ENSP00000426064:p.His817Gln		Somatic				FRYL_uc003gyk.2_Missense_Mutation_p.H817Q	p.H817Q	NM_015030	NP_055845	WXS	Illumina HiSeq	Unspecified	O94915	FRYL_HUMAN			23	3056	-			817					O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	c.2451C>G	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	G	9.103	1.004656	0.19199	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.43688	1.9;1.9;1.9;0.94	6.05	6.05	0.98169	.	0.133263	0.49916	U	0.000128	T	0.31071	0.0785	L	0.33624	1.015	0.80722	D	1	B;B	0.20550	0.046;0.002	B;B	0.21708	0.036;0.005	T	0.09100	-1.0690	10	0.07030	T	0.85	.	14.7216	0.69311	0.0686:0.0:0.9314:0.0	.	817;817	F2Z2S2;O94915	.;FRYL_HUMAN	Q	817	ENSP00000426064:H817Q;ENSP00000351113:H817Q;ENSP00000441114:H817Q;ENSP00000421584:H817Q	ENSP00000351113:H817Q	H	-	3	2	FRYL	48275824	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	1.615000	0.36922	2.866000	0.98385	0.650000	0.86243	CAC		0.393	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			40	62	0	0	0	0	40	62				
REST	5978	broad.mit.edu	37	4	57777137	57777137	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:57777137G>C	ENST00000309042.7	+	2	647	c.333G>C	c.(331-333)ctG>ctC	p.L111L		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	111	Interaction with SIN3A.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					ACATGGAACTGAGAAGTTTGG	0.433																																						uc003hch.2		NA																	0				skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9						c.(331-333)CTG>CTC		RE1-silencing transcription factor							68.0	67.0	68.0					4																	57777137		2203	4300	6503	SO:0001819	synonymous_variant	5978				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding	g.chr4:57777137G>C	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.333G>C	4.37:g.57777137G>C			Somatic				REST_uc003hci.2_Silent_p.L111L|REST_uc003hcj.1_Silent_p.L111L|REST_uc010ihf.2_5'UTR	p.L111L	NM_005612	NP_005603	WXS	Illumina HiSeq	Unspecified	Q13127	REST_HUMAN			2	680	+	Glioma(25;0.08)|all_neural(26;0.181)		111			Interaction with SIN3A.		A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Silent	SNP	ENST00000309042.7	37	c.333G>C	CCDS3509.1																																																																																				0.433	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612		19	56	0	0	0	0	19	56				
ENAM	10117	broad.mit.edu	37	4	71509397	71509397	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:71509397G>A	ENST00000396073.3	+	9	2535	c.2254G>A	c.(2254-2256)Gct>Act	p.A752T	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	752					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.A752T(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TAATAATGCCGCTGGACCAGA	0.453																																						uc011caw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(2254-2256)GCT>ACT		enamelin precursor							62.0	63.0	62.0					4																	71509397		2203	4300	6503	SO:0001583	missense	10117				bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel	g.chr4:71509397G>A	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2254G>A	4.37:g.71509397G>A	ENSP00000379383:p.Ala752Thr		Somatic					p.A752T	NM_031889	NP_114095	WXS	Illumina HiSeq	Unspecified	Q9NRM1	ENAM_HUMAN	Lung(101;0.235)		9	2535	+			752					Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	c.2254G>A	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	6.469	0.454700	0.12283	.	.	ENSG00000132464	ENST00000396073	T	0.30182	1.54	6.01	-6.31	0.02001	.	2.008630	0.02055	N	0.050351	T	0.14917	0.0360	N	0.08118	0	0.09310	N	1	B	0.32862	0.387	B	0.29440	0.102	T	0.25847	-1.0120	10	0.56958	D	0.05	0.8239	8.8622	0.35265	0.5697:0.0:0.3294:0.1009	.	752	Q9NRM1	ENAM_HUMAN	T	752	ENSP00000379383:A752T	ENSP00000379383:A752T	A	+	1	0	ENAM	71728261	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.369000	0.02578	-1.022000	0.03346	-0.137000	0.14449	GCT		0.453	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889		27	38	0	0	0	0	27	38				
MAPK10	5602	broad.mit.edu	37	4	87028405	87028405	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:87028405C>T	ENST00000359221.3	-	5	863	c.337G>A	c.(337-339)Gtc>Atc	p.V113I	MAPK10_ENST00000395157.3_5'UTR|MAPK10_ENST00000449047.2_5'UTR|MAPK10_ENST00000513839.1_5'UTR|MAPK10_ENST00000395160.3_5'UTR|MAPK10_ENST00000395166.1_Missense_Mutation_p.V75I|MAPK10_ENST00000395161.2_Missense_Mutation_p.V113I|MAPK10_ENST00000395169.3_Missense_Mutation_p.V75I|MAPK10_ENST00000361569.2_Missense_Mutation_p.V113I			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	113	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TTCATGAGGACCAGCTCCCGG	0.438																																						uc003hpq.2		NA																	0				stomach(1)|breast(1)|central_nervous_system(1)	3						c.(337-339)GTC>ATC		mitogen-activated protein kinase 10 isoform 2							129.0	123.0	125.0					4																	87028405		2203	4300	6503	SO:0001583	missense	5602				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding	g.chr4:87028405C>T	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.337G>A	4.37:g.87028405C>T	ENSP00000352157:p.Val113Ile		Somatic				MAPK10_uc010ikg.2_Missense_Mutation_p.V75I|MAPK10_uc003hpr.2_Missense_Mutation_p.V75I|MAPK10_uc003hps.2_Missense_Mutation_p.V113I|MAPK10_uc003hpt.2_Missense_Mutation_p.V113I|MAPK10_uc003hpu.2_Missense_Mutation_p.V113I|MAPK10_uc003hpv.2_5'UTR|MAPK10_uc010ikh.1_RNA|MAPK10_uc003hpo.2_5'UTR|MAPK10_uc011ccw.1_5'UTR|MAPK10_uc003hpp.2_5'UTR	p.V113I	NM_138982	NP_620448	WXS	Illumina HiSeq	Unspecified	P53779	MK10_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.002)	4	404	-		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)	113			Protein kinase.		A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	c.337G>A	CCDS34026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.01|19.01	3.743114|3.743114	0.69418|0.69418	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000515400|ENST00000395169;ENST00000359221;ENST00000361569;ENST00000395166;ENST00000395161;ENST00000512017;ENST00000512564;ENST00000511167;ENST00000511328	.|T;T;T;T;T;T;T;T;T	.|0.65364	.|-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	5.9|5.9	5.9|5.9	0.94986|0.94986	.|Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49575|0.49575	0.1565|0.1565	N|N	0.10733|0.10733	0.035|0.035	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.18013	.|0.007;0.007;0.025	.|B;B;B	.|0.27500	.|0.026;0.026;0.08	T|T	0.46442|0.46442	-0.9191|-0.9191	5|10	.|0.56958	.|D	.|0.05	-19.0153|-19.0153	20.2787|20.2787	0.98501|0.98501	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|75;113;113	.|P53779-3;P53779-2;P53779	.|.;.;MK10_HUMAN	D|I	25|75;113;113;75;113;113;75;113;113	.|ENSP00000378598:V75I;ENSP00000352157:V113I;ENSP00000355297:V113I;ENSP00000378595:V75I;ENSP00000378590:V113I;ENSP00000424755:V113I;ENSP00000422985:V75I;ENSP00000422277:V113I;ENSP00000421762:V113I	.|ENSP00000309857:V113I	G|V	-|-	2|1	0|0	MAPK10|MAPK10	87247429|87247429	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.818000|7.818000	0.86416|0.86416	2.798000|2.798000	0.96311|0.96311	0.650000|0.650000	0.86243|0.86243	GGT|GTC		0.438	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2			28	36	0	0	0	0	28	36				
SLC10A6	345274	broad.mit.edu	37	4	87754557	87754557	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:87754557G>A	ENST00000273905.6	-	2	545	c.398C>T	c.(397-399)tCc>tTc	p.S133F	SLC10A6_ENST00000505535.1_5'UTR	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	133					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		GGCCACGGTGGAACAGGTTGT	0.443																																						uc003hqd.2		NA																	0					0						c.(397-399)TCC>TTC		sodium-dependent organic anion transporter							123.0	123.0	123.0					4																	87754557		2203	4300	6503	SO:0001583	missense	345274					integral to membrane|plasma membrane	bile acid:sodium symporter activity	g.chr4:87754557G>A	AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.398C>T	4.37:g.87754557G>A	ENSP00000273905:p.Ser133Phe		Somatic					p.S133F	NM_197965	NP_932069	WXS	Illumina HiSeq	Unspecified	Q3KNW5	SOAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00099)	2	546	-		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)	133			Cytoplasmic (Potential).		Q70EX7	Missense_Mutation	SNP	ENST00000273905.6	37	c.398C>T	CCDS3614.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211962	0.79240	.	.	ENSG00000145283	ENST00000273905	T	0.19938	2.11	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000014	T	0.58850	0.2151	H	0.94542	3.55	0.51482	D	0.99992	D	0.89917	1.0	D	0.97110	1.0	T	0.71830	-0.4474	10	0.87932	D	0	-3.0558	16.0946	0.81112	0.0:0.0:1.0:0.0	.	133	Q3KNW5	SOAT_HUMAN	F	133	ENSP00000273905:S133F	ENSP00000273905:S133F	S	-	2	0	SLC10A6	87973581	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.662000	0.74426	2.406000	0.81754	0.655000	0.94253	TCC		0.443	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253043.2	NM_197965		19	61	0	0	0	0	19	61				
ADH4	127	broad.mit.edu	37	4	100048496	100048496	+	Splice_Site	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:100048496C>G	ENST00000265512.7	-	7	918		c.e7-1		ADH4_ENST00000423445.1_Splice_Site|ADH4_ENST00000508393.1_Splice_Site|ADH4_ENST00000505590.1_Splice_Site|RP11-696N14.1_ENST00000500358.2_RNA	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide						alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		GGGCTGCTTTCTGTGATGGAG	0.413																																						uc003hun.2		NA																	0				skin(2)	2						c.e7-1		class II alcohol dehydrogenase, pi subunit	NADH(DB00157)						62.0	61.0	61.0					4																	100048496		2203	4300	6503	SO:0001630	splice_region_variant	127				alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding	g.chr4:100048496C>G	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.844-1G>C	4.37:g.100048496C>G			Somatic				uc003hum.1_Intron|ADH4_uc011ced.1_Splice_Site_p.K301_splice	p.K282_splice	NM_000670	NP_000661	WXS	Illumina HiSeq	Unspecified	P08319	ADH4_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	7	920	-								A8K470|B4DIE7|C9J4A9|Q8TCD7	Splice_Site	SNP	ENST00000265512.7	37	c.844_splice	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157424	0.38119	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590	.	.	.	3.65	3.65	0.41850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1398	0.72601	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADH4	100267519	1.000000	0.71417	0.851000	0.33527	0.019000	0.09904	5.355000	0.66046	2.345000	0.79718	0.655000	0.94253	.		0.413	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	Intron	10	45	0	0	0	0	10	45				
KIAA1109	84162	broad.mit.edu	37	4	123160874	123160874	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:123160874C>G	ENST00000264501.4	+	29	4410	c.4037C>G	c.(4036-4038)tCt>tGt	p.S1346C	KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000455637.1_Missense_Mutation_p.S1346C|KIAA1109_ENST00000388738.3_Missense_Mutation_p.S1346C			Q2LD37	K1109_HUMAN	KIAA1109	1346					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGTGATGTCTCTCGAAGTGAT	0.433																																						uc003ieh.2		NA																	0				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(4036-4038)TCT>TGT		fragile site-associated protein							112.0	107.0	109.0					4																	123160874		1961	4144	6105	SO:0001583	missense	84162				regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus		g.chr4:123160874C>G	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4037C>G	4.37:g.123160874C>G	ENSP00000264501:p.Ser1346Cys		Somatic				KIAA1109_uc003iei.1_Missense_Mutation_p.S1099C|KIAA1109_uc010ins.1_Missense_Mutation_p.S689C|KIAA1109_uc003iek.2_5'UTR	p.S1346C	NM_015312	NP_056127	WXS	Illumina HiSeq	Unspecified	Q2LD37	K1109_HUMAN			27	4082	+			1346					Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	c.4037C>G	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285297	0.80803	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.32272	2.06;2.06;1.46	5.98	5.98	0.97165	.	0.000000	0.44902	U	0.000411	T	0.45796	0.1360	N	0.24115	0.695	0.58432	D	0.999994	D	0.76494	0.999	D	0.79784	0.993	T	0.43572	-0.9383	10	0.87932	D	0	.	20.4561	0.99145	0.0:1.0:0.0:0.0	.	1346	Q2LD37	K1109_HUMAN	C	1346	ENSP00000264501:S1346C;ENSP00000373390:S1346C;ENSP00000389925:S1346C	ENSP00000264501:S1346C	S	+	2	0	KIAA1109	123380324	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.368000	0.79567	2.843000	0.97960	0.650000	0.86243	TCT		0.433	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		6	129	0	0	0	0	6	129				
KIAA0922	23240	broad.mit.edu	37	4	154502640	154502640	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:154502640G>C	ENST00000409663.3	+	9	872	c.820G>C	c.(820-822)Gaa>Caa	p.E274Q	KIAA0922_ENST00000440693.1_Missense_Mutation_p.E274Q|KIAA0922_ENST00000409959.3_Missense_Mutation_p.E274Q	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	274						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				AAAAGAATTTGAAGAAAACAC	0.343																																						uc003inm.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(820-822)GAA>CAA		hypothetical protein LOC23240 isoform 2							121.0	117.0	118.0					4																	154502640		2203	4299	6502	SO:0001583	missense	23240					integral to membrane		g.chr4:154502640G>C	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.820G>C	4.37:g.154502640G>C	ENSP00000386574:p.Glu274Gln		Somatic				KIAA0922_uc010ipp.2_Missense_Mutation_p.E274Q|KIAA0922_uc010ipq.2_Missense_Mutation_p.E126Q	p.E274Q	NM_015196	NP_056011	WXS	Illumina HiSeq	Unspecified	A2VDJ0	T131L_HUMAN			9	872	+	all_hematologic(180;0.093)	Renal(120;0.118)	274			Extracellular (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	c.820G>C	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846798	0.71603	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.20200	2.31;2.09;2.31;2.09	5.86	5.02	0.67125	.	0.164390	0.53938	D	0.000055	T	0.32912	0.0845	L	0.29908	0.895	0.21473	N	0.999679	P;D;D	0.76494	0.454;0.999;0.999	B;D;P	0.65773	0.082;0.938;0.869	T	0.15263	-1.0443	10	0.40728	T	0.16	-18.3706	15.8182	0.78621	0.0:0.135:0.865:0.0	.	274;274;274	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	Q	274;274;274;135	ENSP00000386574:E274Q;ENSP00000409663:E274Q;ENSP00000386787:E274Q;ENSP00000240487:E135Q	ENSP00000240487:E135Q	E	+	1	0	KIAA0922	154722090	1.000000	0.71417	0.990000	0.47175	0.951000	0.60555	6.235000	0.72332	1.612000	0.50221	0.650000	0.86243	GAA		0.343	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		3	33	0	0	0	0	3	33				
SORBS2	8470	broad.mit.edu	37	4	186567862	186567862	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:186567862T>C	ENST00000284776.7	-	10	1153	c.644A>G	c.(643-645)tAt>tGt	p.Y215C	SORBS2_ENST00000319471.9_Missense_Mutation_p.Y301C|SORBS2_ENST00000393528.3_Missense_Mutation_p.Y261C|SORBS2_ENST00000355634.5_Missense_Mutation_p.Y315C|SORBS2_ENST00000449407.2_Missense_Mutation_p.Y286C|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000418609.1_Missense_Mutation_p.Y119C|SORBS2_ENST00000448662.2_Missense_Mutation_p.Y284C|SORBS2_ENST00000437304.2_Missense_Mutation_p.Y394C|SORBS2_ENST00000431808.1_Missense_Mutation_p.Y215C	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	215					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GCCAGGTTCATATTCAAAAAT	0.428																																					Esophageal Squamous(153;41 2433 9491 36028)	uc003iyl.2		NA																	0				ovary(1)	1						c.(643-645)TAT>TGT		sorbin and SH3 domain containing 2 isoform 2							111.0	111.0	111.0					4																	186567862		2203	4300	6503	SO:0001583	missense	8470					actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chr4:186567862T>C		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.644A>G	4.37:g.186567862T>C	ENSP00000284776:p.Tyr215Cys		Somatic				SORBS2_uc003iyh.2_Missense_Mutation_p.Y394C|SORBS2_uc011ckw.1_Missense_Mutation_p.Y284C|SORBS2_uc003iyi.2_Missense_Mutation_p.Y301C|SORBS2_uc011ckx.1_Missense_Mutation_p.Y261C|SORBS2_uc003iyk.2_Missense_Mutation_p.Y286C|SORBS2_uc003iym.2_Missense_Mutation_p.Y315C|SORBS2_uc003iyn.1_Missense_Mutation_p.Y261C|SORBS2_uc011cky.1_Missense_Mutation_p.Y278C|SORBS2_uc003iyp.2_Missense_Mutation_p.Y315C|SORBS2_uc011cku.1_Missense_Mutation_p.Y134C|SORBS2_uc011ckv.1_Missense_Mutation_p.Y119C|SORBS2_uc003iyd.2_Missense_Mutation_p.Y394C|SORBS2_uc003iye.2_Missense_Mutation_p.Y215C|SORBS2_uc003iya.2_Missense_Mutation_p.Y215C|SORBS2_uc003iyb.2_Missense_Mutation_p.Y215C|SORBS2_uc003iyc.2_Missense_Mutation_p.Y200C|SORBS2_uc003iyg.2_Missense_Mutation_p.Y301C|SORBS2_uc003iyf.2_Missense_Mutation_p.Y278C|SORBS2_uc003iyo.1_Missense_Mutation_p.Y119C	p.Y215C	NM_021069	NP_066547	WXS	Illumina HiSeq	Unspecified	O94875	SRBS2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)	10	1502	-		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)	215					A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	c.644A>G	CCDS3845.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	23.2|23.2|23.2	4.389553|4.389553|4.389553	0.82902|0.82902|0.82902	.|.|.	.|.|.	ENSG00000154556|ENSG00000154556|ENSG00000154556	ENST00000438278|ENST00000445625|ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000451974	.|.|T;T;T;T;T;T;T;T;T;T;T	.|.|0.37235	.|.|1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.25|5.25|5.25	5.25|5.25|5.25	0.73442|0.73442|0.73442	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.58949|0.58949|0.58949	0.2158|0.2158|0.2158	M|M|M	0.68317|0.68317|0.68317	2.08|2.08|2.08	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	.|.|0.89917	.|.|1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0	.|.|D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D	.|.|0.97110	.|.|0.998;0.999;0.995;0.998;0.998;1.0;0.998;0.999;0.998;0.999;0.894;0.997;0.995;0.991;0.999;0.999	T|T|T	0.62927|0.62927|0.62927	-0.6750|-0.6750|-0.6750	5|5|10	.|.|0.87932	.|.|D	.|.|0	-20.5539|-20.5539|-20.5539	15.324|15.324|15.324	0.74144|0.74144|0.74144	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|.|278;261;284;119;134;134;119;261;315;215;286;394;284;261;215;261	.|.|B7Z3D7;G3XAI0;C9JKV9;B7Z3X6;B7Z997;O94875-6;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2	.|.|.;.;.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.	M|V|C	158|113|215;284;215;119;394;301;286;315;261;261;72	.|.|ENSP00000284776:Y215C;ENSP00000409158:Y284C;ENSP00000411764:Y215C;ENSP00000397482:Y119C;ENSP00000396008:Y394C;ENSP00000322182:Y301C;ENSP00000397262:Y286C;ENSP00000347852:Y315C;ENSP00000377162:Y261C;ENSP00000321983:Y261C;ENSP00000401818:Y72C	.|.|ENSP00000284776:Y215C	I|M|Y	-|-|-	3|1|2	3|0|0	SORBS2|SORBS2|SORBS2	186804856|186804856|186804856	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.988000|0.988000|0.988000	0.76386|0.76386|0.76386	7.428000|7.428000|7.428000	0.80296|0.80296|0.80296	2.197000|2.197000|2.197000	0.70478|0.70478|0.70478	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	ATA|ATG|TAT		0.428	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603		26	12	0	0	0	0	26	12				
KLKB1	3818	broad.mit.edu	37	4	187173205	187173205	+	Silent	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:187173205A>G	ENST00000264690.6	+	11	1366	c.1179A>G	c.(1177-1179)ggA>ggG	p.G393G	KLKB1_ENST00000513864.1_Silent_p.G393G	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	393	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		GCATTGTTGGAGGAACAAACT	0.507																																						uc003iyy.2		NA																	0				ovary(1)	1						c.(1177-1179)GGA>GGG		plasma kallikrein B1 precursor							99.0	96.0	97.0					4																	187173205		2203	4300	6503	SO:0001819	synonymous_variant	3818				blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity	g.chr4:187173205A>G	M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1179A>G	4.37:g.187173205A>G			Somatic				KLKB1_uc011clc.1_Silent_p.G191G|KLKB1_uc011cld.1_Silent_p.G355G	p.G393G	NM_000892	NP_000883	WXS	Illumina HiSeq	Unspecified	P03952	KLKB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)	11	1250	+		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)	393			Peptidase S1.		A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Silent	SNP	ENST00000264690.6	37	c.1179A>G	CCDS34120.1	.	.	.	.	.	.	.	.	.	.	a	4.771	0.143278	0.09083	.	.	ENSG00000164344	ENST00000511608	.	.	.	5.58	-0.626	0.11544	.	.	.	.	.	T	0.39306	0.1073	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26087	-1.0113	4	.	.	.	.	0.7154	0.00931	0.4426:0.1175:0.2122:0.2277	.	.	.	.	G	441	.	.	E	+	2	0	KLKB1	187410199	0.891000	0.30450	0.996000	0.52242	0.301000	0.27625	0.048000	0.14078	0.068000	0.16574	0.524000	0.50904	GAG		0.507	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892		25	15	0	0	0	0	25	15				
LRRC14B	389257	broad.mit.edu	37	5	192316	192316	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:192316C>T	ENST00000328278.3	+	1	691	c.663C>T	c.(661-663)aaC>aaT	p.N221N		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	221										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						TGGTGCACAACGTGCGGCTGC	0.716																																						uc003jal.1		NA																	0				skin(1)	1						c.(661-663)AAC>AAT		leucine rich repeat containing 14B							10.0	13.0	12.0					5																	192316		2064	4192	6256	SO:0001819	synonymous_variant	389257							g.chr5:192316C>T		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.663C>T	5.37:g.192316C>T			Somatic					p.N221N	NM_001080478	NP_001073947	WXS	Illumina HiSeq	Unspecified	A6NHZ5	LR14B_HUMAN			1	691	+			221						Silent	SNP	ENST00000328278.3	37	c.663C>T	CCDS47184.1																																																																																				0.716	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478		3	4	0	0	0	0	3	4				
DNAH5	1767	broad.mit.edu	37	5	13885256	13885256	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:13885256G>A	ENST00000265104.4	-	19	2929	c.2825C>T	c.(2824-2826)aCg>aTg	p.T942M	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	942	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTTTTCCTCGTGACTGTCGT	0.423									Kartagener syndrome																													uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(2824-2826)ACG>ATG		dynein, axonemal, heavy chain 5							102.0	100.0	101.0					5																	13885256		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13885256G>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2825C>T	5.37:g.13885256G>A	ENSP00000265104:p.Thr942Met		Somatic					p.T942M	NM_001369	NP_001360	WXS	Illumina HiSeq	Unspecified	Q8TE73	DYH5_HUMAN			19	2867	-	Lung NSC(4;0.00476)		942			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.2825C>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416067	0.25552	.	.	ENSG00000039139	ENST00000265104	T	0.23950	1.88	5.73	-3.15	0.05233	.	1.706560	0.02551	N	0.095721	T	0.13200	0.0320	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.17349	-1.0372	10	0.46703	T	0.11	.	1.3233	0.02121	0.4601:0.1264:0.1897:0.2238	.	942	Q8TE73	DYH5_HUMAN	M	942	ENSP00000265104:T942M	ENSP00000265104:T942M	T	-	2	0	DNAH5	13938256	.	.	0.000000	0.03702	0.045000	0.14185	.	.	-0.568000	0.06038	-0.345000	0.07892	ACG		0.423	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		27	42	0	0	0	0	27	42				
RANBP3L	202151	broad.mit.edu	37	5	36265071	36265071	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:36265071G>T	ENST00000296604.3	-	6	955	c.470C>A	c.(469-471)aCa>aAa	p.T157K	RANBP3L_ENST00000515759.1_Missense_Mutation_p.T157K|RANBP3L_ENST00000502994.1_Missense_Mutation_p.T182K	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	157					intracellular transport (GO:0046907)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			CTTATTATTTGTTTTTTCTTT	0.418																																						uc003jkh.2		NA																	0				ovary(1)	1						c.(469-471)ACA>AAA		RAN binding protein 3-like isoform 2							175.0	183.0	180.0					5																	36265071		2203	4300	6503	SO:0001583	missense	202151				intracellular transport			g.chr5:36265071G>T	BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.470C>A	5.37:g.36265071G>T	ENSP00000296604:p.Thr157Lys		Somatic				RANBP3L_uc011cow.1_Missense_Mutation_p.T182K	p.T157K	NM_145000	NP_659437	WXS	Illumina HiSeq	Unspecified	Q86VV4	RNB3L_HUMAN	Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)		6	963	-	all_lung(31;4.52e-05)		157					B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	ENST00000296604.3	37	c.470C>A	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	G	8.760	0.923379	0.18056	.	.	ENSG00000164188	ENST00000296604;ENST00000502994;ENST00000515759	T;T;T	0.23348	1.93;1.94;1.91	5.68	-3.47	0.04753	.	1.751120	0.02530	N	0.093487	T	0.15392	0.0371	L	0.40543	1.245	0.09310	N	1	P;P	0.35656	0.514;0.454	B;B	0.27170	0.077;0.057	T	0.12451	-1.0547	10	0.13470	T	0.59	16.4076	4.8023	0.13303	0.4901:0.0:0.2437:0.2661	.	182;157	E9PGP9;Q86VV4	.;RNB3L_HUMAN	K	157;182;157	ENSP00000296604:T157K;ENSP00000421853:T182K;ENSP00000421149:T157K	ENSP00000296604:T157K	T	-	2	0	RANBP3L	36300828	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	0.270000	0.18607	-0.689000	0.05149	-0.781000	0.03364	ACA		0.418	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000		36	63	1	0	1.36e-19	1.45e-19	36	63				
RASA1	5921	broad.mit.edu	37	5	86672284	86672284	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:86672284A>G	ENST00000274376.6	+	16	2650	c.2086A>G	c.(2086-2088)Ata>Gta	p.I696V	RASA1_ENST00000506290.1_Missense_Mutation_p.I530V|RASA1_ENST00000456692.2_Missense_Mutation_p.I519V|CTC-428H11.2_ENST00000607486.1_RNA|RASA1_ENST00000512763.1_Missense_Mutation_p.I529V	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	696					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CAGCTCCCATATACCATTAAA	0.423																																						uc003kiw.2		NA																	0				upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5						c.(2086-2088)ATA>GTA		RAS p21 protein activator 1 isoform 1							100.0	96.0	97.0					5																	86672284		2203	4300	6503	SO:0001583	missense	5921				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding	g.chr5:86672284A>G		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2086A>G	5.37:g.86672284A>G	ENSP00000274376:p.Ile696Val		Somatic				RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Missense_Mutation_p.I519V|RASA1_uc011ctv.1_Missense_Mutation_p.I529V|RASA1_uc011ctw.1_Missense_Mutation_p.I530V|RASA1_uc010jaw.2_Missense_Mutation_p.I518V	p.I696V	NM_002890	NP_002881	WXS	Illumina HiSeq	Unspecified	P20936	RASA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)	16	2204	+		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)	696					B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	c.2086A>G	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	6.679	0.493864	0.12702	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48	5.54	5.54	0.83059	C2 calcium/lipid-binding domain, CaLB (1);	0.086431	0.50627	D	0.000119	T	0.42877	0.1222	N	0.02011	-0.69	0.38951	D	0.958342	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.001	T	0.43877	-0.9364	10	0.28530	T	0.3	.	10.3892	0.44158	0.9175:0.0:0.0825:0.0	.	530;529;530;519;696	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	V	696;729;519;529;530	ENSP00000274376:I696V;ENSP00000411221:I519V;ENSP00000422008:I529V;ENSP00000420905:I530V	ENSP00000274376:I696V	I	+	1	0	RASA1	86708040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.258000	0.58822	2.102000	0.63906	0.460000	0.39030	ATA		0.423	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890		6	24	0	0	0	0	6	24				
ARSK	153642	broad.mit.edu	37	5	94938983	94938983	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:94938983A>C	ENST00000380009.4	+	8	1569	c.1364A>C	c.(1363-1365)aAa>aCa	p.K455T		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	455					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		GTTGCTGTAAAATTTCCAGAA	0.308																																						uc003kld.2		NA																	0				pancreas(1)	1						c.(1363-1365)AAA>ACA		arylsulfatase K precursor							27.0	28.0	27.0					5																	94938983		2201	4292	6493	SO:0001583	missense	153642					extracellular region	arylsulfatase activity|metal ion binding	g.chr5:94938983A>C		CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1364A>C	5.37:g.94938983A>C	ENSP00000369346:p.Lys455Thr		Somatic				ARSK_uc010jbg.2_Missense_Mutation_p.K296T|ARSK_uc011cum.1_RNA	p.K455T	NM_198150	NP_937793	WXS	Illumina HiSeq	Unspecified	Q6UWY0	ARSK_HUMAN		all cancers(79;6.5e-16)	8	1522	+		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)	455					A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	ENST00000380009.4	37	c.1364A>C	CCDS4073.1	.	.	.	.	.	.	.	.	.	.	A	13.25	2.181371	0.38511	.	.	ENSG00000164291	ENST00000380009	D	0.99901	-7.65	5.3	2.81	0.32909	Alkaline-phosphatase-like, core domain (1);	0.249861	0.46145	D	0.000305	D	0.99146	0.9705	L	0.43152	1.355	0.58432	D	0.999997	B	0.29341	0.242	B	0.20767	0.031	D	0.99970	1.1990	10	0.41790	T	0.15	-11.0585	8.2154	0.31507	0.7907:0.1361:0.0732:0.0	.	455	Q6UWY0	ARSK_HUMAN	T	455	ENSP00000369346:K455T	ENSP00000369346:K455T	K	+	2	0	ARSK	94964739	0.997000	0.39634	0.829000	0.32907	0.978000	0.69477	1.389000	0.34453	2.123000	0.65237	0.533000	0.62120	AAA		0.308	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150		3	3	0	0	0	0	3	3				
TRIM36	55521	broad.mit.edu	37	5	114469606	114469606	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:114469606G>C	ENST00000282369.3	-	8	1606	c.1485C>G	c.(1483-1485)atC>atG	p.I495M	TRIM36_ENST00000514154.1_Missense_Mutation_p.I340M|TRIM36_ENST00000513154.1_Missense_Mutation_p.I483M	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	495	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		AAGGACTACAGATTGAACCCT	0.388																																						uc003kqs.2		NA																	0				ovary(4)|lung(2)|breast(2)	8						c.(1483-1485)ATC>ATG		tripartite motif-containing 36 isoform 1							106.0	98.0	101.0					5																	114469606		2202	4300	6502	SO:0001583	missense	55521					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding	g.chr5:114469606G>C	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.1485C>G	5.37:g.114469606G>C	ENSP00000282369:p.Ile495Met		Somatic				TRIM36_uc011cwc.1_Missense_Mutation_p.I483M|TRIM36_uc003kqt.2_Missense_Mutation_p.I340M	p.I495M	NM_018700	NP_061170	WXS	Illumina HiSeq	Unspecified	Q9NQ86	TRI36_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)	8	1994	-		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)	495			Fibronectin type-III.		A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	ENST00000282369.3	37	c.1485C>G	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	G	9.326	1.059296	0.19987	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	T;T;T	0.76448	-1.02;-1.02;-1.02	5.48	3.69	0.42338	Fibronectin, type III (3);B30.2/SPRY domain (1);Immunoglobulin-like fold (1);	0.368175	0.36519	N	0.002554	T	0.64918	0.2642	L	0.29908	0.895	0.80722	D	1	B;B	0.20368	0.024;0.044	B;B	0.19946	0.021;0.027	T	0.59968	-0.7354	10	0.66056	D	0.02	.	7.6518	0.28352	0.1403:0.0:0.7249:0.1347	.	483;495	E9PFI8;Q9NQ86	.;TRI36_HUMAN	M	495;483;340	ENSP00000282369:I495M;ENSP00000423934:I483M;ENSP00000424259:I340M	ENSP00000282369:I495M	I	-	3	3	TRIM36	114497505	0.998000	0.40836	0.970000	0.41538	0.985000	0.73830	0.734000	0.26101	0.676000	0.31285	-0.890000	0.02929	ATC		0.388	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700		7	38	0	0	0	0	7	38				
HSPA4	3308	broad.mit.edu	37	5	132427045	132427045	+	Silent	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:132427045T>C	ENST00000304858.2	+	12	1828	c.1539T>C	c.(1537-1539)gaT>gaC	p.D513D		NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	513					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGGAAACAGATCAGAATGCAA	0.438																																					Colon(114;1299 1588 6063 12302 48757)	uc003kyj.2		NA																	0				lung(1)|breast(1)	2						c.(1537-1539)GAT>GAC		heat shock 70kDa protein 4							103.0	102.0	102.0					5																	132427045		2203	4300	6503	SO:0001819	synonymous_variant	3308				cellular chaperone-mediated protein complex assembly|protein import into mitochondrial outer membrane|response to unfolded protein	cytoplasm|nucleus	ATP binding	g.chr5:132427045T>C	AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.1539T>C	5.37:g.132427045T>C			Somatic					p.D513D	NM_002154	NP_002145	WXS	Illumina HiSeq	Unspecified	P34932	HSP74_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		12	1820	+			513					O95756|Q2TAL4|Q9BUK9	Silent	SNP	ENST00000304858.2	37	c.1539T>C	CCDS4166.1																																																																																				0.438	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1	NM_002154, NM_198431		15	28	0	0	0	0	15	28				
PCDHB6	56130	broad.mit.edu	37	5	140531735	140531735	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:140531735G>A	ENST00000231136.1	+	1	1897	c.1897G>A	c.(1897-1899)Gca>Aca	p.A633T	PCDHB6_ENST00000543635.1_Missense_Mutation_p.A497T	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	633	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGCGAGACGCAGCCAAGCA	0.677																																						uc003lir.2		NA																	0				skin(1)	1						c.(1897-1899)GCA>ACA		protocadherin beta 6 precursor							35.0	38.0	37.0					5																	140531735		2097	4142	6239	SO:0001583	missense	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531735G>A	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1897G>A	5.37:g.140531735G>A	ENSP00000231136:p.Ala633Thr		Somatic				PCDHB6_uc011dah.1_Missense_Mutation_p.A497T	p.A633T	NM_018939	NP_061762	WXS	Illumina HiSeq	Unspecified	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1897	+			633			Cadherin 6.|Extracellular (Potential).		B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	c.1897G>A	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746952	0.30955	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.50001	0.76;0.76	4.51	4.51	0.55191	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.47544	0.1451	N	0.25789	0.76	0.20307	N	0.999917	D	0.60160	0.987	P	0.56612	0.802	T	0.32534	-0.9903	9	0.66056	D	0.02	.	8.8291	0.35074	0.1737:0.0:0.8263:0.0	.	633	Q9Y5E3	PCDB6_HUMAN	T	497;633	ENSP00000438466:A497T;ENSP00000231136:A633T	ENSP00000231136:A633T	A	+	1	0	PCDHB6	140511919	0.000000	0.05858	0.967000	0.41034	0.134000	0.20937	-0.351000	0.07711	2.223000	0.72356	0.556000	0.70494	GCA		0.677	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		9	26	0	0	0	0	9	26				
ARHGAP26	23092	broad.mit.edu	37	5	142500686	142500686	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:142500686G>C	ENST00000274498.4	+	18	2050	c.1672G>C	c.(1672-1674)Gag>Cag	p.E558Q	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.E558Q	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	558	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATTGTCATTGAGATCCTAAT	0.443																																						uc011dbj.1		NA																	0				ovary(1)	1						c.(1672-1674)GAG>CAG		GTPase regulator associated with the focal							123.0	114.0	117.0					5																	142500686		2203	4300	6503	SO:0001583	missense	23092				actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding	g.chr5:142500686G>C	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1672G>C	5.37:g.142500686G>C	ENSP00000274498:p.Glu558Gln		Somatic				ARHGAP26_uc003lmt.2_Missense_Mutation_p.E558Q|ARHGAP26_uc003lmw.2_Missense_Mutation_p.E558Q	p.E558Q	NM_015071	NP_055886	WXS	Illumina HiSeq	Unspecified	Q9UNA1	RHG26_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		18	1707	+		all_hematologic(541;0.0416)	558			Rho-GAP.		O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	c.1672G>C	CCDS4277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.746094|4.746094	0.89663|0.89663	.|.	.|.	ENSG00000145819|ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000418668|ENST00000443674;ENST00000418236	T;T|.	0.24723|.	1.84;1.84|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77922|0.77922	0.4203|0.4203	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.994|.	D;D;D|.	0.81914|.	0.972;0.995;0.939|.	T|T	0.77830|0.77830	-0.2442|-0.2442	10|5	0.72032|.	D|.	0.01|.	.|.	19.1627|19.1627	0.93541|0.93541	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	558;131;558|.	Q9UNA1;B3KT96;Q9UNA1-2|.	RHG26_HUMAN;.;.|.	Q|F	558;558;131|176;129	ENSP00000274498:E558Q;ENSP00000367243:E558Q|.	ENSP00000274498:E558Q|.	E|L	+|+	1|3	0|2	ARHGAP26|ARHGAP26	142480879|142480879	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.476000|9.476000	0.97823|0.97823	2.515000|2.515000	0.84797|0.84797	0.655000|0.655000	0.94253|0.94253	GAG|TTG		0.443	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071		10	35	0	0	0	0	10	35				
FBXO38	81545	broad.mit.edu	37	5	147807315	147807315	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:147807315C>G	ENST00000340253.5	+	15	2626	c.2458C>G	c.(2458-2460)Ctg>Gtg	p.L820V	CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000296701.6_Intron|FBXO38_ENST00000394370.3_Intron|FBXO38_ENST00000513826.1_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	820					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTAGGACTCTGCCACAAGG	0.577																																						uc003lpf.1		NA																	0				ovary(4)|skin(2)	6						c.(2458-2460)CTG>GTG		F-box protein 38 isoform b							45.0	44.0	44.0					5																	147807315		2203	4300	6503	SO:0001583	missense	81545					cytoplasm|nucleus		g.chr5:147807315C>G	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2458C>G	5.37:g.147807315C>G	ENSP00000342023:p.Leu820Val		Somatic				FBXO38_uc003lpg.1_Intron|FBXO38_uc003lph.2_Intron	p.L820V	NM_205836	NP_995308	WXS	Illumina HiSeq	Unspecified	Q6PIJ6	FBX38_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		15	2578	+			820					Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37	c.2458C>G		.	.	.	.	.	.	.	.	.	.	C	12.13	1.844399	0.32606	.	.	ENSG00000145868	ENST00000340253	T	0.32023	1.47	5.93	5.05	0.67936	.	0.400478	0.26673	N	0.023098	T	0.23766	0.0575	L	0.27053	0.805	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.02581	-1.1138	10	0.27082	T	0.32	-3.9867	15.7505	0.77983	0.0:0.8632:0.1368:0.0	.	820	Q6PIJ6	FBX38_HUMAN	V	820	ENSP00000342023:L820V	ENSP00000342023:L820V	L	+	1	2	FBXO38	147787508	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.085000	0.30840	1.480000	0.48289	0.655000	0.94253	CTG		0.577	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793		13	4	0	0	0	0	13	4				
FOXI1	2299	broad.mit.edu	37	5	169532981	169532981	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr5:169532981C>T	ENST00000306268.6	+	1	81	c.20C>T	c.(19-21)cCg>cTg	p.P7L	FOXI1_ENST00000449804.2_Missense_Mutation_p.P7L			Q12951	FOXI1_HUMAN	forkhead box I1	7	Pro-rich.				embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCGACCTGCCGGCGCCCTCC	0.697									Pendred syndrome																													uc003mai.3		NA																	0				breast(3)|central_nervous_system(1)	4						c.(19-21)CCG>CTG		forkhead box I1 isoform a							15.0	18.0	17.0					5																	169532981		2200	4293	6493	SO:0001583	missense	2299	Pendred_syndrome	Familial Cancer Database	Goiter-Deafness syndrome	epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr5:169532981C>T	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.20C>T	5.37:g.169532981C>T	ENSP00000304286:p.Pro7Leu		Somatic				FOXI1_uc003maj.3_Missense_Mutation_p.P7L	p.P7L	NM_012188	NP_036320	WXS	Illumina HiSeq	Unspecified	Q12951	FOXI1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		1	65	+	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	7			Pro-rich.		Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	c.20C>T	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661279	0.67700	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.94576	-3.33;-3.46	4.5	2.41	0.29592	.	0.356915	0.27486	N	0.019152	D	0.86260	0.5890	N	0.22421	0.69	0.49483	D	0.999797	P;P	0.43885	0.82;0.725	B;B	0.32928	0.155;0.074	D	0.83630	0.0144	10	0.38643	T	0.18	.	10.7774	0.46358	0.6628:0.3372:0.0:0.0	.	7;7	Q12951-2;Q12951	.;FOXI1_HUMAN	L	7	ENSP00000304286:P7L;ENSP00000415483:P7L	ENSP00000304286:P7L	P	+	2	0	FOXI1	169465559	0.623000	0.27094	0.926000	0.36857	0.989000	0.77384	1.409000	0.34680	0.850000	0.35239	0.491000	0.48974	CCG		0.697	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188		8	3	0	0	0	0	8	3				
HUS1B	135458	broad.mit.edu	37	6	656504	656504	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:656504C>T	ENST00000380907.2	-	1	459	c.441G>A	c.(439-441)ccG>ccA	p.P147P	EXOC2_ENST00000230449.4_Intron|EXOC2_ENST00000448181.3_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	147					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		GCAGGCTGGGCGGCAGGCAGT	0.716																																						uc003mtg.2		NA																	0					0						c.(439-441)CCG>CCA		HUS1 checkpoint protein B							22.0	26.0	25.0					6																	656504		2166	4231	6397	SO:0001819	synonymous_variant	135458							g.chr6:656504C>T	AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.441G>A	6.37:g.656504C>T			Somatic				EXOC2_uc003mtd.2_Intron|EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	p.P147P	NM_148959	NP_683762	WXS	Illumina HiSeq	Unspecified	Q8NHY5	HUS1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)	1	461	-	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)	147					Q5T4Z2	Silent	SNP	ENST00000380907.2	37	c.441G>A	CCDS4470.1																																																																																				0.716	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959		15	24	0	0	0	0	15	24				
DSP	1832	broad.mit.edu	37	6	7569532	7569532	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:7569532C>T	ENST00000379802.3	+	12	1874	c.1533C>T	c.(1531-1533)atC>atT	p.I511I	DSP_ENST00000418664.2_Silent_p.I511I	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	511	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.|SH3.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGGGGCTGATCATCCCTCCTC	0.577																																						uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(1531-1533)ATC>ATT		desmoplakin isoform I							160.0	131.0	141.0					6																	7569532		2203	4300	6503	SO:0001819	synonymous_variant	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7569532C>T	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1533C>T	6.37:g.7569532C>T			Somatic				DSP_uc003mxq.1_Silent_p.I511I	p.I511I	NM_004415	NP_004406	WXS	Illumina HiSeq	Unspecified	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	12	1812	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	511			Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	c.1533C>T	CCDS4501.1																																																																																				0.577	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		21	45	0	0	0	0	21	45				
MRS2	57380	broad.mit.edu	37	6	24409763	24409763	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:24409763A>G	ENST00000378386.3	+	4	469	c.376A>G	c.(376-378)Atc>Gtc	p.I126V	MRS2_ENST00000483634.1_Intron|MRS2_ENST00000274747.7_Intron|MRS2_ENST00000378353.1_Missense_Mutation_p.I126V|MRS2_ENST00000543597.1_5'UTR|MRS2_ENST00000443868.2_Missense_Mutation_p.I126V|MRS2_ENST00000535061.1_Intron	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	126						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						TGTAATGAGTATCACAGTCAG	0.313																																						uc003neb.2		NA																	0					0						c.(376-378)ATC>GTC		MRS2-like, magnesium homeostasis factor							89.0	91.0	90.0					6																	24409763		2203	4298	6501	SO:0001583	missense	57380				ion transport	integral to membrane|mitochondrial inner membrane		g.chr6:24409763A>G	AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.376A>G	6.37:g.24409763A>G	ENSP00000367637:p.Ile126Val		Somatic				MRS2_uc003nea.2_Missense_Mutation_p.I126V|MRS2_uc011djl.1_Missense_Mutation_p.I126V|MRS2_uc011djm.1_RNA|MRS2_uc011djn.1_Intron|MRS2_uc003nec.2_Missense_Mutation_p.I3V	p.I126V	NM_020662	NP_065713	WXS	Illumina HiSeq	Unspecified	Q9HD23	MRS2_HUMAN			4	498	+			126			Mitochondrial matrix (Potential).		A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Missense_Mutation	SNP	ENST00000378386.3	37	c.376A>G	CCDS4552.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.520494	0.44866	.	.	ENSG00000124532	ENST00000378386;ENST00000378353;ENST00000443868	T;T;T	0.61040	0.71;0.14;0.73	5.5	5.5	0.81552	.	0.120339	0.53938	D	0.000056	T	0.42921	0.1224	L	0.45051	1.395	0.80722	D	1	B;P;B	0.40638	0.222;0.725;0.374	B;B;B	0.41374	0.159;0.355;0.102	T	0.49771	-0.8904	10	0.52906	T	0.07	-26.609	15.9147	0.79503	1.0:0.0:0.0:0.0	.	126;126;126	B4DQL2;Q9HD23;Q9HD23-2	.;MRS2_HUMAN;.	V	126	ENSP00000367637:I126V;ENSP00000367604:I126V;ENSP00000399585:I126V	ENSP00000367604:I126V	I	+	1	0	MRS2	24517742	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.626000	0.61269	2.227000	0.72691	0.460000	0.39030	ATC		0.313	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040002.1			22	39	0	0	0	0	22	39				
FAM65B	9750	broad.mit.edu	37	6	24843781	24843781	+	Splice_Site	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:24843781G>C	ENST00000259698.4	-	14	1404	c.1229C>G	c.(1228-1230)tCa>tGa	p.S410*	FAM65B_ENST00000378023.4_Splice_Site_p.S360*|FAM65B_ENST00000538035.1_Splice_Site_p.S389*|FAM65B_ENST00000540914.1_Splice_Site_p.S360*|FAM65B_ENST00000510784.2_Splice_Site_p.S394*|FAM65B_ENST00000473070.1_5'Flank	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	410					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						AGGTAGATTTGACTATAGATA	0.413																																						uc003neo.1		NA																	0				ovary(1)	1						c.(1228-1230)TCA>TGA		hypothetical protein LOC9750 isoform 1							24.0	23.0	24.0					6																	24843781		1869	4098	5967	SO:0001630	splice_region_variant	9750				cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding	g.chr6:24843781G>C	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1228-1C>G	6.37:g.24843781G>C			Somatic				FAM65B_uc011djs.1_Nonsense_Mutation_p.S389*|FAM65B_uc011dju.1_Nonsense_Mutation_p.S394*|FAM65B_uc003nep.2_Nonsense_Mutation_p.S360*|FAM65B_uc011djt.1_Nonsense_Mutation_p.S360*	p.S410*	NM_014722	NP_055537	WXS	Illumina HiSeq	Unspecified	Q9Y4F9	FA65B_HUMAN			14	1405	-			410					A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Nonsense_Mutation	SNP	ENST00000259698.4	37	c.1229C>G	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	G	31	5.087518	0.94100	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	.	.	.	4.17	4.17	0.49024	.	0.165377	0.56097	D	0.000035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-7.0225	17.0107	0.86405	0.0:0.0:1.0:0.0	.	.	.	.	X	410;389;360;360;394	.	ENSP00000259698:S410X	S	-	2	0	FAM65B	24951760	1.000000	0.71417	0.899000	0.35326	0.235000	0.25334	8.924000	0.92827	2.305000	0.77605	0.561000	0.74099	TCA		0.413	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		Nonsense_Mutation	3	17	0	0	0	0	3	17				
HIST1H4C	8364	broad.mit.edu	37	6	26104378	26104378	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:26104378G>C	ENST00000377803.2	+	1	275	c.203G>C	c.(202-204)cGa>cCa	p.R68P		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	68					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R68P(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						AACGTTATTCGAGACGCCGTC	0.527																																						uc003ngi.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(202-204)CGA>CCA		histone cluster 1, H4c							74.0	66.0	69.0					6																	26104378		2203	4300	6503	SO:0001583	missense	8364				CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26104378G>C	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.203G>C	6.37:g.26104378G>C	ENSP00000367034:p.Arg68Pro		Somatic					p.R68P	NM_003542	NP_003533	WXS	Illumina HiSeq	Unspecified	P62805	H4_HUMAN			1	203	+			68					A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377803.2	37	c.203G>C	CCDS4583.1	.	.	.	.	.	.	.	.	.	.	.	17.67	3.445966	0.63178	.	.	ENSG00000197061	ENST00000377803	T	0.69306	-0.39	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.75332	0.3835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78981	-0.1989	7	0.87932	D	0	.	16.8557	0.86005	0.0:0.0:1.0:0.0	.	.	.	.	P	68	ENSP00000367034:R68P	ENSP00000367034:R68P	R	+	2	0	HIST1H4C	26212357	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	9.657000	0.98554	2.533000	0.85409	0.555000	0.69702	CGA		0.527	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542		9	29	0	0	0	0	9	29				
BRPF3	27154	broad.mit.edu	37	6	36193116	36193116	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:36193116G>C	ENST00000357641.6	+	11	3507	c.3254G>C	c.(3253-3255)cGa>cCa	p.R1085P	BRPF3_ENST00000543502.1_Missense_Mutation_p.R815P|BRPF3_ENST00000534400.1_Intron|BRPF3_ENST00000534694.1_Missense_Mutation_p.R751P|BRPF3_ENST00000443324.2_Missense_Mutation_p.R751P|BRPF3_ENST00000339717.7_Missense_Mutation_p.R815P	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1085	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GCCAAGTGCCGAGGCTACCCC	0.642																																						uc003olv.3		NA																	0				ovary(1)|skin(1)	2						c.(3253-3255)CGA>CCA		bromodomain and PHD finger containing, 3							62.0	61.0	61.0					6																	36193116		2203	4300	6503	SO:0001583	missense	27154				histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding	g.chr6:36193116G>C	AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.3254G>C	6.37:g.36193116G>C	ENSP00000350267:p.Arg1085Pro		Somatic				BRPF3_uc010jwb.2_Missense_Mutation_p.R815P|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_Intron|BRPF3_uc011dtk.1_Missense_Mutation_p.R751P|BRPF3_uc010jwd.2_5'UTR	p.R1085P	NM_015695	NP_056510	WXS	Illumina HiSeq	Unspecified	Q9ULD4	BRPF3_HUMAN			11	3478	+			1085			PWWP.		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	37	c.3254G>C	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	G	34	5.382142	0.95967	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	6.04	6.04	0.98038	PWWP (3);	0.000000	0.64402	D	0.000001	T	0.52240	0.1722	M	0.70595	2.14	0.49915	D	0.999837	D;D;D	0.89917	0.993;0.999;1.0	D;D;D	0.91635	0.992;0.997;0.999	T	0.48670	-0.9015	10	0.59425	D	0.04	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	751;815;1085	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	P	1085;815;751;815;751	ENSP00000350267:R1085P;ENSP00000345419:R815P;ENSP00000434501:R751P;ENSP00000445352:R815P;ENSP00000387368:R751P	ENSP00000345419:R815P	R	+	2	0	BRPF3	36301094	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.873000	0.98535	0.561000	0.74099	CGA		0.642	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695		4	26	0	0	0	0	4	26				
KIF6	221458	broad.mit.edu	37	6	39311516	39311516	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:39311516G>C	ENST00000287152.7	-	22	2491	c.2397C>G	c.(2395-2397)atC>atG	p.I799M	KIF6_ENST00000373216.3_Missense_Mutation_p.I782M|KIF6_ENST00000229913.5_Missense_Mutation_p.I250M|KIF6_ENST00000541946.1_Missense_Mutation_p.I250M|KIF6_ENST00000538893.1_Missense_Mutation_p.I743M|KIF6_ENST00000373213.4_Missense_Mutation_p.I638M|KIF6_ENST00000394362.1_Missense_Mutation_p.I233M|KIF6_ENST00000373215.3_Missense_Mutation_p.I782M	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	799					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GTCTGGCCTTGATGAAGGCGA	0.582																																						uc003oot.2		NA																	0				breast(2)|central_nervous_system(1)	3						c.(2395-2397)ATC>ATG		kinesin family member 6							170.0	120.0	137.0					6																	39311516		2203	4300	6503	SO:0001583	missense	221458				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding	g.chr6:39311516G>C	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.2397C>G	6.37:g.39311516G>C	ENSP00000287152:p.Ile799Met		Somatic				KIF6_uc003oos.2_Missense_Mutation_p.I250M|KIF6_uc010jwz.1_Missense_Mutation_p.I174M|KIF6_uc010jxa.1_Missense_Mutation_p.I573M|KIF6_uc011dua.1_Missense_Mutation_p.I782M|KIF6_uc010jxb.1_Missense_Mutation_p.I743M	p.I799M	NM_145027	NP_659464	WXS	Illumina HiSeq	Unspecified	Q6ZMV9	KIF6_HUMAN			22	2492	-			799					Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	c.2397C>G	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.33|13.33	2.204472|2.204472	0.38905|0.38905	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000373215;ENST00000538893;ENST00000541946|ENST00000458470	T;T;T;T;T;T;T;T|.	0.75589|.	-0.87;1.2;-0.87;-0.72;1.2;-0.89;-0.95;1.15|.	4.91|4.91	4.03|4.03	0.46877|0.46877	.|.	.|.	.|.	.|.	.|.	T|.	0.34164|.	0.0888|.	L|L	0.44542|0.44542	1.39|1.39	0.33745|0.33745	D|D	0.619975|0.619975	P;P;P;P|.	0.43701|.	0.815;0.815;0.815;0.718|.	P;P;B;B|.	0.45681|.	0.49;0.49;0.413;0.295|.	T|.	0.18871|.	-1.0323|.	9|.	0.87932|.	D|.	0|.	.|.	9.4362|9.4362	0.38639|0.38639	0.1013:0.0:0.8987:0.0|0.1013:0.0:0.8987:0.0	.|.	782;743;782;799|.	E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9|.	.;.;.;KIF6_HUMAN|.	M|X	799;233;782;638;250;782;743;250|674	ENSP00000287152:I799M;ENSP00000377889:I233M;ENSP00000362312:I782M;ENSP00000362309:I638M;ENSP00000229913:I250M;ENSP00000362311:I782M;ENSP00000441435:I743M;ENSP00000439064:I250M|.	ENSP00000229913:I250M|.	I|S	-|-	3|2	3|0	KIF6|KIF6	39419494|39419494	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.383000|0.383000	0.30230|0.30230	1.558000|1.558000	0.36309|0.36309	1.025000|1.025000	0.39708|0.39708	0.462000|0.462000	0.41574|0.41574	ATC|TCA		0.582	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027		15	35	0	0	0	0	15	35				
HSP90AB1	3326	broad.mit.edu	37	6	44216418	44216418	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:44216418C>G	ENST00000371554.1	+	2	266	c.52C>G	c.(52-54)Cag>Gag	p.Q18E	HSP90AB1_ENST00000371646.5_Missense_Mutation_p.Q18E|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.Q18E			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	18					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)	p.Q18*(2)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTTTGCCTTTCAGGCAGAAAT	0.423																																						uc003oxa.1		NA																	2	Substitution - Nonsense(2)	p.Q18*(1)	urinary_tract(1)|lung(1)	lung(3)|breast(1)	4						c.(52-54)CAG>GAG		heat shock 90kDa protein 1, beta							149.0	147.0	148.0					6																	44216418		2203	4300	6503	SO:0001583	missense	3326				axon guidance|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of nitric oxide biosynthetic process|protein folding|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to unfolded protein	cytosol|melanosome	ATP binding|nitric-oxide synthase regulator activity|TPR domain binding|unfolded protein binding	g.chr6:44216418C>G	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.52C>G	6.37:g.44216418C>G	ENSP00000360609:p.Gln18Glu		Somatic				HSP90AB1_uc011dvr.1_Missense_Mutation_p.Q18E|HSP90AB1_uc003oxb.1_Missense_Mutation_p.Q18E|HSP90AB1_uc011dvs.1_5'UTR|HSP90AB1_uc003oxc.1_5'Flank	p.Q18E	NM_007355	NP_031381	WXS	Illumina HiSeq	Unspecified	P08238	HS90B_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		2	136	+	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		18					B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	37	c.52C>G	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671570	0.67928	.	.	ENSG00000096384	ENST00000441736;ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.76448	-1.02;-1.02;-1.02	4.26	3.37	0.38596	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.091706	0.46442	U	0.000295	T	0.78830	0.4345	M	0.88979	2.995	0.80722	D	1	P;P	0.49961	0.487;0.93	B;P	0.47376	0.052;0.545	T	0.83277	-0.0040	10	0.87932	D	0	-20.1785	13.5607	0.61788	0.1571:0.8429:0.0:0.0	.	18;18	B4DGL0;P08238	.;HS90B_HUMAN	E	18	ENSP00000360709:Q18E;ENSP00000325875:Q18E;ENSP00000360609:Q18E	ENSP00000325875:Q18E	Q	+	1	0	HSP90AB1	44324396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.805000	0.86005	0.898000	0.36418	0.505000	0.49811	CAG		0.423	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355		15	115	0	0	0	0	15	115				
ELOVL5	60481	broad.mit.edu	37	6	53156755	53156755	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:53156755C>G	ENST00000542638.1	-	3	512	c.65G>C	c.(64-66)aGa>aCa	p.R22T	ELOVL5_ENST00000304434.6_Missense_Mutation_p.R22T|ELOVL5_ENST00000541407.1_Missense_Mutation_p.R22T|ELOVL5_ENST00000486973.1_5'UTR|ELOVL5_ENST00000370918.4_Missense_Mutation_p.R22T			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5	22					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					TCCTTTTACTCTAGTATCTGa	0.279																																						uc003pbq.1		NA																	0					0						c.(64-66)AGA>ACA		elongation of very long chain fatty acids-like							56.0	59.0	58.0					6																	53156755		2203	4299	6502	SO:0001583	missense	60481				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding	g.chr6:53156755C>G	AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.65G>C	6.37:g.53156755C>G	ENSP00000440728:p.Arg22Thr		Somatic				ELOVL5_uc003pbr.1_Missense_Mutation_p.R22T|ELOVL5_uc011dwx.1_Missense_Mutation_p.R22T|ELOVL5_uc003pbs.1_Missense_Mutation_p.R22T	p.R22T	NM_021814	NP_068586	WXS	Illumina HiSeq	Unspecified	Q9NYP7	ELOV5_HUMAN			3	513	-	Lung NSC(77;0.116)		22					B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Missense_Mutation	SNP	ENST00000542638.1	37	c.65G>C	CCDS4951.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805315	0.90623	.	.	ENSG00000012660	ENST00000370918;ENST00000304434;ENST00000542638;ENST00000541407	T;T;T;T	0.31510	1.58;1.72;1.72;1.49	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.66257	0.2771	H	0.95114	3.625	0.80722	D	1	D;P;D	0.89917	1.0;0.931;1.0	D;P;D	0.91635	0.999;0.688;0.999	T	0.75139	-0.3423	10	0.62326	D	0.03	-8.7056	20.3593	0.98849	0.0:1.0:0.0:0.0	.	22;22;22	F6SH78;B3KWH9;Q9NYP7	.;.;ELOV5_HUMAN	T	22	ENSP00000359956:R22T;ENSP00000306640:R22T;ENSP00000440728:R22T;ENSP00000438095:R22T	ENSP00000306640:R22T	R	-	2	0	ELOVL5	53264714	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.324000	0.79115	2.807000	0.96579	0.591000	0.81541	AGA		0.279	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043566.1	NM_021814		30	26	0	0	0	0	30	26				
DOPEY1	23033	broad.mit.edu	37	6	83863897	83863897	+	Splice_Site	SNP	A	A	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:83863897A>T	ENST00000349129.2	+	33	6649		c.e33-1		DOPEY1_ENST00000484282.1_Splice_Site|DOPEY1_ENST00000369739.3_Splice_Site|DOPEY1_ENST00000237163.5_Splice_Site	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1						protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TATCTCTTTCAGTTGGAGAGC	0.363																																						uc003pjs.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.e33-2		dopey family member 1							140.0	135.0	137.0					6																	83863897		2203	4300	6503	SO:0001630	splice_region_variant	23033				protein transport			g.chr6:83863897A>T	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6390-1A>T	6.37:g.83863897A>T			Somatic				DOPEY1_uc011dyy.1_Splice_Site_p.H2121_splice|DOPEY1_uc010kbl.1_Splice_Site_p.H2121_splice|DOPEY1_uc003pjt.2_Splice_Site	p.H2130_splice	NM_015018	NP_055833	WXS	Illumina HiSeq	Unspecified	Q5JWR5	DOP1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.053)	33	6650	+		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)						Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Splice_Site	SNP	ENST00000349129.2	37	c.6390_splice	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.232613	0.58777	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1194	0.72429	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOPEY1	83920616	1.000000	0.71417	0.997000	0.53966	0.636000	0.38137	8.900000	0.92551	1.975000	0.57531	0.455000	0.32223	.		0.363	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	Intron	23	39	0	0	0	0	23	39				
TSPYL4	23270	broad.mit.edu	37	6	116574228	116574228	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:116574228T>C	ENST00000420283.1	-	1	1033	c.944A>G	c.(943-945)tAt>tGt	p.Y315C	DSE_ENST00000540275.1_5'Flank|RP3-486I3.7_ENST00000448740.2_lincRNA	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	315					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		TCTGCGTTCATATTCCTTGAC	0.552																																						uc003pwn.2		NA																	0					0						c.(943-945)TAT>TGT		TSPY-like 4							79.0	79.0	79.0					6																	116574228		1934	4168	6102	SO:0001583	missense	23270				nucleosome assembly	nucleus		g.chr6:116574228T>C		CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.944A>G	6.37:g.116574228T>C	ENSP00000410943:p.Tyr315Cys		Somatic				DSE_uc011ebf.1_5'Flank|TSPYL4_uc011ebe.1_Missense_Mutation_p.Y143C|uc003pwo.1_5'Flank	p.Y315C	NM_021648	NP_067680	WXS	Illumina HiSeq	Unspecified	Q9UJ04	TSYL4_HUMAN		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)	1	1034	-		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)	315					B4DYQ2|O94828|Q96GW8	Missense_Mutation	SNP	ENST00000420283.1	37	c.944A>G	CCDS5106.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242146	0.58995	.	.	ENSG00000187189	ENST00000420283	T	0.39406	1.08	3.98	3.98	0.46160	.	0.000000	0.29722	U	0.011366	T	0.61489	0.2351	M	0.91612	3.225	0.37763	D	0.926384	D	0.89917	1.0	D	0.83275	0.996	T	0.70026	-0.4985	10	0.87932	D	0	-5.3515	9.586	0.39517	0.0:0.0:0.0:1.0	.	315	Q9UJ04	TSYL4_HUMAN	C	315	ENSP00000410943:Y315C	ENSP00000410943:Y315C	Y	-	2	0	TSPYL4	116680921	1.000000	0.71417	0.974000	0.42286	0.808000	0.45660	2.760000	0.47581	2.035000	0.60131	0.379000	0.24179	TAT		0.552	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041934.2			17	29	0	0	0	0	17	29				
GRM1	2911	broad.mit.edu	37	6	146673517	146673517	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:146673517G>C	ENST00000282753.1	+	4	1553	c.1318G>C	c.(1318-1320)Gat>Cat	p.D440H	GRM1_ENST00000361719.2_Missense_Mutation_p.D440H|GRM1_ENST00000507907.1_Missense_Mutation_p.D440H|GRM1_ENST00000392299.2_Missense_Mutation_p.D440H|GRM1_ENST00000355289.4_Missense_Mutation_p.D440H|GRM1_ENST00000492807.2_Missense_Mutation_p.D440H			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	440					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GGGCCTCTGCGATGCCATGAA	0.547																																						uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(1318-1320)GAT>CAT		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						173.0	158.0	163.0					6																	146673517		2203	4300	6503	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146673517G>C	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1318G>C	6.37:g.146673517G>C	ENSP00000282753:p.Asp440His		Somatic				GRM1_uc010khv.1_Missense_Mutation_p.D440H|GRM1_uc003qll.2_Missense_Mutation_p.D440H|GRM1_uc011edz.1_Missense_Mutation_p.D440H|GRM1_uc011eea.1_Missense_Mutation_p.D440H	p.D440H	NM_000838	NP_000829	WXS	Illumina HiSeq	Unspecified	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	5	1788	+		Ovarian(120;0.0387)	440			Extracellular (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.1318G>C	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	33	5.240669	0.95240	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12;-2.12;-2.12	5.84	5.84	0.93424	Extracellular ligand-binding receptor (1);	0.099120	0.64402	D	0.000002	D	0.90793	0.7109	L	0.52364	1.645	0.80722	D	1	D;D;D	0.61080	0.957;0.989;0.976	P;D;P	0.66847	0.861;0.947;0.861	D	0.90764	0.4667	10	0.72032	D	0.01	.	20.1379	0.98040	0.0:0.0:1.0:0.0	.	440;440;440	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	H	440	ENSP00000354896:D440H;ENSP00000376119:D440H;ENSP00000424095:D440H;ENSP00000282753:D440H;ENSP00000347437:D440H;ENSP00000425599:D440H	ENSP00000282753:D440H	D	+	1	0	GRM1	146715210	1.000000	0.71417	0.966000	0.40874	0.936000	0.57629	9.869000	0.99810	2.779000	0.95612	0.655000	0.94253	GAT		0.547	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		10	89	0	0	0	0	10	89				
PNLDC1	154197	broad.mit.edu	37	6	160222146	160222146	+	Splice_Site	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:160222146C>G	ENST00000610273.1	+	3	274	c.103C>G	c.(103-105)Ctt>Gtt	p.L35V	PNLDC1_ENST00000609334.1_3'UTR|PNLDC1_ENST00000392167.3_Splice_Site_p.L46V	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	35						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TGTTCACAGTCTTTTTGATTT	0.483																																						uc003qsx.1		NA																	0					0						c.(103-105)CTT>GTT		poly(A)-specific ribonuclease (PARN)-like domain							230.0	209.0	216.0					6																	160222146		2203	4300	6503	SO:0001630	splice_region_variant	154197					integral to membrane|nucleus	nucleic acid binding	g.chr6:160222146C>G	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.102-1C>G	6.37:g.160222146C>G			Somatic				PNLDC1_uc003qsy.1_Missense_Mutation_p.L46V	p.L35V	NM_173516	NP_775787	WXS	Illumina HiSeq	Unspecified	Q8NA58	PNDC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)	3	274	+		Breast(66;0.00519)|Ovarian(120;0.123)	35			Cytoplasmic (Potential).		Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	c.103C>G	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354591	0.61293	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	T;T	0.22134	1.97;1.97	5.0	5.0	0.66597	Ribonuclease H-like (1);	0.000000	0.49305	D	0.000154	T	0.26448	0.0646	M	0.70595	2.14	0.36679	D	0.878924	D;D	0.63046	0.972;0.992	P;D	0.63597	0.673;0.916	T	0.05716	-1.0868	10	0.19590	T	0.45	.	10.1615	0.42855	0.0:0.8616:0.0:0.1384	.	46;35	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	V	35;46	ENSP00000275275:L35V;ENSP00000376007:L46V	ENSP00000275275:L35V	L	+	1	0	PNLDC1	160142136	0.998000	0.40836	0.965000	0.40720	0.985000	0.73830	2.496000	0.45346	2.495000	0.84180	0.650000	0.86243	CTT		0.483	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	Missense_Mutation	5	117	0	0	0	0	5	117				
MAP3K4	4216	broad.mit.edu	37	6	161469773	161469773	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:161469773C>G	ENST00000392142.4	+	3	617	c.469C>G	c.(469-471)Cgt>Ggt	p.R157G	MAP3K4_ENST00000348824.7_Missense_Mutation_p.R157G|MAP3K4_ENST00000366919.2_Missense_Mutation_p.R157G|MAP3K4_ENST00000366920.2_Missense_Mutation_p.R157G|MAP3K4_ENST00000446500.1_3'UTR	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	157			R -> H (in dbSNP:rs4559074). {ECO:0000269|PubMed:15489334}.		activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGAGCGTGATCGTAAAAAAAA	0.403																																						uc003qtn.2		NA																	0				ovary(3)|lung(3)|skin(2)|stomach(1)	9						c.(469-471)CAT>GAT		mitogen-activated protein kinase kinase kinase 4							115.0	116.0	116.0					6																	161469773		2203	4300	6503	SO:0001583	missense	4216				activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr6:161469773C>G	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.469C>G	6.37:g.161469773C>G	ENSP00000375986:p.Arg157Gly		Somatic				MAP3K4_uc010kkc.1_Missense_Mutation_p.R157G|MAP3K4_uc003qto.2_Missense_Mutation_p.H157D|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Translation_Start_Site	p.H157D	NM_005922	NP_005913	WXS	Illumina HiSeq	Unspecified	Q9Y6R4	M3K4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)	3	611	+		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)	157					A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	c.469C>G	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.790080	0.31685	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.33527	0.0866	N	0.08118	0	0.23926	N	0.996444	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.09840	-1.0656	10	0.29301	T	0.29	-21.185	20.4171	0.99027	0.0:1.0:0.0:0.0	.	157;157	Q9Y6R4-2;Q9Y6R4	.;M3K4_HUMAN	G	157	ENSP00000355886:R157G;ENSP00000375986:R157G;ENSP00000355887:R157G;ENSP00000297332:R157G	ENSP00000297332:R157G	R	+	1	0	MAP3K4	161389763	1.000000	0.71417	0.758000	0.31321	0.675000	0.39556	2.894000	0.48640	2.832000	0.97577	0.585000	0.79938	CGT		0.403	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3			7	75	0	0	0	0	7	75				
DLL1	28514	broad.mit.edu	37	6	170592437	170592437	+	Missense_Mutation	SNP	C	C	T	rs187849210	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr6:170592437C>T	ENST00000366756.3	-	9	2263	c.1930G>A	c.(1930-1932)Gtg>Atg	p.V644M		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	644					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		AGGTCCTGCACGAGGTTATAG	0.627													C|||	2	0.000399361	0.0	0.0	5008	,	,		15119	0.002		0.0	False		,,,				2504	0.0					uc003qxm.2		NA																	0				lung(4)|ovary(1)	5						c.(1930-1932)GTG>ATG		delta-like 1 precursor							154.0	127.0	136.0					6																	170592437		2203	4300	6503	SO:0001583	missense	28514				cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding	g.chr6:170592437C>T	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1930G>A	6.37:g.170592437C>T	ENSP00000355718:p.Val644Met		Somatic					p.V644M	NM_005618	NP_005609	WXS	Illumina HiSeq	Unspecified	O00548	DLL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)	9	2400	-		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)	644			Cytoplasmic (Potential).		B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	ENST00000366756.3	37	c.1930G>A	CCDS5313.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.36	1.913901	0.33815	.	.	ENSG00000198719	ENST00000366756	D	0.87029	-2.2	5.53	2.77	0.32553	.	0.178675	0.48286	N	0.000182	D	0.82912	0.5140	M	0.77103	2.36	0.43503	D	0.995759	D	0.57257	0.979	P	0.47251	0.542	T	0.81780	-0.0776	10	0.54805	T	0.06	.	9.5267	0.39169	0.0:0.7459:0.1226:0.1315	.	644	O00548	DLL1_HUMAN	M	644	ENSP00000355718:V644M	ENSP00000355718:V644M	V	-	1	0	DLL1	170434362	1.000000	0.71417	0.073000	0.20177	0.561000	0.35649	3.351000	0.52232	0.378000	0.24764	-0.126000	0.14955	GTG		0.627	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1			28	57	0	0	0	0	28	57				
ETV1	2115	broad.mit.edu	37	7	14027742	14027742	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:14027742G>A	ENST00000430479.1	-	4	769	c.102C>T	c.(100-102)ttC>ttT	p.F34F	ETV1_ENST00000405192.2_Silent_p.F34F|ETV1_ENST00000343495.5_Silent_p.F34F|ETV1_ENST00000405358.4_Silent_p.F48F|ETV1_ENST00000476720.2_5'Flank|ETV1_ENST00000399357.3_5'Flank|ETV1_ENST00000420159.2_5'Flank|ETV1_ENST00000405218.2_Silent_p.F34F|ETV1_ENST00000242066.5_Silent_p.F34F|ETV1_ENST00000403527.1_5'Flank|ETV1_ENST00000403685.1_Silent_p.F34F	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	34					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CTCTGTTAATGAATTTTCTTT	0.378			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																	uc011jxq.1		NA		Dom	yes		7	7p22	2115	T	ets variant gene 1			"""M, E"""	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3		Ewing sarcoma|prostate	TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	0				prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						c.(100-102)TTC>TTT		ets variant gene 1 isoform a							144.0	149.0	147.0					7																	14027742		2182	4286	6468	SO:0001819	synonymous_variant	2115				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:14027742G>A		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.102C>T	7.37:g.14027742G>A			Somatic				ETV1_uc011jxn.1_5'Flank|ETV1_uc011jxo.1_5'Flank|ETV1_uc011jxp.1_5'Flank|ETV1_uc003ssw.3_Silent_p.F34F|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Silent_p.F34F|ETV1_uc011jxs.1_Silent_p.F34F|ETV1_uc010ktv.2_5'Flank	p.F34F	NM_004956	NP_004947	WXS	Illumina HiSeq	Unspecified	P50549	ETV1_HUMAN			4	841	-			34					A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Silent	SNP	ENST00000430479.1	37	c.102C>T	CCDS55088.1																																																																																				0.378	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956		4	36	0	0	0	0	4	36				
DNAH11	8701	broad.mit.edu	37	7	21745088	21745088	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:21745088T>G	ENST00000409508.3	+	39	6510	c.6479T>G	c.(6478-6480)cTt>cGt	p.L2160R	DNAH11_ENST00000328843.6_Missense_Mutation_p.L2167R	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2167	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GTTGTCCAGCTTGAGGAACTG	0.433									Kartagener syndrome																													uc003svc.2		NA																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(6499-6501)CTT>CGT		dynein, axonemal, heavy chain 11							79.0	83.0	82.0					7																	21745088		1926	4144	6070	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21745088T>G	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6479T>G	7.37:g.21745088T>G	ENSP00000475939:p.Leu2160Arg		Somatic					p.L2167R	NM_003777	NP_003768	WXS	Illumina HiSeq	Unspecified	Q96DT5	DYH11_HUMAN			40	6531	+			2167			AAA 2 (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.6500T>G		.	.	.	.	.	.	.	.	.	.	T	23.5	4.422376	0.83559	.	.	ENSG00000105877	ENST00000328843	T	0.48201	0.82	5.62	5.62	0.85841	.	0.073459	0.56097	D	0.000029	T	0.65302	0.2678	.	.	.	0.58432	D	0.999999	D	0.57257	0.979	P	0.58172	0.834	T	0.69986	-0.4996	9	0.87932	D	0	.	16.1033	0.81203	0.0:0.0:0.0:1.0	.	2167	Q96DT5	DYH11_HUMAN	R	2167	ENSP00000330671:L2167R	ENSP00000330671:L2167R	L	+	2	0	DNAH11	21711613	1.000000	0.71417	0.979000	0.43373	0.869000	0.49853	7.604000	0.82830	2.266000	0.75297	0.528000	0.53228	CTT		0.433	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		7	12	0	0	0	0	7	12				
FZD9	8326	broad.mit.edu	37	7	72849813	72849813	+	Silent	SNP	A	A	G	rs200330017		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:72849813A>G	ENST00000344575.3	+	1	1705	c.1476A>G	c.(1474-1476)ggA>ggG	p.G492G		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	492					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGGGGCCCGGAGGCCGGAGGG	0.652																																					Pancreas(144;909 1878 36867 38226 39554)	uc003tyb.2		NA																	0				central_nervous_system(1)	1						c.(1474-1476)GGA>GGG		frizzled 9 precursor							28.0	32.0	31.0					7																	72849813		2199	4298	6497	SO:0001819	synonymous_variant	8326				B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding	g.chr7:72849813A>G	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1476A>G	7.37:g.72849813A>G			Somatic					p.G492G	NM_003508	NP_003499	WXS	Illumina HiSeq	Unspecified	O00144	FZD9_HUMAN			1	1705	+		Lung NSC(55;0.0659)|all_lung(88;0.152)	492			Extracellular (Potential).			Silent	SNP	ENST00000344575.3	37	c.1476A>G	CCDS5548.1																																																																																				0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252120.1			4	40	0	0	0	0	4	40				
GTF2IRD1	9569	broad.mit.edu	37	7	73952488	73952488	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:73952488G>A	ENST00000265755.3	+	12	1825	c.1432G>A	c.(1432-1434)Gaa>Aaa	p.E478K	GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.E478K|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.E478K|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.E510K	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	478					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CAGCATGTCTGAAGACTGTGG	0.642																																						uc003uaq.2		NA																	0				ovary(4)	4						c.(1432-1434)GAA>AAA		GTF2I repeat domain containing 1 isoform 1							78.0	75.0	76.0					7																	73952488		2203	4300	6503	SO:0001583	missense	9569					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr7:73952488G>A	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1432G>A	7.37:g.73952488G>A	ENSP00000265755:p.Glu478Lys		Somatic				GTF2IRD1_uc010lbq.2_Missense_Mutation_p.E510K|GTF2IRD1_uc003uap.2_Missense_Mutation_p.E478K|GTF2IRD1_uc003uar.1_Missense_Mutation_p.E478K	p.E478K	NM_016328	NP_057412	WXS	Illumina HiSeq	Unspecified	Q9UHL9	GT2D1_HUMAN			12	1825	+			478					O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	c.1432G>A	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	G	6.389	0.439885	0.12104	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.31510	1.49;1.49;1.5;1.49	4.01	3.12	0.35913	.	0.860760	0.10623	N	0.653120	T	0.28699	0.0711	L	0.47716	1.5	0.37484	D	0.916098	B;B;B;B	0.31949	0.003;0.22;0.236;0.348	B;B;B;B	0.29267	0.002;0.036;0.069;0.1	T	0.15037	-1.0451	10	0.39692	T	0.17	-7.5076	13.0465	0.58928	0.0:0.163:0.837:0.0	.	510;478;478;478	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	K	478;510;478;478	ENSP00000265755:E478K;ENSP00000397566:E510K;ENSP00000408477:E478K;ENSP00000418383:E478K	ENSP00000265755:E478K	E	+	1	0	GTF2IRD1	73590424	0.998000	0.40836	0.697000	0.30258	0.674000	0.39518	2.923000	0.48868	1.041000	0.40125	0.561000	0.74099	GAA		0.642	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		5	65	0	0	0	0	5	65				
CACNA2D1	781	broad.mit.edu	37	7	81964507	81964507	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:81964507C>G	ENST00000356253.5	-	3	493	c.238G>C	c.(238-240)Gaa>Caa	p.E80Q	CACNA2D1_ENST00000423588.1_Missense_Mutation_p.E80Q|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.E80Q			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	80					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GCTGCAATTTCTACCAGCTGG	0.343																																						uc003uhr.1		NA																	0				ovary(5)|pancreas(1)	6						c.(238-240)GAA>CAA		calcium channel, voltage-dependent, alpha	Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)						185.0	192.0	189.0					7																	81964507		2203	4300	6503	SO:0001583	missense	781					voltage-gated calcium channel complex	metal ion binding	g.chr7:81964507C>G	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.238G>C	7.37:g.81964507C>G	ENSP00000348589:p.Glu80Gln		Somatic					p.E80Q	NM_000722	NP_000713	WXS	Illumina HiSeq	Unspecified	P54289	CA2D1_HUMAN			3	494	-			80			Extracellular (Potential).		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37	c.238G>C		.	.	.	.	.	.	.	.	.	.	C	15.10	2.734235	0.48939	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.24151	3.2;3.19;1.87	5.9	4.11	0.48088	.	0.295402	0.32106	N	0.006570	T	0.22475	0.0542	L	0.41492	1.28	0.80722	D	1	B	0.25955	0.138	B	0.32022	0.139	T	0.04885	-1.0920	10	0.59425	D	0.04	-25.9563	8.0309	0.30465	0.0:0.7315:0.131:0.1376	.	80	P54289-2	.	Q	80	ENSP00000349320:E80Q;ENSP00000348589:E80Q;ENSP00000405395:E80Q	ENSP00000284088:E80Q	E	-	1	0	CACNA2D1	81802443	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	4.827000	0.62723	0.839000	0.34971	0.650000	0.86243	GAA		0.343	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				57	106	0	0	0	0	57	106				
PCLO	27445	broad.mit.edu	37	7	82595320	82595320	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:82595320G>A	ENST00000333891.9	-	4	4121	c.3784C>T	c.(3784-3786)Cat>Tat	p.H1262Y	PCLO_ENST00000423517.2_Missense_Mutation_p.H1262Y	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGTAAGTCATGTTTCTGTTCT	0.418																																						uc003uhx.2		NA																	0				ovary(7)	7						c.(3784-3786)CAT>TAT		piccolo isoform 1							235.0	232.0	233.0					7																	82595320		1874	4105	5979	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82595320G>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3784C>T	7.37:g.82595320G>A	ENSP00000334319:p.His1262Tyr		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.H1262Y	p.H1262Y	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			4	4073	-			1201						Missense_Mutation	SNP	ENST00000333891.9	37	c.3784C>T	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292085	0.23564	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15718	2.4;2.4	5.59	4.71	0.59529	.	.	.	.	.	T	0.09774	0.0240	N	0.12182	0.205	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.16988	-1.0384	9	0.87932	D	0	.	5.7145	0.17952	0.077:0.1692:0.633:0.1208	.	1262;1262	Q9Y6V0-5;Q9Y6V0-6	.;.	Y	1201;1262;1262	ENSP00000334319:H1262Y;ENSP00000388393:H1262Y	ENSP00000334319:H1262Y	H	-	1	0	PCLO	82433256	0.008000	0.16893	0.003000	0.11579	0.232000	0.25224	-0.092000	0.11129	1.501000	0.48654	0.655000	0.94253	CAT		0.418	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		74	96	0	0	0	0	74	96				
CFAP69	79846	broad.mit.edu	37	7	89929196	89929196	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:89929196T>A	ENST00000389297.4	+	17	2124	c.1873T>A	c.(1873-1875)Ttc>Atc	p.F625I	C7orf63_ENST00000497910.1_Missense_Mutation_p.F607I|C7orf63_ENST00000316089.8_Missense_Mutation_p.F625I	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		625										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						CCAAAAAAAATTCTGTAATCT	0.323																																						uc010lep.2		NA																	0				ovary(1)	1						c.(1873-1875)TTC>ATC		hypothetical protein LOC79846 isoform 1							33.0	32.0	33.0					7																	89929196		1789	4065	5854	SO:0001583	missense	79846						binding	g.chr7:89929196T>A																												ENST00000389297.4:c.1873T>A	7.37:g.89929196T>A	ENSP00000373948:p.Phe625Ile		Somatic				C7orf63_uc003ukf.2_RNA|C7orf63_uc003ukg.2_Missense_Mutation_p.F300I|C7orf63_uc011khj.1_Missense_Mutation_p.F607I|C7orf63_uc011khk.1_Missense_Mutation_p.F187I	p.F625I	NM_001039706	NP_001034795	WXS	Illumina HiSeq	Unspecified	A5D8W1	CG063_HUMAN			17	2124	+			625					A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	ENST00000389297.4	37	c.1873T>A	CCDS43613.2	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126798	0.56721	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000449577	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.8	4.66	0.58398	Armadillo-type fold (1);	0.212287	0.41605	D	0.000846	T	0.32971	0.0847	M	0.70595	2.14	0.30221	N	0.79683	B;P;B	0.39022	0.074;0.655;0.4	B;B;B	0.35039	0.03;0.194;0.075	T	0.48080	-0.9066	10	0.35671	T	0.21	-11.7366	1.0887	0.01659	0.1708:0.131:0.1793:0.5189	.	607;625;625	A5D8W1-5;A5D8W1;A5D8W1-2	.;CG063_HUMAN;.	I	625;625;607;208	ENSP00000373948:F625I;ENSP00000321753:F625I;ENSP00000419549:F607I;ENSP00000391571:F208I	ENSP00000321753:F625I	F	+	1	0	C7orf63	89767132	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.992000	0.29667	2.213000	0.71641	0.528000	0.53228	TTC		0.323	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4			8	10	0	0	0	0	8	10				
FAM133B	257415	broad.mit.edu	37	7	92195342	92195342	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:92195342G>A	ENST00000445716.1	-	10	745	c.643C>T	c.(643-645)Cga>Tga	p.R215*	FAM133B_ENST00000427372.1_Nonsense_Mutation_p.R205*|FAM133B_ENST00000438306.1_Nonsense_Mutation_p.R205*	NM_152789.2	NP_690002.2	Q5BKY9	F133B_HUMAN	family with sequence similarity 133, member B	215	Lys-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	4	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GCTTTTTCTCGTTCTTCACTG	0.323																																						uc003umc.2		NA																	0		p.R215Q(1)		ovary(1)	1						c.(643-645)CGA>TGA		hypothetical protein LOC257415 isoform 1							140.0	134.0	136.0					7																	92195342		1832	4082	5914	SO:0001587	stop_gained	257415							g.chr7:92195342G>A		CCDS47640.1, CCDS47641.1	7q21.2	2014-02-12	2007-04-26		ENSG00000234545	ENSG00000234545			28629	protein-coding gene	gene with protein product						12477932	Standard	NM_152789		Approved	MGC40405	uc003umc.3	Q5BKY9	OTTHUMG00000155863	ENST00000445716.1:c.643C>T	7.37:g.92195342G>A	ENSP00000398401:p.Arg215*		Somatic				FAM133B_uc003umb.2_Nonsense_Mutation_p.R205*|FAM133B_uc003umd.2_RNA	p.R215*	NM_152789	NP_690002	WXS	Illumina HiSeq	Unspecified	Q5BKY9	F133B_HUMAN	STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)		10	744	-	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		215			Lys-rich.		B2R994|Q05D67|Q6P5S6|Q8N0W8	Nonsense_Mutation	SNP	ENST00000445716.1	37	c.643C>T	CCDS47640.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856016	0.71834	.	.	ENSG00000234545	ENST00000438306;ENST00000445716;ENST00000427372;ENST00000494079	.	.	.	4.68	3.78	0.43462	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999972	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.8205	10.0906	0.42445	0.0:0.0:0.635:0.365	.	.	.	.	X	205;215;205;112	.	ENSP00000402843:R205X	R	-	1	2	FAM133B	92033278	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	1.336000	0.33850	1.271000	0.44313	0.563000	0.77884	CGA		0.323	FAM133B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342181.2	NM_001040057		11	16	0	0	0	0	11	16				
SPDYE3	441272	broad.mit.edu	37	7	99917593	99917593	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:99917593G>C	ENST00000332397.6	+	10	1814	c.1630G>C	c.(1630-1632)Gat>Cat	p.D544H	SPDYE3_ENST00000437326.2_Missense_Mutation_p.D167H	NM_001004351.4	NP_001004351.3	A6NKU9	SPDE3_HUMAN	speedy/RINGO cell cycle regulator family member E3	544								p.D544N(1)		endometrium(10)|kidney(1)|lung(8)|urinary_tract(1)	20						GTGGGCGCGAGATCGCGCCCA	0.582																																						uc003uug.1		NA																	1	Substitution - Missense(1)		NS(1)		0						c.(499-501)GAT>CAT		speedy homolog E3							13.0	20.0	17.0					7																	99917593		1254	2302	3556	SO:0001583	missense	441272							g.chr7:99917593G>C	BC056606	CCDS47658.1, CCDS47658.2	7q22.1	2013-05-08	2013-05-08		ENSG00000214300	ENSG00000214300		"""Speedy homologs"""	35462	protein-coding gene	gene with protein product			"""speedy homolog E3 (Xenopus laevis)"""				Standard	NM_001004351		Approved		uc022aij.1	A6NKU9	OTTHUMG00000155462	ENST00000332397.6:c.1630G>C	7.37:g.99917593G>C	ENSP00000329565:p.Asp544His		Somatic				uc011kjm.1_5'Flank	p.D167H	NM_001004351	NP_001004351	WXS	Illumina HiSeq	Unspecified	A6NKU9	SPDE3_HUMAN			5	739	+			544					Q495Y9|Q6PHC4	Missense_Mutation	SNP	ENST00000332397.6	37	c.499G>C	CCDS47658.2	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427981	0.25726	.	.	ENSG00000214300	ENST00000332397;ENST00000437326	.	.	.	0.185	0.185	0.15096	.	0.093080	0.44097	D	0.000488	T	0.54791	0.1880	M	0.80616	2.505	0.09310	N	1	.	.	.	.	.	.	T	0.51529	-0.8694	6	0.87932	D	0	.	.	.	.	.	.	.	.	H	544;167	.	ENSP00000329565:D544H	D	+	1	0	SPDYE3	99755529	0.996000	0.38824	0.021000	0.16686	0.021000	0.10359	1.061000	0.30542	0.293000	0.22520	0.298000	0.19748	GAT		0.582	SPDYE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340224.2	NM_001004351		9	59	0	0	0	0	9	59				
MUC17	140453	broad.mit.edu	37	7	100686712	100686712	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:100686712G>A	ENST00000306151.4	+	3	12079	c.12015G>A	c.(12013-12015)gtG>gtA	p.V4005V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4005					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCACATATGTGACCATGTCTA	0.488																																						uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(12013-12015)GTG>GTA		mucin 17 precursor							210.0	192.0	198.0					7																	100686712		2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686712G>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12015G>A	7.37:g.100686712G>A			Somatic				MUC17_uc010lho.1_RNA	p.V4005V	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	12068	+	Lung NSC(181;0.136)|all_lung(186;0.182)		4005			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.12015G>A	CCDS34711.1																																																																																				0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		11	318	0	0	0	0	11	318				
MUC17	140453	broad.mit.edu	37	7	100686943	100686943	+	Silent	SNP	G	G	A	rs201108444	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:100686943G>A	ENST00000306151.4	+	3	12310	c.12246G>A	c.(12244-12246)acG>acA	p.T4082T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4082					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTCCTCCACGACTGTGAACC	0.572													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18996	0.0		0.0	False		,,,				2504	0.0					uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(12244-12246)ACG>ACA		mucin 17 precursor		G		5,4401	9.9+/-24.2	0,5,2198	223.0	189.0	201.0		12246	-1.1	0.0	7		201	0,8600		0,0,4300	yes	coding-synonymous	MUC17	NM_001040105.1		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		4082/4494	100686943	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686943G>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12246G>A	7.37:g.100686943G>A			Somatic				MUC17_uc010lho.1_RNA	p.T4082T	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	12299	+	Lung NSC(181;0.136)|all_lung(186;0.182)		4082			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	c.12246G>A	CCDS34711.1																																																																																				0.572	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		40	280	0	0	0	0	40	280				
PLOD3	8985	broad.mit.edu	37	7	100855553	100855553	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:100855553C>T	ENST00000223127.3	-	10	1506	c.1108G>A	c.(1108-1110)Gag>Aag	p.E370K		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	370					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	TCCCTGGCCTCGCCTGGGCTC	0.667																																						uc003uyd.2		NA																	0				ovary(1)|skin(1)	2						c.(1108-1110)GAG>AAG		procollagen-lysine, 2-oxoglutarate 5-dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						58.0	58.0	58.0					7																	100855553		2203	4300	6503	SO:0001583	missense	8985				protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding	g.chr7:100855553C>T	AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1108G>A	7.37:g.100855553C>T	ENSP00000223127:p.Glu370Lys		Somatic				PLOD3_uc010lhs.2_5'UTR	p.E370K	NM_001084	NP_001075	WXS	Illumina HiSeq	Unspecified	O60568	PLOD3_HUMAN			10	1564	-	Lung NSC(181;0.168)|all_lung(186;0.215)		370					B2R6W6|Q540C3	Missense_Mutation	SNP	ENST00000223127.3	37	c.1108G>A	CCDS5715.1	.	.	.	.	.	.	.	.	.	.	C	9.784	1.175988	0.21704	.	.	ENSG00000106397	ENST00000223127	D	0.84370	-1.84	4.44	3.49	0.39957	.	0.349478	0.26251	N	0.025444	T	0.81049	0.4742	M	0.61703	1.905	0.40413	D	0.979762	B	0.28258	0.205	B	0.17979	0.02	T	0.79780	-0.1659	10	0.31617	T	0.26	-13.0875	13.5116	0.61515	0.0:0.8263:0.1737:0.0	.	370	O60568	PLOD3_HUMAN	K	370	ENSP00000223127:E370K	ENSP00000223127:E370K	E	-	1	0	PLOD3	100642273	0.898000	0.30612	0.988000	0.46212	0.181000	0.23173	1.202000	0.32271	2.025000	0.59659	0.462000	0.41574	GAG		0.667	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1			23	165	0	0	0	0	23	165				
PLOD3	8985	broad.mit.edu	37	7	100859523	100859523	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:100859523C>G	ENST00000223127.3	-	4	821	c.423G>C	c.(421-423)gaG>gaC	p.E141D	ZNHIT1_ENST00000305105.2_5'Flank	NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	141					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	AGCAGAAGCTCTCTGCAGAGA	0.637																																						uc003uyd.2		NA																	0				ovary(1)|skin(1)	2						c.(421-423)GAG>GAC		procollagen-lysine, 2-oxoglutarate 5-dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						24.0	26.0	25.0					7																	100859523		2203	4300	6503	SO:0001583	missense	8985				protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding	g.chr7:100859523C>G	AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.423G>C	7.37:g.100859523C>G	ENSP00000223127:p.Glu141Asp		Somatic				ZNHIT1_uc003uye.2_5'Flank|ZNHIT1_uc003uyf.2_5'Flank	p.E141D	NM_001084	NP_001075	WXS	Illumina HiSeq	Unspecified	O60568	PLOD3_HUMAN			4	879	-	Lung NSC(181;0.168)|all_lung(186;0.215)		141					B2R6W6|Q540C3	Missense_Mutation	SNP	ENST00000223127.3	37	c.423G>C	CCDS5715.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835411	0.71373	.	.	ENSG00000106397	ENST00000223127;ENST00000541462;ENST00000414785	T;T	0.40476	1.03;1.03	5.17	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	L	0.55481	1.735	0.58432	D	0.999993	B	0.23854	0.092	B	0.24006	0.05	T	0.11275	-1.0594	10	0.36615	T	0.2	-6.2075	9.4389	0.38657	0.0:0.8248:0.0:0.1752	.	141	O60568	PLOD3_HUMAN	D	141;45;145	ENSP00000223127:E141D;ENSP00000407551:E145D	ENSP00000223127:E141D	E	-	3	2	PLOD3	100646243	0.979000	0.34478	0.124000	0.21820	0.964000	0.63967	2.494000	0.45329	0.584000	0.29591	0.491000	0.48974	GAG		0.637	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347470.1			17	97	0	0	0	0	17	97				
KIAA1549	57670	broad.mit.edu	37	7	138602191	138602191	+	Silent	SNP	G	G	A	rs201109912	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr7:138602191G>A	ENST00000422774.1	-	2	2229	c.2181C>T	c.(2179-2181)ctC>ctT	p.L727L	KIAA1549_ENST00000242365.4_Silent_p.L677L|KIAA1549_ENST00000440172.1_Silent_p.L727L			Q9HCM3	K1549_HUMAN	KIAA1549	727	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CAACAAACTCGAGAGAATCAG	0.468			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	uc011kql.1		NA		Dom	yes		7	7q34	57670	O	KIAA1549			O	BRAF		pilocytic astrocytoma	KIAA1549/BRAF(229)	0				central_nervous_system(229)|pancreas(1)	230						c.(2179-2181)CTC>CTT		hypothetical protein LOC57670 isoform 1		G	,	1,3915		0,1,1957	73.0	69.0	70.0		2181,2181	-2.1	0.0	7		70	8,8312		0,8,4152	yes	coding-synonymous,coding-synonymous	KIAA1549	NM_001164665.1,NM_020910.2	,	0,9,6109	AA,AG,GG		0.0962,0.0255,0.0736	,	727/1951,727/1935	138602191	9,12227	1958	4160	6118	SO:0001819	synonymous_variant	57670					integral to membrane		g.chr7:138602191G>A		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.2181C>T	7.37:g.138602191G>A			Somatic				KIAA1549_uc003vuk.3_Silent_p.L677L|KIAA1549_uc011kqj.1_Silent_p.L727L	p.L727L	NM_020910	NP_065961	WXS	Illumina HiSeq	Unspecified	Q9HCM3	K1549_HUMAN			2	2230	-			727			Ser-rich.		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	c.2181C>T	CCDS56513.1																																																																																				0.468	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1			4	26	0	0	0	0	4	26				
ASH2L	9070	broad.mit.edu	37	8	37964677	37964677	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:37964677G>C	ENST00000343823.6	+	3	703	c.394G>C	c.(394-396)Gat>Cat	p.D132H	ASH2L_ENST00000428278.2_Missense_Mutation_p.D38H|ASH2L_ENST00000521652.1_Missense_Mutation_p.D38H|ASH2L_ENST00000250635.7_Missense_Mutation_p.D38H|ASH2L_ENST00000545394.1_Intron	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	132	DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				ATTTGGCATAGATACCTCGTG	0.433																																						uc003xkt.3		NA																	0				ovary(1)|lung(1)	2						c.(394-396)GAT>CAT		ash2-like isoform a							215.0	192.0	200.0					8																	37964677		2203	4300	6503	SO:0001583	missense	9070				hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding	g.chr8:37964677G>C	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.394G>C	8.37:g.37964677G>C	ENSP00000340896:p.Asp132His		Somatic				ASH2L_uc011lbk.1_Intron|ASH2L_uc003xku.3_Missense_Mutation_p.D38H|ASH2L_uc010lwa.2_Missense_Mutation_p.D38H	p.D132H	NM_004674	NP_004665	WXS	Illumina HiSeq	Unspecified	Q9UBL3	ASH2L_HUMAN			3	452	+	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)	132			C4-type.		A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	ENST00000343823.6	37	c.394G>C	CCDS6101.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676496	0.67928	.	.	ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000517719;ENST00000428278;ENST00000521652	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	L	0.45581	1.43	0.80722	D	1	P;P	0.46656	0.803;0.882	B;B	0.34536	0.156;0.185	T	0.05533	-1.0879	10	0.34782	T	0.22	.	18.1691	0.89739	0.0:0.0:1.0:0.0	.	38;132	Q9UBL3-2;Q9UBL3	.;ASH2L_HUMAN	H	132;38;146;38;38	ENSP00000340896:D132H;ENSP00000250635:D38H;ENSP00000428877:D146H;ENSP00000395310:D38H;ENSP00000430259:D38H	ENSP00000250635:D38H	D	+	1	0	ASH2L	38083834	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.440000	0.97547	2.284000	0.76573	0.557000	0.71058	GAT		0.433	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	NM_004674		12	228	0	0	0	0	12	228				
WHSC1L1	54904	broad.mit.edu	37	8	38172976	38172976	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:38172976C>T	ENST00000317025.8	-	11	2590	c.2073G>A	c.(2071-2073)tcG>tcA	p.S691S	WHSC1L1_ENST00000527502.1_Silent_p.S691S|WHSC1L1_ENST00000525081.1_5'Flank|WHSC1L1_ENST00000433384.2_Silent_p.S691S	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	691					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TGCCTCTTCTCGACAAACTTG	0.428			T	NUP98	AML																																	uc003xli.2		NA		Dom	yes		8	8p12	54904	T	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)			L	NUP98		AML		0				breast(1)	1						c.(2071-2073)TCG>TCA		WHSC1L1 protein isoform long							193.0	177.0	182.0					8																	38172976		1941	4148	6089	SO:0001819	synonymous_variant	54904				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding	g.chr8:38172976C>T	AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.2073G>A	8.37:g.38172976C>T			Somatic				WHSC1L1_uc011lbm.1_Silent_p.S691S|WHSC1L1_uc010lwe.2_Silent_p.S691S	p.S691S	NM_023034	NP_075447	WXS	Illumina HiSeq	Unspecified	Q9BZ95	NSD3_HUMAN	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)		11	2591	-	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	691					B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Silent	SNP	ENST00000317025.8	37	c.2073G>A	CCDS43729.1																																																																																				0.428	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381924.3	NM_023034		29	271	0	0	0	0	29	271				
CEBPD	1052	broad.mit.edu	37	8	48650425	48650425	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:48650425G>A	ENST00000408965.3	-	1	1223	c.258C>T	c.(256-258)ttC>ttT	p.F86F		NM_005195.3	NP_005186.2	P49716	CEBPD_HUMAN	CCAAT/enhancer binding protein (C/EBP), delta	86					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		all_cancers(86;0.0782)|Lung NSC(58;0.00363)|all_epithelial(80;0.0042)|all_lung(54;0.00914)				GATTGCTGTTGAAGAGGTCGG	0.716																																					GBM(26;131 685 21356 28665)	uc003xqh.1		NA																	0					0						c.(256-258)TTC>TTT		CCAAT/enhancer binding protein delta							13.0	16.0	15.0					8																	48650425		1898	4112	6010	SO:0001819	synonymous_variant	1052				transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr8:48650425G>A		CCDS6142.1	8p11.2-p11.1	2013-01-10				ENSG00000221869		"""basic leucine zipper proteins"""	1835	protein-coding gene	gene with protein product		116898				1840554, 1884998	Standard	NM_005195		Approved	CRP3, CELF, C/EBP-delta, NF-IL6-beta	uc003xqh.1	P49716		ENST00000408965.3:c.258C>T	8.37:g.48650425G>A			Somatic				KIAA0146_uc003xqg.1_Intron	p.F86F	NM_005195	NP_005186	WXS	Illumina HiSeq	Unspecified	P49716	CEBPD_HUMAN			1	302	-		all_cancers(86;0.0782)|Lung NSC(58;0.00363)|all_epithelial(80;0.0042)|all_lung(54;0.00914)	86					Q14937|Q2M2X9	Silent	SNP	ENST00000408965.3	37	c.258C>T	CCDS6142.1																																																																																				0.716	CEBPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368448.2	NM_005195		5	5	0	0	0	0	5	5				
PXDNL	137902	broad.mit.edu	37	8	52320812	52320812	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:52320812C>G	ENST00000356297.4	-	17	3472	c.3372G>C	c.(3370-3372)caG>caC	p.Q1124H	PXDNL_ENST00000543296.1_Missense_Mutation_p.Q1124H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1124					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGAAGAGCCTCTGGGTCAGCT	0.577																																						uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(3370-3372)CAG>CAC		peroxidasin homolog-like precursor							65.0	71.0	69.0					8																	52320812		1910	4121	6031	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52320812C>G		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3372G>C	8.37:g.52320812C>G	ENSP00000348645:p.Gln1124His		Somatic				PXDNL_uc003xqt.3_RNA	p.Q1124H	NM_144651	NP_653252	WXS	Illumina HiSeq	Unspecified	A1KZ92	PXDNL_HUMAN			17	3473	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	1124					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.3372G>C	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.654|4.654	0.121667|0.121667	0.08931|0.08931	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297;ENST00000543296|ENST00000522933	T;T|.	0.72615|.	-0.67;-0.67|.	3.82|3.82	1.86|1.86	0.25419|0.25419	.|.	0.422853|.	0.19800|.	N|.	0.105761|.	T|T	0.17534|0.17534	0.0421|0.0421	N|N	0.10837|0.10837	0.055|0.055	0.25552|0.25552	N|N	0.987075|0.987075	B|.	0.11235|.	0.004|.	B|.	0.17979|.	0.02|.	T|T	0.27331|0.27331	-1.0077|-1.0077	10|5	0.66056|.	D|.	0.02|.	.|.	6.3958|6.3958	0.21611|0.21611	0.0:0.7013:0.1868:0.1119|0.0:0.7013:0.1868:0.1119	.|.	1124|.	A1KZ92|.	PXDNL_HUMAN|.	H|T	1124|243	ENSP00000348645:Q1124H;ENSP00000444865:Q1124H|.	ENSP00000348645:Q1124H|.	Q|R	-|-	3|2	2|0	PXDNL|PXDNL	52483365|52483365	0.148000|0.148000	0.22702|0.22702	0.005000|0.005000	0.12908|0.12908	0.006000|0.006000	0.05464|0.05464	0.332000|0.332000	0.19751|0.19751	0.071000|0.071000	0.16664|0.16664	0.655000|0.655000	0.94253|0.94253	CAG|AGA		0.577	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		11	64	0	0	0	0	11	64				
NSMAF	8439	broad.mit.edu	37	8	59511881	59511881	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:59511881T>C	ENST00000038176.3	-	19	1707	c.1495A>G	c.(1495-1497)Agc>Ggc	p.S499G	NSMAF_ENST00000427130.2_Missense_Mutation_p.S530G|NSMAF_ENST00000519858.1_5'Flank	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	499	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				ACATAATTGCTTTCCAATGCA	0.393																																						uc003xtt.2		NA																	0				ovary(1)	1						c.(1495-1497)AGC>GGC		neutral sphingomyelinase (N-SMase) activation							156.0	153.0	154.0					8																	59511881		2203	4300	6503	SO:0001583	missense	8439				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity	g.chr8:59511881T>C	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1495A>G	8.37:g.59511881T>C	ENSP00000038176:p.Ser499Gly		Somatic				NSMAF_uc011lee.1_Missense_Mutation_p.S530G	p.S499G	NM_003580	NP_003571	WXS	Illumina HiSeq	Unspecified	Q92636	FAN_HUMAN			19	1709	-		all_lung(136;0.174)|Lung NSC(129;0.2)	499			BEACH.		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	c.1495A>G	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.269494	0.40095	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	D;D	0.83755	-1.76;-1.76	6.17	6.17	0.99709	BEACH domain (4);	0.037211	0.85682	D	0.000000	D	0.87493	0.6191	M	0.86864	2.845	0.48341	D	0.999631	B;B	0.31485	0.055;0.325	B;B	0.38264	0.056;0.269	D	0.85856	0.1407	9	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	530;499	Q92636-2;Q92636	.;FAN_HUMAN	G	499;530	ENSP00000038176:S499G;ENSP00000411012:S530G	.	S	-	1	0	NSMAF	59674435	1.000000	0.71417	0.972000	0.41901	0.213000	0.24496	6.232000	0.72313	2.371000	0.80710	0.533000	0.62120	AGC		0.393	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580		49	73	0	0	0	0	49	73				
CSPP1	79848	broad.mit.edu	37	8	68071344	68071344	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:68071344G>C	ENST00000262210.5	+	19	2526	c.2495G>C	c.(2494-2496)aGa>aCa	p.R832T	CSPP1_ENST00000521168.1_3'UTR|CSPP1_ENST00000412460.1_Missense_Mutation_p.R487T	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	867	Glu-rich.				positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TACTGTGAAAGAGACAATTTG	0.353																																						uc003xxi.2		NA																	0				ovary(3)|breast(2)	5						c.(2599-2601)AGA>ACA		centrosome spindle pole associated protein 1							112.0	110.0	111.0					8																	68071344		1839	4085	5924	SO:0001583	missense	79848					centrosome|microtubule|spindle		g.chr8:68071344G>C	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2495G>C	8.37:g.68071344G>C	ENSP00000262210:p.Arg832Thr		Somatic				CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.R832T|CSPP1_uc003xxk.2_Missense_Mutation_p.R487T	p.R867T	NM_001077204	NP_001070672	WXS	Illumina HiSeq	Unspecified	Q1MSJ5	CSPP1_HUMAN	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)		21	2631	+	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	867					A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	c.2600G>C	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.944141	0.53079	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.76709	-1.04;1.26;1.26	4.65	3.76	0.43208	.	0.065301	0.64402	D	0.000015	T	0.74718	0.3753	N	0.19112	0.55	0.29916	N	0.823137	D;D;P	0.89917	1.0;0.988;0.936	D;P;P	0.83275	0.996;0.844;0.654	T	0.67971	-0.5532	10	0.36615	T	0.2	-15.6154	5.3872	0.16224	0.0981:0.0:0.578:0.3239	.	487;832;867	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;CSPP1_HUMAN	T	832;867;487;487	ENSP00000262210:R832T;ENSP00000415782:R487T;ENSP00000430092:R487T	ENSP00000262210:R832T	R	+	2	0	CSPP1	68233898	0.997000	0.39634	1.000000	0.80357	0.629000	0.37895	1.984000	0.40658	2.302000	0.77476	0.557000	0.71058	AGA		0.353	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		8	107	0	0	0	0	8	107				
FAM92A1	137392	broad.mit.edu	37	8	94740469	94740469	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:94740469G>A	ENST00000518322.1	+	9	955	c.814G>A	c.(814-816)Gaa>Aaa	p.E272K	RBM12B_ENST00000520961.1_5'Flank|FAM92A1_ENST00000517718.1_Missense_Mutation_p.E117K|FAM92A1_ENST00000423990.2_Missense_Mutation_p.E234K|FAM92A1_ENST00000520363.1_3'UTR	NM_145269.3	NP_660312.2	A1XBS5	F92A1_HUMAN	family with sequence similarity 92, member A1	272										NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)	7	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TCAACAAGCAGAAGATGATGA	0.289																																						uc010maq.2		NA																	0					0						c.(814-816)GAA>AAA		hypothetical protein LOC137392							101.0	97.0	99.0					8																	94740469		1841	4085	5926	SO:0001583	missense	137392							g.chr8:94740469G>A		CCDS47892.1, CCDS64933.1	8q22.1	2005-09-22			ENSG00000188343	ENSG00000188343			30452	protein-coding gene	gene with protein product						12477932	Standard	XM_005250783		Approved	FLJ38979	uc022ayd.1	A1XBS5	OTTHUMG00000164238	ENST00000518322.1:c.814G>A	8.37:g.94740469G>A	ENSP00000429367:p.Glu272Lys		Somatic				FAM92A1_uc003yfv.3_RNA|FAM92A1_uc003yfx.3_RNA|FAM92A1_uc003yfw.3_RNA|FAM92A1_uc010mar.2_Missense_Mutation_p.E79K	p.E272K	NM_145269	NP_660312	WXS	Illumina HiSeq	Unspecified	A1XBS5	F92A1_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.0168)		8	917	+	Breast(36;2.4e-06)		272					A1XBS4|Q32ND3|Q6AHW7|Q8N8R1|Q96L09	Missense_Mutation	SNP	ENST00000518322.1	37	c.814G>A	CCDS47892.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276447	0.23307	.	.	ENSG00000188343	ENST00000518322;ENST00000423990;ENST00000436526;ENST00000517718;ENST00000521641	T;T;T;T	0.49139	1.37;1.3;0.79;0.79	4.59	3.72	0.42706	.	.	.	.	.	T	0.41236	0.1150	L	0.59436	1.845	0.58432	D	0.999993	B;B	0.30634	0.288;0.083	B;B	0.26969	0.075;0.017	T	0.37079	-0.9721	9	0.56958	D	0.05	-17.1926	8.9372	0.35706	0.1052:0.0:0.8948:0.0	.	234;272	A1XBS5-2;A1XBS5	.;F92A1_HUMAN	K	272;234;234;117;117	ENSP00000429367:E272K;ENSP00000401774:E234K;ENSP00000428874:E117K;ENSP00000428751:E117K	ENSP00000401774:E234K	E	+	1	0	FAM92A1	94809645	1.000000	0.71417	0.327000	0.25402	0.745000	0.42441	4.684000	0.61686	1.054000	0.40438	0.655000	0.94253	GAA		0.289	FAM92A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377890.4	NM_145269		5	46	0	0	0	0	5	46				
KIAA1429	25962	broad.mit.edu	37	8	95550492	95550492	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:95550492C>G	ENST00000297591.5	-	3	337	c.262G>C	c.(262-264)Gga>Cga	p.G88R	KIAA1429_ENST00000437199.1_Missense_Mutation_p.G88R|KIAA1429_ENST00000421249.2_Missense_Mutation_p.G88R	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	88					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			ACATACCTTCCCAACCTATCG	0.368																																						uc003ygo.1		NA																	0				ovary(1)|skin(1)	2						c.(262-264)GGA>CGA		hypothetical protein LOC25962 isoform 1							131.0	124.0	127.0					8																	95550492		2203	4300	6503	SO:0001583	missense	25962				mRNA processing|RNA splicing	nucleus		g.chr8:95550492C>G	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.262G>C	8.37:g.95550492C>G	ENSP00000297591:p.Gly88Arg		Somatic				KIAA1429_uc003ygp.2_Missense_Mutation_p.G88R	p.G88R	NM_015496	NP_056311	WXS	Illumina HiSeq	Unspecified	Q69YN4	VIR_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00185)		3	275	-	Breast(36;3.29e-05)		88					Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	c.262G>C	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917684	0.92249	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.62498	0.09;0.05;0.02	5.57	5.57	0.84162	.	0.053974	0.64402	N	0.000001	T	0.79185	0.4403	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80032	-0.1552	10	0.66056	D	0.02	.	19.5403	0.95271	0.0:1.0:0.0:0.0	.	88;88	Q69YN4-4;Q69YN4	.;VIR_HUMAN	R	88	ENSP00000297591:G88R;ENSP00000395600:G88R;ENSP00000398390:G88R	ENSP00000297591:G88R	G	-	1	0	KIAA1429	95619668	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.172000	0.77604	2.623000	0.88846	0.561000	0.74099	GGA		0.368	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496		21	38	0	0	0	0	21	38				
MTDH	92140	broad.mit.edu	37	8	98735238	98735238	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:98735238G>C	ENST00000336273.3	+	11	1981	c.1653G>C	c.(1651-1653)aaG>aaC	p.K551N	MTDH_ENST00000519934.1_Missense_Mutation_p.K495N	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	551					lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			CAAATACCAAGCAAAATAGTG	0.373																																						uc003yhz.2		NA																	0				liver(1)|central_nervous_system(1)	2						c.(1651-1653)AAG>AAC		metadherin							158.0	155.0	156.0					8																	98735238		2203	4300	6503	SO:0001583	missense	92140				lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity	g.chr8:98735238G>C	AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.1653G>C	8.37:g.98735238G>C	ENSP00000338235:p.Lys551Asn		Somatic				MTDH_uc010mbf.2_RNA	p.K551N	NM_178812	NP_848927	WXS	Illumina HiSeq	Unspecified	Q86UE4	LYRIC_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.178)		11	1981	+	Breast(36;2.56e-06)		551			Cytoplasmic (Potential).		Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	ENST00000336273.3	37	c.1653G>C	CCDS6274.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461032	0.84317	.	.	ENSG00000147649	ENST00000336273;ENST00000519934;ENST00000521933	T;T	0.65549	-0.12;-0.16	6.06	6.06	0.98353	.	0.245666	0.41712	D	0.000822	T	0.77103	0.4081	L	0.55481	1.735	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.76881	-0.2795	10	0.72032	D	0.01	-9.7294	18.8014	0.92018	0.0:0.0:1.0:0.0	.	551	Q86UE4	LYRIC_HUMAN	N	551;495;174	ENSP00000338235:K551N;ENSP00000428168:K495N	ENSP00000338235:K551N	K	+	3	2	MTDH	98804414	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.180000	0.50895	2.882000	0.98803	0.655000	0.94253	AAG		0.373	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379772.2			32	95	0	0	0	0	32	95				
VPS13B	157680	broad.mit.edu	37	8	100847876	100847876	+	Silent	SNP	A	A	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:100847876A>G	ENST00000358544.2	+	54	10038	c.9927A>G	c.(9925-9927)ttA>ttG	p.L3309L	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.L3284L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3309					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCAAAGACTTACTTCCAAGCC	0.428																																					Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(9925-9927)TTA>TTG		vacuolar protein sorting 13B isoform 5							92.0	87.0	89.0					8																	100847876		2203	4300	6503	SO:0001819	synonymous_variant	157680				protein transport			g.chr8:100847876A>G	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9927A>G	8.37:g.100847876A>G			Somatic				VPS13B_uc003yiw.2_Silent_p.L3284L	p.L3309L	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		54	10038	+	Breast(36;3.73e-07)		3309					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	c.9927A>G	CCDS6280.1																																																																																				0.428	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		21	48	0	0	0	0	21	48				
PABPC1	26986	broad.mit.edu	37	8	101733737	101733737	+	Silent	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:101733737C>G	ENST00000318607.5	-	1	1203	c.75G>C	c.(73-75)gcG>gcC	p.A25A	PABPC1_ENST00000519004.1_Intron|PABPC1_ENST00000522387.1_Silent_p.A25A	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	25	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CGTAGAGCATCGCCTCGGTCA	0.672																																						uc003yjs.1		NA																	0					0						c.(73-75)GCG>GCC		poly(A) binding protein, cytoplasmic 1							27.0	30.0	29.0					8																	101733737		2202	4299	6501	SO:0001819	synonymous_variant	26986				mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity	g.chr8:101733737C>G	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.75G>C	8.37:g.101733737C>G			Somatic				PABPC1_uc011lhc.1_Silent_p.A25A|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Silent_p.A25A|PABPC1_uc003yju.2_RNA	p.A25A	NM_002568	NP_002559	WXS	Illumina HiSeq	Unspecified	P11940	PABP1_HUMAN	Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)		1	579	-	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		25			RRM 1.		Q15097|Q93004	Silent	SNP	ENST00000318607.5	37	c.75G>C	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	C	8.140	0.785120	0.16189	.	.	ENSG00000070756	ENST00000523555	.	.	.	3.45	0.104	0.14531	.	.	.	.	.	T	0.54870	0.1885	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47315	-0.9127	4	.	.	.	.	8.265	0.31808	0.0:0.3248:0.5653:0.1099	.	.	.	.	H	20	.	.	D	-	1	0	PABPC1	101802913	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	2.581000	0.46077	0.101000	0.17610	0.557000	0.71058	GAT		0.672	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568		7	43	0	0	0	0	7	43				
KLF10	7071	broad.mit.edu	37	8	103664280	103664280	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:103664280G>C	ENST00000285407.6	-	3	580	c.280C>G	c.(280-282)Cca>Gca	p.P94A	KLF10_ENST00000395884.3_Missense_Mutation_p.P83A	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	94					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			CTGTAAGGTGGAGTCAAACAC	0.348											OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(16;495 519 2144 16528 44005)	uc011lhk.1		NA																	0					0						c.(280-282)CCA>GCA		Kruppel-like factor 10 isoform a							44.0	49.0	47.0					8																	103664280		2192	4296	6488	SO:0001583	missense	7071				cell proliferation|cell-cell signaling|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|skeletal system development|transforming growth factor beta receptor signaling pathway	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:103664280G>C	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.280C>G	8.37:g.103664280G>C	ENSP00000285407:p.Pro94Ala		Somatic	OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1375	KLF10_uc011lhj.1_Missense_Mutation_p.P83A	p.P94A	NM_005655	NP_005646	WXS	Illumina HiSeq	Unspecified	Q13118	KLF10_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)		3	434	-	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		94					A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	ENST00000285407.6	37	c.280C>G	CCDS6294.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275117	0.80580	.	.	ENSG00000155090	ENST00000285407;ENST00000395884	T;T	0.71461	-0.57;-0.47	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.85248	0.5653	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.85345	0.1098	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	94;83	Q13118;O75411	KLF10_HUMAN;.	A	94;83	ENSP00000285407:P94A;ENSP00000379222:P83A	ENSP00000285407:P94A	P	-	1	0	KLF10	103733456	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.129000	0.94430	2.865000	0.98341	0.655000	0.94253	CCA		0.348	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1			42	32	0	0	0	0	42	32				
CSMD3	114788	broad.mit.edu	37	8	114031357	114031357	+	Silent	SNP	G	G	A			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:114031357G>A	ENST00000297405.5	-	6	1213	c.969C>T	c.(967-969)ctC>ctT	p.L323L	CSMD3_ENST00000455883.2_Silent_p.L323L|CSMD3_ENST00000352409.3_Silent_p.L323L|CSMD3_ENST00000343508.3_Silent_p.L283L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	323	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AATGCAGTCTGAGCCAGTTTT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(967-969)CTC>CTT		CUB and Sushi multiple domains 3 isoform 1							213.0	194.0	201.0					8																	114031357		2203	4300	6503	SO:0001819	synonymous_variant	114788					integral to membrane|plasma membrane		g.chr8:114031357G>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.969C>T	8.37:g.114031357G>A		HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003ynt.2_Silent_p.L283L|CSMD3_uc011lhx.1_Silent_p.L323L|CSMD3_uc010mcx.1_Silent_p.L323L	p.L323L	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			6	1128	-			323			Extracellular (Potential).|CUB 2.		Q96PZ3	Silent	SNP	ENST00000297405.5	37	c.969C>T	CCDS6315.1																																																																																				0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		6	115	0	0	0	0	6	115				
ZC3H3	23144	broad.mit.edu	37	8	144621302	144621302	+	Missense_Mutation	SNP	G	G	A	rs185805345	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:144621302G>A	ENST00000262577.5	-	2	266	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W	RP11-661A12.5_ENST00000530600.1_RNA|7SK_ENST00000517300.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	79					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CCCGGGGGCCGATTCACGAGG	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		15019	0.002		0.0	False		,,,				2504	0.0					uc003yyd.2		NA																	0				skin(1)	1						c.(235-237)CGG>TGG		zinc finger CCCH-type containing 3		G	TRP/ARG	0,4406		0,0,2203	63.0	60.0	61.0		235	2.9	1.0	8		61	1,8587		0,1,4293	no	missense	ZC3H3	NM_015117.2	101	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	79/949	144621302	1,12993	2203	4294	6497	SO:0001583	missense	23144				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding	g.chr8:144621302G>A	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.235C>T	8.37:g.144621302G>A	ENSP00000262577:p.Arg79Trp		Somatic					p.R79W	NM_015117	NP_055932	WXS	Illumina HiSeq	Unspecified	Q8IXZ2	ZC3H3_HUMAN	Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)		2	264	-	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		79					Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	c.235C>T	CCDS6402.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	11.70	1.716589	0.30413	0.0	1.16E-4	ENSG00000014164	ENST00000262577	T	0.51325	0.71	4.67	2.88	0.33553	.	0.131586	0.36002	N	0.002854	T	0.32852	0.0843	L	0.31926	0.97	0.29849	N	0.828605	B	0.20164	0.042	B	0.12156	0.007	T	0.27971	-1.0058	10	0.87932	D	0	.	6.1247	0.20172	0.1686:0.1525:0.6789:0.0	.	79	Q8IXZ2	ZC3H3_HUMAN	W	79	ENSP00000262577:R79W	ENSP00000262577:R79W	R	-	1	2	ZC3H3	144692445	0.057000	0.20700	0.957000	0.39632	0.795000	0.44927	0.544000	0.23253	0.417000	0.25871	-0.254000	0.11334	CGG		0.672	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117		62	46	0	0	0	0	62	46				
ZNF251	90987	broad.mit.edu	37	8	145947498	145947498	+	Missense_Mutation	SNP	C	C	T	rs201656593		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr8:145947498C>T	ENST00000292562.7	-	5	1822	c.1547G>A	c.(1546-1548)cGt>cAt	p.R516H	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		TCTGCACTTACGAGTCTCTCC	0.532																																						uc003zdv.3		NA																	0					0						c.(1546-1548)CGT>CAT		zinc finger protein 251							94.0	101.0	99.0					8																	145947498		2189	4293	6482	SO:0001583	missense	90987				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:145947498C>T	AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.1547G>A	8.37:g.145947498C>T	ENSP00000292562:p.Arg516His		Somatic					p.R516H	NM_138367	NP_612376	WXS	Illumina HiSeq	Unspecified	Q9BRH9	ZN251_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)	5	1803	-	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		516					Q2M219	Missense_Mutation	SNP	ENST00000292562.7	37	c.1547G>A	CCDS47944.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574742	0.45902	.	.	ENSG00000198169	ENST00000292562	T	0.13901	2.55	2.15	-3.68	0.04463	Zinc finger, C2H2 (1);	.	.	.	.	T	0.02970	0.0088	N	0.00389	-1.56	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41502	-0.9505	9	0.72032	D	0.01	-2.7774	4.7969	0.13277	0.1669:0.194:0.0:0.6391	.	516	Q9BRH9	ZN251_HUMAN	H	516	ENSP00000292562:R516H	ENSP00000292562:R516H	R	-	2	0	ZNF251	145918307	0.000000	0.05858	0.000000	0.03702	0.410000	0.31052	-0.555000	0.05999	-1.165000	0.02786	0.563000	0.77884	CGT		0.532	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382541.1	NM_138367		28	62	0	0	0	0	28	62				
CDKN2A	1029	broad.mit.edu	37	9	21971029	21971029	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:21971029C>T	ENST00000304494.5	-	2	599	c.329G>A	c.(328-330)tGg>tAg	p.W110*	CDKN2A_ENST00000361570.3_Silent_p.L165L|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.W59*|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.W59*|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.W59*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.W110*|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.W59*|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.W110*|CDKN2A_ENST00000530628.2_Silent_p.L124L|CDKN2A_ENST00000579755.1_Silent_p.L124L|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.W110*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.W59*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	110					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.W110*(13)|p.L165L(2)|p.H83fs*2(2)|p.D105fs*8(1)|p.0(1)|p.A68fs*3(1)|p.R107fs*33(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CAGACGGCCCCAGGCATCGCG	0.731		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												uc003zpk.2		17																	1380	Whole gene deletion(1316)|Unknown(44)|Substitution - Nonsense(13)|Deletion - Frameshift(5)|Substitution - coding silent(2)	p.0?(1112)|p.W110*(38)|p.?(13)|p.H83fs*2(2)|p.W110fs*9(1)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)|p.W110fs*36(1)|p.W110C(1)	haematopoietic_and_lymphoid_tissue(283)|skin(177)|central_nervous_system(167)|lung(148)|urinary_tract(91)|bone(74)|soft_tissue(57)|oesophagus(52)|upper_aerodigestive_tract(52)|pleura(51)|pancreas(37)|ovary(36)|kidney(32)|breast(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678						c.(328-330)TGG>TAG		cyclin-dependent kinase inhibitor 2A isoform 1							18.0	20.0	20.0					9																	21971029		2198	4294	6492	SO:0001587	stop_gained	1029	Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma			cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	g.chr9:21971029C>T	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.329G>A	9.37:g.21971029C>T	ENSP00000307101:p.Trp110*	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)	Somatic				MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Silent_p.L165L	p.W110*	NM_000077	NP_000068	WXS	Illumina HiSeq	Unspecified	P42771	CD2A1_HUMAN		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)	2	541	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	110			ANK 4.		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	37	c.329G>A	CCDS6510.1	.	.	.	.	.	.	.	.	.	.	C	37	6.223773	0.97390	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	.	.	.	5.93	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.50632	D	0.999889	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-14.7138	7.5355	0.27708	0.2896:0.6341:0.0:0.0762	.	.	.	.	X	110	.	ENSP00000307101:W110X	W	-	2	0	CDKN2A	21961029	0.001000	0.12720	0.995000	0.50966	0.918000	0.54935	0.120000	0.15647	2.808000	0.96608	0.655000	0.94253	TGG		0.731	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077		26	7	0	0	0	0	26	7				
SPATA31A6	389730	broad.mit.edu	37	9	43628678	43628678	+	Silent	SNP	C	C	G	rs200990015		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:43628678C>G	ENST00000332857.6	-	3	292	c.264G>C	c.(262-264)ccG>ccC	p.P88P	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	88					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P88P(1)									CCAGGCCTCTCGGGCACTCTC	0.587																																						uc011lrb.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(262-264)CCG>CCC		hypothetical protein LOC389730																																				SO:0001819	synonymous_variant	389730					integral to membrane		g.chr9:43628678C>G		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.264G>C	9.37:g.43628678C>G			Somatic					p.P88P	NM_001145196	NP_001138668	WXS	Illumina HiSeq	Unspecified	Q5VVP1	F75A6_HUMAN			3	293	-			88						Silent	SNP	ENST00000332857.6	37	c.264G>C	CCDS47973.1																																																																																				0.587	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196		30	21	0	0	0	0	30	21				
GNAQ	2776	broad.mit.edu	37	9	80537224	80537224	+	Silent	SNP	C	C	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:80537224C>T	ENST00000286548.4	-	2	396	c.174G>A	c.(172-174)caG>caA	p.Q58Q		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	58					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						TGATTCTCATCTGCTTGATAA	0.463			Mis		uveal melanoma																																	uc004akw.2		NA		Dom	yes		9	9q21	2776	Mis	"""guanine nucleotide binding protein (G protein), q polypeptide"""			E			uveal melanoma		0				eye(136)|skin(44)|meninges(11)|ovary(1)|kidney(1)	193						c.(172-174)CAG>CAA		guanine nucleotide binding protein (G protein),							215.0	197.0	203.0					9																	80537224		2203	4300	6503	SO:0001819	synonymous_variant	2776				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity	g.chr9:80537224C>T		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.174G>A	9.37:g.80537224C>T			Somatic					p.Q58Q	NM_002072	NP_002063	WXS	Illumina HiSeq	Unspecified	P50148	GNAQ_HUMAN			2	215	-			58					O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Silent	SNP	ENST00000286548.4	37	c.174G>A	CCDS6658.1																																																																																				0.463	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072		66	82	0	0	0	0	66	82				
COL27A1	85301	broad.mit.edu	37	9	117015171	117015171	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:117015171A>C	ENST00000356083.3	+	27	3491	c.3100A>C	c.(3100-3102)Atg>Ctg	p.M1034L		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1034	Collagen-like 7.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						TCATCCTGGAATGCCAGGTGG	0.567																																						uc011lxl.1		NA																	0				ovary(3)|skin(1)	4						c.(3100-3102)ATG>CTG		collagen, type XXVII, alpha 1 precursor							101.0	94.0	97.0					9																	117015171		2203	4300	6503	SO:0001583	missense	85301				cell adhesion		extracellular matrix structural constituent	g.chr9:117015171A>C	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3100A>C	9.37:g.117015171A>C	ENSP00000348385:p.Met1034Leu		Somatic				COL27A1_uc004bii.2_RNA	p.M1034L	NM_032888	NP_116277	WXS	Illumina HiSeq	Unspecified	Q8IZC6	CORA1_HUMAN			27	3100	+			1034			Pro-rich.|Collagen-like 7.|Triple-helical region.		Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	c.3100A>C	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	A	7.811	0.715644	0.15306	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.93366	-3.21	4.69	3.56	0.40772	.	.	.	.	.	T	0.79082	0.4386	N	0.02202	-0.64	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.66180	-0.5988	9	0.07813	T	0.8	.	6.9039	0.24299	0.8967:0.0:0.1033:0.0	.	1034	Q8IZC6	CORA1_HUMAN	L	1034	ENSP00000348385:M1034L	ENSP00000348385:M1034L	M	+	1	0	COL27A1	116054992	0.160000	0.22878	0.720000	0.30636	0.642000	0.38348	0.707000	0.25704	0.936000	0.37367	0.459000	0.35465	ATG		0.567	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888		21	31	0	0	0	0	21	31				
TNC	3371	broad.mit.edu	37	9	117797486	117797486	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:117797486G>C	ENST00000350763.4	-	22	6195	c.5784C>G	c.(5782-5784)gtC>gtG	p.V1928V	TNC_ENST00000535648.1_Silent_p.V1473V|TNC_ENST00000537320.1_Silent_p.V1291V|TNC_ENST00000345230.3_Silent_p.V1291V|TNC_ENST00000542877.1_Silent_p.V1565V|TNC_ENST00000341037.4_Silent_p.V1746V|TNC_ENST00000346706.3_Silent_p.V1382V|TNC_ENST00000340094.3_Silent_p.V1564V|TNC_ENST00000423613.2_Silent_p.V1655V	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1928	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AAAATACCTTGACTGTGCCAT	0.468																																						uc004bjj.3		NA																	0				central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						c.(5782-5784)GTC>GTG		tenascin C precursor							68.0	70.0	69.0					9																	117797486		2203	4300	6503	SO:0001819	synonymous_variant	3371				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding	g.chr9:117797486G>C		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5784C>G	9.37:g.117797486G>C			Somatic				TNC_uc010mvf.2_Silent_p.V1655V	p.V1928V	NM_002160	NP_002151	WXS	Illumina HiSeq	Unspecified	P24821	TENA_HUMAN			22	6146	-			1928			Fibronectin type-III 15.		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	c.5784C>G	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	G	9.685	1.150459	0.21371	.	.	ENSG00000041982	ENST00000544972	.	.	.	5.73	4.82	0.62117	.	.	.	.	.	T	0.72898	0.3518	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72839	-0.4171	4	.	.	.	.	16.6543	0.85224	0.0:0.1299:0.8701:0.0	.	.	.	.	E	491	.	.	Q	-	1	0	TNC	116837307	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.139000	0.50577	1.382000	0.46385	0.655000	0.94253	CAA		0.468	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160		8	73	0	0	0	0	8	73				
CDK5RAP2	55755	broad.mit.edu	37	9	123169396	123169396	+	Silent	SNP	G	G	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:123169396G>C	ENST00000349780.4	-	32	5036	c.4857C>G	c.(4855-4857)ctC>ctG	p.L1619L	CDK5RAP2_ENST00000359309.3_Silent_p.L1578L|CDK5RAP2_ENST00000360822.3_Silent_p.L1587L|CDK5RAP2_ENST00000360190.4_Intron	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1619					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						GCTGTTCCTTGAGCCTGCTCT	0.592																																						uc004bkf.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(4855-4857)CTC>CTG		CDK5 regulatory subunit associated protein 2							107.0	80.0	89.0					9																	123169396		2203	4300	6503	SO:0001819	synonymous_variant	55755				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding	g.chr9:123169396G>C	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4857C>G	9.37:g.123169396G>C			Somatic				CDK5RAP2_uc010mvi.2_Silent_p.L628L|CDK5RAP2_uc004bke.2_Silent_p.L904L|CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Silent_p.L884L|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Silent_p.L884L|CDK5RAP2_uc011lya.1_Silent_p.L884L|CDK5RAP2_uc004bkh.1_Silent_p.L1389L|CDK5RAP2_uc004bki.2_3'UTR	p.L1619L	NM_018249	NP_060719	WXS	Illumina HiSeq	Unspecified	Q96SN8	CK5P2_HUMAN			32	5038	-			1619					Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	c.4857C>G	CCDS6823.1																																																																																				0.592	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		18	56	0	0	0	0	18	56				
PTGS1	5742	broad.mit.edu	37	9	125154519	125154519	+	Missense_Mutation	SNP	C	C	T	rs200550102	byFrequency	TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:125154519C>T	ENST00000362012.2	+	11	1501	c.1496C>T	c.(1495-1497)gCg>gTg	p.A499V	PTGS1_ENST00000373698.5_Missense_Mutation_p.A390V|PTGS1_ENST00000540753.1_Missense_Mutation_p.A437V|PTGS1_ENST00000223423.4_Missense_Mutation_p.A462V	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	499					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	GACATTGATGCGTTGGAGTTC	0.468													C|||	5	0.000998403	0.0	0.0	5008	,	,		20918	0.0		0.0	False		,,,				2504	0.0051					uc004bmg.1		NA																	0				ovary(1)|skin(1)	2						c.(1495-1497)GCG>GTG		prostaglandin-endoperoxide synthase 1 isoform 1	Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dipyrone(DB04817)|Etodolac(DB00749)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Mesalazine(DB00244)|Minoxidil(DB00350)|Nabumetone(DB00461)|Naproxen(DB00788)|Phenacetin(DB03783)|Piroxicam(DB00554)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Tolmetin(DB00500)	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	61.0	64.0	63.0		1496,1385	5.8	1.0	9		63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PTGS1	NM_000962.2,NM_080591.1	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	499/600,462/563	125154519	1,13005	2203	4300	6503	SO:0001583	missense	5742				cyclooxygenase pathway|hormone biosynthetic process|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum membrane|Golgi apparatus|microsome|plasma membrane	heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity	g.chr9:125154519C>T	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1496C>T	9.37:g.125154519C>T	ENSP00000354612:p.Ala499Val		Somatic				PTGS1_uc011lys.1_Missense_Mutation_p.A437V|PTGS1_uc010mwb.1_Missense_Mutation_p.A353V|PTGS1_uc004bmf.1_Missense_Mutation_p.A462V|PTGS1_uc004bmh.1_Missense_Mutation_p.A390V|PTGS1_uc011lyt.1_Missense_Mutation_p.A390V	p.A499V	NM_000962	NP_000953	WXS	Illumina HiSeq	Unspecified	P23219	PGH1_HUMAN			11	1631	+			499					A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	37	c.1496C>T	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039808	0.75732	0.0	1.16E-4	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000373698	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.85026	0.5603	M	0.91090	3.175	0.80722	D	1	D;D;P	0.63046	0.992;0.989;0.956	D;P;P	0.62955	0.909;0.47;0.538	D	0.86923	0.2068	10	0.54805	T	0.06	-26.3004	19.0512	0.93046	0.0:1.0:0.0:0.0	.	437;499;462	B4DHQ2;P23219;P23219-2	.;PGH1_HUMAN;.	V	437;499;462;390	ENSP00000437709:A437V;ENSP00000354612:A499V;ENSP00000223423:A462V;ENSP00000362802:A390V	ENSP00000223423:A462V	A	+	2	0	PTGS1	124194340	1.000000	0.71417	0.992000	0.48379	0.235000	0.25334	6.081000	0.71309	2.735000	0.93741	0.655000	0.94253	GCG		0.468	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1			5	57	0	0	0	0	5	57				
GOLGA2	2801	broad.mit.edu	37	9	131022404	131022404	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:131022404C>G	ENST00000421699.2	-	18	1754	c.1742G>C	c.(1741-1743)gGa>gCa	p.G581A	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Missense_Mutation_p.G569A	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	581					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CAGCTTCTTTCCCAGCTCCCT	0.612																																						uc011maw.1		NA																	0				ovary(1)	1						c.(1741-1743)GGA>GCA		Golgi autoantigen, golgin subfamily a, 2							110.0	105.0	107.0					9																	131022404		2203	4300	6503	SO:0001583	missense	2801					Golgi cisterna membrane	protein binding	g.chr9:131022404C>G	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1742G>C	9.37:g.131022404C>G	ENSP00000416097:p.Gly581Ala		Somatic				GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004buh.2_Missense_Mutation_p.G54A	p.G581A	NM_004486	NP_004477	WXS	Illumina HiSeq	Unspecified	Q08379	GOGA2_HUMAN			18	1755	-			581			Potential.		Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	ENST00000421699.2	37	c.1742G>C	CCDS6896.2	.	.	.	.	.	.	.	.	.	.	c	0.174	-1.069055	0.01918	.	.	ENSG00000167110	ENST00000421699	T	0.13901	2.55	5.39	3.55	0.40652	.	0.102714	0.64402	N	0.000003	T	0.01870	0.0059	N	0.00038	-2.52	0.24823	N	0.992576	B	0.06786	0.001	B	0.04013	0.001	T	0.42599	-0.9442	10	0.02654	T	1	.	10.6638	0.45717	0.0726:0.1385:0.7889:0.0	.	581	Q08379	GOGA2_HUMAN	A	581	ENSP00000416097:G581A	ENSP00000416097:G581A	G	-	2	0	GOLGA2	130062225	1.000000	0.71417	0.999000	0.59377	0.008000	0.06430	5.430000	0.66501	0.645000	0.30675	-0.479000	0.04858	GGA		0.612	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486		7	124	0	0	0	0	7	124				
NUP188	23511	broad.mit.edu	37	9	131745290	131745290	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:131745290C>G	ENST00000372577.2	+	17	1800	c.1779C>G	c.(1777-1779)atC>atG	p.I593M		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	593					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CATCTCGCATCTACATGCTGC	0.532																																						uc004bws.1		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(1777-1779)ATC>ATG		nucleoporin 188kDa							169.0	131.0	144.0					9																	131745290		2203	4300	6503	SO:0001583	missense	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131745290C>G	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1779C>G	9.37:g.131745290C>G	ENSP00000361658:p.Ile593Met		Somatic				NUP188_uc004bwu.2_5'Flank	p.I593M	NM_015354	NP_056169	WXS	Illumina HiSeq	Unspecified	Q5SRE5	NU188_HUMAN			17	1801	+			593					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	c.1779C>G	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929027	0.73327	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.66460	-0.21	6.06	5.16	0.70880	.	0.046204	0.85682	D	0.000000	T	0.52158	0.1717	N	0.24115	0.695	0.58432	D	0.999997	B	0.30068	0.267	B	0.30495	0.116	T	0.55457	-0.8138	10	0.72032	D	0.01	-0.6347	9.9549	0.41660	0.0:0.789:0.1398:0.0713	.	593	Q5SRE5	NU188_HUMAN	M	482;593	ENSP00000361658:I593M	ENSP00000349125:I482M	I	+	3	3	NUP188	130785111	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.438000	0.35002	1.564000	0.49628	0.655000	0.94253	ATC		0.532	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			40	65	0	0	0	0	40	65				
SETX	23064	broad.mit.edu	37	9	135204799	135204799	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr9:135204799C>G	ENST00000224140.5	-	10	2368	c.2186G>C	c.(2185-2187)aGa>aCa	p.R729T	SETX_ENST00000372169.2_Missense_Mutation_p.R729T|SETX_ENST00000393220.1_Missense_Mutation_p.R729T	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	729					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TGGACCATTTCTTGAAGTACA	0.363																																						uc004cbk.2		NA																	0				ovary(2)|skin(1)	3						c.(2185-2187)AGA>ACA		senataxin							124.0	127.0	126.0					9																	135204799		2203	4299	6502	SO:0001583	missense	23064				cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	g.chr9:135204799C>G	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.2186G>C	9.37:g.135204799C>G	ENSP00000224140:p.Arg729Thr		Somatic				SETX_uc004cbj.2_Missense_Mutation_p.R348T|SETX_uc010mzt.2_Missense_Mutation_p.R348T	p.R729T	NM_015046	NP_055861	WXS	Illumina HiSeq	Unspecified	Q7Z333	SETX_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	10	2369	-		Myeloproliferative disorder(178;0.204)	729					A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	c.2186G>C	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301406	0.23736	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.88124	-2.26;-2.34;-1.96	5.79	2.9	0.33743	.	3.491080	0.00710	N	0.000820	T	0.81635	0.4864	L	0.34521	1.04	0.21147	N	0.999772	B;B;B	0.32753	0.383;0.055;0.383	B;B;B	0.28849	0.095;0.022;0.095	T	0.69716	-0.5070	10	0.72032	D	0.01	.	5.8742	0.18820	0.1397:0.6513:0.1348:0.0742	.	729;729;729	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	T	729	ENSP00000224140:R729T;ENSP00000361242:R729T;ENSP00000376913:R729T	ENSP00000224140:R729T	R	-	2	0	SETX	134194620	0.445000	0.25657	0.373000	0.26003	0.386000	0.30323	0.245000	0.18142	0.786000	0.33708	-0.122000	0.15005	AGA		0.363	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046		9	106	0	0	0	0	9	106				
FAM9B	171483	broad.mit.edu	37	X	8995923	8995923	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chrX:8995923C>G	ENST00000327220.5	-	7	842	c.478G>C	c.(478-480)Gac>Cac	p.D160H	FAM9B_ENST00000428477.1_Missense_Mutation_p.D160H|FAM9B_ENST00000362066.3_Missense_Mutation_p.D200H			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	160						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				ACGAATTGGTCACGTAGCAGC	0.358																																						uc011mhu.1		NA																	0					0						c.(478-480)GAC>CAC		family with sequence similarity 9, member B							230.0	192.0	205.0					X																	8995923		2203	4300	6503	SO:0001583	missense	171483					nucleus		g.chrX:8995923C>G		CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.478G>C	X.37:g.8995923C>G	ENSP00000318716:p.Asp160His		Somatic				FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_Missense_Mutation_p.D200H	p.D160H	NM_205849	NP_995321	WXS	Illumina HiSeq	Unspecified	Q8IZU0	FAM9B_HUMAN			6	567	-		Hepatocellular(5;0.219)	160					Q0IJ68|Q8N7Z8	Missense_Mutation	SNP	ENST00000327220.5	37	c.478G>C	CCDS14132.1	.	.	.	.	.	.	.	.	.	.	C	10.27	1.304515	0.23736	.	.	ENSG00000177138	ENST00000362066;ENST00000327220;ENST00000428477	.	.	.	1.31	1.31	0.21738	.	.	.	.	.	T	0.40372	0.1114	N	0.22421	0.69	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.76575	0.988;0.988	T	0.15350	-1.0440	8	0.87932	D	0	.	6.2772	0.20987	0.0:1.0:0.0:0.0	.	160;200	Q8IZU0;Q8N7Z8	FAM9B_HUMAN;.	H	200;160;160	.	ENSP00000318716:D160H	D	-	1	0	FAM9B	8955923	0.962000	0.33011	0.012000	0.15200	0.025000	0.11179	1.683000	0.37638	0.539000	0.28788	0.292000	0.19580	GAC		0.358	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055702.2	NM_205849		4	30	0	0	0	0	4	30				
CXorf21	80231	broad.mit.edu	37	X	30578057	30578057	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chrX:30578057G>T	ENST00000378962.3	-	3	738	c.416C>A	c.(415-417)tCa>tAa	p.S139*		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	139										kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						TGTTGTCACTGAATTAATGGC	0.433																																						uc004dcg.1		NA																	0				ovary(1)	1						c.(415-417)TCA>TAA		hypothetical protein LOC80231							60.0	61.0	60.0					X																	30578057		2202	4299	6501	SO:0001587	stop_gained	80231							g.chrX:30578057G>T	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.416C>A	X.37:g.30578057G>T	ENSP00000368245:p.Ser139*		Somatic					p.S139*	NM_025159	NP_079435	WXS	Illumina HiSeq	Unspecified	Q9HAI6	CX021_HUMAN			3	692	-			139						Nonsense_Mutation	SNP	ENST00000378962.3	37	c.416C>A	CCDS14224.1	.	.	.	.	.	.	.	.	.	.	G	36	5.608501	0.96626	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.06	4.12	0.48240	.	0.129644	0.35040	N	0.003496	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.9743	13.0346	0.58862	0.0934:0.0:0.9066:0.0	.	.	.	.	X	139	.	ENSP00000368245:S139X	S	-	2	0	CXorf21	30487978	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	5.983000	0.70540	2.336000	0.79503	0.513000	0.50165	TCA		0.433	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159		36	9	1	0	4.23e-30	4.56e-30	36	9				
AR	367	broad.mit.edu	37	X	66905872	66905872	+	Missense_Mutation	SNP	G	G	A	rs137852569		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chrX:66905872G>A	ENST00000374690.3	+	3	2313	c.1789G>A	c.(1789-1791)Gcc>Acc	p.A597T	AR_ENST00000504326.1_Missense_Mutation_p.A597T|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.A597T|AR_ENST00000396043.2_Missense_Mutation_p.A65T	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	596	Interaction with HIPK3. {ECO:0000250}.|Interaction with LPXN.		S -> G (in PAIS; high dissociation rate; associated with P-617 in a PAIS patient; partially restores DNA-binding activity of P-617 mutant receptors). {ECO:0000269|PubMed:1316540}.|S -> T (in a patient with severe hypospadias). {ECO:0000269|PubMed:10092153}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GTACCTGTGCGCCAGCAGAAA	0.413									Androgen Insensitivity Syndrome																													uc004dwu.1		NA																	0				ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	GRCh37	CM920071	AR	M	rs137852569	c.(1789-1791)GCC>ACC		androgen receptor isoform 1	Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)						106.0	93.0	97.0					X																	66905872		2203	4300	6503	SO:0001583	missense	367	Androgen_Insensitivity_Syndrome	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chrX:66905872G>A	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1789G>A	X.37:g.66905872G>A	ENSP00000363822:p.Ala597Thr		Somatic				AR_uc011mpd.1_Missense_Mutation_p.A597T|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Missense_Mutation_p.A597T|AR_uc004dwv.1_Missense_Mutation_p.A65T	p.A597T	NM_000044	NP_000035	WXS	Illumina HiSeq	Unspecified	P10275	ANDR_HUMAN			3	2904	+	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)	596		A -> T (in AIS; abolishes dimerization).	NR C4-type.|Interaction with HIPK3 (By similarity).|Nuclear receptor.		A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	c.1789G>A	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214457	0.58452	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000396043	D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29	5.32	4.47	0.54385	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.97155	0.9070	L	0.45352	1.415	0.80722	D	1	P;P;D;B	0.89917	0.881;0.881;1.0;0.343	B;B;D;B	0.97110	0.175;0.175;1.0;0.076	D	0.97171	0.9844	10	0.87932	D	0	.	10.6719	0.45764	0.0936:0.0:0.9064:0.0	.	597;597;65;596	E7EVX6;D3YPQ2;F1D8N5;P10275	.;.;.;ANDR_HUMAN	T	407;597;597;597;65	ENSP00000363822:A597T;ENSP00000421155:A597T;ENSP00000379359:A597T;ENSP00000379358:A65T	ENSP00000363822:A597T	A	+	1	0	AR	66822597	1.000000	0.71417	0.987000	0.45799	0.102000	0.19082	9.050000	0.93843	1.228000	0.43614	-0.306000	0.09157	GCC		0.413	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044		3	33	0	0	0	0	3	33				
KIAA2022	340533	broad.mit.edu	37	X	73964209	73964209	+	Silent	SNP	G	G	A	rs397518479		TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chrX:73964209G>A	ENST00000055682.6	-	3	794	c.183C>T	c.(181-183)ccC>ccT	p.P61P		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	61					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GGAGACCTCTGGGATACATCA	0.537																																						uc004eby.2		NA																	0				ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(181-183)CCC>CCT		hypothetical protein LOC340533							60.0	58.0	58.0					X																	73964209		2203	4300	6503	SO:0001819	synonymous_variant	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73964209G>A		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.183C>T	X.37:g.73964209G>A			Somatic					p.P61P	NM_001008537	NP_001008537	WXS	Illumina HiSeq	Unspecified	Q5QGS0	K2022_HUMAN			3	800	-			61					A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	c.183C>T	CCDS35337.1																																																																																				0.537	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		3	9	0	0	0	0	3	9				
PKN1	5585	broad.mit.edu	37	19	14562741	14562741	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr19:14562741delC	ENST00000242783.6	+	7	1236	c.1071delC	c.(1069-1071)cgcfs	p.R357fs	PKN1_ENST00000342216.4_Frame_Shift_Del_p.R363fs	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	357	C2.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.F360fs*2(1)		breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						CAGACAGCCGCCCCCCCTTCC	0.667																																					NSCLC(185;2539 2965 10733 52867)	uc002myp.2		NA																	1	Deletion - Frameshift(1)		ovary(1)	ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						c.(1069-1071)CGCfs		protein kinase N1 isoform 2							18.0	26.0	23.0					19																	14562741		1942	4133	6075	SO:0001589	frameshift_variant	5585				activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding	g.chr19:14562741delC	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.1071delC	19.37:g.14562741delC	ENSP00000242783:p.Arg357fs		Somatic				PKN1_uc002myq.2_Frame_Shift_Del_p.R363fs	p.R357fs	NM_002741	NP_002732	WXS	Illumina HiSeq	Unspecified	Q16512	PKN1_HUMAN			7	1239	+			357			C2.		A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Frame_Shift_Del	DEL	ENST00000242783.6	37	c.1071delC	CCDS42513.1																																																																																				0.667	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560		11	10	NA	NA	NA	NA	11	10	---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187539265	187539266	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CV-7414-01A-11D-2078-08	TCGA-CV-7414-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	7137f980-5301-4b18-9664-d887eaced75e	1d18702d-756c-4764-92d5-6ffbd598cc90	g.chr4:187539265_187539266insC	ENST00000441802.2	-	10	8683_8684	c.8474_8475insG	c.(8473-8475)ggafs	p.G2825fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2825	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTACTCTACTTCCCCCTGGCAG	0.436										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(8473-8475)GGAfs		FAT tumor suppressor 1 precursor																																				SO:0001589	frameshift_variant	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187539265_187539266insC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8475dupG	4.37:g.187539270_187539270dupC	ENSP00000406229:p.Gly2825fs	HNSCC(5;0.00058)	Somatic					p.G2825fs	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			10	8662_8663	-			2825			Extracellular (Potential).|Cadherin 26.			Frame_Shift_Ins	INS	ENST00000441802.2	37	c.8474_8475insG	CCDS47177.1																																																																																				0.436	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		29	24	NA	NA	NA	NA	29	24	---	---	---	---
