#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
ACAP3	116983	broad.mit.edu	37	1	1236026	1236026	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:1236026G>A	ENST00000354700.5	-	6	587	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	ACAP3_ENST00000379037.2_5'Flank|ACAP3_ENST00000353662.3_Missense_Mutation_p.R87W	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	129					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						AGGTCCTCCCGCACCTTGTCA	0.647																																						uc001aeb.2		NA																	0					0						c.(385-387)CGG>TGG		ArfGAP with coiled-coil, ankyrin repeat and PH							60.0	61.0	61.0					1																	1236026		2203	4300	6503	SO:0001583	missense	116983				filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding	g.chr1:1236026G>A	AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.385C>T	1.37:g.1236026G>A	ENSP00000346733:p.Arg129Trp		Somatic				ACAP3_uc001ady.2_5'Flank|ACAP3_uc001aea.2_Missense_Mutation_p.R87W|ACAP3_uc001aec.1_Missense_Mutation_p.R87W	p.R129W	NM_030649	NP_085152	WXS	Illumina HiSeq	Unspecified	Q96P50	ACAP3_HUMAN			6	459	-			129					B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	ENST00000354700.5	37	c.385C>T	CCDS19.2	.	.	.	.	.	.	.	.	.	.	G	19.18	3.776968	0.70107	.	.	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.00522	6.84;6.84	4.05	4.05	0.47172	IRSp53/MIM homology domain (IMD) (1);	0.070576	0.56097	D	0.000033	T	0.01558	0.0050	M	0.75447	2.3	0.31520	N	0.662497	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.94;0.989;0.997	T	0.10941	-1.0608	10	0.87932	D	0	.	11.4051	0.49894	0.0:0.0:0.6828:0.3172	.	169;129;87	Q5TA40;Q96P50;Q96P50-1	.;ACAP3_HUMAN;.	W	129;87	ENSP00000346733:R129W;ENSP00000321139:R87W	ENSP00000321139:R87W	R	-	1	2	ACAP3	1225889	0.957000	0.32711	0.689000	0.30133	0.988000	0.76386	1.983000	0.40648	1.983000	0.57843	0.313000	0.20887	CGG		0.647	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006366.2	NM_030649		11	45	0	0	0	0	11	45				
UBE4B	10277	broad.mit.edu	37	1	10132157	10132157	+	Silent	SNP	C	C	A	rs201875729		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:10132157C>A	ENST00000253251.8	+	2	935	c.96C>A	c.(94-96)ccC>ccA	p.P32P	UBE4B_ENST00000377157.3_5'UTR|UBE4B_ENST00000377153.1_Silent_p.P32P|UBE4B_ENST00000343090.6_Silent_p.P32P					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TCACCTCTCCCCAGAGGGAGA	0.597																																						uc001aqs.3		NA																	0				ovary(2)|skin(2)	4						c.(94-96)CCC>CCA		ubiquitination factor E4B isoform 1							68.0	66.0	66.0					1																	10132157		2203	4300	6503	SO:0001819	synonymous_variant	10277				apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding	g.chr1:10132157C>A	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.96C>A	1.37:g.10132157C>A			Somatic				UBE4B_uc001aqr.3_Silent_p.P32P|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_5'UTR	p.P32P	NM_001105562	NP_001099032	WXS	Illumina HiSeq	Unspecified	O95155	UBE4B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)	2	809	+		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	32						Silent	SNP	ENST00000253251.8	37	c.96C>A	CCDS110.1																																																																																				0.597	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		17	47	1	0	1.34e-09	1.59e-09	17	47				
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																						uc009vos.1		NA																	0					0						c.e6+1		hypothetical protein LOC55672																																				SO:0001630	splice_region_variant	55672					cytoplasm		g.chr1:16918653C>T	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T			Somatic				NBPF1_uc010oce.1_Intron		NM_017940	NP_060410	WXS	Illumina HiSeq	Unspecified	Q3BBV0	NBPF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)	6	853	-								Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37	c.-35_splice																																																																																					0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	Intron	4	62	0	0	0	0	4	62				
ARID1A	8289	broad.mit.edu	37	1	27106228	27106228	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:27106228C>T	ENST00000324856.7	+	20	6210	c.5839C>T	c.(5839-5841)Cag>Tag	p.Q1947*	ARID1A_ENST00000540690.1_Nonsense_Mutation_p.Q275*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1730*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q1564*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1947					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TAGCCCAGCACAGAGCCACCG	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	uc001bmv.1		NA		Rec	yes		1	1p35.3	8289	Mis|N|F|S|D	AT rich interactive domain 1A (SWI-like)			E			clear cell ovarian carcinoma|RCC		0				ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142						c.(5839-5841)CAG>TAG		AT rich interactive domain 1A isoform a							165.0	147.0	153.0					1																	27106228		2203	4300	6503	SO:0001587	stop_gained	8289				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	g.chr1:27106228C>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5839C>T	1.37:g.27106228C>T	ENSP00000320485:p.Gln1947*		Somatic				ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q1730*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.Q793*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.Q275*|ARID1A_uc009vsn.1_Nonsense_Mutation_p.Q189*	p.Q1947*	NM_006015	NP_006006	WXS	Illumina HiSeq	Unspecified	O14497	ARI1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)	20	6212	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	1947					D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	c.5839C>T	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.895876|9.895876	0.99290|0.99290	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	0.263023|.	0.39687|.	N|.	0.001300|.	.|T	.|0.70527	.|0.3234	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68300	.|-0.5445	.|4	0.02654|.	T|.	1|.	-6.3757|-6.3757	14.6091|14.6091	0.68504|0.68504	0.1463:0.8537:0.0:0.0|0.1463:0.8537:0.0:0.0	.|.	.|.	.|.	.|.	X|I	1947;1730;1564;275|843	.|.	ENSP00000320485:Q1947X|.	Q|T	+|+	1|2	0|0	ARID1A|ARID1A	26978815|26978815	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	3.660000|3.660000	0.54496|0.54496	2.769000|2.769000	0.95229|0.95229	0.491000|0.491000	0.48974|0.48974	CAG|ACA		0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		18	73	0	0	0	0	18	73				
EPHA10	284656	broad.mit.edu	37	1	38227731	38227731	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:38227731C>G	ENST00000373048.4	-	3	195	c.196G>C	c.(196-198)Gaa>Caa	p.E66Q	EPHA10_ENST00000319637.6_Missense_Mutation_p.E66Q|EPHA10_ENST00000427468.2_Missense_Mutation_p.E66Q	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	66	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGTCGTGTTCATCCACGCCG	0.617																																						uc009vvi.2		NA																	0				breast(4)|stomach(3)|lung(1)	8						c.(196-198)GAA>CAA		EPH receptor A10 isofom 3							65.0	53.0	57.0					1																	38227731		2203	4300	6503	SO:0001583	missense	284656					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity	g.chr1:38227731C>G	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.196G>C	1.37:g.38227731C>G	ENSP00000362139:p.Glu66Gln		Somatic				EPHA10_uc001cbw.3_Missense_Mutation_p.E66Q	p.E66Q	NM_001099439	NP_001092909	WXS	Illumina HiSeq	Unspecified	Q5JZY3	EPHAA_HUMAN			3	282	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	66			Extracellular (Potential).		A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	c.196G>C	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591534	0.86953	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.03889	3.77;3.77;3.77	4.47	4.47	0.54385	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.39083	N	0.001473	T	0.22360	0.0539	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.75484	0.986;0.985	T	0.00934	-1.1509	10	0.87932	D	0	.	16.6276	0.84975	0.0:1.0:0.0:0.0	.	66;66	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	Q	66	ENSP00000397746:E66Q;ENSP00000362139:E66Q;ENSP00000316395:E66Q	ENSP00000316395:E66Q	E	-	1	0	EPHA10	38000318	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	5.763000	0.68818	2.448000	0.82819	0.549000	0.68633	GAA		0.617	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641		8	56	0	0	0	0	8	56				
MACF1	23499	broad.mit.edu	37	1	39854051	39854052	+	Nonsense_Mutation	DNP	TG	TG	AT			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:39854051_39854052TG>AT	ENST00000372915.3	+	57	15639_15640	c.15552_15553TG>AT	c.(15550-15555)tcTGaa>tcATaa	p.E5185*	MACF1_ENST00000567887.1_Nonsense_Mutation_p.E5217*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.E5180*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.E3118*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.E3118*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.E3620*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.E3118*|MACF1_ENST00000539005.1_Nonsense_Mutation_p.E3097*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5185					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TAGAGGCCTCTGAAGCAGAGTG	0.47																																						uc010oiu.1		NA																	0				ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16						c.(10855-10860)TCTGAA>TCATAA		microfilament and actin filament cross-linker																																				SO:0001587	stop_gained	23499				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding	g.chr1:39854051_39854052TG>AT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	Exception_encountered	1.37:g.39854051_39854052delinsAT	ENSP00000362006:p.Glu5185*		Somatic				MACF1_uc010ois.1_Nonsense_Mutation_p.E3118*|MACF1_uc001cda.1_Nonsense_Mutation_p.E3005*|MACF1_uc001cdc.1_Nonsense_Mutation_p.E2184*	p.E3620*	NM_033044	NP_149033	WXS	Illumina HiSeq	Unspecified	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)		22	10988_10989	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	5185			LRR 20.		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	DNP	ENST00000372915.3	37	c.10857_10858TG>AT																																																																																					0.470	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044		5	40	0	0	0	0	5	40				
C8B	732	broad.mit.edu	37	1	57415426	57415426	+	Splice_Site	SNP	C	C	A	rs200785263		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:57415426C>A	ENST00000371237.4	-	6	733		c.e6-1		C8B_ENST00000543257.1_Splice_Site|C8B_ENST00000535057.1_Splice_Site	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						TGCCTTGGGTCTAAAGAAGAA	0.368													C|||	1	0.000199681	0.0	0.0	5008	,	,		19924	0.0		0.001	False		,,,				2504	0.0					uc001cyp.2		NA																	0				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						c.e6-1		complement component 8, beta polypeptide							46.0	46.0	46.0					1																	57415426		2202	4299	6501	SO:0001630	splice_region_variant	732				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex		g.chr1:57415426C>A	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.667-1G>T	1.37:g.57415426C>A			Somatic				C8B_uc010oon.1_Splice_Site_p.T161_splice|C8B_uc010ooo.1_Splice_Site_p.T171_splice	p.T223_splice	NM_000066	NP_000057	WXS	Illumina HiSeq	Unspecified	P07358	CO8B_HUMAN			6	734	-								A1L4K7	Splice_Site	SNP	ENST00000371237.4	37	c.667_splice	CCDS30730.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.25	2.779098	0.49891	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6646	0.91485	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C8B	57188014	1.000000	0.71417	0.996000	0.52242	0.507000	0.33981	6.073000	0.71245	2.479000	0.83701	0.591000	0.81541	.		0.368	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		Intron	8	26	1	0	6.55e-12	7.92e-12	8	26				
ZNF644	84146	broad.mit.edu	37	1	91406244	91406244	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:91406244C>G	ENST00000370440.1	-	3	884	c.667G>C	c.(667-669)Gag>Cag	p.E223Q	ZNF644_ENST00000337393.5_Missense_Mutation_p.E223Q|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCACCCACCTCTACTTGATTT	0.373																																						uc001dnw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(667-669)GAG>CAG		zinc finger protein 644 isoform 1							168.0	175.0	173.0					1																	91406244		2202	4299	6501	SO:0001583	missense	84146				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:91406244C>G	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.667G>C	1.37:g.91406244C>G	ENSP00000359469:p.Glu223Gln		Somatic				ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron|ZNF644_uc001dny.1_Missense_Mutation_p.E223Q	p.E223Q	NM_201269	NP_958357	WXS	Illumina HiSeq	Unspecified	Q9H582	ZN644_HUMAN		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)	3	809	-		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)	223					A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	37	c.667G>C	CCDS731.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.730775	0.30684	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000541557	T;T	0.00617	6.19;6.19	6.03	5.11	0.69529	.	0.131649	0.52532	D	0.000074	T	0.00356	0.0011	L	0.27053	0.805	0.37576	D	0.919633	P	0.35433	0.501	B	0.30495	0.116	T	0.75599	-0.3262	10	0.56958	D	0.05	-12.0294	15.5916	0.76534	0.0:0.9335:0.0:0.0665	.	223	Q9H582	ZN644_HUMAN	Q	223	ENSP00000359469:E223Q;ENSP00000337008:E223Q	ENSP00000337008:E223Q	E	-	1	0	ZNF644	91178832	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.019000	0.49635	2.861000	0.98227	0.655000	0.94253	GAG		0.373	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186		35	171	0	0	0	0	35	171				
VCAM1	7412	broad.mit.edu	37	1	101186049	101186049	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:101186049G>C	ENST00000294728.2	+	2	183	c.82G>C	c.(82-84)Gag>Cag	p.E28Q	VCAM1_ENST00000370115.1_Missense_Mutation_p.E28Q|VCAM1_ENST00000347652.2_Missense_Mutation_p.E28Q|VCAM1_ENST00000370119.4_Missense_Mutation_p.E28Q	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	28	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.E28*(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TTTTAAAATCGAGACCACCCC	0.413																																						uc001dti.2		NA																	1	Substitution - Nonsense(1)		central_nervous_system(1)	central_nervous_system(1)	1						c.(82-84)GAG>CAG		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						80.0	85.0	84.0					1																	101186049		2203	4300	6503	SO:0001583	missense	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101186049G>C	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.82G>C	1.37:g.101186049G>C	ENSP00000294728:p.Glu28Gln		Somatic				VCAM1_uc001dtj.2_Missense_Mutation_p.E28Q|VCAM1_uc010ouj.1_Missense_Mutation_p.E28Q	p.E28Q	NM_001078	NP_001069	WXS	Illumina HiSeq	Unspecified	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	2	202	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	28			Ig-like C2-type 1.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	c.82G>C	CCDS773.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697361	0.30142	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.69306	-0.39;-0.28;-0.28;-0.28	5.82	4.92	0.64577	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.297652	0.39687	N	0.001300	T	0.67618	0.2912	M	0.87456	2.885	0.37415	D	0.91342	B;B;P	0.46064	0.124;0.269;0.872	B;B;P	0.52189	0.079;0.108;0.692	T	0.71454	-0.4588	10	0.14656	T	0.56	-14.6548	13.1227	0.59336	0.0747:0.0:0.9253:0.0	.	28;28;28	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	Q	28	ENSP00000359137:E28Q;ENSP00000304611:E28Q;ENSP00000294728:E28Q;ENSP00000359133:E28Q	ENSP00000294728:E28Q	E	+	1	0	VCAM1	100958637	0.510000	0.26171	0.249000	0.24280	0.299000	0.27559	0.919000	0.28692	1.465000	0.48006	-0.137000	0.14449	GAG		0.413	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		8	111	0	0	0	0	8	111				
LRIF1	55791	broad.mit.edu	37	1	111494331	111494331	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:111494331C>A	ENST00000369763.4	-	2	1565	c.1175G>T	c.(1174-1176)aGa>aTa	p.R392I	LRIF1_ENST00000494675.1_Intron|LRIF1_ENST00000485275.2_Intron|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CGTGTCTTTTCTTACTGGAGT	0.388																																						uc001eaa.2		NA																	0					0						c.(1174-1176)AGA>ATA		receptor-interacting factor 1 isoform 1							180.0	185.0	184.0					1																	111494331		2203	4300	6503	SO:0001583	missense	55791				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding	g.chr1:111494331C>A	AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1175G>T	1.37:g.111494331C>A	ENSP00000358778:p.Arg392Ile		Somatic				C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	p.R392I	NM_018372	NP_060842	WXS	Illumina HiSeq	Unspecified	Q5T3J3	LRIF1_HUMAN		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)	2	1431	-		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)	392					Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	37	c.1175G>T	CCDS30800.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.057826	0.55325	.	.	ENSG00000121931	ENST00000369763	T	0.28069	1.63	5.24	4.33	0.51752	.	0.267554	0.32868	N	0.005546	T	0.22399	0.0540	N	0.19112	0.55	0.80722	D	1	D	0.57899	0.981	P	0.59012	0.85	T	0.08086	-1.0739	10	0.72032	D	0.01	-7.1992	11.4667	0.50243	0.0:0.9119:0.0:0.0881	.	392	Q5T3J3	LRIF1_HUMAN	I	392	ENSP00000358778:R392I	ENSP00000358778:R392I	R	-	2	0	LRIF1	111295854	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.285000	0.43487	1.216000	0.43427	0.591000	0.81541	AGA		0.388	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372		33	237	1	0	2.08e-15	2.54e-15	33	237				
NBPF7	343505	broad.mit.edu	37	1	120386968	120386968	+	IGR	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:120386968A>G								REG4 (32685 upstream) : ADAM30 (49187 downstream)																							CATTTGAGTTACAAGAAATTT	0.428											OREG0013730	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc010oxk.1		NA																	0				ovary(1)|skin(1)	2						c.(190-192)GTA>GCA		hypothetical protein LOC343505							105.0	118.0	114.0					1																	120386968		2097	4248	6345	SO:0001628	intergenic_variant	343505					cytoplasm		g.chr1:120386968A>G																													1.37:g.120386968A>G			Somatic	OREG0013730	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1503		p.V64A	NM_001047980	NP_001041445	WXS	Illumina HiSeq	Unspecified	P0C2Y1	NBPF7_HUMAN		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)	1	812	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)	64						Missense_Mutation	SNP		37	c.191T>C																																																																																				0	0.428									31	70	0	0	0	0	31	70				
FLG2	388698	broad.mit.edu	37	1	152327955	152327955	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:152327955G>A	ENST00000388718.5	-	3	2379	c.2307C>T	c.(2305-2307)agC>agT	p.S769S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	769	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S769S(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGGCCATAGCTAGACTGAC	0.517																																						uc001ezw.3		NA																	1	Substitution - coding silent(1)		kidney(1)	ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(2305-2307)AGC>AGT		filaggrin family member 2							412.0	337.0	362.0					1																	152327955		2203	4300	6503	SO:0001819	synonymous_variant	388698						calcium ion binding|structural molecule activity	g.chr1:152327955G>A	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2307C>T	1.37:g.152327955G>A			Somatic				uc001ezv.2_Intron	p.S769S	NM_001014342	NP_001014364	WXS	Illumina HiSeq	Unspecified	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2380	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		769			Ser-rich.		Q9H4U1	Silent	SNP	ENST00000388718.5	37	c.2307C>T	CCDS30861.1																																																																																				0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		23	411	0	0	0	0	23	411				
UBE2Q1	55585	broad.mit.edu	37	1	154523418	154523418	+	Silent	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:154523418T>C	ENST00000292211.4	-	12	1312	c.1233A>G	c.(1231-1233)aaA>aaG	p.K411K	UBE2Q1_ENST00000497453.1_5'Flank|UBE2Q1-AS1_ENST00000441613.1_RNA	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	411					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCTCACCGTTTTTTTCGTGGA	0.532																																						uc001fff.1		NA																	0					0						c.(1231-1233)AAA>AAG		ubiquitin-conjugating enzyme E2Q							214.0	203.0	206.0					1																	154523418		2203	4300	6503	SO:0001819	synonymous_variant	55585						ATP binding|protein binding|ubiquitin-protein ligase activity	g.chr1:154523418T>C	AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.1233A>G	1.37:g.154523418T>C			Somatic					p.K411K	NM_017582	NP_060052	WXS	Illumina HiSeq	Unspecified	Q7Z7E8	UB2Q1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)		12	1324	-	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		411					B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Silent	SNP	ENST00000292211.4	37	c.1233A>G	CCDS1069.1																																																																																				0.532	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090704.1	NM_017582		49	129	0	0	0	0	49	129				
SHC1	6464	broad.mit.edu	37	1	154938440	154938440	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:154938440G>A	ENST00000368445.5	-	10	1580	c.1366C>T	c.(1366-1368)Cgg>Tgg	p.R456W	SHC1_ENST00000448116.2_Missense_Mutation_p.R457W|PYGO2_ENST00000483463.1_5'Flank|SHC1_ENST00000368450.1_Missense_Mutation_p.R346W|SHC1_ENST00000606391.1_Missense_Mutation_p.R257W|SHC1_ENST00000368453.4_Missense_Mutation_p.R347W|SHC1_ENST00000368449.4_Missense_Mutation_p.R227W|SHC1_ENST00000490667.1_5'Flank	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	456	CH1.|Pro-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.R347W(1)|p.R457W(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AACAGGTCCCGGGGTGCACTG	0.562																																					NSCLC(4;32 234 1864 2492 3259 13747 17376)	uc001ffv.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(1)|skin(1)	2						c.(1366-1368)CGG>TGG		SHC-transforming protein 1 isoform 1							91.0	97.0	95.0					1																	154938440		2203	4300	6503	SO:0001583	missense	6464				activation of MAPK activity|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|positive regulation of DNA replication|Ras protein signal transduction|regulation of epidermal growth factor receptor activity|regulation of growth	cytosol|mitochondrial matrix|Shc-EGFR complex	epidermal growth factor receptor binding|insulin receptor binding|insulin-like growth factor receptor binding|phospholipid binding|protein binding|transmembrane receptor protein tyrosine kinase adaptor activity	g.chr1:154938440G>A	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.1366C>T	1.37:g.154938440G>A	ENSP00000357430:p.Arg456Trp		Somatic				SHC1_uc001ffu.2_5'Flank|SHC1_uc001ffz.1_Missense_Mutation_p.R227W|SHC1_uc001ffw.2_Missense_Mutation_p.R457W|SHC1_uc001ffx.2_Missense_Mutation_p.R347W|SHC1_uc001ffy.2_Missense_Mutation_p.R346W	p.R456W	NM_183001	NP_892113	WXS	Illumina HiSeq	Unspecified	P29353	SHC1_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		10	1587	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		456			Pro-rich.|CH1.		B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	c.1366C>T	CCDS30881.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.920|9.920	1.211823|1.211823	0.22289|0.22289	.|.	.|.	ENSG00000160691|ENSG00000160691	ENST00000444664|ENST00000368445;ENST00000448116;ENST00000368449;ENST00000368453;ENST00000368450;ENST00000368443;ENST00000368441	T|T;T;T;T;T	0.46063|0.50277	0.88|0.75;0.75;0.75;0.75;0.75	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	.|0.135206	.|0.45867	.|D	.|0.000324	T|T	0.25121|0.25121	0.0610|0.0610	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.24426	.|0.039;0.103;0.017	.|B;B;B	.|0.18263	.|0.004;0.021;0.006	T|T	0.15578|0.15578	-1.0432|-1.0432	7|10	0.40728|0.51188	T|T	0.16|0.08	-21.3112|-21.3112	11.3481|11.3481	0.49573|0.49573	0.0:0.0:0.6896:0.3104|0.0:0.0:0.6896:0.3104	.|.	.|235;457;456	.|Q59HB0;P29353-6;P29353	.|.;.;SHC1_HUMAN	L|W	119|456;457;257;347;346;393;128	ENSP00000396333:P119L|ENSP00000357430:R456W;ENSP00000401303:R457W;ENSP00000357434:R257W;ENSP00000357438:R347W;ENSP00000357435:R346W	ENSP00000396333:P119L|ENSP00000357426:R128W	P|R	-|-	2|1	0|2	SHC1|SHC1	153205064|153205064	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.092000|0.092000	0.18411|0.18411	2.991000|2.991000	0.49409|0.49409	2.287000|2.287000	0.76781|0.76781	0.455000|0.455000	0.32223|0.32223	CCG|CGG		0.562	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001		26	91	0	0	0	0	26	91				
OR6N1	128372	broad.mit.edu	37	1	158735880	158735880	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:158735880A>G	ENST00000335094.2	-	1	612	c.593T>C	c.(592-594)gTa>gCa	p.V198A		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					AACAAAATCTACTAGGACATT	0.483																																						uc010piq.1		NA																	0				ovary(1)	1						c.(592-594)GTA>GCA		olfactory receptor, family 6, subfamily N,							104.0	111.0	109.0					1																	158735880		2203	4300	6503	SO:0001583	missense	128372				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158735880A>G	BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.593T>C	1.37:g.158735880A>G	ENSP00000335535:p.Val198Ala		Somatic					p.V198A	NM_001005185	NP_001005185	WXS	Illumina HiSeq	Unspecified	Q8NGY5	OR6N1_HUMAN			1	593	-	all_hematologic(112;0.0378)		198			Helical; Name=5; (Potential).		Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	c.593T>C	CCDS30905.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.246491	0.59103	.	.	ENSG00000197403	ENST00000335094	T	0.38077	1.16	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41823	D	0.000810	T	0.35941	0.0949	L	0.39020	1.185	0.33627	D	0.605586	D	0.89917	1.0	D	0.87578	0.998	T	0.18461	-1.0336	10	0.31617	T	0.26	-13.7675	13.4224	0.61005	1.0:0.0:0.0:0.0	.	198	Q8NGY5	OR6N1_HUMAN	A	198	ENSP00000335535:V198A	ENSP00000335535:V198A	V	-	2	0	OR6N1	157002504	0.000000	0.05858	1.000000	0.80357	0.944000	0.59088	0.578000	0.23773	1.986000	0.57962	0.533000	0.62120	GTA		0.483	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		10	90	0	0	0	0	10	90				
CFAP45	25790	broad.mit.edu	37	1	159842833	159842833	+	Missense_Mutation	SNP	C	C	T	rs375439463		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:159842833C>T	ENST00000368099.4	-	11	1542	c.1478G>A	c.(1477-1479)cGg>cAg	p.R493Q	RP11-190A12.7_ENST00000544342.1_5'Flank|CCDC19_ENST00000426543.2_Missense_Mutation_p.R408Q|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			GGTGGCAATCCGGTTCTGCAC	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19243	0.0		0.0	False		,,,				2504	0.0					uc001fui.2		NA																	0				ovary(1)	1						c.(1477-1479)CGG>CAG		nasopharyngeal epithelium specific protein 1		C	GLN/ARG	0,4406		0,0,2203	84.0	80.0	81.0		1478	5.3	1.0	1		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC19	NM_012337.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	493/552	159842833	1,13005	2203	4300	6503	SO:0001583	missense	25790					mitochondrion|soluble fraction		g.chr1:159842833C>T																												ENST00000368099.4:c.1478G>A	1.37:g.159842833C>T	ENSP00000357079:p.Arg493Gln		Somatic				CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Missense_Mutation_p.R408Q|CCDC19_uc001ful.2_Missense_Mutation_p.R408Q	p.R493Q	NM_012337	NP_036469	WXS	Illumina HiSeq	Unspecified	Q9UL16	CCD19_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.151)		11	1496	-	all_hematologic(112;0.0597)		493			Potential.			Missense_Mutation	SNP	ENST00000368099.4	37	c.1478G>A	CCDS30914.1	.	.	.	.	.	.	.	.	.	.	C	35	5.482361	0.96307	0.0	1.16E-4	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.11712	2.75;2.75	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00425	-1.1747	9	.	.	.	-24.1753	16.7324	0.85438	0.0:1.0:0.0:0.0	.	493	Q9UL16	CCD19_HUMAN	Q	493;408	ENSP00000357079:R493Q;ENSP00000403044:R408Q	.	R	-	2	0	CCDC19	158109457	1.000000	0.71417	0.993000	0.49108	0.959000	0.62525	6.265000	0.72534	2.609000	0.88269	0.655000	0.94253	CGG		0.597	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085979.1			6	77	0	0	0	0	6	77				
PLA2G4A	5321	broad.mit.edu	37	1	186909195	186909195	+	Silent	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:186909195C>T	ENST00000367466.3	+	10	1154	c.1002C>T	c.(1000-1002)gtC>gtT	p.V334V	PLA2G4A_ENST00000442353.2_Silent_p.V274V	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	334	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	GTCTTCATGTCAAACCTGACG	0.418																																						uc001gsc.2		NA																	0				lung(2)|breast(1)	3						c.(1000-1002)GTC>GTT		cytosolic phospholipase A2, group IVA	Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)						156.0	145.0	149.0					1																	186909195		2203	4300	6503	SO:0001819	synonymous_variant	5321				phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity	g.chr1:186909195C>T	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1002C>T	1.37:g.186909195C>T			Somatic				PLA2G4A_uc010pos.1_Silent_p.V274V	p.V334V	NM_024420	NP_077734	WXS	Illumina HiSeq	Unspecified	P47712	PA24A_HUMAN			10	1207	+			334			PLA2c.		B1AKG4|Q29R80	Silent	SNP	ENST00000367466.3	37	c.1002C>T	CCDS1372.1																																																																																				0.418	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420		5	87	0	0	0	0	5	87				
CR1L	1379	broad.mit.edu	37	1	207867934	207867934	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:207867934A>G	ENST00000508064.2	+	5	760	c.700A>G	c.(700-702)Aat>Gat	p.N234D	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	234	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CACGCCTCCAAATGTGGAAAA	0.473																																						uc001hga.3		NA																	0					0						c.(700-702)AAT>GAT		complement component (3b/4b) receptor 1-like							188.0	181.0	183.0					1																	207867934		1864	4108	5972	SO:0001583	missense	1379					cytoplasm|extracellular region|membrane		g.chr1:207867934A>G	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.700A>G	1.37:g.207867934A>G	ENSP00000421736:p.Asn234Asp		Somatic				CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	p.N234D	NM_175710	NP_783641	WXS	Illumina HiSeq	Unspecified	Q2VPA4	CR1L_HUMAN			5	821	+			234			Sushi 4.		Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	37	c.700A>G	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	A	3.242	-0.155219	0.06544	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.61742	0.08	2.38	-4.75	0.03239	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.21186	0.0510	N	0.03071	-0.42	0.09310	N	1	B	0.06786	0.001	B	0.14578	0.011	T	0.16012	-1.0417	9	0.09590	T	0.72	.	1.492	0.02459	0.1998:0.2422:0.4099:0.1481	.	234	Q2VPA4	CR1L_HUMAN	D	234	ENSP00000421736:N234D	ENSP00000434864:N178D	N	+	1	0	CR1L	205934557	0.000000	0.05858	0.029000	0.17559	0.350000	0.29205	-0.364000	0.07583	-1.858000	0.01158	0.248000	0.18094	AAT		0.473	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735		8	338	0	0	0	0	8	338				
SLC30A10	55532	broad.mit.edu	37	1	220088985	220088985	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:220088985G>C	ENST00000366926.3	-	4	1425	c.1264C>G	c.(1264-1266)Ctg>Gtg	p.L422V	SLC30A10_ENST00000536446.1_Missense_Mutation_p.L177V|SLC30A10_ENST00000484079.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	422					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		ACGTGAGCCAGAGGCAGTGCC	0.567																																					Colon(76;360 1614 43677 51136)	uc001hlw.2		NA																	0					0						c.(1264-1266)CTG>GTG		solute carrier family 30 (zinc transporter),							94.0	91.0	92.0					1																	220088985		2203	4300	6503	SO:0001583	missense	55532				zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr1:220088985G>C	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1264C>G	1.37:g.220088985G>C	ENSP00000355893:p.Leu422Val		Somatic				SLC30A10_uc001hlu.1_Intron|SLC30A10_uc001hlv.2_Missense_Mutation_p.L177V|SLC30A10_uc001hlx.2_Missense_Mutation_p.L197V	p.L422V	NM_018713	NP_061183	WXS	Illumina HiSeq	Unspecified	Q6XR72	ZNT10_HUMAN		GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)	4	1475	-			422			Cytoplasmic (Potential).		Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	c.1264C>G	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	G	5.680	0.310007	0.10733	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.67523	-0.27;0.32	6.02	3.13	0.36017	.	0.368243	0.23338	N	0.049266	T	0.49677	0.1571	L	0.34521	1.04	0.19575	N	0.999966	B	0.18310	0.027	B	0.15052	0.012	T	0.30297	-0.9983	9	.	.	.	-13.2069	7.0659	0.25151	0.1975:0.124:0.6784:0.0	.	422	Q6XR72	ZNT10_HUMAN	V	422;177	ENSP00000355893:L422V;ENSP00000439489:L177V	.	L	-	1	2	SLC30A10	218155608	0.990000	0.36364	0.488000	0.27440	0.162000	0.22319	2.158000	0.42329	0.425000	0.26087	0.650000	0.86243	CTG		0.567	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713		31	61	0	0	0	0	31	61				
HNRNPU	3192	broad.mit.edu	37	1	245019248	245019248	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr1:245019248G>A	ENST00000283179.9	-	11	2288	c.2125C>T	c.(2125-2127)Cgt>Tgt	p.R709C	HNRNPU-AS1_ENST00000475997.1_RNA|HNRNPU_ENST00000444376.2_Missense_Mutation_p.R690C|HNRNPU-AS1_ENST00000489705.1_RNA			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	709	Gly-rich.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			AATCCTCCACGTCCTCTATGG	0.403																																					NSCLC(33;911 1010 3329 23631 49995)	uc001iaz.1		NA																	0					0						c.(2125-2127)CGT>TGT		heterogeneous nuclear ribonucleoprotein U							186.0	175.0	179.0					1																	245019248		2203	4300	6503	SO:0001583	missense	3192				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding	g.chr1:245019248G>A	X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.2125C>T	1.37:g.245019248G>A	ENSP00000283179:p.Arg709Cys		Somatic				HNRNPU_uc001iaw.1_RNA|HNRNPU_uc001iax.1_RNA|HNRNPU_uc001iay.1_Missense_Mutation_p.R433C|HNRNPU_uc001iba.1_Missense_Mutation_p.R690C	p.R709C	NM_031844	NP_114032	WXS	Illumina HiSeq	Unspecified	Q00839	HNRPU_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00868)		11	2343	-	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		709			Gly-rich.		O75507|Q8N174|Q96HY9|Q9BQ09	Missense_Mutation	SNP	ENST00000283179.9	37	c.2125C>T	CCDS41479.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998428	0.54147	.	.	ENSG00000153187	ENST00000444376;ENST00000283179;ENST00000427948	T;T	0.55930	0.49;0.53	5.7	5.7	0.88788	.	0.049640	0.85682	D	0.000000	T	0.71888	0.3393	M	0.68317	2.08	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;P;P	0.67231	0.95;0.893;0.749	T	0.73248	-0.4043	10	0.72032	D	0.01	-8.9443	19.8463	0.96708	0.0:0.0:1.0:0.0	.	690;709;433	Q00839-2;Q00839;Q5RI19	.;HNRPU_HUMAN;.	C	690;709;634	ENSP00000393151:R690C;ENSP00000283179:R709C	ENSP00000283179:R709C	R	-	1	0	HNRNPU	243085871	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.108000	0.77055	2.688000	0.91661	0.655000	0.94253	CGT		0.403	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097163.3	NM_031844		12	206	0	0	0	0	12	206				
FBXO18	84893	broad.mit.edu	37	10	5958323	5958323	+	Silent	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:5958323T>C	ENST00000362091.4	+	10	1807	c.1692T>C	c.(1690-1692)ttT>ttC	p.F564F	FBXO18_ENST00000397269.3_Silent_p.F51F|FBXO18_ENST00000379999.5_Silent_p.F615F	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	564					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AAAACTTCTTTGCCTCGGCTG	0.468																																						uc001iis.2		NA																	0				ovary(2)|skin(1)	3						c.(1690-1692)TTT>TTC		F-box only protein, helicase, 18 isoform 2							163.0	143.0	150.0					10																	5958323		2203	4300	6503	SO:0001819	synonymous_variant	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5958323T>C	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1692T>C	10.37:g.5958323T>C			Somatic				FBXO18_uc001iir.2_Silent_p.F490F|FBXO18_uc009xig.2_Silent_p.F490F|FBXO18_uc001iit.2_Silent_p.F615F	p.F564F	NM_178150	NP_835363	WXS	Illumina HiSeq	Unspecified	Q8NFZ0	FBX18_HUMAN			10	1787	+			564					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Silent	SNP	ENST00000362091.4	37	c.1692T>C	CCDS7072.1																																																																																				0.468	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		6	98	0	0	0	0	6	98				
CUBN	8029	broad.mit.edu	37	10	17126316	17126316	+	Missense_Mutation	SNP	T	T	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:17126316T>A	ENST00000377833.4	-	17	2320	c.2255A>T	c.(2254-2256)cAc>cTc	p.H752L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	752	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGCTCCACGTGGGTGAAGTT	0.438																																						uc001ioo.2		NA																	0				ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19						c.(2254-2256)CAC>CTC		cubilin precursor	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)						169.0	154.0	159.0					10																	17126316		2203	4300	6503	SO:0001583	missense	8029				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity	g.chr10:17126316T>A	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2255A>T	10.37:g.17126316T>A	ENSP00000367064:p.His752Leu		Somatic					p.H752L	NM_001081	NP_001072	WXS	Illumina HiSeq	Unspecified	O60494	CUBN_HUMAN			17	2307	-			752			CUB 3.		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	c.2255A>T	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867580	0.51588	.	.	ENSG00000107611	ENST00000377833	T	0.17854	2.25	5.69	2.05	0.26809	CUB (5);	0.904818	0.09224	N	0.831569	T	0.15912	0.0383	M	0.69823	2.125	0.80722	D	1	P	0.40360	0.714	B	0.30716	0.119	T	0.08785	-1.0705	10	0.34782	T	0.22	.	5.8544	0.18712	0.124:0.1377:0.0:0.7383	.	752	O60494	CUBN_HUMAN	L	752	ENSP00000367064:H752L	ENSP00000367064:H752L	H	-	2	0	CUBN	17166322	0.974000	0.33945	0.798000	0.32154	0.865000	0.49528	2.579000	0.46059	0.094000	0.17404	0.533000	0.62120	CAC		0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081		7	62	0	0	0	0	7	62				
KIAA1462	57608	broad.mit.edu	37	10	30315990	30315990	+	Silent	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:30315990C>G	ENST00000375377.1	-	3	3188	c.3087G>C	c.(3085-3087)ggG>ggC	p.G1029G		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1029					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GGAGCCCTGCCCCCCTCTCTC	0.587																																						uc001iux.2		NA																	0				ovary(4)	4						c.(3085-3087)GGG>GGC		hypothetical protein LOC57608							92.0	92.0	92.0					10																	30315990		1889	4105	5994	SO:0001819	synonymous_variant	57608							g.chr10:30315990C>G	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3087G>C	10.37:g.30315990C>G			Somatic				KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Silent_p.G891G|KIAA1462_uc009xle.1_Silent_p.G1029G	p.G1029G	NM_020848	NP_065899	WXS	Illumina HiSeq	Unspecified	Q9P266	K1462_HUMAN			2	3146	-			1029					Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	ENST00000375377.1	37	c.3087G>C	CCDS41500.1																																																																																				0.587	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848		27	96	0	0	0	0	27	96				
ZNF239	8187	broad.mit.edu	37	10	44052206	44052206	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:44052206C>A	ENST00000306006.6	-	2	1974	c.1322G>T	c.(1321-1323)aGc>aTc	p.S441I	ZNF239_ENST00000374446.2_Missense_Mutation_p.S441I|ZNF239_ENST00000426961.1_Missense_Mutation_p.S441I|ZNF239_ENST00000535642.1_Missense_Mutation_p.S441I|ZNF239_ENST00000491188.1_5'Flank	NM_005674.2	NP_005665.2	Q16600	ZN239_HUMAN	zinc finger protein 239	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GGAGCTCTGGCTGAAGCCCTT	0.502																																						uc001jaw.3		NA																	0					0						c.(1321-1323)AGC>ATC		zinc finger protein 239							63.0	69.0	67.0					10																	44052206		2202	4300	6502	SO:0001583	missense	8187				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|RNA binding|zinc ion binding	g.chr10:44052206C>A	X82125	CCDS41502.1	10q11.22-q11.23	2013-01-08			ENSG00000196793	ENSG00000196793		"""Zinc fingers, C2H2-type"""	13031	protein-coding gene	gene with protein product		601069				8903737, 8587123	Standard	NM_005674		Approved	MOK2, HOK-2	uc009xmk.3	Q16600	OTTHUMG00000018033	ENST00000306006.6:c.1322G>T	10.37:g.44052206C>A	ENSP00000307774:p.Ser441Ile		Somatic				ZNF239_uc001jax.3_Missense_Mutation_p.S441I|ZNF239_uc009xmj.2_Missense_Mutation_p.S441I|ZNF239_uc009xmk.2_Missense_Mutation_p.S441I	p.S441I	NM_005674	NP_005665	WXS	Illumina HiSeq	Unspecified	Q16600	ZN239_HUMAN			2	1975	-			441			C2H2-type 9.		Q5T1G9|Q8TAS5	Missense_Mutation	SNP	ENST00000306006.6	37	c.1322G>T	CCDS41502.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.848089	0.51164	.	.	ENSG00000196793	ENST00000306006;ENST00000374446;ENST00000426961;ENST00000535642;ENST00000339962	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	3.25	3.25	0.37280	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45836	0.1362	L	0.41356	1.27	0.28448	N	0.916499	D	0.89917	1.0	D	0.91635	0.999	T	0.21314	-1.0249	9	0.46703	T	0.11	-17.6278	6.4971	0.22148	0.0:0.8717:0.0:0.1283	.	441	Q16600	ZN239_HUMAN	I	441	ENSP00000307774:S441I;ENSP00000363569:S441I;ENSP00000398202:S441I;ENSP00000443907:S441I	ENSP00000307774:S441I	S	-	2	0	ZNF239	43372212	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-1.558000	0.02164	2.129000	0.65627	0.650000	0.86243	AGC		0.502	ZNF239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047710.1			5	28	1	0	0.00116845	0.00126263	5	28				
BICC1	80114	broad.mit.edu	37	10	60461890	60461890	+	Silent	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:60461890C>A	ENST00000373886.3	+	3	298	c.294C>A	c.(292-294)gcC>gcA	p.A98A		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	98					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						AGATCGGAGCCAAATCCAAGA	0.373																																						uc001jki.1		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(292-294)GCC>GCA		bicaudal C homolog 1							58.0	54.0	56.0					10																	60461890		2203	4300	6503	SO:0001819	synonymous_variant	80114				multicellular organismal development		RNA binding	g.chr10:60461890C>A	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.294C>A	10.37:g.60461890C>A			Somatic					p.A98A	NM_001080512	NP_001073981	WXS	Illumina HiSeq	Unspecified	Q9H694	BICC1_HUMAN			3	294	+			98						Silent	SNP	ENST00000373886.3	37	c.294C>A	CCDS31206.1																																																																																				0.373	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044		6	33	1	0	0.00116845	0.00126263	6	33				
LRIT1	26103	broad.mit.edu	37	10	85992510	85992510	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:85992510G>T	ENST00000372105.3	-	4	1066	c.1045C>A	c.(1045-1047)Ccg>Acg	p.P349T		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	349						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						GTGGAAGTCGGTGGCTCAGTG	0.567																																						uc001kcz.1		NA																	0					0						c.(1045-1047)CCG>ACG		retina specific protein PAL							57.0	48.0	51.0					10																	85992510		2203	4300	6503	SO:0001583	missense	26103					integral to endoplasmic reticulum membrane		g.chr10:85992510G>T	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1045C>A	10.37:g.85992510G>T	ENSP00000361177:p.Pro349Thr		Somatic					p.P349T	NM_015613	NP_056428	WXS	Illumina HiSeq	Unspecified	Q9P2V4	LRIT1_HUMAN			4	1067	-			349			Lumenal (Potential).		Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	c.1045C>A	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	G	0.043	-1.274960	0.01410	.	.	ENSG00000148602	ENST00000372105	T	0.69040	-0.37	5.8	4.84	0.62591	Immunoglobulin-like fold (1);	0.723862	0.14620	N	0.308448	T	0.48370	0.1496	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.30765	-0.9967	10	0.48119	T	0.1	.	9.168	0.37063	0.0:0.234:0.6222:0.1438	.	349	Q9P2V4	LRIT1_HUMAN	T	349	ENSP00000361177:P349T	ENSP00000361177:P349T	P	-	1	0	LRIT1	85982490	0.000000	0.05858	0.009000	0.14445	0.012000	0.07955	0.720000	0.25896	2.749000	0.94314	0.655000	0.94253	CCG		0.567	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613		3	35	1	0	0.004672	0.00496111	3	35				
ACTA2	59	broad.mit.edu	37	10	90707105	90707105	+	Silent	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:90707105C>G	ENST00000458208.1	-	3	642	c.168G>C	c.(166-168)gtG>gtC	p.V56V	STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000480297.1_5'UTR|ACTA2_ENST00000224784.6_Silent_p.V56V	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	56					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		CTTCGTCACCCACGTAGCTGT	0.473																																						uc001kfp.2		NA																	0					0						c.(166-168)GTG>GTC		alpha 2 actin							359.0	295.0	317.0					10																	90707105		2203	4300	6503	SO:0001819	synonymous_variant	59				response to virus	cytosol	ATP binding	g.chr10:90707105C>G	X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.168G>C	10.37:g.90707105C>G			Somatic				STAMBPL1_uc010qmx.1_Intron|ACTA2_uc010qmy.1_Silent_p.V11V|ACTA2_uc001kfq.2_Silent_p.V56V|ACTA2_uc010qmz.1_Silent_p.V56V	p.V56V	NM_001613	NP_001604	WXS	Illumina HiSeq	Unspecified	P62736	ACTA_HUMAN		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)	3	284	-		Colorectal(252;0.0161)	56					B2R8A4|P03996|P04108|Q6FI19	Silent	SNP	ENST00000458208.1	37	c.168G>C	CCDS7392.1																																																																																				0.473	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049264.1	NM_001613		34	117	0	0	0	0	34	117				
HPS1	3257	broad.mit.edu	37	10	100195167	100195167	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:100195167C>G	ENST00000325103.6	-	5	493	c.260G>C	c.(259-261)gGa>gCa	p.G87A	HPS1_ENST00000338546.5_Missense_Mutation_p.G87A|HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Missense_Mutation_p.G87A	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	87					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		CAGGCATTCTCCAAACTGCAG	0.597									Hermansky-Pudlak syndrome																													uc010qpf.1		NA																	0				skin(1)	1						c.(259-261)GGA>GCA		Hermansky-Pudlak syndrome 1 protein isoform a							91.0	83.0	86.0					10																	100195167		2203	4300	6503	SO:0001583	missense	3257	Hermansky-Pudlak_syndrome	Familial Cancer Database	HPS, HPS1-8	lysosome organization|response to stimulus|visual perception	cytoplasmic membrane-bounded vesicle|integral to plasma membrane|lysosome|membrane fraction|soluble fraction	protein dimerization activity	g.chr10:100195167C>G	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.260G>C	10.37:g.100195167C>G	ENSP00000326649:p.Gly87Ala		Somatic				HPS1_uc001kpi.1_Missense_Mutation_p.G87A|HPS1_uc001kpj.1_Missense_Mutation_p.G27A|HPS1_uc001kpk.1_Intron|HPS1_uc009xwb.2_RNA|HPS1_uc010qph.1_Missense_Mutation_p.G87A|HPS1_uc001kpl.2_Missense_Mutation_p.G87A	p.G87A	NM_000195	NP_000186	WXS	Illumina HiSeq	Unspecified	Q92902	HPS1_HUMAN		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)	5	506	-		Colorectal(252;0.234)	87					A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Missense_Mutation	SNP	ENST00000325103.6	37	c.260G>C	CCDS7475.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166097	0.57476	.	.	ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891;ENST00000338546	T;T;T	0.28255	1.62;1.62;1.62	5.32	4.42	0.53409	.	0.098818	0.64402	D	0.000002	T	0.56001	0.1956	M	0.78637	2.42	0.51767	D	0.99993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.988	T	0.61217	-0.7107	10	0.66056	D	0.02	.	13.6027	0.62029	0.0:0.9256:0.0:0.0744	.	87;87;87;87	Q92902;Q92902-3;Q8WXE5;D3DR62	HPS1_HUMAN;.;.;.	A	87	ENSP00000326649:G87A;ENSP00000355310:G87A;ENSP00000343638:G87A	ENSP00000326649:G87A	G	-	2	0	HPS1	100185157	1.000000	0.71417	0.998000	0.56505	0.656000	0.38851	3.125000	0.50469	1.240000	0.43803	0.555000	0.69702	GGA		0.597	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	NM_000195, NM_182637, NM_182638, NM_182639		5	55	0	0	0	0	5	55				
CNNM1	26507	broad.mit.edu	37	10	101090475	101090475	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:101090475C>G	ENST00000356713.4	+	1	1620	c.1331C>G	c.(1330-1332)tCa>tGa	p.S444*	CNNM1_ENST00000370534.4_Nonsense_Mutation_p.S79*|CNNM1_ENST00000446890.1_Nonsense_Mutation_p.S373*|CNNM1_ENST00000370528.3_Nonsense_Mutation_p.S373*	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	444	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.			S -> P (in Ref. 4; AAH98307). {ECO:0000305}.	ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		ATGCTGCGCTCAGACGCGGTG	0.612																																						uc001kpp.3		NA																	0					0						c.(1330-1332)TCA>TGA		cyclin M1							79.0	66.0	70.0					10																	101090475		2203	4300	6503	SO:0001587	stop_gained	26507				ion transport	integral to membrane|plasma membrane		g.chr10:101090475C>G	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1331C>G	10.37:g.101090475C>G	ENSP00000349147:p.Ser444*		Somatic				CNNM1_uc009xwe.2_Nonsense_Mutation_p.S444*|CNNM1_uc010qpi.1_Nonsense_Mutation_p.S444*|CNNM1_uc009xwf.2_Nonsense_Mutation_p.S444*	p.S444*	NM_020348	NP_065081	WXS	Illumina HiSeq	Unspecified	Q9NRU3	CNNM1_HUMAN		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)	1	1620	+		Colorectal(252;0.234)	444	S -> P (in Ref. 4; AAH98307).		CBS 1.		Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Nonsense_Mutation	SNP	ENST00000356713.4	37	c.1331C>G	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	C	42	9.632001	0.99224	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-10.2673	17.7065	0.88310	0.0:1.0:0.0:0.0	.	.	.	.	X	444;373;373;79	.	ENSP00000349147:S444X	S	+	2	0	CNNM1	101080465	1.000000	0.71417	0.971000	0.41717	0.996000	0.88848	7.646000	0.83445	2.517000	0.84864	0.462000	0.41574	TCA		0.612	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348		8	47	0	0	0	0	8	47				
ELOVL3	83401	broad.mit.edu	37	10	103989006	103989006	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:103989006G>T	ENST00000370005.3	+	4	1031	c.810G>T	c.(808-810)caG>caT	p.Q270H		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	270					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		CCAAGAGCCAGTGAAGGTTTG	0.493											OREG0020475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc001kut.2		NA																	0				ovary(2)	2						c.(808-810)CAG>CAT		elongation of very long chain fatty acids like							85.0	82.0	83.0					10																	103989006		2203	4300	6503	SO:0001583	missense	83401				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding	g.chr10:103989006G>T	AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.810G>T	10.37:g.103989006G>T	ENSP00000359022:p.Gln270His		Somatic	OREG0020475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1378		p.Q270H	NM_152310	NP_689523	WXS	Illumina HiSeq	Unspecified	Q9HB03	ELOV3_HUMAN		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)	4	973	+		Colorectal(252;0.207)	270			Di-lysine motif (Potential).		Q5VZL3|Q8N180	Missense_Mutation	SNP	ENST00000370005.3	37	c.810G>T	CCDS7531.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845592	0.32606	.	.	ENSG00000119915	ENST00000370005	T	0.23147	1.92	5.36	1.46	0.22682	.	0.632641	0.14678	N	0.304932	T	0.21468	0.0517	L	0.54323	1.7	0.27274	N	0.958283	B	0.13145	0.007	B	0.14023	0.01	T	0.24225	-1.0166	10	0.72032	D	0.01	-16.9664	4.3994	0.11379	0.414:0.0:0.4379:0.148	.	270	Q9HB03	ELOV3_HUMAN	H	270	ENSP00000359022:Q270H	ENSP00000359022:Q270H	Q	+	3	2	ELOVL3	103978996	1.000000	0.71417	0.976000	0.42696	0.700000	0.40528	1.391000	0.34475	0.008000	0.14787	-0.145000	0.13849	CAG		0.493	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050030.1	NM_152310		3	41	1	0	0.004672	0.00496111	3	41				
CFAP43	80217	broad.mit.edu	37	10	105967445	105967445	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr10:105967445C>A	ENST00000278064.2	-	6	988	c.663G>T	c.(661-663)aaG>aaT	p.K221N	WDR96_ENST00000357060.3_Missense_Mutation_p.K291N|WDR96_ENST00000369720.1_Missense_Mutation_p.K221N|WDR96_ENST00000428666.1_Missense_Mutation_p.K291N|WDR96_ENST00000369719.1_Missense_Mutation_p.K221N																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCTCTTCTATCTTATTAAGTA	0.393																																						uc001kxw.2		NA																	0					0						c.(871-873)AAG>AAT		hypothetical protein LOC80217							131.0	126.0	127.0					10																	105967445		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105967445C>A																												ENST00000278064.2:c.663G>T	10.37:g.105967445C>A	ENSP00000278064:p.Lys221Asn		Somatic				C10orf79_uc001kxx.3_Missense_Mutation_p.K291N|C10orf79_uc001kxy.1_Missense_Mutation_p.K291N|C10orf79_uc001kxz.2_Missense_Mutation_p.K291N	p.K291N	NM_025145	NP_079421	WXS	Illumina HiSeq	Unspecified	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	6	989	-		Colorectal(252;0.178)	291						Missense_Mutation	SNP	ENST00000278064.2	37	c.873G>T		.	.	.	.	.	.	.	.	.	.	C	12.19	1.864562	0.32977	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064;ENST00000369720;ENST00000369719	T;T;T;T;T	0.71579	2.51;2.5;2.49;1.49;-0.58	5.56	2.7	0.31948	WD40 repeat-like-containing domain (1);	0.155276	0.30356	N	0.009817	T	0.73753	0.3627	M	0.65975	2.015	0.09310	N	1	P;D;P	0.57571	0.473;0.98;0.507	B;P;B	0.55615	0.19;0.78;0.112	T	0.63328	-0.6662	10	0.46703	T	0.11	.	6.6943	0.23191	0.0:0.5991:0.0:0.4009	.	291;291;291	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	N	291;291;221;221;221	ENSP00000349568:K291N;ENSP00000400289:K291N;ENSP00000278064:K221N;ENSP00000358734:K221N;ENSP00000358733:K221N	ENSP00000278064:K221N	K	-	3	2	WDR96	105957435	0.324000	0.24652	0.010000	0.14722	0.001000	0.01503	0.579000	0.23788	0.833000	0.34828	-0.781000	0.03364	AAG		0.393	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1			13	98	1	0	0.00010058	0.000112367	13	98				
OR52N1	79473	broad.mit.edu	37	11	5809578	5809578	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:5809578G>T	ENST00000317078.1	-	1	468	c.469C>A	c.(469-471)Ctt>Att	p.L157I	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GGGATAACAAGCATCACACCC	0.507																																						uc010qzo.1		NA																	0				skin(1)	1						c.(469-471)CTT>ATT		olfactory receptor, family 52, subfamily N,							133.0	113.0	120.0					11																	5809578		2201	4296	6497	SO:0001583	missense	79473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5809578G>T	AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.469C>A	11.37:g.5809578G>T	ENSP00000322823:p.Leu157Ile		Somatic				TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.L157I	NM_001001913	NP_001001913	WXS	Illumina HiSeq	Unspecified	Q8NH53	O52N1_HUMAN		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)	1	469	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	157			Helical; Name=4; (Potential).		Q6IFF6	Missense_Mutation	SNP	ENST00000317078.1	37	c.469C>A	CCDS31398.1	.	.	.	.	.	.	.	.	.	.	G	9.583	1.123994	0.20959	.	.	ENSG00000181001	ENST00000317078	T	0.38560	1.13	4.59	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.155822	0.29783	N	0.011212	T	0.51312	0.1667	M	0.67517	2.055	0.09310	N	1	P	0.51147	0.942	D	0.64595	0.927	T	0.34079	-0.9843	10	0.20046	T	0.44	.	5.1483	0.14996	0.3636:0.0:0.6364:0.0	.	157	Q8NH53	O52N1_HUMAN	I	157	ENSP00000322823:L157I	ENSP00000322823:L157I	L	-	1	0	OR52N1	5766154	0.000000	0.05858	0.511000	0.27724	0.403000	0.30841	-0.637000	0.05459	1.264000	0.44198	0.609000	0.83330	CTT		0.507	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913		9	35	1	0	0.000442599	0.000484375	9	35				
OR10A2	341276	broad.mit.edu	37	11	6891559	6891559	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:6891559C>G	ENST00000307322.4	+	1	636	c.574C>G	c.(574-576)Ctg>Gtg	p.L192V		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CGGAACCATTCTGGTGGTCAT	0.502																																						uc001meu.1		NA																	0				breast(1)	1						c.(574-576)CTG>GTG		olfactory receptor, family 10, subfamily A,							265.0	199.0	222.0					11																	6891559		2201	4296	6497	SO:0001583	missense	341276				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6891559C>G	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.574C>G	11.37:g.6891559C>G	ENSP00000303862:p.Leu192Val		Somatic					p.L192V	NM_001004460	NP_001004460	WXS	Illumina HiSeq	Unspecified	Q9H208	O10A2_HUMAN		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)	1	574	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	192			Helical; Name=5; (Potential).		B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	37	c.574C>G	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	c	4.979	0.181766	0.09495	.	.	ENSG00000170790	ENST00000307322	T	0.39229	1.09	4.18	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000364	T	0.32224	0.0822	L	0.35341	1.055	0.29058	N	0.884111	B	0.23806	0.091	B	0.33690	0.168	T	0.24368	-1.0162	10	0.39692	T	0.17	.	7.0193	0.24904	0.0:0.7895:0.0:0.2105	.	192	Q9H208	O10A2_HUMAN	V	192	ENSP00000303862:L192V	ENSP00000303862:L192V	L	+	1	2	OR10A2	6848135	0.000000	0.05858	0.490000	0.27465	0.251000	0.25915	-0.944000	0.03913	1.098000	0.41479	0.650000	0.86243	CTG		0.502	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460		20	106	0	0	0	0	20	106				
CALCA	796	broad.mit.edu	37	11	14989343	14989343	+	Silent	SNP	T	T	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:14989343T>G	ENST00000486207.1	-	3	293	c.285A>C	c.(283-285)gcA>gcC	p.A95A	CALCB_ENST00000523376.1_Intron|CALCA_ENST00000361010.3_Silent_p.A95A			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	95					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						TCAGCAAGCCTGCCAGCCGAT	0.542																																						uc001mlt.1		NA																	0				central_nervous_system(1)	1						c.(283-285)GCA>GCC		calcitonin isoform CGRP preproprotein	Phentolamine(DB00692)						71.0	70.0	71.0					11																	14989343		2200	4294	6494	SO:0001819	synonymous_variant	796				activation of adenylate cyclase activity|cell-cell signaling|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|endothelial cell migration|endothelial cell proliferation|leukocyte cell-cell adhesion|negative regulation of blood pressure|negative regulation of bone resorption|negative regulation of calcium ion transport into cytosol|negative regulation of osteoclast differentiation|neurological system process involved in regulation of systemic arterial blood pressure|positive regulation of interleukin-1 alpha production|positive regulation of interleukin-8 production|positive regulation of macrophage differentiation|positive regulation of vasodilation|regulation of blood pressure|vasculature development|vasodilation	cytosol|extracellular space	hormone activity	g.chr11:14989343T>G	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.285A>C	11.37:g.14989343T>G			Somatic				CALCA_uc001mlu.1_RNA	p.A95A	NM_001033953	NP_001029125	WXS	Illumina HiSeq	Unspecified	P06881	CALCA_HUMAN			4	360	-			95					Q93048|Q9UCP0	Silent	SNP	ENST00000486207.1	37	c.285A>C	CCDS31432.1																																																																																				0.542	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741		10	75	0	0	0	0	10	75				
OR4C12	283093	broad.mit.edu	37	11	50003965	50003965	+	Missense_Mutation	SNP	T	T	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:50003965T>G	ENST00000335238.4	-	1	106	c.73A>C	c.(73-75)Acg>Ccg	p.T25P		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						ACTACAAACGTGACTTTCTCC	0.408																																						uc010ria.1		NA																	0				ovary(2)|skin(1)	3						c.(73-75)ACG>CCG		olfactory receptor, family 4, subfamily C,							63.0	60.0	61.0					11																	50003965		2201	4296	6497	SO:0001583	missense	283093				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:50003965T>G	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.73A>C	11.37:g.50003965T>G	ENSP00000334418:p.Thr25Pro		Somatic					p.T25P	NM_001005270	NP_001005270	WXS	Illumina HiSeq	Unspecified	Q96R67	OR4CC_HUMAN			1	73	-			25			Helical; Name=1; (Potential).		B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	37	c.73A>C	CCDS31496.1	.	.	.	.	.	.	.	.	.	.	.	10.06	1.246698	0.22796	.	.	ENSG00000221954	ENST00000335238	T	0.03004	4.08	3.31	-6.61	0.01818	.	0.953754	0.08551	U	0.928992	T	0.01387	0.0045	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.47509	-0.9112	10	0.72032	D	0.01	.	0.9051	0.01282	0.2179:0.1475:0.3304:0.3042	.	25	Q96R67	OR4CC_HUMAN	P	25	ENSP00000334418:T25P	ENSP00000334418:T25P	T	-	1	0	OR4C12	49960541	0.000000	0.05858	0.000000	0.03702	0.179000	0.23085	-2.400000	0.01049	-1.964000	0.01012	0.325000	0.21440	ACG		0.408	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270		6	54	0	0	0	0	6	54				
NPAS4	266743	broad.mit.edu	37	11	66191816	66191816	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:66191816G>A	ENST00000311034.2	+	7	1631	c.1455G>A	c.(1453-1455)ctG>ctA	p.L485L		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	485					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CTAGCCCACTGCAAGGCCAGT	0.557																																						uc001ohx.1		NA																	0					0						c.(1453-1455)CTG>CTA		neuronal PAS domain protein 4							227.0	220.0	222.0					11																	66191816		2200	4295	6495	SO:0001819	synonymous_variant	266743				transcription, DNA-dependent		DNA binding|signal transducer activity	g.chr11:66191816G>A	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1455G>A	11.37:g.66191816G>A			Somatic				NPAS4_uc010rpc.1_Silent_p.L275L	p.L485L	NM_178864	NP_849195	WXS	Illumina HiSeq	Unspecified	Q8IUM7	NPAS4_HUMAN			7	1631	+			485					B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	ENST00000311034.2	37	c.1455G>A	CCDS8138.1																																																																																				0.557	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864		136	217	0	0	0	0	136	217				
PC	5091	broad.mit.edu	37	11	66638327	66638327	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:66638327C>T	ENST00000393958.2	-	7	763	c.670G>A	c.(670-672)Gct>Act	p.A224T	PC_ENST00000393960.1_Missense_Mutation_p.A224T|PC_ENST00000393955.2_Missense_Mutation_p.A224T|PC_ENST00000355677.3_Missense_Mutation_p.A224T|PC_ENST00000524491.1_Missense_Mutation_p.A184T	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	224	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCGGCCAGAGCCTCTGAGTAG	0.637																																						uc001ojn.1		NA																	0				ovary(2)|lung(1)|kidney(1)	4						c.(670-672)GCT>ACT		pyruvate carboxylase precursor	Biotin(DB00121)|Pyruvic acid(DB00119)						100.0	114.0	109.0					11																	66638327		2200	4295	6495	SO:0001583	missense	5091				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity	g.chr11:66638327C>T	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.670G>A	11.37:g.66638327C>T	ENSP00000377530:p.Ala224Thr		Somatic				PC_uc001ojo.1_Missense_Mutation_p.A224T|PC_uc001ojp.1_Missense_Mutation_p.A224T	p.A224T	NM_022172	NP_071504	WXS	Illumina HiSeq	Unspecified	P11498	PYC_HUMAN		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	6	719	-		Melanoma(852;0.0525)	224			ATP-grasp.|Biotin carboxylation.		B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	c.670G>A	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	C	36	5.744224	0.96882	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.97870	-4.58;-4.58;-4.58;-4.58;-4.58	5.29	5.29	0.74685	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.062767	0.64402	D	0.000007	D	0.99083	0.9685	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99418	1.0932	10	0.87932	D	0	-18.3459	16.425	0.83812	0.0:1.0:0.0:0.0	.	224	P11498	PYC_HUMAN	T	224;224;224;184;224	ENSP00000377527:A224T;ENSP00000377530:A224T;ENSP00000377532:A224T;ENSP00000434192:A184T;ENSP00000347900:A224T	ENSP00000347900:A224T	A	-	1	0	PC	66394903	1.000000	0.71417	0.997000	0.53966	0.969000	0.65631	5.374000	0.66167	2.483000	0.83821	0.462000	0.41574	GCT		0.637	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716		35	214	0	0	0	0	35	214				
PPFIA1	8500	broad.mit.edu	37	11	70224267	70224267	+	Silent	SNP	C	C	T	rs374468603		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:70224267C>T	ENST00000253925.7	+	26	3731	c.3516C>T	c.(3514-3516)tcC>tcT	p.S1172S	AP000487.5_ENST00000530690.1_RNA|PPFIA1_ENST00000389547.3_Silent_p.S1172S|AP000487.5_ENST00000524619.1_RNA|AP000487.5_ENST00000500185.2_RNA|PPFIA1_ENST00000530548.1_3'UTR	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1172					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CTATGTCTTCCCCCTCTATGC	0.488																																						uc001opo.2		NA																	0				lung(2)|ovary(1)	3						c.(3514-3516)TCC>TCT		PTPRF interacting protein alpha 1 isoform b							140.0	125.0	130.0					11																	70224267		2200	4294	6494	SO:0001819	synonymous_variant	8500				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity	g.chr11:70224267C>T	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3516C>T	11.37:g.70224267C>T			Somatic				PPFIA1_uc001opn.1_Silent_p.S1172S|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opr.2_Silent_p.S311S|PPFIA1_uc001ops.2_Silent_p.S211S|uc001opt.1_Intron	p.S1172S	NM_003626	NP_003617	WXS	Illumina HiSeq	Unspecified	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)		26	3714	+			1172					A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	ENST00000253925.7	37	c.3516C>T	CCDS31627.1																																																																																				0.488	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626		20	215	0	0	0	0	20	215				
PAK1	5058	broad.mit.edu	37	11	77066805	77066805	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:77066805T>C	ENST00000356341.3	-	7	1211	c.680A>G	c.(679-681)aAt>aGt	p.N227S	PAK1_ENST00000530617.1_Missense_Mutation_p.N227S|PAK1_ENST00000278568.4_Missense_Mutation_p.N227S|PAK1_ENST00000528203.1_Missense_Mutation_p.N129S|PAK1_ENST00000525542.1_Intron	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	227	Interaction with CRIPAK.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					AGTGGTGTTATTTTCAGTAGG	0.443																																						uc001oyh.3		NA																	0				skin(2)|stomach(1)|lung(1)	4						c.(679-681)AAT>AGT		p21-activated kinase 1 isoform 2							214.0	193.0	200.0					11																	77066805		2200	4292	6492	SO:0001583	missense	5058				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity	g.chr11:77066805T>C	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.680A>G	11.37:g.77066805T>C	ENSP00000348696:p.Asn227Ser		Somatic				PAK1_uc010rso.1_Missense_Mutation_p.N129S|PAK1_uc001oyg.3_Missense_Mutation_p.N227S|PAK1_uc001oyi.1_Missense_Mutation_p.N227S|PAK1_uc010rsn.1_Intron	p.N227S	NM_002576	NP_002567	WXS	Illumina HiSeq	Unspecified	Q13153	PAK1_HUMAN			7	1213	-	all_cancers(14;1.75e-18)		227			Interaction with CRIPAK.		O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	ENST00000356341.3	37	c.680A>G	CCDS8250.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.449294	0.26074	.	.	ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	T;T;T;T	0.70399	-0.44;-0.48;-0.47;-0.47	5.32	1.62	0.23740	.	0.206512	0.49305	N	0.000142	T	0.32285	0.0824	N	0.00926	-1.1	0.42414	D	0.99261	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.001	T	0.07290	-1.0780	10	0.09084	T	0.74	.	6.411	0.21690	0.0:0.142:0.1325:0.7255	.	129;227;227;227	E9PM17;B3KNX7;Q13153;Q13153-2	.;.;PAK1_HUMAN;.	S	227;227;227;129	ENSP00000348696:N227S;ENSP00000433423:N227S;ENSP00000278568:N227S;ENSP00000433211:N129S	ENSP00000278568:N227S	N	-	2	0	PAK1	76744453	0.889000	0.30405	0.976000	0.42696	0.963000	0.63663	0.996000	0.29719	0.105000	0.17753	0.402000	0.26972	AAT		0.443	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576		36	69	0	0	0	0	36	69				
PANX1	24145	broad.mit.edu	37	11	93911630	93911630	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:93911630G>C	ENST00000227638.3	+	3	802	c.417G>C	c.(415-417)ttG>ttC	p.L139F	PANX1_ENST00000436171.2_Missense_Mutation_p.L139F	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	139					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	GCTCAGACTTGAAGTTTATCA	0.493																																						uc001per.2		NA																	0					0						c.(415-417)TTG>TTC		pannexin 1							117.0	100.0	106.0					11																	93911630		2201	4298	6499	SO:0001583	missense	24145				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding	g.chr11:93911630G>C	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.417G>C	11.37:g.93911630G>C	ENSP00000227638:p.Leu139Phe		Somatic				PANX1_uc001peq.2_Missense_Mutation_p.L139F	p.L139F	NM_015368	NP_056183	WXS	Illumina HiSeq	Unspecified	Q96RD7	PANX1_HUMAN			3	802	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	139			Cytoplasmic (Potential).		O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	37	c.417G>C	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687659	0.68157	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.37235	1.21;1.21	5.17	3.24	0.37175	.	0.122142	0.52532	D	0.000062	T	0.55561	0.1928	M	0.84326	2.69	0.51233	D	0.999912	D;D	0.60575	0.988;0.985	P;P	0.60949	0.881;0.811	T	0.57447	-0.7810	10	0.72032	D	0.01	-18.3962	9.1007	0.36667	0.0746:0.2776:0.6478:0.0	.	139;139	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	F	139	ENSP00000227638:L139F;ENSP00000411461:L139F	ENSP00000227638:L139F	L	+	3	2	PANX1	93551278	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	1.210000	0.32370	0.523000	0.28482	-0.244000	0.11960	TTG		0.493	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368		9	42	0	0	0	0	9	42				
BSX	390259	broad.mit.edu	37	11	122848470	122848470	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:122848470C>T	ENST00000343035.2	-	3	637	c.589G>A	c.(589-591)Gcc>Acc	p.A197T		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	197					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		GCCTCGGCGGCGGTGGCGGCC	0.672																																						uc010rzs.1		NA																	0					0						c.(589-591)GCC>ACC		brain specific homeobox							19.0	23.0	22.0					11																	122848470		1869	4085	5954	SO:0001583	missense	390259							g.chr11:122848470C>T		CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.589G>A	11.37:g.122848470C>T	ENSP00000344285:p.Ala197Thr		Somatic					p.A197T	NM_001098169	NP_001091639	WXS	Illumina HiSeq	Unspecified	Q3C1V8	BSH_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)	3	589	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	197						Missense_Mutation	SNP	ENST00000343035.2	37	c.589G>A	CCDS41728.1	.	.	.	.	.	.	.	.	.	.	C	3.875	-0.027099	0.07589	.	.	ENSG00000188909	ENST00000343035	D	0.93488	-3.23	5.4	-2.06	0.07298	.	0.334792	0.30901	N	0.008644	T	0.79464	0.4450	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.66929	-0.5799	10	0.27785	T	0.31	.	3.8406	0.08912	0.2035:0.331:0.3828:0.0826	.	197	Q3C1V8	BSH_HUMAN	T	197	ENSP00000344285:A197T	ENSP00000344285:A197T	A	-	1	0	BSX	122353680	0.000000	0.05858	0.001000	0.08648	0.147000	0.21601	-0.429000	0.06982	-0.778000	0.04566	0.561000	0.74099	GCC		0.672	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317076.1	NM_001098169		3	27	0	0	0	0	3	27				
ETS1	2113	broad.mit.edu	37	11	128354827	128354827	+	Silent	SNP	C	C	G	rs142070153	byFrequency	TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr11:128354827C>G	ENST00000319397.6	-	5	930	c.621G>C	c.(619-621)tcG>tcC	p.S207S	ETS1_ENST00000531611.1_Silent_p.S207S|ETS1_ENST00000535549.1_Intron|ETS1_ENST00000526145.2_Silent_p.S207S|ETS1_ENST00000345075.4_Silent_p.S207S|ETS1_ENST00000392668.4_Silent_p.S251S	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	207	Activation domain; required for transcription activation.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GGAGAATGACCGAGGGGTAGT	0.517																																						uc010sbs.1		NA																	0				lung(4)|central_nervous_system(1)|pleura(1)	6						c.(619-621)TCG>TCC		v-ets erythroblastosis virus E26 oncogene							146.0	131.0	136.0					11																	128354827		2201	4297	6498	SO:0001819	synonymous_variant	2113				cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr11:128354827C>G		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.621G>C	11.37:g.128354827C>G			Somatic				ETS1_uc001qej.2_Silent_p.S251S|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Silent_p.S207S	p.S207S	NM_005238	NP_005229	WXS	Illumina HiSeq	Unspecified	P14921	ETS1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)	5	937	-	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)	207					A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Silent	SNP	ENST00000319397.6	37	c.621G>C	CCDS8475.1																																																																																				0.517	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238		27	55	0	0	0	0	27	55				
TAPBPL	55080	broad.mit.edu	37	12	6566666	6566666	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:6566666G>C	ENST00000266556.7	+	4	825	c.660G>C	c.(658-660)ttG>ttC	p.L220F	TAPBPL_ENST00000544021.1_Missense_Mutation_p.L143F|TAPBPL_ENST00000545700.1_3'UTR	NM_018009.4	NP_060479.3	Q9BX59	TPSNR_HUMAN	TAP binding protein-like	220	Ig-like V-type.				negative regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			endometrium(2)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	6						CACCGGGCTTGGACCTCATCA	0.622																																						uc001qog.3		NA																	0					0						c.(658-660)TTG>TTC		TAP binding protein-like precursor							104.0	95.0	98.0					12																	6566666		2203	4300	6503	SO:0001583	missense	55080				antigen processing and presentation of endogenous peptide antigen via MHC class I	endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane		g.chr12:6566666G>C	AK001005	CCDS8546.1	12p13.31	2013-01-11						"""Immunoglobulin superfamily / C1-set domain containing"""	30683	protein-coding gene	gene with protein product		607081				11920573	Standard	NM_018009		Approved	TAPBP-R, FLJ10143, TAPBPR	uc001qog.4	Q9BX59		ENST00000266556.7:c.660G>C	12.37:g.6566666G>C	ENSP00000266556:p.Leu220Phe		Somatic				TAPBPL_uc001qoh.3_Missense_Mutation_p.L78F|TAPBPL_uc001qoi.1_RNA	p.L220F	NM_018009	NP_060479	WXS	Illumina HiSeq	Unspecified	Q9BX59	TPSNR_HUMAN			4	898	+			220			Lumenal (Potential).|Ig-like V-type.		Q9NWB8	Missense_Mutation	SNP	ENST00000266556.7	37	c.660G>C	CCDS8546.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.497445	0.26861	.	.	ENSG00000139192	ENST00000544021;ENST00000266556	T;T	0.02763	4.17;4.17	4.62	1.53	0.23141	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.700395	0.14476	N	0.317273	T	0.02418	0.0074	L	0.32530	0.975	0.09310	N	1	P	0.34997	0.479	B	0.39419	0.299	T	0.41161	-0.9524	10	0.08837	T	0.75	-0.7528	4.5132	0.11921	0.207:0.1838:0.6091:0.0	.	220	Q9BX59	TPSNR_HUMAN	F	143;220	ENSP00000445341:L143F;ENSP00000266556:L220F	ENSP00000266556:L220F	L	+	3	2	TAPBPL	6436927	0.967000	0.33354	0.037000	0.18230	0.962000	0.63368	1.246000	0.32803	0.501000	0.28013	0.561000	0.74099	TTG		0.622	TAPBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399263.1	NM_018009		12	74	0	0	0	0	12	74				
PLCZ1	89869	broad.mit.edu	37	12	18847863	18847863	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:18847863G>T	ENST00000538330.1	-	8	1169	c.788C>A	c.(787-789)cCa>cAa	p.P263Q	PLCZ1_ENST00000266505.7_Missense_Mutation_p.P481Q|PLCZ1_ENST00000539875.1_Missense_Mutation_p.P288Q|PLCZ1_ENST00000541695.1_Missense_Mutation_p.P344Q|PLCZ1_ENST00000534932.1_Intron|PLCZ1_ENST00000435379.1_Missense_Mutation_p.P286Q|PLCZ1_ENST00000542762.1_5'Flank|PLCZ1_ENST00000447925.2_Missense_Mutation_p.P479Q					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					AAGTGTAATTGGCATACCCTC	0.269																																						uc010sid.1		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(1441-1443)CCA>CAA		phospholipase C, zeta 1							65.0	68.0	67.0					12																	18847863		2203	4300	6503	SO:0001583	missense	89869				intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr12:18847863G>T	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.788C>A	12.37:g.18847863G>T	ENSP00000445880:p.Pro263Gln		Somatic				PLCZ1_uc001rdv.3_Missense_Mutation_p.P377Q|PLCZ1_uc001rdw.3_Missense_Mutation_p.P222Q|PLCZ1_uc001rdu.1_Missense_Mutation_p.P263Q|PLCZ1_uc009zil.1_RNA	p.P481Q	NM_033123	NP_149114	WXS	Illumina HiSeq	Unspecified	Q86YW0	PLCZ1_HUMAN			12	1633	-	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)		481			C2.			Missense_Mutation	SNP	ENST00000538330.1	37	c.1442C>A		.	.	.	.	.	.	.	.	.	.	G	14.43	2.533479	0.45073	.	.	ENSG00000139151	ENST00000538330;ENST00000266505;ENST00000447925;ENST00000435379;ENST00000541695;ENST00000539875;ENST00000540421	T;T;T;T;T;T;T	0.30448	2.73;2.05;2.05;1.72;1.53;1.73;1.77	5.09	4.18	0.49190	C2 membrane targeting protein (1);PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);C2 calcium/lipid-binding domain, CaLB (1);	0.217217	0.38326	N	0.001730	T	0.53690	0.1812	M	0.73753	2.245	0.31675	N	0.643919	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.63945	-0.6522	10	0.52906	T	0.07	.	12.8762	0.57991	0.0:0.1635:0.8365:0.0	.	481;263	Q86YW0;Q8N7S5	PLCZ1_HUMAN;.	Q	263;481;479;286;344;288;216	ENSP00000445880:P263Q;ENSP00000266505:P481Q;ENSP00000402358:P479Q;ENSP00000400504:P286Q;ENSP00000443349:P344Q;ENSP00000445026:P288Q;ENSP00000445889:P216Q	ENSP00000266505:P481Q	P	-	2	0	PLCZ1	18739130	1.000000	0.71417	0.017000	0.16124	0.039000	0.13416	7.258000	0.78371	1.096000	0.41439	0.313000	0.20887	CCA		0.269	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123		4	38	1	0	1.24e-05	1.4e-05	4	38				
KMT2D	8085	broad.mit.edu	37	12	49443617	49443617	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:49443617G>A	ENST00000301067.7	-	11	3753	c.3754C>T	c.(3754-3756)Cga>Tga	p.R1252*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1252					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCCTCATCTCGGGCTGGACTA	0.597																																						uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(3754-3756)CGA>TGA		myeloid/lymphoid or mixed-lineage leukemia 2							84.0	88.0	87.0					12																	49443617		1940	4143	6083	SO:0001587	stop_gained	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49443617G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3754C>T	12.37:g.49443617G>A	ENSP00000301067:p.Arg1252*	HNSCC(34;0.089)	Somatic					p.R1252*	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			11	3754	-			1252					O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	c.3754C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	42	9.631121	0.99224	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.81	5.81	0.92471	.	0.000000	0.31519	N	0.007517	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.3313	0.55041	0.0:0.0:0.7302:0.2698	.	.	.	.	X	1252	.	ENSP00000301067:R1252X	R	-	1	2	MLL2	47729884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.151000	0.50670	2.736000	0.93811	0.655000	0.94253	CGA		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			24	96	0	0	0	0	24	96				
KRT71	112802	broad.mit.edu	37	12	52938396	52938396	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:52938396G>A	ENST00000267119.5	-	9	1561	c.1492C>T	c.(1492-1494)Cgg>Tgg	p.R498W		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	498	Tail.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		GCACTGCCCCGGCTCCTGCCC	0.622																																						uc001sao.2		NA																	0				ovary(1)|skin(1)	2						c.(1492-1494)CGG>TGG		keratin 71							83.0	88.0	86.0					12																	52938396		2203	4300	6503	SO:0001583	missense	112802						structural molecule activity	g.chr12:52938396G>A	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1492C>T	12.37:g.52938396G>A	ENSP00000267119:p.Arg498Trp		Somatic					p.R498W	NM_033448	NP_258259	WXS	Illumina HiSeq	Unspecified	Q3SY84	K2C71_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.194)	9	1562	-			498			Tail.		B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	c.1492C>T	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	G	7.921	0.738624	0.15642	.	.	ENSG00000139648	ENST00000267119	T	0.81247	-1.47	3.67	0.561	0.17285	.	0.196910	0.22729	N	0.056354	T	0.56187	0.1968	N	0.08118	0	0.25115	N	0.990688	B	0.06786	0.001	B	0.01281	0.0	T	0.42310	-0.9459	10	0.37606	T	0.19	.	4.3683	0.11235	0.1155:0.0:0.474:0.4104	.	498	Q3SY84	K2C71_HUMAN	W	498	ENSP00000267119:R498W	ENSP00000267119:R498W	R	-	1	2	KRT71	51224663	0.000000	0.05858	0.494000	0.27515	0.534000	0.34807	-0.123000	0.10611	-0.011000	0.14247	-0.254000	0.11334	CGG		0.622	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448		32	105	0	0	0	0	32	105				
RNF41	10193	broad.mit.edu	37	12	56604300	56604300	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:56604300G>A	ENST00000345093.4	-	4	512	c.143C>T	c.(142-144)tCt>tTt	p.S48F	RNF41_ENST00000552656.1_Missense_Mutation_p.S48F|RNF41_ENST00000552244.1_Missense_Mutation_p.S48F|RNF41_ENST00000394013.2_5'UTR	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	48					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						CTGTTGCTGAGAGAACCACTG	0.532																																						uc001skf.1		NA																	0				skin(1)	1						c.(142-144)TCT>TTT		ring finger protein 41 isoform 1							101.0	86.0	91.0					12																	56604300		2203	4300	6503	SO:0001583	missense	10193				apoptosis|induction of apoptosis|protein polyubiquitination|regulation of reactive oxygen species metabolic process		protein binding|protein tag|ubiquitin-protein ligase activity|zinc ion binding	g.chr12:56604300G>A	AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.143C>T	12.37:g.56604300G>A	ENSP00000342755:p.Ser48Phe		Somatic				RNF41_uc001ske.1_5'UTR|RNF41_uc001skg.1_Missense_Mutation_p.S48F|RNF41_uc010sqg.1_5'UTR|RNF41_uc010sqh.1_5'UTR|RNF41_uc001skh.2_Missense_Mutation_p.S61F	p.S48F	NM_005785	NP_005776	WXS	Illumina HiSeq	Unspecified	Q9H4P4	RNF41_HUMAN			4	512	-			48			RING-type; degenerate.		A6NFW0|B2RBT8|O75598	Missense_Mutation	SNP	ENST00000345093.4	37	c.143C>T	CCDS8909.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567341	0.86439	.	.	ENSG00000181852	ENST00000345093;ENST00000448057;ENST00000552656;ENST00000552244;ENST00000549038	D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.051635	0.85682	D	0.000000	D	0.88764	0.6525	L	0.42487	1.325	0.48288	D	0.99962	P;P	0.49635	0.926;0.539	P;B	0.53062	0.717;0.369	D	0.89049	0.3454	10	0.59425	D	0.04	.	18.0941	0.89483	0.0:0.0:1.0:0.0	.	48;48	F8VSB6;Q9H4P4	.;RNF41_HUMAN	F	48	ENSP00000342755:S48F;ENSP00000447303:S48F;ENSP00000448187:S48F;ENSP00000446595:S48F	ENSP00000342755:S48F	S	-	2	0	RNF41	54890567	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.759000	0.85235	2.885000	0.99019	0.655000	0.94253	TCT		0.532	RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408525.1	NM_005785		12	38	0	0	0	0	12	38				
GPR182	11318	broad.mit.edu	37	12	57389441	57389441	+	Missense_Mutation	SNP	G	G	A	rs200478269		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:57389441G>A	ENST00000300098.1	+	2	667	c.448G>A	c.(448-450)Gac>Aac	p.D150N	HBCBP_ENST00000600202.1_5'Flank|RP11-474N8.5_ENST00000556850.1_RNA	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	150					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						CCTCAGTGTCGACCGCTATGT	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		21484	0.0		0.001	False		,,,				2504	0.0					uc001smk.2		NA																	0				lung(1)	1						c.(448-450)GAC>AAC		G protein-coupled receptor 182							150.0	124.0	133.0					12																	57389441		2203	4300	6503	SO:0001583	missense	11318					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr12:57389441G>A	Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.448G>A	12.37:g.57389441G>A	ENSP00000300098:p.Asp150Asn		Somatic				RDH16_uc010sqx.1_Intron	p.D150N	NM_007264	NP_009195	WXS	Illumina HiSeq	Unspecified	O15218	GP182_HUMAN			2	542	+			150			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000300098.1	37	c.448G>A	CCDS8927.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	21.0	4.075255	0.76415	.	.	ENSG00000166856	ENST00000300098	D	0.85484	-1.99	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.057461	0.64402	D	0.000002	D	0.93654	0.7973	M	0.92691	3.335	0.48341	D	0.999634	D	0.89917	1.0	D	0.77557	0.99	D	0.94970	0.8116	10	0.87932	D	0	.	14.6905	0.69083	0.0:0.0:1.0:0.0	.	150	O15218	GP182_HUMAN	N	150	ENSP00000300098:D150N	ENSP00000300098:D150N	D	+	1	0	GPR182	55675708	1.000000	0.71417	0.936000	0.37596	0.421000	0.31385	9.588000	0.98232	2.396000	0.81511	0.561000	0.74099	GAC		0.597	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411212.1	NM_007264		12	71	0	0	0	0	12	71				
NXPH4	11247	broad.mit.edu	37	12	57619422	57619422	+	Silent	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:57619422C>A	ENST00000349394.5	+	2	994	c.819C>A	c.(817-819)ccC>ccA	p.P273P	Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	273	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						GTGCCAAGCCCTTCAAAGTCA	0.577																																						uc010srf.1		NA																	0					0						c.(817-819)CCC>CCA		neurexophilin 4 precursor							59.0	65.0	63.0					12																	57619422		2203	4300	6503	SO:0001819	synonymous_variant	11247				neuropeptide signaling pathway	extracellular region		g.chr12:57619422C>A	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.819C>A	12.37:g.57619422C>A			Somatic				NXPH4_uc009zpj.2_Silent_p.P79P	p.P273P	NM_007224	NP_009155	WXS	Illumina HiSeq	Unspecified	O95158	NXPH4_HUMAN			2	994	+			273			V (Cys-rich).		A8K4I4|Q7Z6L3|Q8N462	Silent	SNP	ENST00000349394.5	37	c.819C>A	CCDS8933.1																																																																																				0.577	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224		18	49	1	0	5.39e-06	6.13e-06	18	49				
TMBIM4	51643	broad.mit.edu	37	12	66539718	66539718	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:66539718T>C	ENST00000358230.3	-	5	487	c.367A>G	c.(367-369)Att>Gtt	p.I123V	TMBIM4_ENST00000544599.1_De_novo_Start_OutOfFrame|TMBIM4_ENST00000556010.1_Missense_Mutation_p.I123V|TMBIM4_ENST00000542724.1_Missense_Mutation_p.I92V|TMBIM4_ENST00000539652.1_Missense_Mutation_p.I123V|TMBIM4_ENST00000398033.4_Missense_Mutation_p.I123V|TMBIM4_ENST00000286424.7_Missense_Mutation_p.I170V	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	123					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		TGCAGAATAATATATACATCA	0.303																																						uc001stc.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(367-369)ATT>GTT		transmembrane BAX inhibitor motif containing 4							48.0	47.0	48.0					12																	66539718		1792	4056	5848	SO:0001583	missense	51643					integral to membrane	protein binding	g.chr12:66539718T>C	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.367A>G	12.37:g.66539718T>C	ENSP00000350965:p.Ile123Val		Somatic				LLPH_uc010ssx.1_RNA|TMBIM4_uc001std.2_Missense_Mutation_p.I92V|TMBIM4_uc009zqr.2_Missense_Mutation_p.I170V|TMBIM4_uc001ste.2_RNA|TMBIM4_uc001stf.2_Missense_Mutation_p.I123V|TMBIM4_uc009zqs.2_Missense_Mutation_p.I123V	p.I123V	NM_016056	NP_057140	WXS	Illumina HiSeq	Unspecified	Q9HC24	TMBI4_HUMAN		GBM - Glioblastoma multiforme(28;0.0745)	5	443	-			123			Helical; (Potential).		Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	37	c.367A>G	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	T	4.391	0.072094	0.08436	.	.	ENSG00000155957	ENST00000556010;ENST00000358230;ENST00000426857;ENST00000286424;ENST00000398033;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.76	-1.14	0.09741	.	0.491076	0.21853	N	0.068143	T	0.18215	0.0437	N	0.11023	0.085	0.23050	N	0.998377	B;B;B;B;B	0.09022	0.001;0.002;0.0;0.001;0.0	B;B;B;B;B	0.16722	0.004;0.016;0.004;0.012;0.008	T	0.20874	-1.0262	9	.	.	.	-4.5116	7.1128	0.25401	0.0:0.452:0.1352:0.4127	.	123;170;123;92;123	E7EWY5;G3XAA5;E7EQ00;G3V1M2;Q9HC24	.;.;.;.;TMBI4_HUMAN	V	123;123;123;170;123;123;169;92	ENSP00000451688:I123V;ENSP00000350965:I123V;ENSP00000286424:I170V;ENSP00000381114:I123V;ENSP00000441291:I92V	.	I	-	1	0	TMBIM4	64825985	0.690000	0.27699	0.035000	0.18076	0.510000	0.34073	0.050000	0.14120	-0.134000	0.11516	0.533000	0.62120	ATT		0.303	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056		10	41	0	0	0	0	10	41				
ZFC3H1	196441	broad.mit.edu	37	12	72020216	72020216	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:72020216C>A	ENST00000378743.3	-	22	4499	c.4141G>T	c.(4141-4143)Gaa>Taa	p.E1381*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1381					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCCAAGGATTCTGAGCACTCC	0.353																																						uc001swo.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						c.(4141-4143)GAA>TAA		proline/serine-rich coiled-coil 2							68.0	61.0	63.0					12																	72020216		1814	4068	5882	SO:0001587	stop_gained	196441				RNA processing	intracellular	metal ion binding	g.chr12:72020216C>A	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4141G>T	12.37:g.72020216C>A	ENSP00000368017:p.Glu1381*		Somatic					p.E1381*	NM_144982	NP_659419	WXS	Illumina HiSeq	Unspecified	O60293	ZC3H1_HUMAN			22	4500	-			1381			TPR 1.|HAT 1.		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	37	c.4141G>T	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	C	42	9.373391	0.99151	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.47	3.6	0.41247	.	0.054615	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	16.0702	0.80919	0.0:0.746:0.254:0.0	.	.	.	.	X	1381	.	ENSP00000368017:E1381X	E	-	1	0	ZFC3H1	70306483	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	4.542000	0.60677	0.742000	0.32697	-0.181000	0.13052	GAA		0.353	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982		16	54	1	0	4.75e-09	5.6e-09	16	54				
NAV3	89795	broad.mit.edu	37	12	78400890	78400890	+	Silent	SNP	C	C	G	rs557857297		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:78400890C>G	ENST00000397909.2	+	8	1745	c.1572C>G	c.(1570-1572)tcC>tcG	p.S524S	NAV3_ENST00000228327.6_Silent_p.S524S|NAV3_ENST00000536525.2_Silent_p.S524S|NAV3_ENST00000266692.7_Silent_p.S524S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	524						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TTCCGTCTTCCAGTGGTATTC	0.448										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(1570-1572)TCC>TCG		neuron navigator 3							64.0	63.0	64.0					12																	78400890		1907	4121	6028	SO:0001819	synonymous_variant	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78400890C>G	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1572C>G	12.37:g.78400890C>G		HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Silent_p.S524S	p.S524S	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			8	1745	+			524					Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37	c.1572C>G																																																																																					0.448	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		13	69	0	0	0	0	13	69				
ATP2B1	490	broad.mit.edu	37	12	90010659	90010659	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:90010659C>T	ENST00000428670.3	-	12	2443	c.1987G>A	c.(1987-1989)Gag>Aag	p.E663K	ATP2B1_ENST00000393164.2_Missense_Mutation_p.E406K|ATP2B1_ENST00000261173.2_Missense_Mutation_p.E663K|ATP2B1_ENST00000359142.3_Missense_Mutation_p.E663K|ATP2B1_ENST00000348959.3_Missense_Mutation_p.E663K			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	663					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TTATCCCACTCTGGTTCTGGT	0.428																																						uc001tbh.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1987-1989)GAG>AAG		plasma membrane calcium ATPase 1 isoform 1b							202.0	193.0	196.0					12																	90010659		2203	4300	6503	SO:0001583	missense	490				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr12:90010659C>T	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1987G>A	12.37:g.90010659C>T	ENSP00000392043:p.Glu663Lys		Somatic				ATP2B1_uc001tbg.2_Missense_Mutation_p.E663K|ATP2B1_uc001tbf.2_Missense_Mutation_p.E333K	p.E663K	NM_001682	NP_001673	WXS	Illumina HiSeq	Unspecified	P20020	AT2B1_HUMAN			11	2168	-			663			Cytoplasmic (Potential).		Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	c.1987G>A	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155449	0.78114	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5	5.72	5.72	0.89469	.	0.148995	0.64402	D	0.000013	T	0.65943	0.2740	L	0.37800	1.135	0.58432	D	0.999996	B;B;B	0.30179	0.066;0.063;0.271	B;B;B	0.30495	0.036;0.051;0.116	T	0.63998	-0.6510	10	0.51188	T	0.08	-14.2567	19.8788	0.96888	0.0:1.0:0.0:0.0	.	663;663;663	P20020-3;P20020-2;P20020-6	.;.;.	K	663;663;663;663;406	ENSP00000261173:E663K;ENSP00000343599:E663K;ENSP00000352054:E663K;ENSP00000392043:E663K;ENSP00000376869:E406K	ENSP00000261173:E663K	E	-	1	0	ATP2B1	88534790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.960000	0.63673	2.708000	0.92522	0.650000	0.86243	GAG		0.428	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682		22	131	0	0	0	0	22	131				
HECTD4	283450	broad.mit.edu	37	12	112681213	112681213	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:112681213G>A	ENST00000430131.2	-	31	4781	c.3636C>T	c.(3634-3636)gtC>gtT	p.V1212V	HECTD4_ENST00000377560.5_Silent_p.V1462V|HECTD4_ENST00000550722.1_Silent_p.V1488V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1212					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TCACTCCCCCGACTCGTACGG	0.547																																						uc009zwc.2		NA																	0				ovary(1)|lung(1)	2						c.(3634-3636)GTC>GTT		chromosome 12 open reading frame 51							37.0	40.0	39.0					12																	112681213		2123	4239	6362	SO:0001819	synonymous_variant	283450							g.chr12:112681213G>A	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.3636C>T	12.37:g.112681213G>A			Somatic					p.V1212V	NM_001109662	NP_001103132	WXS	Illumina HiSeq	Unspecified					25	3654	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37	c.3636C>T																																																																																					0.547	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		5	13	0	0	0	0	5	13				
UBC	7316	broad.mit.edu	37	12	125398024	125398024	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:125398024G>A	ENST00000538617.1	-	3	610	c.294C>T	c.(292-294)acC>acT	p.T98T	UBC_ENST00000536661.1_5'Flank|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Silent_p.T98T|UBC_ENST00000339647.5_Silent_p.T98T|UBC_ENST00000536769.1_Silent_p.T98T			P0CG48	UBC_HUMAN	ubiquitin C	478	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CGTTCTCGATGGTGTCACTGG	0.562																																						uc001ugs.3		NA																	0				ovary(2)	2						c.(292-294)ACC>ACT		ubiquitin C							289.0	249.0	263.0					12																	125398024		2203	4300	6503	SO:0001819	synonymous_variant	7316				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding	g.chr12:125398024G>A		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.294C>T	12.37:g.125398024G>A			Somatic				UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Silent_p.T98T|UBC_uc001ugt.2_Silent_p.T98T|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_5'UTR	p.T98T	NM_021009	NP_066289	WXS	Illumina HiSeq	Unspecified	P0CG48	UBC_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)	2	742	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)		98			Ubiquitin-like 2.		P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000538617.1	37	c.294C>T																																																																																					0.562	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009		8	202	0	0	0	0	8	202				
DIS3	22894	broad.mit.edu	37	13	73350163	73350163	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr13:73350163A>C	ENST00000377767.4	-	5	822	c.722T>G	c.(721-723)aTa>aGa	p.I241R	DIS3_ENST00000377780.4_Missense_Mutation_p.I211R|DIS3_ENST00000545453.1_Missense_Mutation_p.I79R	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	241					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		ACCAGATTTTATGCCTTGCTG	0.358										Multiple Myeloma(4;0.011)																												uc001vix.3		NA																	0				central_nervous_system(1)	1						c.(721-723)ATA>AGA		DIS3 mitotic control isoform a							96.0	89.0	92.0					13																	73350163		2202	4298	6500	SO:0001583	missense	22894				CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding	g.chr13:73350163A>C	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.722T>G	13.37:g.73350163A>C	ENSP00000366997:p.Ile241Arg	Multiple Myeloma(4;0.011)	Somatic				DIS3_uc001viy.3_Missense_Mutation_p.I211R|DIS3_uc001viz.2_RNA	p.I241R	NM_014953	NP_055768	WXS	Illumina HiSeq	Unspecified	Q9Y2L1	RRP44_HUMAN		GBM - Glioblastoma multiforme(99;0.000181)	5	1096	-		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)	241					A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	c.722T>G	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.810493	0.90707	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.45668	0.89;0.89;0.89	5.82	5.82	0.92795	.	0.041109	0.85682	D	0.000000	T	0.71281	0.3321	M	0.91972	3.26	0.80722	D	1	D;P	0.61080	0.989;0.937	D;P	0.67382	0.951;0.836	T	0.78807	-0.2059	10	0.87932	D	0	.	16.171	0.81817	1.0:0.0:0.0:0.0	.	211;241	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	R	241;211;79	ENSP00000366997:I241R;ENSP00000367011:I211R;ENSP00000440058:I79R	ENSP00000366997:I241R	I	-	2	0	DIS3	72248164	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.288000	0.96055	2.211000	0.71520	0.533000	0.62120	ATA		0.358	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953		10	28	0	0	0	0	10	28				
RNASE12	493901	broad.mit.edu	37	14	21058750	21058750	+	Missense_Mutation	SNP	A	A	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr14:21058750A>C	ENST00000556526.1	-	1	232	c.133T>G	c.(133-135)Tac>Gac	p.Y45D	RNASE11_ENST00000553849.1_5'Flank|RNASE11_ENST00000432835.2_5'Flank|RP11-14J7.6_ENST00000554006.1_RNA|RNASE11_ENST00000555841.1_5'Flank|RNASE11_ENST00000398009.2_5'Flank|RP11-14J7.6_ENST00000554529.1_RNA|RNASE11_ENST00000555283.1_Splice_Site|RNASE11_ENST00000398008.2_5'Flank|RP11-14J7.6_ENST00000554993.1_RNA|RNASE11_ENST00000610205.1_5'Flank|RP11-14J7.6_ENST00000553604.1_RNA|RP11-14J7.6_ENST00000556487.1_RNA	NM_001024822.2	NP_001019993.1	Q5GAN4	RNS12_HUMAN	ribonuclease, RNase A family, 12 (non-active)	45						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			kidney(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)		TGGTTGCAGTACCTTGCAGGA	0.443																																						uc001vxt.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(133-135)TAC>GAC		ribonuclease, RNase A family, 12 (non-active)							161.0	130.0	141.0					14																	21058750		2203	4300	6503	SO:0001583	missense	493901					extracellular region	nucleic acid binding|pancreatic ribonuclease activity	g.chr14:21058750A>C		CCDS32037.1	14q11.1	2012-10-05			ENSG00000258436	ENSG00000258436		"""Ribonucleases, RNase A"""	24211	protein-coding gene	gene with protein product							Standard	NM_001024822		Approved		uc001vxt.3	Q5GAN4	OTTHUMG00000170991	ENST00000556526.1:c.133T>G	14.37:g.21058750A>C	ENSP00000450580:p.Tyr45Asp		Somatic				RNASE11_uc010ahv.2_5'Flank|RNASE11_uc010ahx.2_5'Flank|RNASE11_uc010ahw.2_5'Flank|RNASE11_uc001vxs.2_5'Flank|uc001vxu.1_RNA	p.Y45D	NM_001024822	NP_001019993	WXS	Illumina HiSeq	Unspecified	Q5GAN4	RNS12_HUMAN	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)	1	233	-	all_cancers(95;0.00238)		45						Missense_Mutation	SNP	ENST00000556526.1	37	c.133T>G	CCDS32037.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463163	0.43736	.	.	ENSG00000258436;ENSG00000206171	ENST00000556526;ENST00000382999	T;T	0.73897	-0.79;-0.79	5.09	5.09	0.68999	Ribonuclease A, domain (3);	0.153499	0.41194	D	0.000922	D	0.83917	0.5358	M	0.72624	2.21	0.34271	D	0.681066	D	0.89917	1.0	D	0.91635	0.999	D	0.89238	0.3582	10	0.87932	D	0	-29.1574	11.1812	0.48629	1.0:0.0:0.0:0.0	.	45	Q5GAN4	RNS12_HUMAN	D	45	ENSP00000450580:Y45D;ENSP00000372460:Y45D	ENSP00000372460:Y45D	Y	-	1	0	RNASE12;AL163195.1	20128590	1.000000	0.71417	0.999000	0.59377	0.205000	0.24178	3.939000	0.56591	2.143000	0.66587	0.533000	0.62120	TAC		0.443	RNASE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411107.1			17	61	0	0	0	0	17	61				
CYFIP1	23191	broad.mit.edu	37	15	22990179	22990179	+	Silent	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr15:22990179G>C	ENST00000313077.7	+	24	2924	c.2799G>C	c.(2797-2799)ctG>ctC	p.L933L	CYFIP1_ENST00000435939.2_Silent_p.L502L|CYFIP1_ENST00000560848.1_Silent_p.L933L	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TGGAGGAGCTGCTGAAGGTCG	0.582																																						uc001yus.2		NA																	0				ovary(4)|pancreas(3)|liver(1)|skin(1)	9						c.(2797-2799)CTG>CTC		cytoplasmic FMR1 interacting protein 1 isoform							82.0	78.0	79.0					15																	22990179		2203	4300	6503	SO:0001819	synonymous_variant	23191				axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding	g.chr15:22990179G>C	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2799G>C	15.37:g.22990179G>C			Somatic				CYFIP1_uc001yut.2_Silent_p.L933L|CYFIP1_uc010aya.1_Silent_p.L961L|CYFIP1_uc001yuu.2_Silent_p.L502L|CYFIP1_uc001yuv.2_Silent_p.L127L	p.L933L	NM_014608	NP_055423	WXS	Illumina HiSeq	Unspecified	Q7L576	CYFP1_HUMAN		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)	24	2903	+		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	933						Silent	SNP	ENST00000313077.7	37	c.2799G>C	CCDS10009.1																																																																																				0.582	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608		6	69	0	0	0	0	6	69				
HERC2	8924	broad.mit.edu	37	15	28459109	28459109	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr15:28459109C>T	ENST00000261609.7	-	42	6673	c.6565G>A	c.(6565-6567)Gag>Aag	p.E2189K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAGTAGTCCTCTAACTGGGCC	0.572																																						uc001zbj.2		NA																	0				ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13						c.(6565-6567)GAG>AAG		hect domain and RLD 2							35.0	31.0	33.0					15																	28459109		2203	4299	6502	SO:0001583	missense	8924				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr15:28459109C>T	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6565G>A	15.37:g.28459109C>T	ENSP00000261609:p.Glu2189Lys		Somatic					p.E2189K	NM_004667	NP_004658	WXS	Illumina HiSeq	Unspecified	O95714	HERC2_HUMAN		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)	42	6671	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)	2189						Missense_Mutation	SNP	ENST00000261609.7	37	c.6565G>A	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897765	0.33535	.	.	ENSG00000128731	ENST00000261609	T	0.38077	1.16	5.17	5.17	0.71159	.	0.351548	0.31624	N	0.007326	T	0.31231	0.0790	L	0.44542	1.39	0.80722	D	1	B	0.26635	0.155	B	0.21360	0.034	T	0.10337	-1.0634	10	0.11182	T	0.66	.	18.8584	0.92262	0.0:1.0:0.0:0.0	.	2189	O95714	HERC2_HUMAN	K	2189	ENSP00000261609:E2189K	ENSP00000261609:E2189K	E	-	1	0	HERC2	26132704	1.000000	0.71417	0.763000	0.31416	0.371000	0.29859	7.312000	0.78968	2.687000	0.91594	0.484000	0.47621	GAG		0.572	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		4	27	0	0	0	0	4	27				
RYR3	6263	broad.mit.edu	37	15	34040341	34040341	+	Silent	SNP	G	G	T	rs201746379	byFrequency	TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr15:34040341G>T	ENST00000389232.4	+	54	8086	c.8016G>T	c.(8014-8016)gcG>gcT	p.A2672A	RYR3_ENST00000415757.3_Silent_p.A2672A	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2672	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.A2672A(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCTGGCCTGCGCGAGAGTCCC	0.522																																						uc001zhi.2		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(8014-8016)GCG>GCT		ryanodine receptor 3							83.0	88.0	86.0					15																	34040341		1981	4173	6154	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34040341G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8016G>T	15.37:g.34040341G>T			Somatic				RYR3_uc010bar.2_Silent_p.A2672A	p.A2672A	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	54	8086	+		all_lung(180;7.18e-09)	2672			3.|Cytoplasmic (By similarity).|4 X approximate repeats.		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.8016G>T	CCDS45210.1																																																																																				0.522	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			9	63	1	0	0.000442599	0.000484375	9	63				
C15orf54	400360	broad.mit.edu	37	15	39544747	39544747	+	Silent	SNP	T	T	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr15:39544747T>G	ENST00000318578.3	+	2	779	c.411T>G	c.(409-411)cgT>cgG	p.R137R	RP11-624L4.1_ENST00000558209.1_RNA|RP11-624L4.1_ENST00000561058.1_RNA|RP11-624L4.1_ENST00000560484.1_RNA|C15orf54_ENST00000561223.1_Silent_p.R137R	NM_207445.2	NP_997328.1	Q8N8G6	CO054_HUMAN	chromosome 15 open reading frame 54	137										NS(1)|haematopoietic_and_lymphoid_tissue(2)|lung(2)	5		all_cancers(109;5.39e-14)|all_epithelial(112;3.14e-12)|Lung NSC(122;9.74e-10)|all_lung(180;2.23e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;1.19e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0706)		CAACAAAGCGTGTGTGCACTA	0.473																																						uc001zkg.2		NA																	0					0						c.(409-411)CGT>CGG		hypothetical protein LOC400360							136.0	117.0	124.0					15																	39544747		2200	4297	6497	SO:0001819	synonymous_variant	400360							g.chr15:39544747T>G		CCDS10049.1	15q14	2014-09-10			ENSG00000175746	ENSG00000175746			33797	protein-coding gene	gene with protein product							Standard	NM_207445		Approved	FLJ39531	uc001zkg.2	Q8N8G6	OTTHUMG00000129843	ENST00000318578.3:c.411T>G	15.37:g.39544747T>G			Somatic					p.R137R	NM_207445	NP_997328	WXS	Illumina HiSeq	Unspecified	Q8N8G6	CO054_HUMAN		GBM - Glioblastoma multiforme(113;1.19e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0706)	2	779	+		all_cancers(109;5.39e-14)|all_epithelial(112;3.14e-12)|Lung NSC(122;9.74e-10)|all_lung(180;2.23e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)	137					B7ZVZ9	Silent	SNP	ENST00000318578.3	37	c.411T>G	CCDS10049.1																																																																																				0.473	C15orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252083.1	NM_207445		14	101	0	0	0	0	14	101				
ALPK3	57538	broad.mit.edu	37	15	85401044	85401044	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr15:85401044G>A	ENST00000258888.5	+	6	3848	c.3681G>A	c.(3679-3681)caG>caA	p.Q1227Q		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1227					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACCTGGTGCAGAGTGCACAGA	0.672																																						uc002ble.2		NA																	0				stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12						c.(3679-3681)CAG>CAA		alpha-kinase 3							68.0	48.0	54.0					15																	85401044		2203	4299	6502	SO:0001819	synonymous_variant	57538				heart development	nucleus	ATP binding|protein serine/threonine kinase activity	g.chr15:85401044G>A	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3681G>A	15.37:g.85401044G>A			Somatic					p.Q1227Q	NM_020778	NP_065829	WXS	Illumina HiSeq	Unspecified	Q96L96	ALPK3_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		6	3848	+			1227					Q9P2L6	Silent	SNP	ENST00000258888.5	37	c.3681G>A	CCDS10333.1																																																																																				0.672	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		13	35	0	0	0	0	13	35				
ITGAD	3681	broad.mit.edu	37	16	31419085	31419085	+	Splice_Site	SNP	A	A	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr16:31419085A>T	ENST00000389202.2	+	9	907		c.e9-1			NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D						activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TCTCTGCTGCAGGTGGGACAC	0.622																																						uc002ebv.1		NA																	0				skin(1)	1						c.e9-2		integrin, alpha D precursor							44.0	38.0	40.0					16																	31419085		2197	4300	6497	SO:0001630	splice_region_variant	3681				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr16:31419085A>T	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.859-1A>T	16.37:g.31419085A>T			Somatic				ITGAD_uc010vfl.1_Silent_p.A318A|ITGAD_uc010cap.1_Splice_Site_p.V287_splice|ITGAD_uc002ebw.1_Silent_p.A129A	p.V287_splice	NM_005353	NP_005344	WXS	Illumina HiSeq	Unspecified	Q13349	ITAD_HUMAN			9	908	+								Q15575|Q15576	Splice_Site	SNP	ENST00000389202.2	37	c.859_splice	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	a	14.86	2.662181	0.47572	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	.	.	.	4.97	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0657	0.36462	0.9106:0.0:0.0894:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAD	31326586	0.999000	0.42202	0.731000	0.30826	0.618000	0.37518	4.610000	0.61155	0.729000	0.32403	0.477000	0.44152	.		0.622	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	Intron	8	31	0	0	0	0	8	31				
NUP93	9688	broad.mit.edu	37	16	56865770	56865770	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr16:56865770G>T	ENST00000308159.5	+	11	1223	c.1102G>T	c.(1102-1104)Gaa>Taa	p.E368*	NUP93_ENST00000569842.1_Nonsense_Mutation_p.E368*|NUP93_ENST00000564887.1_Nonsense_Mutation_p.E245*|NUP93_ENST00000542526.1_Nonsense_Mutation_p.E245*	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	368					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CCCAGCTACGGAAAACAAGCT	0.493																																					Colon(33;610 796 1305 1705 38917)	uc002eka.2		NA																	0				ovary(1)|lung(1)	2						c.(1102-1104)GAA>TAA		nucleoporin 93kDa							84.0	79.0	81.0					16																	56865770		2198	4300	6498	SO:0001587	stop_gained	9688				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr16:56865770G>T	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1102G>T	16.37:g.56865770G>T	ENSP00000310668:p.Glu368*		Somatic				NUP93_uc002ekb.2_Nonsense_Mutation_p.E245*|NUP93_uc010vhi.1_Nonsense_Mutation_p.E245*	p.E368*	NM_014669	NP_055484	WXS	Illumina HiSeq	Unspecified	Q8N1F7	NUP93_HUMAN			11	1223	+			368					B3KPQ8|Q14705	Nonsense_Mutation	SNP	ENST00000308159.5	37	c.1102G>T	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	G	44	10.725890	0.99457	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	.	.	.	5.93	5.93	0.95920	.	0.043330	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-21.6833	18.5344	0.91004	0.0:0.0:1.0:0.0	.	.	.	.	X	368;245	.	ENSP00000310668:E368X	E	+	1	0	NUP93	55423271	1.000000	0.71417	0.956000	0.39512	0.822000	0.46500	9.567000	0.98161	2.826000	0.97356	0.655000	0.94253	GAA		0.493	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669		4	47	1	0	0.00909568	0.00956384	4	47				
TP53	7157	broad.mit.edu	37	17	7579377	7579377	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:7579377G>A	ENST00000269305.4	-	4	499	c.310C>T	c.(310-312)Cag>Tag	p.Q104*	TP53_ENST00000413465.2_Nonsense_Mutation_p.Q104*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q104*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q104*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q104*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q104*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	104	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q104*(12)|p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.Y103_Q104>**(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TAGCTGCCCTGGTAGGTTTTC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		34	Substitution - Nonsense(12)|Deletion - Frameshift(11)|Whole gene deletion(8)|Complex - deletion inframe(2)|Complex - compound substitution(1)	p.0?(7)|p.Q104*(5)|p.G59fs*23(3)|p.Q104fs*19(1)|p.V73fs*9(1)|p.Q104H(1)|p.Y103_Q104>**(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)	lung(6)|ovary(4)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|biliary_tract(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245						c.(310-312)CAG>TAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							54.0	54.0	54.0					17																	7579377		2203	4300	6503	SO:0001587	stop_gained	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7579377G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.310C>T	17.37:g.7579377G>A	ENSP00000269305:p.Gln104*	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Nonsense_Mutation_p.Q104*|TP53_uc002gih.2_Nonsense_Mutation_p.Q104*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.Q104*|TP53_uc010cni.1_Nonsense_Mutation_p.Q104*|TP53_uc002gij.2_Nonsense_Mutation_p.Q104*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.Q65*|TP53_uc010cnk.1_Nonsense_Mutation_p.Q119*	p.Q104*	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	4	504	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	104		Q -> H (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).	Interaction with HIPK1 (By similarity).||Interaction with WWOX.		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	c.310C>T	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460479	0.63401	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.75	4.75	0.60458	.	0.378699	0.29424	N	0.012186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	2.2505	11.3383	0.49518	0.0:0.1837:0.8163:0.0	.	.	.	.	X	104	.	ENSP00000269305:Q104X	Q	-	1	0	TP53	7520102	1.000000	0.71417	0.643000	0.29450	0.384000	0.30261	1.618000	0.36954	2.630000	0.89119	0.655000	0.94253	CAG		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		18	57	0	0	0	0	18	57				
MYH1	4619	broad.mit.edu	37	17	10399767	10399767	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:10399767C>A	ENST00000226207.5	-	34	4850	c.4756G>T	c.(4756-4758)Gaa>Taa	p.E1586*	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1586					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGGTCAATTTCCTCATCTTTT	0.453																																						uc002gmo.2		NA																	0				ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						c.(4756-4758)GAA>TAA		myosin, heavy chain 1, skeletal muscle, adult							195.0	181.0	186.0					17																	10399767		2203	4300	6503	SO:0001587	stop_gained	4619					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:10399767C>A		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4756G>T	17.37:g.10399767C>A	ENSP00000226207:p.Glu1586*		Somatic				uc002gml.1_Intron	p.E1586*	NM_005963	NP_005954	WXS	Illumina HiSeq	Unspecified	P12882	MYH1_HUMAN			34	4850	-			1586			Potential.		Q14CA4|Q9Y622	Nonsense_Mutation	SNP	ENST00000226207.5	37	c.4756G>T	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	44	10.629936	0.99440	.	.	ENSG00000109061	ENST00000226207	.	.	.	5.52	5.52	0.82312	.	0.000000	0.44097	U	0.000482	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7889	0.96450	0.0:1.0:0.0:0.0	.	.	.	.	X	1586	.	ENSP00000226207:E1586X	E	-	1	0	MYH1	10340492	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.594000	0.82698	2.734000	0.93682	0.655000	0.94253	GAA		0.453	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		22	87	1	0	4.35e-09	5.14e-09	22	87				
DHRS11	79154	broad.mit.edu	37	17	34954655	34954655	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:34954655G>A	ENST00000251312.5	+	3	633	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	DHRS11_ENST00000590554.1_Missense_Mutation_p.V62M	NM_024308.3	NP_077284.2	Q6UWP2	DHR11_HUMAN	dehydrogenase/reductase (SDR family) member 11	141						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(4)	5						GGAGCGGAATGTGGACGATGG	0.587																																						uc002hnd.2		NA																	0					0						c.(421-423)GTG>ATG		short-chain dehydrogenase/reductase precursor							191.0	141.0	158.0					17																	34954655		2203	4300	6503	SO:0001583	missense	79154					extracellular region	binding|oxidoreductase activity	g.chr17:34954655G>A		CCDS11315.2	17q12	2014-05-06			ENSG00000108272	ENSG00000278535		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	28639	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 24C, member 1"""					12975309, 19027726	Standard	NM_024308		Approved	MGC4172, SDR24C1	uc002hnd.3	Q6UWP2	OTTHUMG00000188442	ENST00000251312.5:c.421G>A	17.37:g.34954655G>A	ENSP00000251312:p.Val141Met		Somatic					p.V141M	NM_024308	NP_077284	WXS	Illumina HiSeq	Unspecified	Q6UWP2	DHR11_HUMAN			3	635	+			141					B2RDZ3|Q9BUC7|Q9H674	Missense_Mutation	SNP	ENST00000251312.5	37	c.421G>A	CCDS11315.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222929	0.79464	.	.	ENSG00000108272	ENST00000251312	D	0.87256	-2.23	5.26	4.28	0.50868	NAD(P)-binding domain (1);	0.186205	0.46442	D	0.000289	D	0.85539	0.5720	M	0.69823	2.125	0.44843	D	0.997851	B	0.32302	0.363	B	0.36464	0.225	D	0.83848	0.0261	10	0.59425	D	0.04	-20.8709	7.3355	0.26607	0.2671:0.0:0.7329:0.0	.	141	Q6UWP2	DHR11_HUMAN	M	141	ENSP00000251312:V141M	ENSP00000251312:V141M	V	+	1	0	DHRS11	32028768	1.000000	0.71417	0.943000	0.38184	0.956000	0.61745	4.236000	0.58675	1.196000	0.43129	0.561000	0.74099	GTG		0.587	DHRS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256681.2	NM_024308		12	87	0	0	0	0	12	87				
KRTAP4-11	653240	broad.mit.edu	37	17	39274157	39274157	+	Silent	SNP	G	G	A	rs145503152		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:39274157G>A	ENST00000391413.2	-	1	449	c.411C>T	c.(409-411)ccC>ccT	p.P137P		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	137	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.P137P(3)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tgctgcagctggggtggcagc	0.672																																						uc002hvz.2		NA																	3	Substitution - coding silent(3)		prostate(1)|lung(1)|endometrium(1)		0						c.(409-411)CCC>CCT		keratin associated protein 4-11							8.0	13.0	12.0					17																	39274157		684	1586	2270	SO:0001819	synonymous_variant	653240					keratin filament		g.chr17:39274157G>A	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.411C>T	17.37:g.39274157G>A			Somatic					p.P137P	NM_033059	NP_149048	WXS	Illumina HiSeq	Unspecified	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	450	-		Breast(137;0.000496)	137			23.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		A0AUY2	Silent	SNP	ENST00000391413.2	37	c.411C>T	CCDS45675.1																																																																																				0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			7	22	0	0	0	0	7	22				
KRT37	8688	broad.mit.edu	37	17	39577792	39577792	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:39577792G>A	ENST00000225550.3	-	6	1067	c.1068C>T	c.(1066-1068)ggC>ggT	p.G356G	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	356	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CCAGCTCTGTGCCGTAGCGGT	0.562																																						uc002hwp.1		NA																	0				skin(1)	1						c.(1066-1068)GGC>GGT		keratin 37							64.0	61.0	62.0					17																	39577792		2203	4300	6503	SO:0001819	synonymous_variant	8688					intermediate filament	structural molecule activity	g.chr17:39577792G>A	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.1068C>T	17.37:g.39577792G>A			Somatic				uc002hwo.1_Intron	p.G356G	NM_003770	NP_003761	WXS	Illumina HiSeq	Unspecified	O76014	KRT37_HUMAN			6	1115	-		Breast(137;0.000496)	356			Coil 2.|Rod.			Silent	SNP	ENST00000225550.3	37	c.1068C>T	CCDS32653.1																																																																																				0.562	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		22	39	0	0	0	0	22	39				
HEXIM1	10614	broad.mit.edu	37	17	43227248	43227248	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:43227248G>A	ENST00000332499.2	+	1	2565	c.691G>A	c.(691-693)Gcc>Acc	p.A231T	AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	231	Autoinhibitory acidic region; in absence of 7SK snRNA interacts with the basic region preventing interaction with P-TEFb and modulating subcellular localization.				heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GCGGGCCGCCGCCAAATCCGA	0.622																																						uc002iig.2		NA																	0				ovary(1)	1						c.(691-693)GCC>ACC		hexamethylene bis-acetamide inducible 1							35.0	40.0	38.0					17																	43227248		2203	4300	6503	SO:0001583	missense	10614				negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding	g.chr17:43227248G>A	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.691G>A	17.37:g.43227248G>A	ENSP00000328773:p.Ala231Thr		Somatic					p.A231T	NM_006460	NP_006451	WXS	Illumina HiSeq	Unspecified	O94992	HEXI1_HUMAN			1	2565	+			231			Autoinhibitory acidic region; in absence of 7SK snRNA interacts with the basic region preventing interaction with P-TEFb and modulating subcellular localization.		B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	37	c.691G>A	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967998	0.74131	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.74	3.77	0.43336	.	0.413880	0.22906	N	0.054188	T	0.62563	0.2438	L	0.53249	1.67	0.33316	D	0.566716	D	0.89917	1.0	D	0.68621	0.959	T	0.70392	-0.4884	9	0.54805	T	0.06	-4.6464	7.9635	0.30085	0.1877:0.0:0.8123:0.0	.	231	O94992	HEXI1_HUMAN	T	231	.	ENSP00000328773:A231T	A	+	1	0	HEXIM1	40583031	0.941000	0.31946	0.995000	0.50966	0.994000	0.84299	1.676000	0.37565	0.995000	0.38917	0.561000	0.74099	GCC		0.622	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460		19	49	0	0	0	0	19	49				
CDC27	996	broad.mit.edu	37	17	45235606	45235606	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:45235606G>A	ENST00000066544.3	-	5	534	c.441C>T	c.(439-441)ttC>ttT	p.F147F	CDC27_ENST00000531206.1_Silent_p.F147F|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Silent_p.F86F|CDC27_ENST00000527547.1_Silent_p.F147F|RP5-867C24.4_ENST00000574021.1_RNA	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	147					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GAGACCAGAGGAAAGGATTTA	0.418																																						uc002ild.3		NA																	0				lung(2)|breast(2)|ovary(1)	5						c.(439-441)TTC>TTT		cell division cycle protein 27 isoform 2							55.0	57.0	57.0					17																	45235606		2203	4300	6503	SO:0001819	synonymous_variant	996				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding	g.chr17:45235606G>A	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.441C>T	17.37:g.45235606G>A			Somatic				CDC27_uc002ile.3_Silent_p.F147F|CDC27_uc002ilf.3_Silent_p.F147F|CDC27_uc010wkp.1_Silent_p.F86F|CDC27_uc010wkq.1_RNA	p.F147F	NM_001256	NP_001247	WXS	Illumina HiSeq	Unspecified	P30260	CDC27_HUMAN			5	568	-			147			TPR 2.		G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	c.441C>T	CCDS11509.1																																																																																				0.418	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			6	54	0	0	0	0	6	54				
CA10	56934	broad.mit.edu	37	17	49710870	49710870	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:49710870G>C	ENST00000285273.4	-	9	2042	c.931C>G	c.(931-933)Cca>Gca	p.P311A	CA10_ENST00000451037.2_Missense_Mutation_p.P311A|CA10_ENST00000571918.1_5'Flank|CA10_ENST00000570565.1_Missense_Mutation_p.P236A|CA10_ENST00000340813.6_Missense_Mutation_p.P317A|CA10_ENST00000442502.2_Missense_Mutation_p.P311A	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	311					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CGGTTGTTTGGACAGTCCTTC	0.507																																						uc002itw.3		NA																	0				ovary(1)|skin(1)	2						c.(931-933)CCA>GCA		carbonic anhydrase X							144.0	127.0	133.0					17																	49710870		2203	4300	6503	SO:0001583	missense	56934				brain development			g.chr17:49710870G>C	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.931C>G	17.37:g.49710870G>C	ENSP00000285273:p.Pro311Ala		Somatic				CA10_uc002itu.3_Missense_Mutation_p.P240A|CA10_uc002itv.3_Missense_Mutation_p.P317A|CA10_uc002itx.3_Missense_Mutation_p.P311A|CA10_uc002ity.3_Missense_Mutation_p.P311A|CA10_uc002itz.2_Missense_Mutation_p.P311A	p.P311A	NM_020178	NP_064563	WXS	Illumina HiSeq	Unspecified	Q9NS85	CAH10_HUMAN	BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		8	1917	-			311					B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	c.931C>G	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805289	0.90623	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.69926	-0.42;-0.42;-0.42;-0.44	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.74030	0.3663	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.987	T	0.66913	-0.5803	10	0.02654	T	1	.	18.2623	0.90039	0.0:0.0:1.0:0.0	.	311;317;236	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	A	311;311;311;317	ENSP00000390666:P311A;ENSP00000285273:P311A;ENSP00000405388:P311A;ENSP00000340363:P317A	ENSP00000285273:P311A	P	-	1	0	CA10	47065869	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.675000	0.98638	2.558000	0.86282	0.655000	0.94253	CCA		0.507	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178		16	53	0	0	0	0	16	53				
SLC16A6	9120	broad.mit.edu	37	17	66268877	66268877	+	Silent	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:66268877A>G	ENST00000327268.4	-	5	572	c.408T>C	c.(406-408)acT>acC	p.T136T	SLC16A6_ENST00000580666.1_Silent_p.T136T|ARSG_ENST00000448504.2_Intron	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	136					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GGATGGTTACAGTTGGGAGAA	0.423																																						uc002jgz.1		NA																	0					0						c.(406-408)ACT>ACC		solute carrier family 16, member 6	Pyruvic acid(DB00119)						151.0	140.0	144.0					17																	66268877		2203	4300	6503	SO:0001819	synonymous_variant	9120					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity	g.chr17:66268877A>G	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.408T>C	17.37:g.66268877A>G			Somatic				ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Silent_p.T136T	p.T136T	NM_004694	NP_004685	WXS	Illumina HiSeq	Unspecified	O15403	MOT7_HUMAN	BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		4	596	-	all_cancers(12;1.24e-09)		136			Helical; (Potential).		Q6P1X3	Silent	SNP	ENST00000327268.4	37	c.408T>C	CCDS11675.1																																																																																				0.423	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694		10	61	0	0	0	0	10	61				
GPR142	350383	broad.mit.edu	37	17	72368126	72368126	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr17:72368126C>A	ENST00000335666.4	+	4	824	c.776C>A	c.(775-777)gCc>gAc	p.A259D		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	259						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CGCTACACTGCCCTGTGCCAC	0.682																																						uc010wqy.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(775-777)GCC>GAC		G protein-coupled receptor 142							69.0	52.0	58.0					17																	72368126		2202	4300	6502	SO:0001583	missense	350383					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity	g.chr17:72368126C>A	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.776C>A	17.37:g.72368126C>A	ENSP00000335158:p.Ala259Asp		Somatic				GPR142_uc010wqx.1_Missense_Mutation_p.A171D	p.A259D	NM_181790	NP_861455	WXS	Illumina HiSeq	Unspecified	Q7Z601	GP142_HUMAN			4	776	+			259			Cytoplasmic (Potential).		A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	c.776C>A	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501312	0.26861	.	.	ENSG00000257008	ENST00000335666	T	0.55052	0.54	4.99	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.053906	0.64402	N	0.000001	T	0.63931	0.2553	M	0.80183	2.485	0.42644	D	0.993428	B;P	0.42296	0.035;0.775	B;P	0.46758	0.045;0.526	T	0.72750	-0.4199	10	0.87932	D	0	-22.7095	15.6433	0.77025	0.1379:0.8621:0.0:0.0	.	259;1221	Q7Z601;Q8NGB0	GP142_HUMAN;.	D	259	ENSP00000335158:A259D	ENSP00000335158:A259D	A	+	2	0	GPR142	69879721	1.000000	0.71417	0.995000	0.50966	0.018000	0.09664	5.650000	0.67944	1.430000	0.47334	-0.147000	0.13772	GCC		0.682	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790		4	31	1	0	0.00024832	0.000275269	4	31				
ZNF562	54811	broad.mit.edu	37	19	9764328	9764328	+	Missense_Mutation	SNP	A	A	G	rs61743320	byFrequency	TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:9764328A>G	ENST00000448622.1	-	6	740	c.578T>C	c.(577-579)gTg>gCg	p.V193A	ZNF562_ENST00000590155.1_Missense_Mutation_p.V192A|ZNF562_ENST00000453372.2_Missense_Mutation_p.V193A|ZNF562_ENST00000537617.1_Missense_Mutation_p.V77A|ZNF562_ENST00000293648.4_Missense_Mutation_p.V121A|ZNF562_ENST00000453792.2_Missense_Mutation_p.V124A|ZNF562_ENST00000541032.1_Missense_Mutation_p.V156A	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						TTCAAGATGCACAGCAAGGCC	0.403																																						uc010xks.1		NA																	0					0						c.(577-579)GTG>GCG		zinc finger protein 562 isoform a							90.0	81.0	84.0					19																	9764328		2203	4300	6503	SO:0001583	missense	54811				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9764328A>G	AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.578T>C	19.37:g.9764328A>G	ENSP00000411784:p.Val193Ala		Somatic				ZNF562_uc002mly.2_Missense_Mutation_p.V193A|ZNF562_uc002mlx.2_Missense_Mutation_p.V121A|ZNF562_uc010xkt.1_Missense_Mutation_p.V156A|ZNF562_uc010xku.1_Missense_Mutation_p.V124A|ZNF562_uc010xkv.1_Missense_Mutation_p.V192A|ZNF562_uc010xkw.1_Missense_Mutation_p.V77A	p.V193A	NM_001130032	NP_001123504	WXS	Illumina HiSeq	Unspecified	Q6V9R5	ZN562_HUMAN			6	741	-			193			C2H2-type 1; degenerate.		Q32MN2|Q9NXS5	Missense_Mutation	SNP	ENST00000448622.1	37	c.578T>C	CCDS45956.1	.	.	.	.	.	.	.	.	.	.	A	0.247	-1.009504	0.02095	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000293648;ENST00000541032;ENST00000453792;ENST00000537617	T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45	1.67	-0.743	0.11105	.	.	.	.	.	T	0.08802	0.0218	L	0.33753	1.03	0.09310	N	1	B;B;B;B;B	0.13594	0.0;0.001;0.0;0.001;0.008	B;B;B;B;B	0.13407	0.002;0.001;0.0;0.002;0.009	T	0.42207	-0.9465	9	0.07813	T	0.8	.	2.6262	0.04930	0.6124:0.0:0.1592:0.2284	.	77;192;156;193;121	F5H1B4;B4DMG0;B4DZP9;Q6V9R5;Q6V9R5-2	.;.;.;ZN562_HUMAN;.	A	193;193;121;156;124;77	ENSP00000410734:V193A;ENSP00000411784:V193A;ENSP00000293648:V121A;ENSP00000442614:V156A;ENSP00000440451:V124A;ENSP00000445816:V77A	ENSP00000293648:V121A	V	-	2	0	ZNF562	9625328	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-7.928000	0.00027	-0.297000	0.08934	-0.818000	0.03119	GTG		0.403	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450239.1	NM_017656		8	65	0	0	0	0	8	65				
CYP4F2	8529	broad.mit.edu	37	19	16006374	16006374	+	Silent	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:16006374G>T	ENST00000221700.6	-	3	380	c.285C>A	c.(283-285)atC>atA	p.I95I	CYP4F2_ENST00000011989.7_Intron	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGAGGGGGGAGATGGGTCCCA	0.592																																						uc002nbs.1		NA																	0				ovary(1)|skin(1)	2						c.(283-285)ATC>ATA		cytochrome P450, family 4, subfamily F,							112.0	120.0	117.0					19																	16006374		2203	4300	6503	SO:0001819	synonymous_variant	8529				leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding	g.chr19:16006374G>T	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.285C>A	19.37:g.16006374G>T			Somatic				CYP4F2_uc010xot.1_5'UTR|CYP4F2_uc010xou.1_Intron	p.I95I	NM_001082	NP_001073	WXS	Illumina HiSeq	Unspecified	P78329	CP4F2_HUMAN			3	335	-			95						Silent	SNP	ENST00000221700.6	37	c.285C>A	CCDS12336.1																																																																																				0.592	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082		6	170	1	0	2.01e-06	2.31e-06	6	170				
OR10H4	126541	broad.mit.edu	37	19	16060695	16060695	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:16060695G>A	ENST00000322107.1	+	1	878	c.878G>A	c.(877-879)aGc>aAc	p.S293N		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						ATCATTTTCAGCCTAAGGAAC	0.448																																						uc010xov.1		NA																	0				ovary(1)|breast(1)	2						c.(877-879)AGC>AAC		olfactory receptor, family 10, subfamily H,							118.0	109.0	112.0					19																	16060695		2203	4300	6503	SO:0001583	missense	126541				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:16060695G>A	AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.878G>A	19.37:g.16060695G>A	ENSP00000318834:p.Ser293Asn		Somatic					p.S293N	NM_001004465	NP_001004465	WXS	Illumina HiSeq	Unspecified	Q8NGA5	O10H4_HUMAN			1	878	+			293			Helical; Name=7; (Potential).		Q6IFJ2|Q96R57	Missense_Mutation	SNP	ENST00000322107.1	37	c.878G>A	CCDS32941.1	.	.	.	.	.	.	.	.	.	.	g	14.28	2.487381	0.44249	.	.	ENSG00000176231	ENST00000322107	T	0.39056	1.1	1.55	1.55	0.23275	.	0.274181	0.25467	U	0.030464	T	0.68091	0.2963	M	0.93197	3.39	0.36092	D	0.84355	D	0.89917	1.0	D	0.91635	0.999	T	0.76358	-0.2988	10	0.87932	D	0	.	8.6119	0.33808	0.0:0.0:1.0:0.0	.	293	Q8NGA5	O10H4_HUMAN	N	293	ENSP00000318834:S293N	ENSP00000318834:S293N	S	+	2	0	OR10H4	15921695	0.028000	0.19301	0.926000	0.36857	0.407000	0.30961	0.860000	0.27871	0.839000	0.34971	0.484000	0.47621	AGC		0.448	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460311.1			44	95	0	0	0	0	44	95				
ELL	8178	broad.mit.edu	37	19	18632829	18632829	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:18632829A>G	ENST00000262809.4	-	1	108	c.37T>C	c.(37-39)Tcg>Ccg	p.S13P		NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	13					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		CGCCCGCACGACAGCCCGTAG	0.697			T	MLL	AL																																	uc002njh.2		NA		Dom	yes		19	19p13.1	8178	T	ELL gene (11-19 lysine-rich leukemia gene)			L	MLL		AL		0				lung(1)	1						c.(37-39)TCG>CCG		elongation factor RNA polymerase II							69.0	51.0	57.0					19																	18632829		2203	4300	6503	SO:0001583	missense	8178				positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding	g.chr19:18632829A>G	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.37T>C	19.37:g.18632829A>G	ENSP00000262809:p.Ser13Pro		Somatic				ELL_uc010ebq.2_5'UTR	p.S13P	NM_006532	NP_006523	WXS	Illumina HiSeq	Unspecified	P55199	ELL_HUMAN		GBM - Glioblastoma multiforme(1328;7.81e-07)	1	109	-			13						Missense_Mutation	SNP	ENST00000262809.4	37	c.37T>C	CCDS12380.1	.	.	.	.	.	.	.	.	.	.	a	25.0	4.593252	0.86953	.	.	ENSG00000105656	ENST00000262809	T	0.34275	1.37	3.68	3.68	0.42216	.	0.230045	0.38605	U	0.001634	T	0.57636	0.2067	M	0.76574	2.34	0.58432	D	0.999996	D	0.76494	0.999	D	0.85130	0.997	T	0.62025	-0.6941	10	0.72032	D	0.01	.	11.5398	0.50659	1.0:0.0:0.0:0.0	.	13	P55199	ELL_HUMAN	P	13	ENSP00000262809:S13P	ENSP00000262809:S13P	S	-	1	0	ELL	18493829	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.922000	0.87538	1.327000	0.45338	0.392000	0.25879	TCG		0.697	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466362.1	NM_006532		3	33	0	0	0	0	3	33				
WDR62	284403	broad.mit.edu	37	19	36593683	36593683	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:36593683G>A	ENST00000270301.7	+	27	3250	c.3250G>A	c.(3250-3252)Gaa>Aaa	p.E1084K	WDR62_ENST00000401500.2_Missense_Mutation_p.E1089K			O43379	WDR62_HUMAN	WD repeat domain 62	1084					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CTCTGAAGCTGAAGACCACTT	0.617																																						uc002odc.2		NA																	0					0						c.(3250-3252)GAA>AAA		WD repeat domain 62 isoform 2							103.0	86.0	91.0					19																	36593683		2203	4300	6503	SO:0001583	missense	284403				cerebral cortex development	nucleus		g.chr19:36593683G>A	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.3250G>A	19.37:g.36593683G>A	ENSP00000270301:p.Glu1084Lys		Somatic				WDR62_uc002odd.2_Missense_Mutation_p.E1089K	p.E1084K	NM_173636	NP_775907	WXS	Illumina HiSeq	Unspecified	O43379	WDR62_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.06)		27	3341	+	Esophageal squamous(110;0.162)		1084					Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	c.3250G>A	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981432	0.34942	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.53857	0.68;0.6	5.3	3.18	0.36537	.	1.046710	0.07504	N	0.907745	T	0.38931	0.1059	L	0.32530	0.975	0.41581	D	0.988749	B;B	0.15930	0.015;0.008	B;B	0.15052	0.012;0.005	T	0.11743	-1.0575	10	0.08837	T	0.75	-9.5395	8.0666	0.30665	0.1866:0.0:0.8134:0.0	.	1089;1084	O43379-4;O43379	.;WDR62_HUMAN	K	1089;1084	ENSP00000384792:E1089K;ENSP00000270301:E1084K	ENSP00000270301:E1084K	E	+	1	0	WDR62	41285523	0.396000	0.25262	0.179000	0.23059	0.002000	0.02628	1.925000	0.40074	0.636000	0.30508	-0.136000	0.14681	GAA		0.617	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671		5	36	0	0	0	0	5	36				
ZNF790	388536	broad.mit.edu	37	19	37310699	37310699	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:37310699A>G	ENST00000356725.4	-	5	667	c.547T>C	c.(547-549)Tca>Cca	p.S183P	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTATGATCTGAACCAGAAATA	0.348																																						uc002oew.2		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(547-549)TCA>CCA		zinc finger protein 790							94.0	93.0	93.0					19																	37310699		2203	4300	6503	SO:0001583	missense	388536				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37310699A>G	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.547T>C	19.37:g.37310699A>G	ENSP00000349161:p.Ser183Pro		Somatic				uc002oev.1_Intron	p.S183P	NM_206894	NP_996777	WXS	Illumina HiSeq	Unspecified	Q6PG37	ZN790_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		5	666	-	Esophageal squamous(110;0.183)		183						Missense_Mutation	SNP	ENST00000356725.4	37	c.547T>C	CCDS12496.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.929745	0.34096	.	.	ENSG00000197863	ENST00000356725	T	0.18657	2.2	3.17	-0.665	0.11403	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21267	0.0512	M	0.79926	2.475	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41538	-0.9503	9	0.59425	D	0.04	.	1.1234	0.01729	0.5139:0.1827:0.124:0.1794	.	183	Q6PG37	ZN790_HUMAN	P	183	ENSP00000349161:S183P	ENSP00000349161:S183P	S	-	1	0	ZNF790	42002539	0.000000	0.05858	0.001000	0.08648	0.505000	0.33919	-0.798000	0.04565	0.017000	0.15025	0.260000	0.18958	TCA		0.348	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385341.2	NM_206894		11	67	0	0	0	0	11	67				
ZNF569	148266	broad.mit.edu	37	19	37904514	37904514	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:37904514G>T	ENST00000316950.6	-	6	1603	c.1046C>A	c.(1045-1047)aCa>aAa	p.T349K	ZNF569_ENST00000392149.2_Missense_Mutation_p.T349K|ZNF569_ENST00000392150.2_Missense_Mutation_p.T190K	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTTCTCCTGTATGACTTCT	0.368																																						uc002ogi.2		NA																	0				breast(2)|skin(1)	3						c.(1045-1047)ACA>AAA		zinc finger protein 569							96.0	94.0	95.0					19																	37904514		2203	4300	6503	SO:0001583	missense	148266				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37904514G>T	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1046C>A	19.37:g.37904514G>T	ENSP00000325018:p.Thr349Lys		Somatic				ZNF569_uc002ogh.2_Missense_Mutation_p.T190K|ZNF569_uc002ogj.2_Missense_Mutation_p.T373K	p.T349K	NM_152484	NP_689697	WXS	Illumina HiSeq	Unspecified	Q5MCW4	ZN569_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1604	-			349					A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	c.1046C>A	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222693	0.58668	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.24538	1.85;1.85	3.97	2.83	0.33086	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38837	N	0.001541	T	0.35740	0.0942	L	0.53249	1.67	0.47374	D	0.999405	D;D	0.71674	0.998;0.998	P;P	0.60789	0.879;0.879	T	0.12192	-1.0557	10	0.87932	D	0	.	6.2819	0.21011	0.1038:0.0:0.7112:0.185	.	190;349	Q17RR6;Q5MCW4	.;ZN569_HUMAN	K	349;5;190	ENSP00000325018:T349K;ENSP00000375993:T190K	ENSP00000325018:T349K	T	-	2	0	ZNF569	42596354	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	2.045000	0.41250	2.204000	0.70986	0.655000	0.94253	ACA		0.368	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484		11	107	1	0	0.000978159	0.00106505	11	107				
LGALS4	3960	broad.mit.edu	37	19	39292682	39292682	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:39292682C>T	ENST00000307751.4	-	9	1252	c.775G>A	c.(775-777)Gag>Aag	p.E259K		NM_006149.3	NP_006140.1	P56470	LEG4_HUMAN	lectin, galactoside-binding, soluble, 4	259	Beta-galactoside binding. {ECO:0000250}.|Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				cell adhesion (GO:0007155)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			TTCTTCTCCTCGGATCCCCAC	0.567																																						uc002ojg.2		NA																	0				ovary(1)|skin(1)	2						c.(775-777)GAG>AAG		galectin-4							91.0	83.0	86.0					19																	39292682		2203	4300	6503	SO:0001583	missense	3960				cell adhesion	cytosol|plasma membrane	sugar binding	g.chr19:39292682C>T		CCDS12521.1	19q13.2	2014-03-19	2008-07-25		ENSG00000171747	ENSG00000171747		"""Lectins, galactoside-binding"""	6565	protein-coding gene	gene with protein product	"""galectin 4"""	602518				8063692	Standard	NM_006149		Approved	GAL4	uc002ojg.3	P56470	OTTHUMG00000182608	ENST00000307751.4:c.775G>A	19.37:g.39292682C>T	ENSP00000302100:p.Glu259Lys		Somatic					p.E259K	NM_006149	NP_006140	WXS	Illumina HiSeq	Unspecified	P56470	LEG4_HUMAN	Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)		9	989	-	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		259			Galectin 2.|Beta-galactoside binding (By similarity).			Missense_Mutation	SNP	ENST00000307751.4	37	c.775G>A	CCDS12521.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656679	0.88154	.	.	ENSG00000171747	ENST00000307751	T	0.25912	1.77	4.87	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.62344	0.2420	M	0.93420	3.415	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.74044	-0.3791	10	0.66056	D	0.02	-35.9275	16.7452	0.85470	0.0:1.0:0.0:0.0	.	259	P56470	LEG4_HUMAN	K	259	ENSP00000302100:E259K	ENSP00000302100:E259K	E	-	1	0	LGALS4	43984522	1.000000	0.71417	0.930000	0.37139	0.652000	0.38707	6.386000	0.73186	2.254000	0.74563	0.491000	0.48974	GAG		0.567	LGALS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462641.1	NM_006149		15	77	0	0	0	0	15	77				
DYRK1B	9149	broad.mit.edu	37	19	40318983	40318983	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:40318983G>T	ENST00000593685.1	-	6	1229	c.761C>A	c.(760-762)gCc>gAc	p.A254D	DYRK1B_ENST00000323039.5_Missense_Mutation_p.A254D|DYRK1B_ENST00000430012.2_Missense_Mutation_p.A254D|DYRK1B_ENST00000348817.3_Missense_Mutation_p.A254D|DYRK1B_ENST00000597639.1_Missense_Mutation_p.A254D			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			AATCTTGATGGCGCTGCGCTT	0.622																																						uc002omj.2		NA																	0				ovary(4)|stomach(1)|central_nervous_system(1)|skin(1)	7						c.(760-762)GCC>GAC		dual-specificity tyrosine-(Y)-phosphorylation							56.0	48.0	50.0					19																	40318983		2203	4300	6503	SO:0001583	missense	9149				positive regulation of transcription, DNA-dependent	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|transcription coactivator activity	g.chr19:40318983G>T	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.761C>A	19.37:g.40318983G>T	ENSP00000469863:p.Ala254Asp		Somatic				DYRK1B_uc002omi.2_Missense_Mutation_p.A254D|DYRK1B_uc002omk.2_Missense_Mutation_p.A254D	p.A254D	NM_004714	NP_004705	WXS	Illumina HiSeq	Unspecified	Q9Y463	DYR1B_HUMAN	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)		6	1041	-	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		254			Protein kinase.		O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	c.761C>A	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021692	0.93462	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.64803	-0.12;-0.12;-0.12	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.13272	0.32	0.80722	D	1	D;D;D	0.67145	0.991;0.996;0.991	D;D;D	0.65010	0.931;0.924;0.931	T	0.68330	-0.5437	10	0.52906	T	0.07	.	17.8657	0.88794	0.0:0.0:1.0:0.0	.	254;254;254	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	D	254	ENSP00000312789:A254D;ENSP00000221803:A254D;ENSP00000403182:A254D	ENSP00000312789:A254D	A	-	2	0	DYRK1B	45010823	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.841000	0.99482	2.826000	0.97356	0.491000	0.48974	GCC		0.622	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714		6	31	1	0	0.00307968	0.00330296	6	31				
MEIS3	56917	broad.mit.edu	37	19	47909780	47909780	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:47909780G>A	ENST00000558555.1	-	12	1269	c.1082C>T	c.(1081-1083)tCa>tTa	p.S361L	MEIS3_ENST00000561096.1_Missense_Mutation_p.S449L|MEIS3_ENST00000331559.5_Missense_Mutation_p.S390L|MEIS3_ENST00000441740.2_Missense_Mutation_p.S344L|MEIS3_ENST00000560253.1_Intron|MEIS3_ENST00000561293.1_Missense_Mutation_p.S407L|MEIS3_ENST00000559524.1_Missense_Mutation_p.S407L			Q99687	MEIS3_HUMAN	Meis homeobox 3	361					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		CATCCCCACTGATCCTGGAAG	0.507																																						uc002pgu.2		NA																	0					0						c.(1081-1083)TCA>TTA		Meis1, myeloid ecotropic viral integration site							94.0	84.0	88.0					19																	47909780		2203	4300	6503	SO:0001583	missense	56917					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr19:47909780G>A	BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.1082C>T	19.37:g.47909780G>A	ENSP00000454073:p.Ser361Leu		Somatic				MEIS3_uc010xyp.1_RNA|MEIS3_uc002pgo.2_Intron|MEIS3_uc002pgp.2_Missense_Mutation_p.S193L|MEIS3_uc002pgq.2_Missense_Mutation_p.S442L|MEIS3_uc002pgr.2_Missense_Mutation_p.S229L|MEIS3_uc002pgt.2_Missense_Mutation_p.S344L|MEIS3_uc002pgv.2_Missense_Mutation_p.S390L|MEIS3_uc002pgs.2_Missense_Mutation_p.S407L|MEIS3_uc010eld.2_Missense_Mutation_p.S407L	p.S361L	NM_001009813	NP_001009813	WXS	Illumina HiSeq	Unspecified	Q99687	MEIS3_HUMAN		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)	12	1529	-		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	361					A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	ENST00000558555.1	37	c.1082C>T		.	.	.	.	.	.	.	.	.	.	G	8.292	0.817869	0.16607	.	.	ENSG00000105419	ENST00000331559;ENST00000441740;ENST00000437609	D	0.86432	-2.12	3.73	3.73	0.42828	.	0.638760	0.12765	N	0.441038	D	0.85182	0.5638	L	0.28274	0.84	0.09310	N	0.999997	B;B;B;D	0.62365	0.18;0.001;0.002;0.991	B;B;B;P	0.59595	0.103;0.002;0.002;0.86	T	0.73007	-0.4118	10	0.10636	T	0.68	-10.9257	11.3274	0.49456	0.0:0.0:1.0:0.0	.	253;361;344;407	Q8TCW1;Q99687;Q99687-3;Q99687-2	.;MEIS3_HUMAN;.;.	L	407;344;38	ENSP00000388667:S344L	ENSP00000333552:S407L	S	-	2	0	MEIS3	52601592	0.467000	0.25831	0.369000	0.25952	0.811000	0.45836	3.140000	0.50585	2.393000	0.81446	0.430000	0.28490	TCA		0.507	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929		12	94	0	0	0	0	12	94				
KCNC3	3748	broad.mit.edu	37	19	50826961	50826961	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:50826961G>A	ENST00000477616.1	-	2	1543	c.1249C>T	c.(1249-1251)Cgc>Tgc	p.R417C	KCNC3_ENST00000474951.1_Intron|KCNC3_ENST00000376959.2_Missense_Mutation_p.R417C|KCNC3_ENST00000391818.2_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	417					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	CGGACGAAGCGGACCACCCGC	0.657																																					Melanoma(91;1496 2324 50908)	uc002pru.1		NA																	0				pancreas(1)	1						c.(1249-1251)CGC>TGC		Shaw-related voltage-gated potassium channel							80.0	78.0	78.0					19																	50826961		2203	4300	6503	SO:0001583	missense	3748				cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr19:50826961G>A	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1249C>T	19.37:g.50826961G>A	ENSP00000434241:p.Arg417Cys		Somatic				KCNC3_uc002prt.1_Missense_Mutation_p.R53C	p.R417C	NM_004977	NP_004968	WXS	Illumina HiSeq	Unspecified	Q14003	KCNC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	2	1544	-		all_neural(266;0.057)|Ovarian(192;0.208)	417			Helical; Voltage-sensor; Name=Segment S4; (Potential).			Missense_Mutation	SNP	ENST00000477616.1	37	c.1249C>T	CCDS12793.1	.	.	.	.	.	.	.	.	.	.	g	20.4	3.992020	0.74703	.	.	ENSG00000131398	ENST00000376959;ENST00000477616;ENST00000443843	D;D	0.99259	-5.64;-5.64	2.86	2.86	0.33363	Ion transport (1);	0.182505	0.36101	U	0.002783	D	0.99606	0.9857	H	0.98238	4.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97561	1.0098	10	0.87932	D	0	.	12.9172	0.58213	0.0:0.0:1.0:0.0	.	417;417	Q14003;E7ETH1	KCNC3_HUMAN;.	C	417;417;231	ENSP00000366158:R417C;ENSP00000434241:R417C	ENSP00000366158:R417C	R	-	1	0	KCNC3	55518773	1.000000	0.71417	0.678000	0.29963	0.842000	0.47809	7.506000	0.81665	1.615000	0.50252	0.486000	0.48141	CGC		0.657	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314288.2	NM_004977		10	31	0	0	0	0	10	31				
MBOAT7	79143	broad.mit.edu	37	19	54677887	54677887	+	Missense_Mutation	SNP	G	G	A	rs376939333		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:54677887G>A	ENST00000245615.1	-	8	1750	c.1270C>T	c.(1270-1272)Cgg>Tgg	p.R424W	MBOAT7_ENST00000338624.6_Missense_Mutation_p.R351W|TMC4_ENST00000376591.4_5'Flank|TMC4_ENST00000476013.2_5'Flank|TMC4_ENST00000301187.4_5'Flank|MBOAT7_ENST00000431666.2_Missense_Mutation_p.R351W	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	424					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCCCAGTACCGAAGGGTGTCG	0.647																																					NSCLC(97;826 2151 10470 22540)	uc002qdq.2		NA																	0					0						c.(1270-1272)CGG>TGG		membrane bound O-acyltransferase domain		G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	110.0	98.0	102.0		1051,1051,1270	4.8	0.8	19		102	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	MBOAT7	NM_001146056.1,NM_001146083.1,NM_024298.3	101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	351/400,351/400,424/473	54677887	1,13005	2203	4300	6503	SO:0001583	missense	79143				phospholipid biosynthetic process	integral to membrane	acyltransferase activity	g.chr19:54677887G>A	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.1270C>T	19.37:g.54677887G>A	ENSP00000245615:p.Arg424Trp		Somatic				TMC4_uc010erf.2_5'Flank|TMC4_uc002qdo.2_5'Flank|MBOAT7_uc010erg.2_Missense_Mutation_p.R108W|MBOAT7_uc010yem.1_Missense_Mutation_p.R406W|MBOAT7_uc002qdr.2_Missense_Mutation_p.R424W|MBOAT7_uc002qds.2_Missense_Mutation_p.R351W|MBOAT7_uc010yen.1_Missense_Mutation_p.R351W	p.R424W	NM_024298	NP_077274	WXS	Illumina HiSeq	Unspecified	Q96N66	MBOA7_HUMAN			9	1536	-	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		424					A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Missense_Mutation	SNP	ENST00000245615.1	37	c.1270C>T	CCDS12883.1	.	.	.	.	.	.	.	.	.	.	g	17.23	3.336589	0.60963	0.0	1.16E-4	ENSG00000125505	ENST00000431666;ENST00000338624;ENST00000245615	T;T;T	0.18960	2.18;2.18;2.18	4.79	4.79	0.61399	.	0.225320	0.45361	D	0.000379	T	0.41627	0.1167	L	0.55481	1.735	0.48632	D	0.99968	D;D;D	0.89917	1.0;1.0;1.0	P;D;P	0.67382	0.895;0.951;0.895	T	0.29181	-1.0020	10	0.66056	D	0.02	-29.3926	17.0288	0.86455	0.0:0.0:1.0:0.0	.	406;351;424	B4DDH8;Q96N66-2;Q96N66	.;.;MBOA7_HUMAN	W	351;351;424	ENSP00000410503:R351W;ENSP00000344377:R351W;ENSP00000245615:R424W	ENSP00000245615:R424W	R	-	1	2	MBOAT7	59369699	1.000000	0.71417	0.848000	0.33437	0.613000	0.37349	4.109000	0.57824	2.393000	0.81446	0.480000	0.44947	CGG		0.647	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	NM_024298		16	88	0	0	0	0	16	88				
PEG3	5178	broad.mit.edu	37	19	57325822	57325822	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr19:57325822G>T	ENST00000326441.9	-	10	4351	c.3988C>A	c.(3988-3990)Cca>Aca	p.P1330T	PEG3_ENST00000598410.1_Missense_Mutation_p.P1206T|PEG3_ENST00000423103.2_Missense_Mutation_p.P1330T|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.P1204T|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1330					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCATAGAATGGTATAGCTCCT	0.423																																						uc002qnu.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(3988-3990)CCA>ACA		paternally expressed 3 isoform 1							89.0	87.0	88.0					19																	57325822		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57325822G>T	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3988C>A	19.37:g.57325822G>T	ENSP00000326581:p.Pro1330Thr		Somatic				ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.P1301T|PEG3_uc002qnv.2_Missense_Mutation_p.P1330T|PEG3_uc002qnw.2_Missense_Mutation_p.P1206T|PEG3_uc002qnx.2_Missense_Mutation_p.P1204T|PEG3_uc010etr.2_Missense_Mutation_p.P1330T	p.P1330T	NM_001146186	NP_001139658	WXS	Illumina HiSeq	Unspecified	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	4339	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	1330					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.3988C>A	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.056384	0.55325	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02916	4.11;4.11	4.48	2.38	0.29361	.	0.000000	0.47093	D	0.000246	T	0.11879	0.0289	M	0.78637	2.42	.	.	.	P;D;D	0.89917	0.931;1.0;1.0	P;D;D	0.85130	0.476;0.997;0.997	T	0.08889	-1.0700	9	0.40728	T	0.16	-7.766	9.0036	0.36097	0.1831:0.0:0.8169:0.0	.	1206;1330;1265	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	T	1330	ENSP00000326581:P1330T;ENSP00000403051:P1330T	ENSP00000326581:P1330T	P	-	1	0	ZIM2	62017634	0.092000	0.21681	0.085000	0.20634	0.993000	0.82548	1.387000	0.34430	0.830000	0.34757	0.655000	0.94253	CCA		0.423	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			16	46	1	0	7.05e-17	8.62e-17	16	46				
APOB	338	broad.mit.edu	37	2	21233595	21233595	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr2:21233595G>A	ENST00000233242.1	-	26	6272	c.6145C>T	c.(6145-6147)Ccc>Tcc	p.P2049S		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2049	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATTCTTGGGGCTTCTCAACG	0.373																																						uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(6145-6147)CCC>TCC		apolipoprotein B precursor	Atorvastatin(DB01076)						93.0	103.0	99.0					2																	21233595		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21233595G>A	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6145C>T	2.37:g.21233595G>A	ENSP00000233242:p.Pro2049Ser		Somatic					p.P2049S	NM_000384	NP_000375	WXS	Illumina HiSeq	Unspecified	P04114	APOB_HUMAN			26	6273	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		2049			Heparin-binding.		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.6145C>T	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211073	0.58343	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00792	5.69	5.32	5.32	0.75619	.	0.000000	0.45867	D	0.000331	T	0.04137	0.0115	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.47623	-0.9103	10	0.62326	D	0.03	.	18.6024	0.91253	0.0:0.0:1.0:0.0	.	2049	P04114	APOB_HUMAN	S	2049	ENSP00000233242:P2049S	ENSP00000233242:P2049S	P	-	1	0	APOB	21087100	1.000000	0.71417	0.985000	0.45067	0.657000	0.38888	4.795000	0.62489	2.478000	0.83669	0.561000	0.74099	CCC		0.373	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			11	133	0	0	0	0	11	133				
TMEM131	23505	broad.mit.edu	37	2	98411468	98411468	+	Nonsense_Mutation	SNP	A	A	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr2:98411468A>C	ENST00000186436.5	-	29	3539	c.3311T>G	c.(3310-3312)tTa>tGa	p.L1104*		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1104						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						ACAGGTTGCTAACATATGGTA	0.403																																						uc002syh.3		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(3310-3312)TTA>TGA		RW1 protein							92.0	89.0	90.0					2																	98411468		1876	4110	5986	SO:0001587	stop_gained	23505					integral to membrane		g.chr2:98411468A>C	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3311T>G	2.37:g.98411468A>C	ENSP00000186436:p.Leu1104*		Somatic					p.L1104*	NM_015348	NP_056163	WXS	Illumina HiSeq	Unspecified	Q92545	TM131_HUMAN			29	3540	-			1104			Helical; (Potential).			Nonsense_Mutation	SNP	ENST00000186436.5	37	c.3311T>G	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	A	44	10.902859	0.99486	.	.	ENSG00000075568	ENST00000186436	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3248	16.3948	0.83586	1.0:0.0:0.0:0.0	.	.	.	.	X	1104	.	ENSP00000186436:L1104X	L	-	2	0	TMEM131	97777900	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.910000	0.92685	2.326000	0.78906	0.533000	0.62120	TTA		0.403	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542		11	22	0	0	0	0	11	22				
CCDC138	165055	broad.mit.edu	37	2	109463283	109463283	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr2:109463283G>A	ENST00000295124.4	+	12	1473	c.1413G>A	c.(1411-1413)caG>caA	p.Q471Q	CCDC138_ENST00000412964.2_Silent_p.Q471Q	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	471										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						ATTCTCCACAGCATTCTGTGG	0.363																																						uc002ten.1		NA																	0					0						c.(1411-1413)CAG>CAA		coiled-coil domain containing 138							82.0	81.0	81.0					2																	109463283		2203	4300	6503	SO:0001819	synonymous_variant	165055							g.chr2:109463283G>A	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1413G>A	2.37:g.109463283G>A			Somatic				CCDC138_uc002teo.1_Silent_p.Q471Q|CCDC138_uc002tep.1_Silent_p.Q155Q|CCDC138_uc010fjm.1_Silent_p.Q155Q	p.Q471Q	NM_144978	NP_659415	WXS	Illumina HiSeq	Unspecified	Q96M89	CC138_HUMAN			12	1473	+			471					Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Silent	SNP	ENST00000295124.4	37	c.1413G>A	CCDS2080.1																																																																																				0.363	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978		4	69	0	0	0	0	4	69				
TTN	7273	broad.mit.edu	37	2	179592514	179592514	+	Silent	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr2:179592514T>C	ENST00000591111.1	-	66	19064	c.18840A>G	c.(18838-18840)ctA>ctG	p.L6280L	TTN_ENST00000342992.6_Silent_p.L5353L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.L6597L|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13057	Ig-like 44.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGTTCCTTTTAGTATTGCCT	0.393																																						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(16057-16059)CTA>CTG		titin isoform N2-A							129.0	127.0	128.0					2																	179592514		1850	4089	5939	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179592514T>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18840A>G	2.37:g.179592514T>C			Somatic				TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.L2014L	p.L5353L	NM_133378	NP_596869	WXS	Illumina HiSeq	Unspecified	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		65	16283	-			6280					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.16059A>G																																																																																					0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		16	157	0	0	0	0	16	157				
TTLL4	9654	broad.mit.edu	37	2	219610493	219610493	+	Silent	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr2:219610493C>T	ENST00000392102.1	+	7	2206	c.1866C>T	c.(1864-1866)acC>acT	p.T622T	TTLL4_ENST00000442769.1_Silent_p.T622T|TTLL4_ENST00000457313.1_Silent_p.T457T|TTLL4_ENST00000258398.4_Silent_p.T622T	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	622	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TCAAGCAGACCATTGGACGGT	0.512																																					GBM(172;1818 2053 15407 20943 49753)	uc002viy.2		NA																	0				ovary(2)|skin(1)	3						c.(1864-1866)ACC>ACT		tubulin tyrosine ligase-like family, member 4							69.0	63.0	65.0					2																	219610493		2203	4300	6503	SO:0001819	synonymous_variant	9654				protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity	g.chr2:219610493C>T		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.1866C>T	2.37:g.219610493C>T			Somatic				TTLL4_uc010zkl.1_Silent_p.T457T|TTLL4_uc010fvx.2_Silent_p.T622T|TTLL4_uc010zkm.1_5'Flank	p.T622T	NM_014640	NP_055455	WXS	Illumina HiSeq	Unspecified	Q14679	TTLL4_HUMAN		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)	7	2236	+		Renal(207;0.0915)	622			TTL.		A8K6V5|Q8WW29	Silent	SNP	ENST00000392102.1	37	c.1866C>T	CCDS2422.1																																																																																				0.512	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640		4	24	0	0	0	0	4	24				
CHGB	1114	broad.mit.edu	37	20	5904039	5904039	+	Missense_Mutation	SNP	C	C	T	rs373817587		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr20:5904039C>T	ENST00000378961.4	+	4	1453	c.1249C>T	c.(1249-1251)Cgc>Tgc	p.R417C		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	417			R -> H (in dbSNP:rs742711). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.4}.			extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GGGAAAGGGACGCCATCACAG	0.532																																						uc002wmg.2		NA																	0				breast(3)|skin(2)|ovary(1)	6						c.(1249-1251)CGC>TGC		chromogranin B precursor		C	CYS/ARG	0,4406		0,0,2203	83.0	82.0	82.0		1249	1.2	0.0	20		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	CHGB	NM_001819.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	417/678	5904039	1,13005	2203	4300	6503	SO:0001583	missense	1114					extracellular region	hormone activity	g.chr20:5904039C>T		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1249C>T	20.37:g.5904039C>T	ENSP00000368244:p.Arg417Cys		Somatic				CHGB_uc010zqz.1_Missense_Mutation_p.R100C	p.R417C	NM_001819	NP_001810	WXS	Illumina HiSeq	Unspecified	P05060	SCG1_HUMAN			4	1555	+			417					A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	ENST00000378961.4	37	c.1249C>T	CCDS13092.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.498669	0.26861	0.0	1.16E-4	ENSG00000089199	ENST00000378961	T	0.02015	4.5	5.4	1.23	0.21249	.	2.054640	0.02189	N	0.061130	T	0.06234	0.0161	L	0.59436	1.845	0.09310	N	1	D	0.76494	0.999	P	0.54174	0.744	T	0.20773	-1.0265	10	0.41790	T	0.15	1.7578	2.824	0.05480	0.113:0.4686:0.2202:0.1983	.	417	P05060	SCG1_HUMAN	C	417	ENSP00000368244:R417C	ENSP00000368244:R417C	R	+	1	0	CHGB	5852039	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.376000	0.20535	-0.003000	0.14444	0.655000	0.94253	CGC		0.532	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819		6	67	0	0	0	0	6	67				
PCSK2	5126	broad.mit.edu	37	20	17462541	17462541	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr20:17462541G>C	ENST00000262545.2	+	12	2058	c.1743G>C	c.(1741-1743)aaG>aaC	p.K581N	PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000377899.1_Missense_Mutation_p.K562N|PCSK2_ENST00000536609.1_Missense_Mutation_p.K546N	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	581					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCCCGCAGAAGGGGGTGCTGA	0.617																																						uc002wpm.2		NA																	0				ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7						c.(1741-1743)AAG>AAC		proprotein convertase subtilisin/kexin type 2	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						33.0	33.0	33.0					20																	17462541		2203	4300	6503	SO:0001583	missense	5126				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity	g.chr20:17462541G>C	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1743G>C	20.37:g.17462541G>C	ENSP00000262545:p.Lys581Asn		Somatic				PCSK2_uc002wpl.2_Missense_Mutation_p.K562N|PCSK2_uc010zrm.1_Missense_Mutation_p.K546N|PCSK2_uc002wpn.2_Missense_Mutation_p.K235N	p.K581N	NM_002594	NP_002585	WXS	Illumina HiSeq	Unspecified	P16519	NEC2_HUMAN			12	2063	+			581					B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	c.1743G>C	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364802	0.24684	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.76968	-1.06;-1.06;-1.06	5.63	3.45	0.39498	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.210983	0.49916	D	0.000122	T	0.58192	0.2105	N	0.17564	0.495	0.44500	D	0.997441	B;B;B	0.17465	0.01;0.022;0.0	B;B;B	0.29440	0.102;0.063;0.01	T	0.42982	-0.9419	10	0.06494	T	0.89	-26.5367	7.6547	0.28369	0.2927:0.0:0.7073:0.0	.	546;562;581	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	N	562;581;546	ENSP00000367131:K562N;ENSP00000262545:K581N;ENSP00000437458:K546N	ENSP00000262545:K581N	K	+	3	2	PCSK2	17410541	0.759000	0.28416	1.000000	0.80357	0.949000	0.60115	-0.049000	0.11924	0.652000	0.30806	0.585000	0.79938	AAG		0.617	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594		6	32	0	0	0	0	6	32				
LBP	3929	broad.mit.edu	37	20	36975003	36975003	+	Silent	SNP	C	C	T	rs149360570		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr20:36975003C>T	ENST00000217407.2	+	1	245	c.84C>T	c.(82-84)ccC>ccT	p.P28P		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	28					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				GTGCCAACCCCGGCTTGGTCG	0.612																																						uc002xic.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(82-84)CCC>CCT		lipopolysaccharide-binding protein precursor		C		1,4405	2.1+/-5.4	0,1,2202	65.0	60.0	62.0		84	-3.4	0.7	20	dbSNP_134	62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LBP	NM_004139.2		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		28/482	36975003	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	3929				acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding	g.chr20:36975003C>T		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.84C>T	20.37:g.36975003C>T			Somatic					p.P28P	NM_004139	NP_004130	WXS	Illumina HiSeq	Unspecified	P18428	LBP_HUMAN			1	119	+		Myeloproliferative disorder(115;0.00878)	28					B2R938|O43438|Q92672|Q9H403|Q9UD66	Silent	SNP	ENST00000217407.2	37	c.84C>T	CCDS13304.1																																																																																				0.612	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139		7	47	0	0	0	0	7	47				
TSHZ2	128553	broad.mit.edu	37	20	51870578	51870578	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr20:51870578C>T	ENST00000371497.5	+	2	1468	c.581C>T	c.(580-582)tCg>tTg	p.S194L	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.S191L|TSHZ2_ENST00000603338.2_Missense_Mutation_p.S191L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	194					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CTGTTCAGCTCGGTGCAGTTG	0.562																																						uc002xwo.2		NA																	0				ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6						c.(580-582)TCG>TTG		teashirt zinc finger homeobox 2							63.0	60.0	61.0					20																	51870578		2203	4300	6503	SO:0001583	missense	128553				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:51870578C>T	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.581C>T	20.37:g.51870578C>T	ENSP00000360552:p.Ser194Leu		Somatic					p.S194L	NM_173485	NP_775756	WXS	Illumina HiSeq	Unspecified	Q9NRE2	TSH2_HUMAN	STAD - Stomach adenocarcinoma(23;0.1)		2	1537	+			194					B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	c.581C>T	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039330	0.93630	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.16073	2.37;2.37	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.37156	0.0993	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.09037	-1.0693	10	0.87932	D	0	-25.7344	19.0899	0.93223	0.0:1.0:0.0:0.0	.	194	Q9NRE2	TSH2_HUMAN	L	194;191	ENSP00000360552:S194L;ENSP00000333114:S191L	ENSP00000333114:S191L	S	+	2	0	TSHZ2	51303985	1.000000	0.71417	0.983000	0.44433	0.992000	0.81027	7.440000	0.80464	2.579000	0.87056	0.643000	0.83706	TCG		0.562	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		8	40	0	0	0	0	8	40				
KRTAP6-1	337966	broad.mit.edu	37	21	31986075	31986075	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr21:31986075C>A	ENST00000329122.2	-	1	174	c.149G>T	c.(148-150)gGc>gTc	p.G50V	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	50						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						GGAGCCATAGCCATAGCCACA	0.592																																						uc002yop.2		NA																	0					0						c.(148-150)GGC>GTC		keratin associated protein 6-1							117.0	122.0	120.0					21																	31986075		2203	4300	6503	SO:0001583	missense	337966					cytosol|intermediate filament		g.chr21:31986075C>A	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.149G>T	21.37:g.31986075C>A	ENSP00000332690:p.Gly50Val		Somatic				KRTAP20-1_uc011ade.1_5'Flank	p.G50V	NM_181602	NP_853633	WXS	Illumina HiSeq	Unspecified	Q3LI64	KRA61_HUMAN			1	149	-			50						Missense_Mutation	SNP	ENST00000329122.2	37	c.149G>T	CCDS13602.1	.	.	.	.	.	.	.	.	.	.	C	4.778	0.144590	0.09134	.	.	ENSG00000184724	ENST00000329122;ENST00000399871	T	0.33865	1.39	4.06	3.16	0.36331	.	0.000000	0.34986	U	0.003534	T	0.57946	0.2088	.	.	.	0.44579	D	0.997546	D	0.89917	1.0	D	0.74674	0.984	T	0.62964	-0.6742	9	0.87932	D	0	.	11.7366	0.51769	0.0:0.8198:0.1802:0.0	.	50	Q3LI64	KRA61_HUMAN	V	50;36	ENSP00000332690:G50V	ENSP00000332690:G50V	G	-	2	0	KRTAP6-1	30907946	0.973000	0.33851	0.111000	0.21465	0.287000	0.27160	3.412000	0.52679	1.018000	0.39521	0.643000	0.83706	GGC		0.592	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128240.2	NM_181602		19	111	1	0	5.04e-11	6.03e-11	19	111				
CCT8L2	150160	broad.mit.edu	37	22	17071848	17071848	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr22:17071848C>A	ENST00000359963.3	-	1	1852	c.1593G>T	c.(1591-1593)gaG>gaT	p.E531D		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	531					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GATTCCAGATCTCCTGATGTG	0.438																																						uc002zlp.1		NA																	0				ovary(1)	1						c.(1591-1593)GAG>GAT		T-complex protein 1							146.0	131.0	136.0					22																	17071848		2203	4300	6503	SO:0001583	missense	150160				cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity	g.chr22:17071848C>A	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1593G>T	22.37:g.17071848C>A	ENSP00000353048:p.Glu531Asp		Somatic					p.E531D	NM_014406	NP_055221	WXS	Illumina HiSeq	Unspecified	Q96SF2	TCPQM_HUMAN			1	1853	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	531					A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	37	c.1593G>T	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	9.605	1.129647	0.21041	.	.	ENSG00000198445	ENST00000359963	T	0.56444	0.46	1.98	1.98	0.26296	.	1.424450	0.05045	U	0.477130	T	0.32526	0.0832	N	0.08118	0	0.09310	N	1	B	0.19073	0.033	B	0.13407	0.009	T	0.19516	-1.0303	10	0.30854	T	0.27	-4.7106	7.4423	0.27190	0.0:1.0:0.0:0.0	.	531	Q96SF2	TCPQM_HUMAN	D	531	ENSP00000353048:E531D	ENSP00000353048:E531D	E	-	3	2	CCT8L2	15451848	0.001000	0.12720	0.002000	0.10522	0.010000	0.07245	0.607000	0.24209	1.115000	0.41800	0.379000	0.24179	GAG		0.438	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1			31	108	1	0	4.42e-11	5.31e-11	31	108				
TRIOBP	11078	broad.mit.edu	37	22	38165092	38165092	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr22:38165092G>A	ENST00000406386.3	+	20	6888	c.6633G>A	c.(6631-6633)caG>caA	p.Q2211Q	TRIOBP_ENST00000403663.2_Silent_p.Q498Q	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	2211					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGTACTCGCAGAAGTGCCTGG	0.637																																						uc003atr.2		NA																	0				central_nervous_system(1)	1						c.(6631-6633)CAG>CAA		TRIO and F-actin binding protein isoform 6							39.0	44.0	43.0					22																	38165092		2188	4300	6488	SO:0001819	synonymous_variant	11078				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding	g.chr22:38165092G>A	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6633G>A	22.37:g.38165092G>A			Somatic				TRIOBP_uc003atu.2_Silent_p.Q2039Q|TRIOBP_uc003atw.2_Silent_p.Q498Q|TRIOBP_uc003atx.1_Silent_p.Q94Q|TRIOBP_uc010gxh.2_Silent_p.Q94Q	p.Q2211Q	NM_001039141	NP_001034230	WXS	Illumina HiSeq	Unspecified	Q9H2D6	TARA_HUMAN			20	6904	+	Melanoma(58;0.0574)		2211			Potential.		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	c.6633G>A	CCDS43015.1																																																																																				0.637	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			16	52	0	0	0	0	16	52				
FGD5	152273	broad.mit.edu	37	3	14965561	14965561	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:14965561G>A	ENST00000285046.5	+	17	4094	c.3984G>A	c.(3982-3984)tcG>tcA	p.S1328S	FGD5_ENST00000476851.1_3'UTR|FGD5_ENST00000543601.1_Silent_p.S1087S|FGD5-AS1_ENST00000430166.1_RNA	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1328					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						CCCGCTTCTCGGGCAGTGCCT	0.572																																						uc003bzc.2		NA																	0				ovary(3)|kidney(1)|pancreas(1)	5						c.(3982-3984)TCG>TCA		FYVE, RhoGEF and PH domain containing 5							88.0	88.0	88.0					3																	14965561		2046	4204	6250	SO:0001819	synonymous_variant	152273				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chr3:14965561G>A	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3984G>A	3.37:g.14965561G>A			Somatic				FGD5_uc011avk.1_Silent_p.S1328S|FGD5_uc003bzd.2_Silent_p.S406S	p.S1328S	NM_152536	NP_689749	WXS	Illumina HiSeq	Unspecified	Q6ZNL6	FGD5_HUMAN			17	4094	+			1328					B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	ENST00000285046.5	37	c.3984G>A	CCDS46767.1																																																																																				0.572	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536		8	53	0	0	0	0	8	53				
TRIM71	131405	broad.mit.edu	37	3	32931948	32931948	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:32931948G>A	ENST00000383763.5	+	4	1315	c.1252G>A	c.(1252-1254)Gtg>Atg	p.V418M		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	418					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CATCAGTGCCGTGCAGCAGGT	0.597																																						uc003cff.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(1252-1254)GTG>ATG		tripartite motif-containing 71							62.0	69.0	67.0					3																	32931948		2082	4212	6294	SO:0001583	missense	131405				multicellular organismal development	cytoplasm	zinc ion binding	g.chr3:32931948G>A		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1252G>A	3.37:g.32931948G>A	ENSP00000373272:p.Val418Met		Somatic					p.V418M	NM_001039111	NP_001034200	WXS	Illumina HiSeq	Unspecified	Q2Q1W2	LIN41_HUMAN			4	1315	+			418			Potential.			Missense_Mutation	SNP	ENST00000383763.5	37	c.1252G>A	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929409	0.73327	.	.	ENSG00000206557	ENST00000383763	D	0.84146	-1.81	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.88407	0.6428	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.66602	0.945	D	0.89062	0.3463	10	0.62326	D	0.03	-43.4315	18.298	0.90153	0.0:0.0:1.0:0.0	.	418	Q2Q1W2	LIN41_HUMAN	M	418	ENSP00000373272:V418M	ENSP00000373272:V418M	V	+	1	0	TRIM71	32906952	1.000000	0.71417	0.958000	0.39756	0.848000	0.48234	7.939000	0.87685	2.686000	0.91538	0.650000	0.86243	GTG		0.597	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111		5	62	0	0	0	0	5	62				
SCN10A	6336	broad.mit.edu	37	3	38739930	38739930	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:38739930C>T	ENST00000449082.2	-	27	4780	c.4781G>A	c.(4780-4782)cGc>cAc	p.R1594H		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1594					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GAGCAGTGTGCGGATCCCCTT	0.537																																						uc003ciq.2		NA																	0				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(4780-4782)CGC>CAC		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						147.0	137.0	141.0					3																	38739930		2203	4300	6503	SO:0001583	missense	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38739930C>T	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4781G>A	3.37:g.38739930C>T	ENSP00000390600:p.Arg1594His		Somatic					p.R1594H	NM_006514	NP_006505	WXS	Illumina HiSeq	Unspecified	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	27	4781	-			1594			IV.|Helical; Voltage-sensor; Name=S4 of repeat IV; (Potential).		A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	c.4781G>A	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800797	0.90538	.	.	ENSG00000185313	ENST00000449082	D	0.98889	-5.21	5.42	5.42	0.78866	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99462	0.9809	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.98440	1.0586	10	0.87932	D	0	.	19.406	0.94647	0.0:1.0:0.0:0.0	.	1594	Q9Y5Y9	SCNAA_HUMAN	H	1594	ENSP00000390600:R1594H	ENSP00000390600:R1594H	R	-	2	0	SCN10A	38714934	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.641000	0.83368	2.822000	0.97130	0.655000	0.94253	CGC		0.537	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		8	90	0	0	0	0	8	90				
HTR1F	3355	broad.mit.edu	37	3	88040986	88040986	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:88040986C>T	ENST00000319595.4	+	1	1141	c.1087C>T	c.(1087-1089)Cga>Tga	p.R363*		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	363					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	AAAGCTTGTGCGATGTCGATG	0.338																																						uc003dqr.2		NA																	0				ovary(3)	3						c.(1087-1089)CGA>TGA		5-hydroxytryptamine (serotonin) receptor 1F	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)						44.0	47.0	46.0					3																	88040986		2200	4299	6499	SO:0001587	stop_gained	3355				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity	g.chr3:88040986C>T	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.1087C>T	3.37:g.88040986C>T	ENSP00000322924:p.Arg363*		Somatic					p.R363*	NM_000866	NP_000857	WXS	Illumina HiSeq	Unspecified	P30939	5HT1F_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	2	1245	+	all_cancers(8;0.147)	Lung NSC(201;0.0283)	363			Cytoplasmic (By similarity).			Nonsense_Mutation	SNP	ENST00000319595.4	37	c.1087C>T	CCDS2920.1	.	.	.	.	.	.	.	.	.	.	C	32	5.115192	0.94339	.	.	ENSG00000179097	ENST00000319595	.	.	.	5.54	4.59	0.56863	.	0.271359	0.32518	N	0.005996	.	.	.	.	.	.	0.31805	N	0.627955	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	12.5546	0.56246	0.1989:0.801:0.0:0.0	.	.	.	.	X	363	.	ENSP00000322924:R363X	R	+	1	2	HTR1F	88123676	0.995000	0.38212	1.000000	0.80357	0.972000	0.66771	2.287000	0.43505	2.607000	0.88179	0.557000	0.71058	CGA		0.338	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866		13	53	0	0	0	0	13	53				
IMPG2	50939	broad.mit.edu	37	3	100962722	100962722	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:100962722A>G	ENST00000193391.7	-	13	2640	c.2453T>C	c.(2452-2454)tTg>tCg	p.L818S		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	818					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GGTTGGAGGCAATTTGGTAGA	0.448																																						uc003duq.1		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						c.(2452-2454)TTG>TCG		interphotoreceptor matrix proteoglycan 2							97.0	99.0	98.0					3																	100962722		2203	4300	6503	SO:0001583	missense	50939				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity	g.chr3:100962722A>G	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.2453T>C	3.37:g.100962722A>G	ENSP00000193391:p.Leu818Ser		Somatic				IMPG2_uc011bhe.1_Missense_Mutation_p.L681S	p.L818S	NM_016247	NP_057331	WXS	Illumina HiSeq	Unspecified	Q9BZV3	IMPG2_HUMAN			13	2656	-			818			Extracellular (Potential).		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	c.2453T>C	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.343737	0.41498	.	.	ENSG00000081148	ENST00000193391	T	0.20598	2.06	5.55	3.05	0.35203	.	0.608759	0.14900	N	0.291849	T	0.14313	0.0346	L	0.32530	0.975	0.22240	N	0.99927	B;B	0.21520	0.057;0.057	B;B	0.17979	0.02;0.02	T	0.18209	-1.0344	10	0.49607	T	0.09	0.0872	5.0207	0.14360	0.6785:0.1573:0.1642:0.0	.	818;818	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	S	818	ENSP00000193391:L818S	ENSP00000193391:L818S	L	-	2	0	IMPG2	102445412	0.187000	0.23238	0.956000	0.39512	0.670000	0.39368	0.859000	0.27858	0.947000	0.37659	0.379000	0.24179	TTG		0.448	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			12	92	0	0	0	0	12	92				
MYH15	22989	broad.mit.edu	37	3	108195321	108195321	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:108195321C>T	ENST00000273353.3	-	13	1272	c.1216G>A	c.(1216-1218)Gag>Aag	p.E406K		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	406	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TTTACCAACTCAGAGGAGTTA	0.393																																						uc003dxa.1		NA																	0				ovary(5)|central_nervous_system(2)	7						c.(1216-1218)GAG>AAG		myosin, heavy polypeptide 15							81.0	75.0	76.0					3																	108195321		1892	4123	6015	SO:0001583	missense	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108195321C>T	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1216G>A	3.37:g.108195321C>T	ENSP00000273353:p.Glu406Lys		Somatic					p.E406K	NM_014981	NP_055796	WXS	Illumina HiSeq	Unspecified	Q9Y2K3	MYH15_HUMAN			13	1273	-			406			Myosin head-like.			Missense_Mutation	SNP	ENST00000273353.3	37	c.1216G>A	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372121	0.82573	.	.	ENSG00000144821	ENST00000273353	D	0.87887	-2.31	5.62	5.62	0.85841	Myosin head, motor domain (2);	.	.	.	.	D	0.92541	0.7631	M	0.70275	2.135	0.58432	D	0.999997	P	0.44429	0.835	P	0.57620	0.824	D	0.92741	0.6208	9	0.87932	D	0	.	19.6634	0.95882	0.0:1.0:0.0:0.0	.	406	Q9Y2K3	MYH15_HUMAN	K	406	ENSP00000273353:E406K	ENSP00000273353:E406K	E	-	1	0	MYH15	109678011	1.000000	0.71417	0.789000	0.31954	0.068000	0.16541	5.681000	0.68175	2.643000	0.89663	0.650000	0.86243	GAG		0.393	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		6	29	0	0	0	0	6	29				
CASR	846	broad.mit.edu	37	3	121980531	121980531	+	Missense_Mutation	SNP	G	G	A	rs201091657		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:121980531G>A	ENST00000490131.1	+	4	1021	c.649G>A	c.(649-651)Gac>Aac	p.D217N	CASR_ENST00000296154.5_Missense_Mutation_p.D217N|CASR_ENST00000498619.1_Missense_Mutation_p.D217N	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	217					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AGCTGATGACGACTATGGGCG	0.537																																						uc003eev.3		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7						c.(649-651)GAC>AAC		calcium-sensing receptor precursor	Cinacalcet(DB01012)	G	ASN/ASP,ASN/ASP	0,4406		0,0,2203	127.0	137.0	133.0		649,649	6.2	1.0	3		133	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CASR	NM_000388.3,NM_001178065.1	23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	217/1079,217/1089	121980531	1,13005	2203	4300	6503	SO:0001583	missense	846				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity	g.chr3:121980531G>A	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.649G>A	3.37:g.121980531G>A	ENSP00000418685:p.Asp217Asn		Somatic				CASR_uc003eew.3_Missense_Mutation_p.D217N	p.D217N	NM_000388	NP_000379	WXS	Illumina HiSeq	Unspecified	P41180	CASR_HUMAN		GBM - Glioblastoma multiforme(114;0.226)	4	1021	+			217			Extracellular (Potential).		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	c.649G>A	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389618	0.61956	0.0	1.16E-4	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.85258	-1.96;-1.96;-1.96	6.17	6.17	0.99709	Extracellular ligand-binding receptor (1);	0.040124	0.85682	D	0.000000	D	0.90290	0.6963	L	0.49350	1.555	0.80722	D	1	B;D	0.89917	0.075;1.0	B;D	0.63597	0.033;0.916	D	0.89852	0.4010	10	0.66056	D	0.02	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	217;217	E7ENE0;P41180	.;CASR_HUMAN	N	217	ENSP00000418685:D217N;ENSP00000420194:D217N;ENSP00000296154:D217N	ENSP00000296154:D217N	D	+	1	0	CASR	123463221	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	8.029000	0.88807	2.941000	0.99782	0.655000	0.94253	GAC		0.537	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388		10	127	0	0	0	0	10	127				
OSBPL11	114885	broad.mit.edu	37	3	125282600	125282600	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:125282600C>G	ENST00000296220.5	-	7	1245	c.956G>C	c.(955-957)aGt>aCt	p.S319T		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	319					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						CACCGGCTTACTCTGATCAGT	0.413																																						uc003eic.2		NA																	0				ovary(3)|breast(1)|kidney(1)	5						c.(955-957)AGT>ACT		oxysterol binding protein-like 11							104.0	106.0	105.0					3																	125282600		2203	4300	6503	SO:0001583	missense	114885				lipid transport		lipid binding	g.chr3:125282600C>G	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.956G>C	3.37:g.125282600C>G	ENSP00000296220:p.Ser319Thr		Somatic					p.S319T	NM_022776	NP_073613	WXS	Illumina HiSeq	Unspecified	Q9BXB4	OSB11_HUMAN			7	1693	-			319					A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	c.956G>C	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	C	9.262	1.043446	0.19748	.	.	ENSG00000144909	ENST00000296220	T	0.17528	2.27	4.71	1.65	0.23941	.	1.212280	0.05492	N	0.556886	T	0.09992	0.0245	N	0.11927	0.2	0.21841	N	0.999518	B	0.06786	0.001	B	0.04013	0.001	T	0.32107	-0.9919	10	0.37606	T	0.19	-3.3942	5.2158	0.15342	0.0:0.5224:0.0:0.4776	.	319	Q9BXB4	OSB11_HUMAN	T	319	ENSP00000296220:S319T	ENSP00000296220:S319T	S	-	2	0	OSBPL11	126765290	0.998000	0.40836	0.921000	0.36526	0.972000	0.66771	0.380000	0.20602	0.565000	0.29255	0.467000	0.42956	AGT		0.413	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776		13	67	0	0	0	0	13	67				
TOPBP1	11073	broad.mit.edu	37	3	133358856	133358856	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:133358856G>A	ENST00000260810.5	-	13	2311	c.2180C>T	c.(2179-2181)aCg>aTg	p.T727M		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	727	BRCT 5. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TCTCTTTCCCGTTCTAGCAGT	0.363								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)	uc003eps.2		NA																	0				ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						c.(2179-2181)ACG>ATG	Other_conserved_DNA_damage_response_genes	topoisomerase (DNA) II binding protein 1							95.0	87.0	90.0					3																	133358856		1850	4087	5937	SO:0001583	missense	11073				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding	g.chr3:133358856G>A	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2180C>T	3.37:g.133358856G>A	ENSP00000260810:p.Thr727Met		Somatic					p.T727M	NM_007027	NP_008958	WXS	Illumina HiSeq	Unspecified	Q92547	TOPB1_HUMAN			13	2312	-			727			BRCT 5.		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	c.2180C>T	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	G	8.758	0.922965	0.18056	.	.	ENSG00000163781	ENST00000260810	T	0.11385	2.78	5.59	-2.5	0.06384	BRCT (3);	1.289010	0.04924	N	0.455586	T	0.12178	0.0296	L	0.41236	1.265	0.09310	N	1	B	0.28026	0.198	B	0.26094	0.066	T	0.37197	-0.9716	10	0.28530	T	0.3	.	17.5939	0.88005	0.2297:0.0:0.7703:0.0	.	727	Q92547	TOPB1_HUMAN	M	727	ENSP00000260810:T727M	ENSP00000260810:T727M	T	-	2	0	TOPBP1	134841546	0.001000	0.12720	0.063000	0.19743	0.967000	0.64934	0.320000	0.19540	-0.742000	0.04790	-0.312000	0.09012	ACG		0.363	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027		10	42	0	0	0	0	10	42				
ATR	545	broad.mit.edu	37	3	142274981	142274981	+	Splice_Site	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:142274981T>C	ENST00000350721.4	-	10	2200	c.2079A>G	c.(2077-2079)atA>atG	p.I693M	ATR_ENST00000383101.3_Splice_Site_p.I629M	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	693					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TGACTTTATCTCTGGGGAAAA	0.338								Other conserved DNA damage response genes																														uc003eux.3		NA																	0				lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						c.(2077-2079)ATA>ATG	Other_conserved_DNA_damage_response_genes	ataxia telangiectasia and Rad3 related protein							64.0	67.0	66.0					3																	142274981		2203	4300	6503	SO:0001630	splice_region_variant	545				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity	g.chr3:142274981T>C	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2079-1A>G	3.37:g.142274981T>C			Somatic					p.I693M	NM_001184	NP_001175	WXS	Illumina HiSeq	Unspecified	Q13535	ATR_HUMAN			10	2201	-			693					Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	c.2079A>G	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	14.30	2.494182	0.44352	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.65178	-0.14;-0.14	4.82	4.82	0.62117	Armadillo-like helical (1);Armadillo-type fold (1);	0.249769	0.38837	N	0.001541	T	0.45856	0.1363	N	0.24115	0.695	0.37990	D	0.933872	B	0.27380	0.177	B	0.23852	0.049	T	0.51748	-0.8666	10	0.48119	T	0.1	.	10.1305	0.42676	0.1491:0.0:0.0:0.8509	.	693	Q13535	ATR_HUMAN	M	693;629	ENSP00000343741:I693M;ENSP00000372581:I629M	ENSP00000343741:I693M	I	-	3	3	ATR	143757671	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.172000	0.31908	2.142000	0.66516	0.477000	0.44152	ATA		0.338	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	Missense_Mutation	9	80	0	0	0	0	9	80				
ZIC1	7545	broad.mit.edu	37	3	147128491	147128491	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:147128491G>A	ENST00000282928.4	+	1	1321	c.592G>A	c.(592-594)Ggg>Agg	p.G198R		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	198					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GCACGGCTACGGGCCCATGAA	0.652																																						uc003ewe.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(592-594)GGG>AGG		zinc finger protein of the cerebellum 1							41.0	44.0	43.0					3																	147128491		2203	4299	6502	SO:0001583	missense	7545				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr3:147128491G>A	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.592G>A	3.37:g.147128491G>A	ENSP00000282928:p.Gly198Arg		Somatic					p.G198R	NM_003412	NP_003403	WXS	Illumina HiSeq	Unspecified	Q15915	ZIC1_HUMAN			1	1311	+			198					Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	c.592G>A	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292844	0.80914	.	.	ENSG00000152977	ENST00000282928	T	0.42513	0.97	3.31	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.63269	-0.6675	10	0.48119	T	0.1	.	15.1323	0.72533	0.0:0.0:1.0:0.0	.	198	Q15915	ZIC1_HUMAN	R	198	ENSP00000282928:G198R	ENSP00000282928:G198R	G	+	1	0	ZIC1	148611181	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	9.265000	0.95647	1.847000	0.53656	0.549000	0.68633	GGG		0.652	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412		3	57	0	0	0	0	3	57				
MME	4311	broad.mit.edu	37	3	154890356	154890356	+	Missense_Mutation	SNP	C	C	T	rs200313650		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:154890356C>T	ENST00000460393.1	+	22	2228	c.2108C>T	c.(2107-2109)gCg>gTg	p.A703V	MME_ENST00000360490.2_Missense_Mutation_p.A703V|MME_ENST00000462745.1_Missense_Mutation_p.A703V|MME_ENST00000492661.1_Missense_Mutation_p.A703V|MME_ENST00000493237.1_Missense_Mutation_p.A703V|MME-AS1_ENST00000484721.1_RNA	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	703					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	CCAGAGTATGCGGTTAACTCC	0.428																																						uc010hvr.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2107-2109)GCG>GTG		membrane metallo-endopeptidase	Candoxatril(DB00616)						203.0	185.0	191.0					3																	154890356		2203	4300	6503	SO:0001583	missense	4311				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding	g.chr3:154890356C>T		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.2108C>T	3.37:g.154890356C>T	ENSP00000418525:p.Ala703Val		Somatic				MME_uc003fab.1_Missense_Mutation_p.A703V|MME_uc003fac.1_Missense_Mutation_p.A703V|MME_uc003fad.1_Missense_Mutation_p.A703V|MME_uc003fae.1_Missense_Mutation_p.A703V	p.A703V	NM_007289	NP_009220	WXS	Illumina HiSeq	Unspecified	P08473	NEP_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		22	2319	+		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	703			Extracellular (Potential).		A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	c.2108C>T	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653760	0.88056	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.43	5.43	0.79202	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.115021	0.64402	D	0.000020	D	0.88377	0.6420	M	0.75264	2.295	0.80722	D	1	D	0.63046	0.992	P	0.52627	0.704	D	0.89548	0.3797	10	0.66056	D	0.02	-17.7536	19.2626	0.93974	0.0:1.0:0.0:0.0	.	703	P08473	NEP_HUMAN	V	703	ENSP00000420389:A703V;ENSP00000418525:A703V;ENSP00000419653:A703V;ENSP00000417079:A703V;ENSP00000353679:A703V	ENSP00000353679:A703V	A	+	2	0	MME	156373050	1.000000	0.71417	0.954000	0.39281	0.828000	0.46876	5.919000	0.70005	2.544000	0.85801	0.585000	0.79938	GCG		0.428	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902		13	128	0	0	0	0	13	128				
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		555	Substitution - Missense(555)	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1624-1626)GAA>AAA		phosphoinositide-3-kinase, catalytic, alpha							56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936082G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)	Somatic					p.E542K	NM_006218	NP_006209	WXS	Illumina HiSeq	Unspecified	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1781	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		542		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1624G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			26	47	0	0	0	0	26	47				
MB21D2	151963	broad.mit.edu	37	3	192516360	192516360	+	Nonsense_Mutation	SNP	G	G	A	rs199520781		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr3:192516360G>A	ENST00000392452.2	-	2	1611	c.1291C>T	c.(1291-1293)Cga>Tga	p.R431*		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	431							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						GTGCTACCTCGCCTCTGGAGC	0.607																																						uc011bsp.1		NA																	0					0						c.(1291-1293)CGA>TGA		hypothetical protein LOC151963							74.0	74.0	74.0					3																	192516360		2203	4300	6503	SO:0001587	stop_gained	151963							g.chr3:192516360G>A	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.1291C>T	3.37:g.192516360G>A	ENSP00000376246:p.Arg431*		Somatic					p.R431*	NM_178496	NP_848591	WXS	Illumina HiSeq	Unspecified	Q8IYB1	M21D2_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)	2	1612	-	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		431					Q86VD8	Nonsense_Mutation	SNP	ENST00000392452.2	37	c.1291C>T	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	G	37	6.592174	0.97688	.	.	ENSG00000180611	ENST00000392452	.	.	.	5.27	3.45	0.39498	.	0.061993	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6022	0.56503	0.0:0.0:0.5639:0.4361	.	.	.	.	X	431	.	ENSP00000376246:R431X	R	-	1	2	MB21D2	193999054	1.000000	0.71417	0.842000	0.33263	0.985000	0.73830	3.099000	0.50267	0.582000	0.29556	-0.188000	0.12872	CGA		0.607	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496		9	119	0	0	0	0	9	119				
NOP14	8602	broad.mit.edu	37	4	2954030	2954030	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr4:2954030T>C	ENST00000314262.6	-	6	890	c.842A>G	c.(841-843)gAa>gGa	p.E281G	NOP14_ENST00000398071.4_Missense_Mutation_p.E281G|NOP14_ENST00000416614.2_Missense_Mutation_p.E281G|NOP14_ENST00000502735.1_Missense_Mutation_p.E281G|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000515194.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	281					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						CTCCTGCTCTTCCTTTGCCAA	0.567																																						uc003ggj.1		NA																	0				pancreas(1)	1						c.(841-843)GAA>GGA		probable nucleolar complex protein 14							116.0	98.0	104.0					4																	2954030		2203	4300	6503	SO:0001583	missense	8602				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding	g.chr4:2954030T>C	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.842A>G	4.37:g.2954030T>C	ENSP00000315674:p.Glu281Gly		Somatic				C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Missense_Mutation_p.E27G|NOP14_uc003ggk.3_Missense_Mutation_p.E281G|NOP14_uc003ggl.2_Missense_Mutation_p.E281G|NOP14_uc010icq.1_RNA	p.E281G	NM_003703	NP_003694	WXS	Illumina HiSeq	Unspecified	P78316	NOP14_HUMAN			6	914	-			281					D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	ENST00000314262.6	37	c.842A>G	CCDS33945.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.393150	0.62066	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.25	5.25	0.73442	.	0.054863	0.64402	D	0.000001	T	0.71195	0.3311	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	0.993;0.999;1.0	D;D;D	0.79784	0.96;0.993;0.993	T	0.79075	-0.1952	10	0.87932	D	0	-40.4654	14.8141	0.70017	0.0:0.0:0.0:1.0	.	74;281;281	Q96GC8;E9PFK5;P78316	.;.;NOP14_HUMAN	G	281;281;281;281;180	ENSP00000405068:E281G;ENSP00000315674:E281G;ENSP00000427415:E281G;ENSP00000381146:E281G	ENSP00000315674:E281G	E	-	2	0	NOP14	2923828	1.000000	0.71417	0.998000	0.56505	0.048000	0.14542	7.424000	0.80242	1.987000	0.57996	0.533000	0.62120	GAA		0.567	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703		17	48	0	0	0	0	17	48				
PCDH7	5099	broad.mit.edu	37	4	30723146	30723146	+	Silent	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr4:30723146C>G	ENST00000361762.2	+	1	1110	c.102C>G	c.(100-102)ctC>ctG	p.L34L	PCDH7_ENST00000543491.1_Silent_p.L34L	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	34	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGCAGCTCCTCCGGTACCGGC	0.711																																						uc003gsk.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						c.(100-102)CTC>CTG		protocadherin 7 isoform a precursor							14.0	17.0	16.0					4																	30723146		2171	4232	6403	SO:0001819	synonymous_variant	5099				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chr4:30723146C>G	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.102C>G	4.37:g.30723146C>G			Somatic				PCDH7_uc011bxw.1_Silent_p.L34L|PCDH7_uc011bxx.1_Silent_p.L34L	p.L34L	NM_002589	NP_002580	WXS	Illumina HiSeq	Unspecified	O60245	PCDH7_HUMAN			1	1110	+			34			Extracellular (Potential).|Cadherin 1.		O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	37	c.102C>G	CCDS33971.1																																																																																				0.711	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		8	13	0	0	0	0	8	13				
GC	2638	broad.mit.edu	37	4	72620734	72620734	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr4:72620734G>A	ENST00000273951.8	-	9	1468	c.1125C>T	c.(1123-1125)tgC>tgT	p.C375C	GC_ENST00000503472.1_5'UTR|GC_ENST00000504199.1_Silent_p.C394C|GC_ENST00000513476.1_Silent_p.C375C	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	375	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	CAACATCACAGCATTCACCAA	0.378																																						uc003hge.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(1123-1125)TGC>TGT		vitamin D-binding protein precursor	Cholecalciferol(DB00169)						138.0	129.0	132.0					4																	72620734		2203	4300	6503	SO:0001819	synonymous_variant	2638				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity	g.chr4:72620734G>A	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.1125C>T	4.37:g.72620734G>A			Somatic				GC_uc003hgd.2_Silent_p.C253C|GC_uc010iie.2_Silent_p.C375C|GC_uc010iif.2_Silent_p.C394C	p.C375C	NM_000583	NP_000574	WXS	Illumina HiSeq	Unspecified	P02774	VTDB_HUMAN	Lung(101;0.148)		9	1278	-		all_hematologic(202;0.107)	375			Albumin 2.		B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Silent	SNP	ENST00000273951.8	37	c.1125C>T	CCDS3550.1																																																																																				0.378	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2			11	48	0	0	0	0	11	48				
F11	2160	broad.mit.edu	37	4	187208888	187208888	+	Nonsense_Mutation	SNP	G	G	T	rs142952627		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr4:187208888G>T	ENST00000403665.2	+	14	1979	c.1627G>T	c.(1627-1629)Gaa>Taa	p.E543*	F11-AS1_ENST00000505103.1_RNA|F11_ENST00000264692.4_Nonsense_Mutation_p.E491*	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	543	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	AGTGACCAACGAAGAGTGCCA	0.408																																						uc003iza.1		NA																	0					0						c.(1627-1629)GAA>TAA		coagulation factor XI precursor	Coagulation Factor IX(DB00100)						95.0	92.0	93.0					4																	187208888		2203	4300	6503	SO:0001587	stop_gained	2160				blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity	g.chr4:187208888G>T	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.1627G>T	4.37:g.187208888G>T	ENSP00000384957:p.Glu543*		Somatic				uc003izb.1_Intron	p.E543*	NM_000128	NP_000119	WXS	Illumina HiSeq	Unspecified	P03951	FA11_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	14	1960	+		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)	543			Peptidase S1.		D3DP64|Q4W5C2|Q9Y495	Nonsense_Mutation	SNP	ENST00000403665.2	37	c.1627G>T	CCDS3847.1	.	.	.	.	.	.	.	.	.	.	G	37	5.993247	0.97184	.	.	ENSG00000088926	ENST00000403665;ENST00000264692	.	.	.	4.92	4.92	0.64577	.	0.075247	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	15.0916	0.72198	0.0:0.1419:0.8581:0.0	.	.	.	.	X	543;491	.	ENSP00000264692:E491X	E	+	1	0	F11	187445882	0.989000	0.36119	0.617000	0.29091	0.016000	0.09150	3.325000	0.52030	2.700000	0.92200	0.561000	0.74099	GAA		0.408	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4			8	68	1	0	0.000157383	0.000174916	8	68				
LRRC14B	389257	broad.mit.edu	37	5	195405	195405	+	Silent	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:195405C>T	ENST00000328278.3	+	2	1510	c.1482C>T	c.(1480-1482)ttC>ttT	p.F494F	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	494										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						TTGGTGCTTTCTTGCTGCAAG	0.473																																						uc003jal.1		NA																	0				skin(1)	1						c.(1480-1482)TTC>TTT		leucine rich repeat containing 14B							64.0	67.0	66.0					5																	195405		2013	4176	6189	SO:0001819	synonymous_variant	389257							g.chr5:195405C>T		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1482C>T	5.37:g.195405C>T			Somatic					p.F494F	NM_001080478	NP_001073947	WXS	Illumina HiSeq	Unspecified	A6NHZ5	LR14B_HUMAN			2	1510	+			494						Silent	SNP	ENST00000328278.3	37	c.1482C>T	CCDS47184.1																																																																																				0.473	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478		17	46	0	0	0	0	17	46				
C5orf22	55322	broad.mit.edu	37	5	31532542	31532542	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:31532542C>G	ENST00000325366.9	+	1	170	c.43C>G	c.(43-45)Ccc>Gcc	p.P15A	C5orf22_ENST00000355907.3_5'UTR|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000513349.1_5'Flank|DROSHA_ENST00000511367.2_5'Flank	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	15										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						CCGGCGTTACCCCAAGCTCCC	0.632																																						uc003jhj.3		NA																	0				ovary(2)	2						c.(43-45)CCC>GCC		hypothetical protein LOC55322							49.0	52.0	51.0					5																	31532542		2203	4300	6503	SO:0001583	missense	55322							g.chr5:31532542C>G	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.43C>G	5.37:g.31532542C>G	ENSP00000326879:p.Pro15Ala		Somatic				RNASEN_uc003jhh.2_5'Flank|RNASEN_uc003jhg.2_5'Flank|RNASEN_uc003jhi.2_5'Flank|C5orf22_uc011cnw.1_RNA|C5orf22_uc003jhk.3_5'UTR	p.P15A	NM_018356	NP_060826	WXS	Illumina HiSeq	Unspecified	Q49AR2	CE022_HUMAN			1	170	+			15					Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	ENST00000325366.9	37	c.43C>G	CCDS3895.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786214	0.31593	.	.	ENSG00000082213	ENST00000325366;ENST00000507818	T	0.29655	1.56	5.05	-1.13	0.09775	.	0.903038	0.09781	N	0.756686	T	0.24470	0.0593	M	0.62723	1.935	0.42035	D	0.991046	B	0.06786	0.001	B	0.06405	0.002	T	0.27123	-1.0083	10	0.44086	T	0.13	0.0823	1.1661	0.01816	0.2392:0.4005:0.1172:0.2431	.	15	Q49AR2	CE022_HUMAN	A	15	ENSP00000326879:P15A	ENSP00000326879:P15A	P	+	1	0	C5orf22	31568299	0.019000	0.18553	0.690000	0.30148	0.558000	0.35554	-0.286000	0.08399	-0.192000	0.10432	0.655000	0.94253	CCC		0.632	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356		7	52	0	0	0	0	7	52				
MAP1B	4131	broad.mit.edu	37	5	71494067	71494067	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:71494067G>T	ENST00000296755.7	+	5	5183	c.4885G>T	c.(4885-4887)Gca>Tca	p.A1629S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1629					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCCTAAAACTGCAAAGTCCAG	0.443																																					Melanoma(17;367 822 11631 31730 47712)	uc003kbw.3		NA																	0				large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5						c.(4885-4887)GCA>TCA		microtubule-associated protein 1B							106.0	109.0	108.0					5																	71494067		2203	4300	6503	SO:0001583	missense	4131					microtubule|microtubule associated complex	structural molecule activity	g.chr5:71494067G>T	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4885G>T	5.37:g.71494067G>T	ENSP00000296755:p.Ala1629Ser		Somatic				MAP1B_uc010iyw.1_Missense_Mutation_p.A1646S|MAP1B_uc010iyx.1_Missense_Mutation_p.A1503S|MAP1B_uc010iyy.1_Missense_Mutation_p.A1503S	p.A1629S	NM_005909	NP_005900	WXS	Illumina HiSeq	Unspecified	P46821	MAP1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)	5	5126	+		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)	1629					A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	c.4885G>T	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.993445	0.35131	.	.	ENSG00000131711	ENST00000296755	T	0.04083	3.71	5.19	5.19	0.71726	.	0.094446	0.46145	D	0.000312	T	0.03477	0.0100	N	0.08118	0	0.42529	D	0.993037	P;P	0.37525	0.598;0.455	B;B	0.32211	0.142;0.142	T	0.58081	-0.7699	10	0.44086	T	0.13	-19.8395	18.7095	0.91651	0.0:0.0:1.0:0.0	.	1503;1629	A2BDK6;P46821	.;MAP1B_HUMAN	S	1629	ENSP00000296755:A1629S	ENSP00000296755:A1629S	A	+	1	0	MAP1B	71529823	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.101000	0.71479	2.435000	0.82474	0.313000	0.20887	GCA		0.443	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909		7	102	1	0	0.00307968	0.00330296	7	102				
IQGAP2	10788	broad.mit.edu	37	5	75906864	75906864	+	Silent	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:75906864C>T	ENST00000274364.6	+	13	1674	c.1377C>T	c.(1375-1377)taC>taT	p.Y459Y	IQGAP2_ENST00000396234.3_Silent_p.Y12Y|CTD-2236F14.1_ENST00000511327.1_RNA|IQGAP2_ENST00000379730.3_Silent_p.Y18Y|IQGAP2_ENST00000502745.1_Silent_p.Y12Y	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	459					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CTGTAGGGTACATCAATGAAG	0.398																																						uc003kek.2		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(1375-1377)TAC>TAT		IQ motif containing GTPase activating protein 2							114.0	105.0	108.0					5																	75906864		2203	4300	6503	SO:0001819	synonymous_variant	10788				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity	g.chr5:75906864C>T	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1377C>T	5.37:g.75906864C>T			Somatic				IQGAP2_uc010izv.2_Silent_p.Y12Y|IQGAP2_uc011csv.1_Silent_p.Y12Y|IQGAP2_uc003kel.2_Silent_p.Y12Y	p.Y459Y	NM_006633	NP_006624	WXS	Illumina HiSeq	Unspecified	Q13576	IQGA2_HUMAN		all cancers(79;1.38e-36)	13	1599	+		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)	459					A8K4V1|B7Z8A4|J3KR91	Silent	SNP	ENST00000274364.6	37	c.1377C>T	CCDS34188.1																																																																																				0.398	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		8	57	0	0	0	0	8	57				
ANKHD1	54882	broad.mit.edu	37	5	139921779	139921779	+	IGR	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:139921779C>T	ENST00000360839.2	+	0	8221				ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.P2531L|ANKHD1_ENST00000297183.6_Missense_Mutation_p.P2531L	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1							cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCAGTCCCTGCTCTCAAA	0.453																																						uc003lfs.1		NA																	0				ovary(6)	6						c.(7591-7593)CCT>CTT		ANKHD1-EIF4EBP3 protein							74.0	65.0	68.0					5																	139921779		2203	4300	6503	SO:0001628	intergenic_variant	404734					cytoplasm|nucleus	RNA binding	g.chr5:139921779C>T	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610		5.37:g.139921779C>T			Somatic				ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.P1287L|ANKHD1-EIF4EBP3_uc003lfx.1_Missense_Mutation_p.P676L	p.P2531L	NM_020690	NP_065741	WXS	Illumina HiSeq	Unspecified	Q8IWZ2	Q8IWZ2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		34	7716	+			2531					A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	c.7592C>T	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	c	17.81	3.480801	0.63849	.	.	ENSG00000131503;ENSG00000254996;ENSG00000254996	ENST00000297183;ENST00000532219;ENST00000437495	T;T;T	0.79352	-1.26;-1.26;0.16	4.21	3.35	0.38373	.	0.524073	0.20594	N	0.089291	D	0.82540	0.5059	L	0.50333	1.59	0.30254	N	0.793774	D	0.71674	0.998	D	0.73708	0.981	T	0.79052	-0.1961	10	0.87932	D	0	.	9.7183	0.40286	0.2067:0.7933:0.0:0.0	.	2531	Q8IWZ2	.	L	2531;2531;550	ENSP00000297183:P2531L;ENSP00000432016:P2531L;ENSP00000396882:P550L	ENSP00000396882:P550L	P	+	2	0	ANKHD1-EIF4EBP3;ANKHD1	139901963	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.713000	0.37951	1.382000	0.46385	-0.216000	0.12614	CCT		0.453	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747		7	42	0	0	0	0	7	42				
PCDHA12	56137	broad.mit.edu	37	5	140256490	140256490	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:140256490C>T	ENST00000398631.2	+	1	1433	c.1433C>T	c.(1432-1434)tCg>tTg	p.S478L	PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	478	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCACGGTGTCGGCATGGGAC	0.657																																					Pancreas(113;759 1672 13322 24104 50104)	uc003lic.2		NA																	0					0						c.(1432-1434)TCG>TTG		protocadherin alpha 12 isoform 1 precursor							80.0	83.0	82.0					5																	140256490		2203	4299	6502	SO:0001583	missense	56137				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr5:140256490C>T	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1433C>T	5.37:g.140256490C>T	ENSP00000381628:p.Ser478Leu		Somatic				PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.S478L	p.S478L	NM_018903	NP_061726	WXS	Illumina HiSeq	Unspecified	Q9UN75	PCDAC_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1560	+			478			Cadherin 5.|Extracellular (Potential).		O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	c.1433C>T	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767724	0.49574	.	.	ENSG00000251664	ENST00000398631	T	0.01787	4.64	4.77	2.89	0.33648	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.05593	0.0147	M	0.67517	2.055	0.09310	N	1	P;P	0.42375	0.737;0.778	B;P	0.50791	0.244;0.65	T	0.14364	-1.0475	9	0.56958	D	0.05	.	10.7908	0.46432	0.1338:0.6317:0.2344:0.0	.	478;478	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	L	478	ENSP00000381628:S478L	ENSP00000381628:S478L	S	+	2	0	PCDHA12	140236674	0.000000	0.05858	0.222000	0.23844	0.815000	0.46073	-0.302000	0.08221	0.490000	0.27771	0.650000	0.86243	TCG		0.657	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903		10	86	0	0	0	0	10	86				
PCDHGA5	56110	broad.mit.edu	37	5	140745472	140745472	+	Missense_Mutation	SNP	G	G	C	rs539434078		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:140745472G>C	ENST00000518069.1	+	1	1575	c.1575G>C	c.(1573-1575)ttG>ttC	p.L525F	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	525	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAGCAGTTGAGAGACCTAC	0.527													.|||	1	0.000199681	0.0	0.0	5008	,	,		20402	0.0		0.001	False		,,,				2504	0.0					uc003lju.1		NA																	0				ovary(4)	4						c.(1573-1575)TTG>TTC		protocadherin gamma subfamily A, 5 isoform 1							189.0	207.0	201.0					5																	140745472		2194	4298	6492	SO:0001583	missense	56110				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140745472G>C	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1575G>C	5.37:g.140745472G>C	ENSP00000429834:p.Leu525Phe		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.L525F	p.L525F	NM_018918	NP_061741	WXS	Illumina HiSeq	Unspecified	Q9Y5G8	PCDG5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1575	+			525			Extracellular (Potential).|Cadherin 5.		Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	c.1575G>C	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	0.071	-1.201881	0.01581	.	.	ENSG00000253485	ENST00000518069	T	0.52295	0.67	4.84	-1.83	0.07833	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.23766	0.0575	N	0.26162	0.8	0.20074	N	0.999933	B;B	0.02656	0.0;0.0	B;B	0.11329	0.003;0.006	T	0.28713	-1.0035	9	0.06236	T	0.91	.	2.837	0.05518	0.0922:0.3946:0.2672:0.246	.	525;525	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	F	525	ENSP00000429834:L525F	ENSP00000429834:L525F	L	+	3	2	PCDHGA5	140725656	0.000000	0.05858	0.769000	0.31535	0.809000	0.45718	-0.994000	0.03716	-0.650000	0.05423	0.563000	0.77884	TTG		0.527	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		19	146	0	0	0	0	19	146				
PCDHGB4	8641	broad.mit.edu	37	5	140768196	140768196	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:140768196G>T	ENST00000519479.1	+	1	745	c.745G>T	c.(745-747)Gtg>Ttg	p.V249L	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	249	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTATACAGGGTGAGCCTTTC	0.517																																						uc003lkc.1		NA																	0					0						c.(745-747)GTG>TTG		protocadherin gamma subfamily B, 4 isoform 1							179.0	180.0	180.0					5																	140768196		2053	4208	6261	SO:0001583	missense	8641				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140768196G>T	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.745G>T	5.37:g.140768196G>T	ENSP00000428288:p.Val249Leu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.V249L	p.V249L	NM_003736	NP_003727	WXS	Illumina HiSeq	Unspecified	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	745	+			249			Cadherin 3.|Extracellular (Potential).		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	37	c.745G>T	CCDS54928.1	.	.	.	.	.	.	.	.	.	.	.	11.67	1.706552	0.30232	.	.	ENSG00000253953	ENST00000519479	T	0.01584	4.75	4.99	4.12	0.48240	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.07413	0.0187	M	0.82323	2.585	0.25159	N	0.990366	P;P	0.49559	0.907;0.925	P;P	0.52672	0.582;0.706	T	0.06917	-1.0800	9	0.72032	D	0.01	.	10.7623	0.46272	0.1538:0.0:0.8462:0.0	.	249;249	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	L	249	ENSP00000428288:V249L	ENSP00000428288:V249L	V	+	1	0	PCDHGB4	140748380	0.023000	0.18921	0.576000	0.28549	0.039000	0.13416	1.934000	0.40163	1.225000	0.43566	0.655000	0.94253	GTG		0.517	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		22	137	1	0	6.21e-17	7.62e-17	22	137				
TENM2	57451	broad.mit.edu	37	5	167645811	167645811	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr5:167645811C>T	ENST00000518659.1	+	23	4954	c.4915C>T	c.(4915-4917)Cgt>Tgt	p.R1639C	TENM2_ENST00000519204.1_Missense_Mutation_p.R1518C|TENM2_ENST00000520394.1_Missense_Mutation_p.R1400C|TENM2_ENST00000545108.1_Missense_Mutation_p.R1638C|TENM2_ENST00000403607.2_Missense_Mutation_p.R1463C	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1639					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCTGAAGATCCGTCGGGACAG	0.507																																						uc010jjd.2		NA																	0				ovary(6)|central_nervous_system(4)	10						c.(4888-4890)CGT>TGT		odz, odd Oz/ten-m homolog 2							132.0	132.0	132.0					5																	167645811		2053	4209	6262	SO:0001583	missense	57451							g.chr5:167645811C>T	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4915C>T	5.37:g.167645811C>T	ENSP00000429430:p.Arg1639Cys		Somatic				ODZ2_uc003lzr.3_Missense_Mutation_p.R1400C|ODZ2_uc003lzt.3_Missense_Mutation_p.R1003C|ODZ2_uc010jje.2_Missense_Mutation_p.R894C	p.R1630C	NM_001122679	NP_001116151	WXS	Illumina HiSeq	Unspecified			Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)	23	4888	+	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)						Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37	c.4888C>T		.	.	.	.	.	.	.	.	.	.	C	17.54	3.414643	0.62511	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.57273	1.58;0.41;1.58;1.58;1.58	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.74199	0.3685	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.995	T	0.76672	-0.2873	10	0.72032	D	0.01	.	15.7292	0.77788	0.1371:0.8628:0.0:0.0	.	1638;1639;1400	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	C	1639;1638;1518;1400;1463	ENSP00000429430:R1639C;ENSP00000438635:R1638C;ENSP00000428964:R1518C;ENSP00000427874:R1400C;ENSP00000384905:R1463C	ENSP00000384905:R1463C	R	+	1	0	ODZ2	167578389	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.959000	0.56744	2.767000	0.95098	0.655000	0.94253	CGT		0.507	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		18	93	0	0	0	0	18	93				
HIST1H3G	8355	broad.mit.edu	37	6	26271479	26271479	+	Missense_Mutation	SNP	C	C	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:26271479C>A	ENST00000305910.3	-	1	133	c.134G>T	c.(133-135)gGc>gTc	p.G45V	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	45					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						AGCCACGGTGCCGGGACGGTA	0.642																																						uc003nhi.2		NA																	0					0						c.(133-135)GGC>GTC		H3 histone family, member H							53.0	56.0	55.0					6																	26271479		2203	4300	6503	SO:0001583	missense	8355				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26271479C>A	Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.134G>T	6.37:g.26271479C>A	ENSP00000439660:p.Gly45Val		Somatic				uc003nhj.2_5'Flank|HIST1H2BI_uc003nhk.2_5'Flank	p.G45V	NM_003534	NP_003525	WXS	Illumina HiSeq	Unspecified	P68431	H31_HUMAN			1	134	-			45					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000305910.3	37	c.134G>T	CCDS4602.1	.	.	.	.	.	.	.	.	.	.	.	11.66	1.706141	0.30232	.	.	ENSG00000256018	ENST00000305910	T	0.50001	0.76	4.42	4.42	0.53409	.	.	.	.	.	T	0.57917	0.2086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65220	-0.6221	6	0.87932	D	0	.	16.4001	0.83637	0.0:1.0:0.0:0.0	.	.	.	.	V	45	ENSP00000439660:G45V	ENSP00000439660:G45V	G	-	2	0	HIST1H3G	26379458	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	5.843000	0.69424	2.183000	0.69458	0.563000	0.77884	GGC		0.642	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534		9	80	1	0	0.00010058	0.000112367	9	80				
BTN2A2	10385	broad.mit.edu	37	6	26392973	26392973	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:26392973G>A	ENST00000356709.4	+	8	1461	c.1350G>A	c.(1348-1350)ctG>ctA	p.L450L	BTN2A2_ENST00000432533.2_3'UTR|BTN2A2_ENST00000352867.2_Silent_p.L334L|BTN2A2_ENST00000482536.1_Silent_p.L240L|BTN2A2_ENST00000416795.2_Silent_p.L450L|BTN2A2_ENST00000469230.1_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	450	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						GCGTCTTCCTGGACTATGAAG	0.547																																						uc003nhq.2		NA																	0					0						c.(1348-1350)CTG>CTA		butyrophilin, subfamily 2, member A2 isoform a							111.0	102.0	105.0					6																	26392973		2203	4298	6501	SO:0001819	synonymous_variant	10385				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane		g.chr6:26392973G>A	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.1350G>A	6.37:g.26392973G>A			Somatic				BTN2A2_uc011dkg.1_3'UTR|BTN2A2_uc003nhr.2_Silent_p.L334L|BTN2A2_uc011dkh.1_Silent_p.L240L|BTN2A2_uc003nhs.2_Intron|BTN2A2_uc003nht.2_Silent_p.L450L|BTN2A2_uc011dki.1_3'UTR	p.L450L	NM_006995	NP_008926	WXS	Illumina HiSeq	Unspecified	Q8WVV5	BT2A2_HUMAN			8	1436	+			450			B30.2/SPRY.|Cytoplasmic (Potential).		A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Silent	SNP	ENST00000356709.4	37	c.1350G>A	CCDS4606.1																																																																																				0.547	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1			10	101	0	0	0	0	10	101				
BAI3	577	broad.mit.edu	37	6	70071087	70071087	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:70071087T>C	ENST00000370598.1	+	29	4743	c.3922T>C	c.(3922-3924)Tat>Cat	p.Y1308H	BAI3_ENST00000546190.1_Missense_Mutation_p.Y272H|BAI3_ENST00000238918.8_Missense_Mutation_p.Y514H	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1308					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GGAAAGTGACTATATTGTGAT	0.398																																						uc003pev.3		NA																	0				lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(3922-3924)TAT>CAT		brain-specific angiogenesis inhibitor 3							63.0	61.0	62.0					6																	70071087		2203	4299	6502	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:70071087T>C	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3922T>C	6.37:g.70071087T>C	ENSP00000359630:p.Tyr1308His		Somatic				BAI3_uc010kak.2_Missense_Mutation_p.Y1308H|BAI3_uc011dxx.1_Missense_Mutation_p.Y514H	p.Y1308H	NM_001704	NP_001695	WXS	Illumina HiSeq	Unspecified	O60242	BAI3_HUMAN			29	4370	+		all_lung(197;0.212)	1308			Cytoplasmic (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.3922T>C	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104211	0.76983	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.06933	3.24;3.24;3.24	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.20901	0.0503	M	0.71206	2.165	0.54753	D	0.999988	D;D	0.76494	0.995;0.999	D;D	0.83275	0.979;0.996	T	0.00759	-1.1578	10	0.87932	D	0	.	16.0417	0.80687	0.0:0.0:0.0:1.0	.	514;1308	B7Z356;O60242	.;BAI3_HUMAN	H	1308;514;272	ENSP00000359630:Y1308H;ENSP00000238918:Y514H;ENSP00000441821:Y272H	ENSP00000238918:Y514H	Y	+	1	0	BAI3	70127808	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.499000	0.81566	2.198000	0.70561	0.482000	0.46254	TAT		0.398	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			6	50	0	0	0	0	6	50				
DOPEY1	23033	broad.mit.edu	37	6	83834483	83834483	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:83834483T>A	ENST00000349129.2	+	13	1660	c.1400T>A	c.(1399-1401)tTa>tAa	p.L467*	DOPEY1_ENST00000369739.3_Nonsense_Mutation_p.L458*|DOPEY1_ENST00000237163.5_Nonsense_Mutation_p.L458*	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	467					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TCATCTGAATTACAGCTGACC	0.368																																						uc003pjs.1		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(1399-1401)TTA>TAA		dopey family member 1							214.0	214.0	214.0					6																	83834483		2203	4300	6503	SO:0001587	stop_gained	23033				protein transport			g.chr6:83834483T>A	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.1400T>A	6.37:g.83834483T>A	ENSP00000195654:p.Leu467*		Somatic				DOPEY1_uc011dyy.1_Nonsense_Mutation_p.L458*|DOPEY1_uc010kbl.1_Nonsense_Mutation_p.L458*	p.L467*	NM_015018	NP_055833	WXS	Illumina HiSeq	Unspecified	Q5JWR5	DOP1_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.053)	13	1660	+		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)	467					Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Nonsense_Mutation	SNP	ENST00000349129.2	37	c.1400T>A	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	T	39	7.658329	0.98415	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	.	.	.	5.67	5.67	0.87782	.	0.524025	0.18763	N	0.131838	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	15.9169	0.79527	0.0:0.0:0.0:1.0	.	.	.	.	X	467;458;458	.	ENSP00000237163:L458X	L	+	2	0	DOPEY1	83891202	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.948000	0.49066	2.152000	0.67230	0.455000	0.32223	TTA		0.368	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018		13	164	0	0	0	0	13	164				
RSPH4A	345895	broad.mit.edu	37	6	116938023	116938023	+	Silent	SNP	A	A	G	rs145831200		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:116938023A>G	ENST00000229554.5	+	1	374	c.237A>G	c.(235-237)acA>acG	p.T79T	RSPH4A_ENST00000368580.4_Silent_p.T79T|RSPH4A_ENST00000368581.4_Silent_p.T79T	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	79					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GACCAGAAACATCATCACCTG	0.657									Kartagener syndrome																													uc003pxe.2		NA																	0					0						c.(235-237)ACA>ACG		radial spoke head 4 homolog A isoform 1		A	,	1,4405	2.1+/-5.4	0,1,2202	35.0	41.0	39.0		237,237	0.2	0.0	6	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	RSPH4A	NM_001010892.2,NM_001161664.1	,	0,2,6501	GG,GA,AA		0.0116,0.0227,0.0154	,	79/717,79/601	116938023	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	345895	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton|radial spoke		g.chr6:116938023A>G		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.237A>G	6.37:g.116938023A>G			Somatic				RSPH4A_uc010kee.2_Silent_p.T79T	p.T79T	NM_001010892	NP_001010892	WXS	Illumina HiSeq	Unspecified	Q5TD94	RSH4A_HUMAN			1	382	+			79					B4DSI1|Q3KP24|Q5TD95	Silent	SNP	ENST00000229554.5	37	c.237A>G	CCDS34521.1																																																																																				0.657	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041960.1	NM_001010892		13	57	0	0	0	0	13	57				
TMEM200A	114801	broad.mit.edu	37	6	130762772	130762772	+	Missense_Mutation	SNP	G	G	C	rs148429620		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:130762772G>C	ENST00000296978.3	+	3	2076	c.1205G>C	c.(1204-1206)cGg>cCg	p.R402P	TMEM200A_ENST00000545622.1_Missense_Mutation_p.R402P|TMEM200A_ENST00000392429.1_Missense_Mutation_p.R402P	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	402						integral component of membrane (GO:0016021)		p.R402Q(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GACTTAGACCGGGGTCCCTCC	0.502																																						uc003qca.2		NA																	2	Substitution - Missense(2)		prostate(2)	ovary(1)	1						c.(1204-1206)CGG>CCG		transmembrane protein 200A							89.0	83.0	85.0					6																	130762772		2203	4300	6503	SO:0001583	missense	114801					integral to membrane		g.chr6:130762772G>C	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.1205G>C	6.37:g.130762772G>C	ENSP00000296978:p.Arg402Pro		Somatic				TMEM200A_uc010kfh.2_Missense_Mutation_p.R402P|TMEM200A_uc010kfi.2_Missense_Mutation_p.R402P|TMEM200A_uc003qcb.2_Missense_Mutation_p.R402P	p.R402P	NM_052913	NP_443145	WXS	Illumina HiSeq	Unspecified	Q86VY9	T200A_HUMAN		GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)	3	2076	+			402			Cytoplasmic (Potential).		Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	c.1205G>C	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465104	0.84425	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.59390	0.2190	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.52162	-0.8612	9	0.27082	T	0.32	-12.1272	20.6593	0.99626	0.0:0.0:1.0:0.0	.	402	Q86VY9	T200A_HUMAN	P	402	.	ENSP00000296978:R402P	R	+	2	0	TMEM200A	130804465	1.000000	0.71417	0.718000	0.30602	0.989000	0.77384	9.683000	0.98657	2.885000	0.99019	0.655000	0.94253	CGG		0.502	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913		7	82	0	0	0	0	7	82				
SYNE1	23345	broad.mit.edu	37	6	152631904	152631904	+	Silent	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:152631904T>C	ENST00000367255.5	-	88	17416	c.16815A>G	c.(16813-16815)caA>caG	p.Q5605Q	SYNE1_ENST00000341594.5_Silent_p.Q5217Q|SYNE1_ENST00000423061.1_Silent_p.Q5534Q|SYNE1_ENST00000265368.4_Silent_p.Q5605Q|SYNE1_ENST00000356820.4_Silent_p.Q129Q|SYNE1_ENST00000448038.1_Silent_p.Q5534Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5605					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTTCTGCCACTTGCTGAGACA	0.413										HNSCC(10;0.0054)																												uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(16813-16815)CAA>CAG		spectrin repeat containing, nuclear envelope 1							98.0	85.0	89.0					6																	152631904		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152631904T>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16815A>G	6.37:g.152631904T>C		HNSCC(10;0.0054)	Somatic				SYNE1_uc010kiv.2_Silent_p.Q129Q|SYNE1_uc003qos.3_Silent_p.Q129Q|SYNE1_uc003qot.3_Silent_p.Q5534Q|SYNE1_uc003qou.3_Silent_p.Q5605Q	p.Q5605Q	NM_182961	NP_892006	WXS	Illumina HiSeq	Unspecified	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	88	17417	-		Ovarian(120;0.0955)	5605			Spectrin 17.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.16815A>G	CCDS5236.2																																																																																				0.413	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		15	20	0	0	0	0	15	20				
UNC93A	54346	broad.mit.edu	37	6	167708122	167708122	+	Missense_Mutation	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr6:167708122G>T	ENST00000230256.3	+	2	380	c.205G>T	c.(205-207)Ggg>Tgg	p.G69W	UNC93A_ENST00000366830.2_3'UTR|UNC93A_ENST00000366829.2_Missense_Mutation_p.G69W	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GGGCTGCAAGGGGACCATCAT	0.652																																						uc003qvq.2		NA																	0					0						c.(205-207)GGG>TGG		unc-93 homolog A isoform 1							275.0	241.0	252.0					6																	167708122		2203	4300	6503	SO:0001583	missense	54346					integral to membrane|plasma membrane		g.chr6:167708122G>T	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.205G>T	6.37:g.167708122G>T	ENSP00000230256:p.Gly69Trp		Somatic				UNC93A_uc003qvr.2_Missense_Mutation_p.G69W	p.G69W	NM_018974	NP_061847	WXS	Illumina HiSeq	Unspecified	Q86WB7	UN93A_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)	2	380	+		Breast(66;7.62e-05)|Ovarian(120;0.105)	69			Helical; (Potential).		B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	37	c.205G>T	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	G	0.899	-0.722778	0.03158	.	.	ENSG00000112494	ENST00000503433;ENST00000230256;ENST00000366829	T;T;T	0.36520	1.25;1.25;1.25	4.66	3.5	0.40072	Major facilitator superfamily domain, general substrate transporter (1);	0.060420	0.64402	N	0.000001	T	0.01523	0.0049	N	0.00031	-2.6	0.33802	D	0.62674	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.42224	-0.9464	10	0.05959	T	0.93	-12.5265	10.5186	0.44905	0.0:0.0:0.1718:0.8282	.	69;69	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	W	69	ENSP00000421484:G69W;ENSP00000230256:G69W;ENSP00000355794:G69W	ENSP00000230256:G69W	G	+	1	0	UNC93A	167628112	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	4.184000	0.58323	0.636000	0.30508	0.313000	0.20887	GGG		0.652	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974		14	190	1	0	6.72e-11	8.04e-11	14	190				
NPTX2	4885	broad.mit.edu	37	7	98256574	98256574	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr7:98256574G>A	ENST00000265634.3	+	4	1151	c.986G>A	c.(985-987)gGa>gAa	p.G329E		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	329	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			TTCCAGGACGGAGAGAAGCTG	0.642																																						uc003upl.2		NA																	0				central_nervous_system(2)|skin(1)	3						c.(985-987)GGA>GAA		neuronal pentraxin II precursor							98.0	80.0	86.0					7																	98256574		2203	4300	6503	SO:0001583	missense	4885				synaptic transmission	extracellular region	metal ion binding|sugar binding	g.chr7:98256574G>A		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.986G>A	7.37:g.98256574G>A	ENSP00000265634:p.Gly329Glu		Somatic					p.G329E	NM_002523	NP_002514	WXS	Illumina HiSeq	Unspecified	P47972	NPTX2_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		4	1163	+	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		329			Pentaxin.		A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	c.986G>A	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151049	0.94645	.	.	ENSG00000106236	ENST00000265634	T	0.79749	-1.3	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.93973	0.8070	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95905	0.8918	10	0.87932	D	0	-29.5835	18.4968	0.90867	0.0:0.0:1.0:0.0	.	329	P47972	NPTX2_HUMAN	E	329	ENSP00000265634:G329E	ENSP00000265634:G329E	G	+	2	0	NPTX2	98094510	1.000000	0.71417	0.991000	0.47740	0.819000	0.46315	9.807000	0.99171	2.682000	0.91365	0.655000	0.94253	GGA		0.642	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523		15	44	0	0	0	0	15	44				
SLC13A1	6561	broad.mit.edu	37	7	122787224	122787224	+	Silent	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr7:122787224C>T	ENST00000194130.2	-	7	840	c.801G>A	c.(799-801)gaG>gaA	p.E267E	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	267					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TATTGAAATACTCTGCAAAGA	0.368																																						uc003vkm.2		NA																	0				ovary(2)	2						c.(799-801)GAG>GAA		solute carrier family 13 (sodium/sulfate	Succinic acid(DB00139)						165.0	137.0	146.0					7																	122787224		2203	4300	6503	SO:0001819	synonymous_variant	6561					integral to membrane|plasma membrane	sodium:sulfate symporter activity	g.chr7:122787224C>T		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.801G>A	7.37:g.122787224C>T			Somatic				SLC13A1_uc010lks.2_Silent_p.E143E	p.E267E	NM_022444	NP_071889	WXS	Illumina HiSeq	Unspecified	Q9BZW2	S13A1_HUMAN			7	826	-			267					Q9H5Z0	Silent	SNP	ENST00000194130.2	37	c.801G>A	CCDS5786.1																																																																																				0.368	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444		4	25	0	0	0	0	4	25				
MEST	4232	broad.mit.edu	37	7	130148414	130148414	+	IGR	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr7:130148414C>T	ENST00000223215.4	+	0	2465				RP11-2E11.9_ENST00000604965.1_RNA	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript						mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					ACATACTCATCATCATACCCA	0.473																																					Colon(126;2182 2305 6517 35181)	uc003vqh.1		NA																	0					0						c.(2236-2238)GAT>AAT		coatomer protein complex, subunit gamma 2							80.0	77.0	78.0					7																	130148414		2027	4197	6224	SO:0001628	intergenic_variant	26958				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity	g.chr7:130148414C>T		CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661		7.37:g.130148414C>T			Somatic					p.D746N	NM_012133	NP_036265	WXS	Illumina HiSeq	Unspecified	Q9UBF2	COPG2_HUMAN			11	2326	-	Melanoma(18;0.0435)		746					B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	ENST00000223215.4	37	c.2236G>A	CCDS5822.1	.	.	.	.	.	.	.	.	.	.	C	35	5.517269	0.96416	.	.	ENSG00000158623	ENST00000425248	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	D	0.86439	0.5933	M	0.92970	3.365	0.80722	D	1	.	.	.	.	.	.	D	0.89430	0.3716	5	.	.	.	.	18.3598	0.90371	0.0:1.0:0.0:0.0	.	.	.	.	I	29	.	.	M	-	3	0	COPG2	129935650	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.453000	0.80700	2.662000	0.90505	0.637000	0.83480	ATG		0.473	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2	NM_002402		3	20	0	0	0	0	3	20				
ZFHX4	79776	broad.mit.edu	37	8	77766752	77766752	+	Missense_Mutation	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr8:77766752C>G	ENST00000521891.2	+	10	8043	c.7595C>G	c.(7594-7596)cCc>cGc	p.P2532R	ZFHX4_ENST00000455469.2_Missense_Mutation_p.P2487R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P2506R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.P2487R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TTGGAAAGGCCCATGGACATG	0.527										HNSCC(33;0.089)																												uc003yav.2		NA																	0				ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(7459-7461)CCC>CGC		zinc finger homeodomain 4							150.0	149.0	149.0					8																	77766752		2020	4186	6206	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77766752C>G		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7595C>G	8.37:g.77766752C>G	ENSP00000430497:p.Pro2532Arg	HNSCC(33;0.089)	Somatic				ZFHX4_uc003yau.1_Missense_Mutation_p.P2532R|ZFHX4_uc003yaw.1_Missense_Mutation_p.P2487R	p.P2487R	NM_024721	NP_078997	WXS	Illumina HiSeq	Unspecified	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	7847	+			2487					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.7460C>G	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	15.18	2.758438	0.49468	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53206	0.63;0.68;0.65;0.64	4.94	4.94	0.65067	.	0.000000	0.44285	U	0.000475	T	0.67804	0.2932	M	0.70275	2.135	0.80722	D	1	D;D;D	0.60575	0.979;0.988;0.988	P;P;D	0.65773	0.822;0.883;0.938	T	0.71748	-0.4499	10	0.87932	D	0	.	18.3571	0.90361	0.0:1.0:0.0:0.0	.	2487;2487;2532	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	2532;2516;2487;2487;2506	ENSP00000430497:P2532R;ENSP00000399605:P2487R;ENSP00000050961:P2487R;ENSP00000430848:P2506R	ENSP00000050961:P2487R	P	+	2	0	ZFHX4	77929307	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.645000	0.83430	2.569000	0.86673	0.650000	0.86243	CCC		0.527	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		12	98	0	0	0	0	12	98				
LRP12	29967	broad.mit.edu	37	8	105521200	105521200	+	Missense_Mutation	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr8:105521200A>G	ENST00000276654.5	-	3	347	c.239T>C	c.(238-240)aTa>aCa	p.I80T	LRP12_ENST00000424843.2_Missense_Mutation_p.I61T	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	80	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GTTTGCCCTTATGAACCAGCT	0.368																																						uc003yma.2		NA																	0					0						c.(238-240)ATA>ACA		low density lipoprotein-related protein 12							141.0	135.0	137.0					8																	105521200		2203	4300	6503	SO:0001583	missense	29967				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding	g.chr8:105521200A>G	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.239T>C	8.37:g.105521200A>G	ENSP00000276654:p.Ile80Thr		Somatic				LRP12_uc003ymb.2_Missense_Mutation_p.I61T|LRP12_uc003ymc.3_Missense_Mutation_p.I61T	p.I80T	NM_013437	NP_038465	WXS	Illumina HiSeq	Unspecified	Q9Y561	LRP12_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)		3	334	-			80			Extracellular (Potential).|CUB 1.		A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	c.239T>C	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.373460	0.82573	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523830	T;T	0.49720	0.77;0.77	5.44	5.44	0.79542	CUB (5);	0.000000	0.85682	D	0.000000	T	0.81664	0.4870	H	0.99026	4.405	0.80722	D	1	D;D;D	0.76494	0.999;0.989;0.991	D;D;D	0.85130	0.997;0.985;0.991	D	0.89361	0.3668	10	0.87932	D	0	-23.1145	15.7875	0.78319	1.0:0.0:0.0:0.0	.	61;61;80	Q68DE8;Q9Y561-2;Q9Y561	.;.;LRP12_HUMAN	T	61;80;80	ENSP00000399148:I61T;ENSP00000276654:I80T	ENSP00000276654:I80T	I	-	2	0	LRP12	105590376	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	8.525000	0.90583	2.189000	0.69895	0.459000	0.35465	ATA		0.368	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437		7	82	0	0	0	0	7	82				
KLHL9	55958	broad.mit.edu	37	9	21333736	21333736	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:21333736G>A	ENST00000359039.4	-	1	1643	c.1123C>T	c.(1123-1125)Cgg>Tgg	p.R375W	KLHL9_ENST00000537938.1_Missense_Mutation_p.R307W			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	375					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.R375W(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		TTATTATACCGAGGATCAAAT	0.383																																						uc003zoy.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)|skin(1)	4						c.(1123-1125)CGG>TGG		kelch-like 9							80.0	80.0	80.0					9																	21333736		2203	4300	6503	SO:0001583	missense	55958				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody		g.chr9:21333736G>A	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.1123C>T	9.37:g.21333736G>A	ENSP00000351933:p.Arg375Trp		Somatic				KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	p.R375W	NM_018847	NP_061335	WXS	Illumina HiSeq	Unspecified	Q9P2J3	KLHL9_HUMAN		Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)	1	1694	-			375			Kelch 2.		Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	37	c.1123C>T	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478664	0.63849	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.79141	-1.24;-1.24	4.67	4.67	0.58626	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	U	0.000000	D	0.89157	0.6635	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91079	0.4898	10	0.72032	D	0.01	.	15.4698	0.75432	0.0:0.0:1.0:0.0	.	375	Q9P2J3	KLHL9_HUMAN	W	375;307	ENSP00000351933:R375W;ENSP00000437733:R307W	ENSP00000351933:R375W	R	-	1	2	KLHL9	21323736	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.512000	0.73737	2.319000	0.78375	0.650000	0.86243	CGG		0.383	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		29	65	0	0	0	0	29	65				
SPATA31E1	286234	broad.mit.edu	37	9	90500809	90500809	+	Silent	SNP	A	A	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:90500809A>C	ENST00000325643.5	+	4	1473	c.1407A>C	c.(1405-1407)gtA>gtC	p.V469V		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	469					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CACACTCTGTACCACTGGATA	0.582																																						uc004app.3		NA																	0				ovary(3)	3						c.(1405-1407)GTA>GTC		chromosome 9 open reading frame 79							173.0	178.0	176.0					9																	90500809		2203	4300	6503	SO:0001819	synonymous_variant	286234					integral to membrane		g.chr9:90500809A>C	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1407A>C	9.37:g.90500809A>C			Somatic				C9orf79_uc004apo.1_Silent_p.V281V	p.V469V	NM_178828	NP_849150	WXS	Illumina HiSeq	Unspecified	Q6ZUB1	CI079_HUMAN			4	1442	+			469					B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	37	c.1407A>C	CCDS6676.1																																																																																				0.582	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828		21	205	0	0	0	0	21	205				
FBP2	8789	broad.mit.edu	37	9	97346868	97346868	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:97346868G>C	ENST00000375337.3	-	3	483	c.417C>G	c.(415-417)atC>atG	p.I139M		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	139					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				CCTTTCTATAGATGGCAAAGA	0.493																																						uc004auv.2		NA																	0					0						c.(415-417)ATC>ATG		fructose-1,6-bisphosphatase 2							149.0	122.0	131.0					9																	97346868		2203	4300	6503	SO:0001583	missense	8789				fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding	g.chr9:97346868G>C	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.417C>G	9.37:g.97346868G>C	ENSP00000364486:p.Ile139Met		Somatic					p.I139M	NM_003837	NP_003828	WXS	Illumina HiSeq	Unspecified	O00757	F16P2_HUMAN			3	484	-		Acute lymphoblastic leukemia(62;0.136)	139					Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	c.417C>G	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263649	0.59431	.	.	ENSG00000130957	ENST00000375337	T	0.78246	-1.16	4.87	2.98	0.34508	.	0.000000	0.85682	D	0.000000	D	0.90573	0.7045	H	0.97918	4.105	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.88591	0.3143	10	0.87932	D	0	-9.715	6.4241	0.21760	0.1549:0.0:0.6993:0.1458	.	139	O00757	F16P2_HUMAN	M	139	ENSP00000364486:I139M	ENSP00000364486:I139M	I	-	3	3	FBP2	96386689	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.479000	0.66813	0.539000	0.28788	0.655000	0.94253	ATC		0.493	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837		6	39	0	0	0	0	6	39				
ASTN2	23245	broad.mit.edu	37	9	119770538	119770538	+	Splice_Site	SNP	C	C	T	rs139435569		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:119770538C>T	ENST00000313400.4	-	7	1524	c.1424G>A	c.(1423-1425)gGa>gAa	p.G475E	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Splice_Site_p.G475E|ASTN2_ENST00000361209.2_Splice_Site_p.G424E			O75129	ASTN2_HUMAN	astrotactin 2	475					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.G424E(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GAAGCTGCTTCCTATGGGTGA	0.498																																						uc004bjs.1		NA																	1	Substitution - Missense(1)	p.G424E(1)	skin(1)	skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(1423-1425)GGA>GAA		astrotactin 2 isoform c							87.0	74.0	78.0					9																	119770538		2203	4300	6503	SO:0001630	splice_region_variant	23245					integral to membrane		g.chr9:119770538C>T	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1424-1G>A	9.37:g.119770538C>T			Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.G475E|ASTN2_uc004bjt.1_Missense_Mutation_p.G424E	p.G475E	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			7	1525	-			475			Extracellular (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.1424G>A		.	.	.	.	.	.	.	.	.	.	C	19.05	3.752557	0.69533	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.30981	1.61;1.61;1.51;1.74	5.56	5.56	0.83823	.	0.125553	0.53938	D	0.000057	T	0.46889	0.1416	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.997	T	0.22800	-1.0206	9	.	.	.	.	19.5337	0.95240	0.0:1.0:0.0:0.0	.	424;475;475	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	E	475;475;202;424	ENSP00000314038:G475E;ENSP00000363108:G475E;ENSP00000363098:G202E;ENSP00000354504:G424E	.	G	-	2	0	ASTN2	118810359	1.000000	0.71417	0.992000	0.48379	0.730000	0.41778	7.726000	0.84824	2.602000	0.87976	0.655000	0.94253	GGA		0.498	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	Missense_Mutation	8	46	0	0	0	0	8	46				
ASTN2	23245	broad.mit.edu	37	9	119976991	119976991	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:119976991G>C	ENST00000313400.4	-	3	761	c.661C>G	c.(661-663)Ctg>Gtg	p.L221V	ASTN2_ENST00000373996.3_Missense_Mutation_p.L221V|ASTN2_ENST00000361209.2_Missense_Mutation_p.L221V|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	221					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTGAACACCAGCAGCAGCAGC	0.602																																						uc004bjs.1		NA																	0				skin(4)|ovary(3)|breast(1)|kidney(1)	9						c.(661-663)CTG>GTG		astrotactin 2 isoform c							34.0	35.0	35.0					9																	119976991		2203	4300	6503	SO:0001583	missense	23245					integral to membrane		g.chr9:119976991G>C	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.661C>G	9.37:g.119976991G>C	ENSP00000314038:p.Leu221Val		Somatic				ASTN2_uc004bjr.1_Missense_Mutation_p.L221V|ASTN2_uc004bjt.1_Missense_Mutation_p.L221V	p.L221V	NM_198187	NP_937830	WXS	Illumina HiSeq	Unspecified	O75129	ASTN2_HUMAN			3	762	-			221			Helical; (Potential).		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37	c.661C>G		.	.	.	.	.	.	.	.	.	.	G	19.87	3.907561	0.72868	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.14022	2.62;2.62;2.54	5.41	4.5	0.54988	.	0.000000	0.56097	D	0.000023	T	0.23249	0.0562	L	0.27053	0.805	0.47476	D	0.999432	D;D;P	0.69078	0.971;0.997;0.946	P;D;P	0.72625	0.835;0.978;0.808	T	0.01982	-1.1235	9	.	.	.	-12.1738	14.2439	0.65975	0.0739:0.0:0.9261:0.0	.	221;221;221	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	V	221	ENSP00000314038:L221V;ENSP00000363108:L221V;ENSP00000354504:L221V	.	L	-	1	2	ASTN2	119016812	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.130000	0.57964	1.250000	0.43966	0.655000	0.94253	CTG		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		3	45	0	0	0	0	3	45				
CDK5RAP2	55755	broad.mit.edu	37	9	123201903	123201903	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:123201903C>T	ENST00000349780.4	-	24	3675	c.3496G>A	c.(3496-3498)Ggg>Agg	p.G1166R	CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.G1166R|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.G1134R|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.G1125R	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1166	Interaction with MAPRE1.				brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						ATTTCTTCCCCATCAGAACCA	0.512											OREG0019438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc004bkf.2		NA																	0				ovary(2)|lung(1)|skin(1)	4						c.(3496-3498)GGG>AGG		CDK5 regulatory subunit associated protein 2							93.0	86.0	88.0					9																	123201903		2203	4300	6503	SO:0001583	missense	55755				brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding	g.chr9:123201903C>T	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3496G>A	9.37:g.123201903C>T	ENSP00000343818:p.Gly1166Arg		Somatic	OREG0019438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1524	CDK5RAP2_uc010mvi.2_Missense_Mutation_p.G175R|CDK5RAP2_uc004bke.2_Missense_Mutation_p.G451R|CDK5RAP2_uc004bkg.2_Missense_Mutation_p.G1166R|CDK5RAP2_uc011lxw.1_Missense_Mutation_p.G431R|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Missense_Mutation_p.G431R|CDK5RAP2_uc011lya.1_Missense_Mutation_p.G431R|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.G936R|CDK5RAP2_uc004bki.2_Missense_Mutation_p.G933R	p.G1166R	NM_018249	NP_060719	WXS	Illumina HiSeq	Unspecified	Q96SN8	CK5P2_HUMAN			24	3677	-			1166			Interaction with MAPRE1.		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	c.3496G>A	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	C	9.049	0.991723	0.18966	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.21191	4.02;3.93;4.02;3.92;2.34;2.02	5.51	5.51	0.81932	.	0.510359	0.19597	N	0.110463	T	0.11324	0.0276	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.21821	0.001;0.001;0.0;0.061;0.0;0.001	B;B;B;B;B;B	0.21708	0.001;0.001;0.001;0.036;0.0;0.001	T	0.11690	-1.0577	10	0.54805	T	0.06	.	8.5057	0.33186	0.0:0.8693:0.0:0.1307	.	176;935;1134;1166;1166;560	Q5JTU8;Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;.;CK5P2_HUMAN;.	R	1134;1125;1166;1166;560;176;938	ENSP00000354065:G1134R;ENSP00000352258:G1125R;ENSP00000343818:G1166R;ENSP00000353317:G1166R;ENSP00000400395:G560R;ENSP00000409941:G176R	ENSP00000341695:G938R	G	-	1	0	CDK5RAP2	122241724	0.000000	0.05858	0.718000	0.30602	0.040000	0.13550	0.595000	0.24029	2.586000	0.87340	0.557000	0.71058	GGG		0.512	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		18	42	0	0	0	0	18	42				
OR1L4	254973	broad.mit.edu	37	9	125486388	125486388	+	Silent	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr9:125486388G>A	ENST00000259466.1	+	1	120	c.120G>A	c.(118-120)gcG>gcA	p.A40A		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A40A(1)		breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						TACTCACTGCGGTGGGGAATG	0.517																																						uc004bmu.1		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(118-120)GCG>GCA		olfactory receptor, family 1, subfamily L,							200.0	182.0	188.0					9																	125486388		2203	4300	6503	SO:0001819	synonymous_variant	254973				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125486388G>A		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.120G>A	9.37:g.125486388G>A			Somatic					p.A40A	NM_001005235	NP_001005235	WXS	Illumina HiSeq	Unspecified	Q8NGR5	OR1L4_HUMAN			1	120	+			40			Helical; Name=1; (Potential).		Q6IFN0|Q96R81	Silent	SNP	ENST00000259466.1	37	c.120G>A	CCDS35129.1																																																																																				0.517	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1			15	145	0	0	0	0	15	145				
REPS2	9185	broad.mit.edu	37	X	17072947	17072947	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:17072947G>C	ENST00000357277.3	+	8	1159	c.988G>C	c.(988-990)Gac>Cac	p.D330H	REPS2_ENST00000303843.7_Missense_Mutation_p.D329H|REPS2_ENST00000380064.4_Missense_Mutation_p.D190H	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	330	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					TAGTGATGCTGACTGTGATGG	0.512																																						uc004cxv.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(988-990)GAC>CAC		RALBP1 associated Eps domain containing 2							213.0	172.0	186.0					X																	17072947		2203	4300	6503	SO:0001583	missense	9185				epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding	g.chrX:17072947G>C	AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.988G>C	X.37:g.17072947G>C	ENSP00000349824:p.Asp330His		Somatic				REPS2_uc004cxw.1_Missense_Mutation_p.D329H|REPS2_uc011miw.1_Missense_Mutation_p.D189H	p.D330H	NM_004726	NP_004717	WXS	Illumina HiSeq	Unspecified	Q8NFH8	REPS2_HUMAN			8	1159	+	Hepatocellular(33;0.183)		330			EH 2.|EF-hand.|Potential.		A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	ENST00000357277.3	37	c.988G>C	CCDS14180.2	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749272	0.69533	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.41758	0.99;0.99;0.99	5.13	5.13	0.70059	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.64402	D	0.000004	T	0.67748	0.2926	M	0.84219	2.685	0.80722	D	1	D;P;D	0.89917	1.0;0.457;1.0	D;P;D	0.97110	1.0;0.768;1.0	T	0.71666	-0.4524	10	0.51188	T	0.08	-15.2606	16.6137	0.84901	0.0:0.0:1.0:0.0	.	190;329;330	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	H	330;330;329;190	ENSP00000349824:D330H;ENSP00000306033:D329H;ENSP00000369404:D190H	ENSP00000306033:D329H	D	+	1	0	REPS2	16982868	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.763000	0.74955	2.267000	0.75376	0.600000	0.82982	GAC		0.512	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1	NM_004726		8	83	0	0	0	0	8	83				
GPR64	10149	broad.mit.edu	37	X	19039220	19039220	+	Splice_Site	SNP	A	A	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:19039220A>G	ENST00000379869.3	-	14	807		c.e14+1		GPR64_ENST00000379878.3_Splice_Site|GPR64_ENST00000360279.4_Splice_Site|GPR64_ENST00000379873.2_Splice_Site|GPR64_ENST00000356606.4_Splice_Site|GPR64_ENST00000357544.3_Splice_Site|GPR64_ENST00000340581.3_Splice_Site|GPR64_ENST00000354791.3_Splice_Site|GPR64_ENST00000379876.1_Splice_Site|GPR64_ENST00000357991.3_Splice_Site	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					TAGACAACTTACCCATTGGTC	0.284																																						uc004cyx.2		NA																	0					0						c.e14+1		G protein-coupled receptor 64 isoform 1							154.0	125.0	135.0					X																	19039220		2202	4299	6501	SO:0001630	splice_region_variant	10149				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity	g.chrX:19039220A>G	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.643+1T>C	X.37:g.19039220A>G			Somatic				GPR64_uc004cyy.2_Splice_Site_p.E212_splice|GPR64_uc004cyz.2_Splice_Site_p.E201_splice|GPR64_uc004czb.2_Splice_Site_p.E215_splice|GPR64_uc004czc.2_Splice_Site_p.E199_splice|GPR64_uc004czd.2_Splice_Site_p.E191_splice|GPR64_uc004cze.2_Splice_Site_p.E185_splice|GPR64_uc004czf.2_Splice_Site_p.E177_splice|GPR64_uc004cza.2_Splice_Site_p.E193_splice|GPR64_uc004cyw.2_Splice_Site_p.E199_splice|GPR64_uc010nfj.2_Splice_Site_p.E185_splice	p.E215_splice	NM_001079858	NP_001073327	WXS	Illumina HiSeq	Unspecified	Q8IZP9	GPR64_HUMAN			14	807	-	Hepatocellular(33;0.183)							B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Splice_Site	SNP	ENST00000379869.3	37	c.643_splice	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	A	9.836	1.189630	0.21954	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3537	0.43952	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPR64	18949141	1.000000	0.71417	0.998000	0.56505	0.079000	0.17450	3.944000	0.56629	1.970000	0.57323	0.481000	0.45027	.		0.284	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2		Intron	4	68	0	0	0	0	4	68				
DCAF8L1	139425	broad.mit.edu	37	X	27998267	27998267	+	Missense_Mutation	SNP	G	G	C	rs371674204		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:27998267G>C	ENST00000441525.1	-	1	1299	c.1185C>G	c.(1183-1185)tgC>tgG	p.C395W		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	395								p.C395C(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						TGTACACAACGCAGGTGATGT	0.418																																						uc004dbx.1		NA																	1	Substitution - coding silent(1)		kidney(1)	ovary(3)|skin(1)	4						c.(1183-1185)TGC>TGG		DDB1 and CUL4 associated factor 8-like 1							98.0	89.0	92.0					X																	27998267		2202	4300	6502	SO:0001583	missense	139425							g.chrX:27998267G>C		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1185C>G	X.37:g.27998267G>C	ENSP00000405222:p.Cys395Trp		Somatic					p.C395W	NM_001017930	NP_001017930	WXS	Illumina HiSeq	Unspecified	A6NGE4	DC8L1_HUMAN			1	1300	-			395			WD 5.		B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	c.1185C>G	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383418	0.25031	.	.	ENSG00000226372	ENST00000441525	D	0.82167	-1.58	1.08	-0.719	0.11201	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.059063	0.64402	D	0.000001	D	0.89283	0.6671	M	0.88906	2.99	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.85227	0.1030	10	0.72032	D	0.01	-1.7133	5.1961	0.15239	0.3273:0.0:0.6727:0.0	.	395	A6NGE4	DC8L1_HUMAN	W	395	ENSP00000405222:C395W	ENSP00000405222:C395W	C	-	3	2	DCAF8L1	27908188	0.999000	0.42202	0.023000	0.16930	0.125000	0.20455	0.074000	0.14662	-0.300000	0.08895	0.284000	0.19432	TGC		0.418	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		24	81	0	0	0	0	24	81				
WDR13	64743	broad.mit.edu	37	X	48457988	48457988	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:48457988G>A	ENST00000218056.5	+	4	911	c.406G>A	c.(406-408)Gtg>Atg	p.V136M	WDR13_ENST00000492715.1_3'UTR|WDR13_ENST00000376729.5_Missense_Mutation_p.V136M	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	136						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CCCTGGCAGCGTGGTGCCCAC	0.617																																						uc004dkh.1		NA																	0				ovary(2)	2						c.(406-408)GTG>ATG		WD repeat domain 13 protein							73.0	64.0	67.0					X																	48457988		2203	4300	6503	SO:0001583	missense	64743					cytoplasm|nucleus		g.chrX:48457988G>A	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.406G>A	X.37:g.48457988G>A	ENSP00000218056:p.Val136Met		Somatic				WDR13_uc010nif.1_Missense_Mutation_p.V14M|WDR13_uc004dki.1_Missense_Mutation_p.V44M|WDR13_uc004dkj.1_Missense_Mutation_p.V136M|WDR13_uc004dkk.1_Missense_Mutation_p.V44M|WDR13_uc004dkl.3_Missense_Mutation_p.V44M|WDR13_uc011mme.1_Missense_Mutation_p.V14M	p.V136M	NM_017883	NP_060353	WXS	Illumina HiSeq	Unspecified	Q9H1Z4	WDR13_HUMAN			5	553	+			136					Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	ENST00000218056.5	37	c.406G>A	CCDS14302.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885774	0.51908	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.72394	-0.65;-0.65	5.48	4.62	0.57501	.	0.066508	0.64402	D	0.000009	T	0.65407	0.2688	L	0.46157	1.445	0.34829	D	0.739532	D;P	0.67145	0.996;0.918	P;B	0.47827	0.558;0.187	T	0.73714	-0.3896	10	0.54805	T	0.06	-10.9067	6.3256	0.21242	0.0955:0.0:0.7231:0.1814	.	14;136	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	M	136	ENSP00000365919:V136M;ENSP00000218056:V136M	ENSP00000218056:V136M	V	+	1	0	WDR13	48342932	0.998000	0.40836	0.735000	0.30896	0.986000	0.74619	2.804000	0.47931	1.077000	0.40990	0.529000	0.55759	GTG		0.617	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2			15	98	0	0	0	0	15	98				
GSPT2	23708	broad.mit.edu	37	X	51486870	51486870	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:51486870C>T	ENST00000340438.4	+	1	390	c.148C>T	c.(148-150)Cgt>Tgt	p.R50C		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	50					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					GGCTTTCAGCCGTAAGCTCAA	0.697																																						uc004dpl.2		NA																	0				ovary(1)	1						c.(148-150)CGT>TGT		peptide chain release factor 3							32.0	32.0	32.0					X																	51486870		2202	4300	6502	SO:0001583	missense	23708				cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding	g.chrX:51486870C>T	AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.148C>T	X.37:g.51486870C>T	ENSP00000341247:p.Arg50Cys		Somatic					p.R50C	NM_018094	NP_060564	WXS	Illumina HiSeq	Unspecified	Q8IYD1	ERF3B_HUMAN			1	374	+	Ovarian(276;0.236)		50					Q9H909|Q9NVY0|Q9NY44	Missense_Mutation	SNP	ENST00000340438.4	37	c.148C>T	CCDS14336.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708439	0.68615	.	.	ENSG00000189369	ENST00000340438	T	0.32515	1.45	3.63	2.63	0.31362	Ataxin-2, C-terminal (1);	0.531689	0.15933	N	0.237575	T	0.31979	0.0814	L	0.60455	1.87	0.37599	D	0.920499	P	0.47409	0.895	B	0.43990	0.438	T	0.32348	-0.9910	10	0.66056	D	0.02	-12.6787	9.0407	0.36316	0.2865:0.7135:0.0:0.0	.	50	Q8IYD1	ERF3B_HUMAN	C	50	ENSP00000341247:R50C	ENSP00000341247:R50C	R	+	1	0	GSPT2	51503610	0.992000	0.36948	0.977000	0.42913	0.955000	0.61496	0.414000	0.21164	0.742000	0.32697	0.519000	0.50382	CGT		0.697	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1			10	38	0	0	0	0	10	38				
FGD1	2245	broad.mit.edu	37	X	54492144	54492144	+	Silent	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:54492144G>T	ENST00000375135.3	-	7	2215	c.1482C>A	c.(1480-1482)atC>atA	p.I494I		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	494	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CCTCATGGATGATGACTTTAA	0.562																																						uc004dtg.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(1480-1482)ATC>ATA		faciogenital dysplasia protein							74.0	61.0	65.0					X																	54492144		2203	4300	6503	SO:0001819	synonymous_variant	2245				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding	g.chrX:54492144G>T	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1482C>A	X.37:g.54492144G>T			Somatic				FGD1_uc011moi.1_Silent_p.I252I	p.I494I	NM_004463	NP_004454	WXS	Illumina HiSeq	Unspecified	P98174	FGD1_HUMAN			7	2216	-			494			DH.		Q5H999|Q8N4D9	Silent	SNP	ENST00000375135.3	37	c.1482C>A	CCDS14359.1																																																																																				0.562	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		6	71	1	0	5.94e-07	6.85e-07	6	71				
MED12	9968	broad.mit.edu	37	X	70347860	70347860	+	Silent	SNP	C	C	G			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:70347860C>G	ENST00000374080.3	+	22	3131	c.3099C>G	c.(3097-3099)acC>acG	p.T1033T	MED12_ENST00000374102.1_Silent_p.T1033T|MED12_ENST00000333646.6_Silent_p.T1033T			Q93074	MED12_HUMAN	mediator complex subunit 12	1033					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CAGCTCACACCTTCACCTACA	0.527			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(3097-3099)ACC>ACG		mediator complex subunit 12							87.0	80.0	82.0					X																	70347860		2014	4186	6200	SO:0001819	synonymous_variant	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70347860C>G	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3099C>G	X.37:g.70347860C>G			Somatic				MED12_uc011mpq.1_Silent_p.T1033T|MED12_uc004dyz.2_Silent_p.T1033T|MED12_uc004dza.2_Silent_p.T880T|MED12_uc010nla.2_5'Flank	p.T1033T	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			22	3298	+	Renal(35;0.156)		1033					O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	c.3099C>G	CCDS43970.1																																																																																				0.527	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		7	68	0	0	0	0	7	68				
PCDH11X	27328	broad.mit.edu	37	X	91090649	91090649	+	Missense_Mutation	SNP	T	T	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:91090649T>C	ENST00000373094.1	+	1	991	c.146T>C	c.(145-147)tTg>tCg	p.L49S	PCDH11X_ENST00000504220.2_Missense_Mutation_p.L49S|PCDH11X_ENST00000361655.2_Missense_Mutation_p.L49S|PCDH11X_ENST00000298274.8_Missense_Mutation_p.L49S|PCDH11X_ENST00000406881.1_Missense_Mutation_p.L49S|PCDH11X_ENST00000361724.1_Missense_Mutation_p.L49S|PCDH11X_ENST00000373088.1_Missense_Mutation_p.L49S|PCDH11X_ENST00000373097.1_Missense_Mutation_p.L49S|PCDH11X_ENST00000395337.2_Missense_Mutation_p.L49S	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GACCTTAACTTGTCGCTGATT	0.473																																					NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(145-147)TTG>TCG		protocadherin 11 X-linked isoform c							180.0	135.0	150.0					X																	91090649		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91090649T>C	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.146T>C	X.37:g.91090649T>C	ENSP00000362186:p.Leu49Ser		Somatic				PCDH11X_uc004efl.1_Missense_Mutation_p.L49S|PCDH11X_uc004efo.1_Missense_Mutation_p.L49S|PCDH11X_uc010nmv.1_Missense_Mutation_p.L49S|PCDH11X_uc004efm.1_Missense_Mutation_p.L49S|PCDH11X_uc004efn.1_Missense_Mutation_p.L49S|PCDH11X_uc004efh.1_Missense_Mutation_p.L49S|PCDH11X_uc004efj.1_Missense_Mutation_p.L49S	p.L49S	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			1	991	+			49			Extracellular (Potential).|Cadherin 1.		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.146T>C	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.376035	0.42105	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42;0.42;0.42;0.42	3.93	3.93	0.45458	Cadherin, N-terminal (1);Cadherin (2);	0.000000	0.64402	D	0.000010	T	0.74481	0.3722	M	0.88181	2.935	0.42538	D	0.99306	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.85130	0.994;0.996;0.994;0.994;0.994;0.997;0.994;0.989	T	0.79785	-0.1657	10	0.87932	D	0	.	11.4508	0.50151	0.0:0.0:0.0:1.0	.	49;49;49;49;49;49;49;49	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	S	49	ENSP00000378746:L49S;ENSP00000362186:L49S;ENSP00000362189:L49S;ENSP00000355040:L49S;ENSP00000362180:L49S;ENSP00000423762:L49S;ENSP00000355105:L49S;ENSP00000384758:L49S;ENSP00000298274:L49S	ENSP00000298274:L49S	L	+	2	0	PCDH11X	90977305	1.000000	0.71417	0.976000	0.42696	0.268000	0.26511	6.855000	0.75445	1.555000	0.49500	0.339000	0.21740	TTG		0.473	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		11	88	0	0	0	0	11	88				
PCDH11X	27328	broad.mit.edu	37	X	91090730	91090730	+	Missense_Mutation	SNP	G	G	A			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:91090730G>A	ENST00000373094.1	+	1	1072	c.227G>A	c.(226-228)cGa>cAa	p.R76Q	PCDH11X_ENST00000504220.2_Missense_Mutation_p.R76Q|PCDH11X_ENST00000361655.2_Missense_Mutation_p.R76Q|PCDH11X_ENST00000298274.8_Missense_Mutation_p.R76Q|PCDH11X_ENST00000406881.1_Missense_Mutation_p.R76Q|PCDH11X_ENST00000361724.1_Missense_Mutation_p.R76Q|PCDH11X_ENST00000373088.1_Missense_Mutation_p.R76Q|PCDH11X_ENST00000373097.1_Missense_Mutation_p.R76Q|PCDH11X_ENST00000395337.2_Missense_Mutation_p.R76Q	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	76	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CCACTGATTCGAATTGAAGAG	0.438																																					NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(226-228)CGA>CAA		protocadherin 11 X-linked isoform c							200.0	167.0	178.0					X																	91090730		2203	4300	6503	SO:0001583	missense	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91090730G>A	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.227G>A	X.37:g.91090730G>A	ENSP00000362186:p.Arg76Gln		Somatic				PCDH11X_uc004efl.1_Missense_Mutation_p.R76Q|PCDH11X_uc004efo.1_Missense_Mutation_p.R76Q|PCDH11X_uc010nmv.1_Missense_Mutation_p.R76Q|PCDH11X_uc004efm.1_Missense_Mutation_p.R76Q|PCDH11X_uc004efn.1_Missense_Mutation_p.R76Q|PCDH11X_uc004efh.1_Missense_Mutation_p.R76Q|PCDH11X_uc004efj.1_Missense_Mutation_p.R76Q	p.R76Q	NM_032968	NP_116750	WXS	Illumina HiSeq	Unspecified	Q9BZA7	PC11X_HUMAN			1	1072	+			76			Extracellular (Potential).|Cadherin 1.		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	c.227G>A	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568784	0.45798	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77;1.77;1.77	4.06	3.18	0.36537	Cadherin, N-terminal (1);Cadherin (2);	0.078447	0.48767	D	0.000165	T	0.42944	0.1225	L	0.59436	1.845	0.24630	N	0.993625	D;D;D;D;D;D;D;D	0.76494	0.994;0.973;0.999;0.999;0.999;0.999;0.984;0.994	P;P;D;D;D;D;P;P	0.72338	0.823;0.787;0.961;0.961;0.961;0.977;0.726;0.726	T	0.10222	-1.0639	10	0.72032	D	0.01	.	10.6885	0.45856	0.1038:0.0:0.8962:0.0	.	76;76;76;76;76;76;76;76	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	Q	76	ENSP00000378746:R76Q;ENSP00000362186:R76Q;ENSP00000362189:R76Q;ENSP00000355040:R76Q;ENSP00000362180:R76Q;ENSP00000423762:R76Q;ENSP00000355105:R76Q;ENSP00000384758:R76Q;ENSP00000298274:R76Q	ENSP00000298274:R76Q	R	+	2	0	PCDH11X	90977386	0.900000	0.30661	0.901000	0.35422	0.230000	0.25150	4.023000	0.57211	1.993000	0.58246	0.506000	0.49869	CGA		0.438	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		21	141	0	0	0	0	21	141				
CENPI	2491	broad.mit.edu	37	X	100403043	100403043	+	Missense_Mutation	SNP	A	A	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:100403043A>T	ENST00000372927.1	+	19	2264	c.1987A>T	c.(1987-1989)Att>Ttt	p.I663F	CENPI_ENST00000423383.1_Missense_Mutation_p.I663F|CENPI_ENST00000218507.5_Missense_Mutation_p.I663F	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	663					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						AGGAATATATATTGACCCTGA	0.363																																						uc004egx.2		NA																	0				skin(1)	1						c.(1987-1989)ATT>TTT		centromere protein I							126.0	126.0	126.0					X																	100403043		2203	4300	6503	SO:0001583	missense	2491				CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding	g.chrX:100403043A>T	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.1987A>T	X.37:g.100403043A>T	ENSP00000362018:p.Ile663Phe		Somatic				CENPI_uc011mrg.1_Missense_Mutation_p.I663F	p.I663F	NM_006733	NP_006724	WXS	Illumina HiSeq	Unspecified	Q92674	CENPI_HUMAN			19	2257	+			663					Q5JWZ9|Q96ED0	Missense_Mutation	SNP	ENST00000372927.1	37	c.1987A>T	CCDS14479.1	.	.	.	.	.	.	.	.	.	.	a	4.371	0.068400	0.08436	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372927	.	.	.	5.58	-2.19	0.07015	.	0.938726	0.09020	N	0.860278	T	0.31420	0.0796	L	0.50333	1.59	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.003;0.004	T	0.35126	-0.9801	9	0.56958	D	0.05	-0.063	3.6146	0.08073	0.2806:0.4236:0.0679:0.2279	.	663;663	B4DZL4;Q92674	.;CENPI_HUMAN	F	663	.	ENSP00000218507:I663F	I	+	1	0	CENPI	100289699	0.008000	0.16893	0.001000	0.08648	0.017000	0.09413	0.020000	0.13466	-0.375000	0.07955	-0.588000	0.04126	ATT		0.363	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733		16	178	0	0	0	0	16	178				
DOCK11	139818	broad.mit.edu	37	X	117815169	117815169	+	Missense_Mutation	SNP	G	G	C			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:117815169G>C	ENST00000276202.7	+	50	5883	c.5820G>C	c.(5818-5820)atG>atC	p.M1940I	DOCK11_ENST00000276204.6_Missense_Mutation_p.M1940I	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1940	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						ACGTGGACATGATTCAGCTCC	0.373																																						uc004eqp.2		NA																	0				ovary(3)	3						c.(5818-5820)ATG>ATC		dedicator of cytokinesis 11							99.0	77.0	85.0					X																	117815169		2203	4300	6503	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117815169G>C	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.5820G>C	X.37:g.117815169G>C	ENSP00000276202:p.Met1940Ile		Somatic				DOCK11_uc004eqq.2_Missense_Mutation_p.M1719I	p.M1940I	NM_144658	NP_653259	WXS	Illumina HiSeq	Unspecified	Q5JSL3	DOC11_HUMAN			50	5883	+			1940			DHR-2.		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.5820G>C	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577426	0.86645	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.15372	2.43;2.43	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.41328	0.1154	M	0.63169	1.94	0.58432	D	0.999999	D;D	0.59357	0.985;0.985	D;D	0.81914	0.995;0.995	T	0.06807	-1.0806	10	0.46703	T	0.11	-21.1845	17.8167	0.88637	0.0:0.0:1.0:0.0	.	1940;1940	A6NIW2;Q5JSL3	.;DOC11_HUMAN	I	1940	ENSP00000276204:M1940I;ENSP00000276202:M1940I	ENSP00000276202:M1940I	M	+	3	0	DOCK11	117699197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.441000	0.97557	2.426000	0.82243	0.544000	0.68410	ATG		0.373	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		29	86	0	0	0	0	29	86				
CUL4B	8450	broad.mit.edu	37	X	119672528	119672528	+	Silent	SNP	G	G	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:119672528G>T	ENST00000404115.3	-	15	2294	c.1893C>A	c.(1891-1893)tcC>tcA	p.S631S	CUL4B_ENST00000336592.6_Silent_p.S618S|CUL4B_ENST00000371322.5_Silent_p.S613S	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	631					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTTTAAGTTTGGACAGCATTG	0.383																																						uc004esw.2		NA																	0				lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(1891-1893)TCC>TCA		cullin 4B isoform 1							112.0	110.0	111.0					X																	119672528		2203	4300	6503	SO:0001819	synonymous_variant	8450				cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding	g.chrX:119672528G>T	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1893C>A	X.37:g.119672528G>T			Somatic				CUL4B_uc010nqq.2_Silent_p.S330S|CUL4B_uc004esv.2_Silent_p.S613S	p.S631S	NM_003588	NP_003579	WXS	Illumina HiSeq	Unspecified	Q13620	CUL4B_HUMAN			15	2330	-			631					B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Silent	SNP	ENST00000404115.3	37	c.1893C>A	CCDS35379.1																																																																																				0.383	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588		25	103	1	0	7.26e-15	8.83e-15	25	103				
THOC2	57187	broad.mit.edu	37	X	122837338	122837338	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:122837338C>T	ENST00000245838.8	-	4	271	c.240G>A	c.(238-240)atG>atA	p.M80I	THOC2_ENST00000355725.4_Missense_Mutation_p.M80I	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	80					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GAATGGAGGGCATATCCTCAC	0.308																																						uc004etu.2		NA																	0				ovary(3)	3						c.(238-240)ATG>ATA		THO complex 2							73.0	64.0	67.0					X																	122837338		1826	4067	5893	SO:0001583	missense	57187				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding	g.chrX:122837338C>T	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.240G>A	X.37:g.122837338C>T	ENSP00000245838:p.Met80Ile		Somatic				THOC2_uc011muh.1_Missense_Mutation_p.M1I|THOC2_uc011mui.1_5'UTR	p.M80I	NM_001081550	NP_001075019	WXS	Illumina HiSeq	Unspecified	Q8NI27	THOC2_HUMAN			4	272	-			80					A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	c.240G>A	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227984	0.39399	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000408933	.	.	.	5.39	5.39	0.77823	.	0.065471	0.64402	D	0.000009	T	0.36690	0.0976	N	0.04260	-0.245	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20907	-1.0261	9	0.16896	T	0.51	-3.0309	18.1461	0.89655	0.0:1.0:0.0:0.0	.	1;80	B4DKZ6;Q8NI27	.;THOC2_HUMAN	I	80;80;1	.	ENSP00000245838:M80I	M	-	3	0	THOC2	122665019	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.977000	0.76141	2.221000	0.72209	0.600000	0.82982	ATG		0.308	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3			5	80	0	0	0	0	5	80				
HMGB3	3149	broad.mit.edu	37	X	150156302	150156302	+	Missense_Mutation	SNP	C	C	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:150156302C>T	ENST00000325307.7	+	5	614	c.518C>T	c.(517-519)gCt>gTt	p.A173V	HMGB3_ENST00000448905.2_Missense_Mutation_p.A173V	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	173					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.A173D(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					AAGGGTCCTGCTAAAGTTGCC	0.443																																						uc004fep.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(517-519)GCT>GTT		high-mobility group box 3							78.0	72.0	74.0					X																	150156302		2203	4300	6503	SO:0001583	missense	3149				DNA recombination|multicellular organismal development	chromosome|nucleus	DNA bending activity|double-stranded DNA binding	g.chrX:150156302C>T	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.518C>T	X.37:g.150156302C>T	ENSP00000359393:p.Ala173Val		Somatic				HMGB3_uc004feq.2_3'UTR|HMGB3_uc004fer.2_Missense_Mutation_p.A173V	p.A173V	NM_005342	NP_005333	WXS	Illumina HiSeq	Unspecified	O15347	HMGB3_HUMAN			5	610	+	Acute lymphoblastic leukemia(192;6.56e-05)		173					O95556|Q6NS40	Missense_Mutation	SNP	ENST00000325307.7	37	c.518C>T	CCDS35428.1	.	.	.	.	.	.	.	.	.	.	c	9.064	0.995313	0.19043	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905	D;D;D;D	0.95588	-3.74;-3.72;-3.75;-3.72	5.0	5.0	0.66597	.	0.444926	0.21994	N	0.066101	D	0.88470	0.6445	N	0.08118	0	0.34418	D	0.697173	B	0.24721	0.11	B	0.14578	0.011	D	0.87543	0.2460	10	0.19147	T	0.46	.	15.915	0.79508	0.0:1.0:0.0:0.0	.	173	O15347	HMGB3_HUMAN	V	173	ENSP00000410354:A173V;ENSP00000359393:A173V;ENSP00000405601:A173V;ENSP00000442758:A173V	ENSP00000359393:A173V	A	+	2	0	HMGB3	149906960	0.998000	0.40836	0.999000	0.59377	0.091000	0.18340	3.991000	0.56973	2.061000	0.61500	0.600000	0.82982	GCT		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060867.1	NM_005342		5	84	0	0	0	0	5	84				
CLIP1	6249	broad.mit.edu	37	12	122812690	122812691	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr12:122812690_122812691insT	ENST00000540338.1	-	16	3093_3094	c.3052_3053insA	c.(3052-3054)agcfs	p.S1018fs	CLIP1_ENST00000361654.4_Frame_Shift_Ins_p.S896fs|CLIP1_ENST00000537178.1_Frame_Shift_Ins_p.S972fs|CLIP1_ENST00000302528.7_Frame_Shift_Ins_p.S1007fs|CLIP1_ENST00000358808.2_Frame_Shift_Ins_p.S1007fs|CLIP1_ENST00000545889.1_Frame_Shift_Ins_p.S593fs			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1018					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTGGTTGTGGCTTGTTTCCATT	0.505																																						uc001ucg.1		NA																	0				ovary(2)|breast(1)	3						c.(3052-3054)AGCfs		restin isoform a																																				SO:0001589	frameshift_variant	6249				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding	g.chr12:122812690_122812691insT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3053dupA	12.37:g.122812692_122812692dupT	ENSP00000439093:p.Ser1018fs		Somatic				CLIP1_uc001uch.1_Frame_Shift_Ins_p.S1007fs|CLIP1_uc001uci.1_Frame_Shift_Ins_p.S972fs|CLIP1_uc001ucj.1_Frame_Shift_Ins_p.S593fs	p.S1018fs	NM_002956	NP_002947	WXS	Illumina HiSeq	Unspecified	P30622	CLIP1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)	16	3158_3159	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		1018			Potential.		A0AVD3|Q17RS4|Q29RG0	Frame_Shift_Ins	INS	ENST00000540338.1	37	c.3052_3053insA	CCDS58285.1																																																																																				0.505	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956		7	201	NA	NA	NA	NA	7	201	---	---	---	---
PABPC3	5042	broad.mit.edu	37	13	25671273	25671273	+	Frame_Shift_Del	DEL	G	G	-	rs376589131		TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr13:25671273delG	ENST00000281589.3	+	1	974	c.937delG	c.(937-939)gcgfs	p.A313fs		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	313	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TCTCCGGAAAGCGTTTTCTCC	0.408																																						uc001upy.2		NA																	0				ovary(3)|skin(1)	4						c.(937-939)GCGfs		poly(A) binding protein, cytoplasmic 3							213.0	213.0	213.0					13																	25671273		2203	4300	6503	SO:0001589	frameshift_variant	5042				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding	g.chr13:25671273delG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.937delG	13.37:g.25671273delG	ENSP00000281589:p.Ala313fs		Somatic					p.A313fs	NM_030979	NP_112241	WXS	Illumina HiSeq	Unspecified	Q9H361	PABP3_HUMAN		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)	1	998	+		Lung SC(185;0.0225)|Breast(139;0.0602)	313			RRM 4.		Q8NHV0|Q9H086	Frame_Shift_Del	DEL	ENST00000281589.3	37	c.937delG	CCDS9311.1																																																																																				0.408	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		13	235	NA	NA	NA	NA	13	235	---	---	---	---
DICER1	23405	broad.mit.edu	37	14	95562901	95562901	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr14:95562901delA	ENST00000526495.1	-	25	4647	c.4356delT	c.(4354-4356)tttfs	p.F1452fs	DICER1_ENST00000527414.1_Frame_Shift_Del_p.F1452fs|DICER1_ENST00000343455.3_Frame_Shift_Del_p.F1452fs|DICER1_ENST00000393063.1_Frame_Shift_Del_p.F1452fs|DICER1_ENST00000541352.1_Frame_Shift_Del_p.F1452fs|DICER1_ENST00000556045.1_Frame_Shift_Del_p.F350fs			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1452					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TATTATCTATAAATCTGATAT	0.413			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													uc001ydw.2		NA	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	Mis F|N	"""dicer 1, ribonuclease type III """			"""E, M, O"""		pleuropulmonary blastoma			0				skin(2)|ovary(1)|pancreas(1)|lung(1)	5						c.(4354-4356)TTTfs		dicer1							59.0	63.0	61.0					14																	95562901		2203	4300	6503	SO:0001589	frameshift_variant	23405	DICER_1_syndrome_|Familial_Multinodular_Goiter_	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity	g.chr14:95562901delA	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.4356delT	14.37:g.95562901delA	ENSP00000437256:p.Phe1452fs		Somatic				DICER1_uc010avh.1_Frame_Shift_Del_p.F350fs|DICER1_uc001ydv.2_Frame_Shift_Del_p.F1442fs|DICER1_uc001ydx.2_Frame_Shift_Del_p.F1452fs|DICER1_uc001ydy.1_Frame_Shift_Del_p.F304fs	p.F1452fs	NM_030621	NP_085124	WXS	Illumina HiSeq	Unspecified	Q9UPY3	DICER_HUMAN		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)	24	4538	-		all_cancers(154;0.0621)|all_epithelial(191;0.223)	1452					A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Frame_Shift_Del	DEL	ENST00000526495.1	37	c.4356delT	CCDS9931.1																																																																																				0.413	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1			11	67	NA	NA	NA	NA	11	67	---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187540153	187540154	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chr4:187540153_187540154insT	ENST00000441802.2	-	10	7795_7796	c.7586_7587insA	c.(7585-7587)tacfs	p.Y2529fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2529	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTACAATATGGTAAGTAACGTG	0.411										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	uc003izf.2		NA																	0				ovary(10)|central_nervous_system(1)|pancreas(1)	12						c.(7585-7587)TACfs		FAT tumor suppressor 1 precursor																																				SO:0001589	frameshift_variant	2195				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding	g.chr4:187540153_187540154insT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7587dupA	4.37:g.187540154_187540154dupT	ENSP00000406229:p.Tyr2529fs	HNSCC(5;0.00058)	Somatic					p.Y2529fs	NM_005245	NP_005236	WXS	Illumina HiSeq	Unspecified	Q14517	FAT1_HUMAN			10	7774_7775	-			2529			Extracellular (Potential).|Cadherin 23.			Frame_Shift_Ins	INS	ENST00000441802.2	37	c.7586_7587insA	CCDS47177.1																																																																																				0.411	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		41	100	NA	NA	NA	NA	41	100	---	---	---	---
FANCB	2187	broad.mit.edu	37	X	14871234	14871235	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CV-7422-01A-21D-2078-08	TCGA-CV-7422-10A-01D-2078-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	5eb3f291-082c-48a8-b653-09264342adee	f3de3c44-abb1-4a38-945c-cbdd7dd132a5	g.chrX:14871234_14871235insT	ENST00000324138.3	-	5	1405_1406	c.1252_1253insA	c.(1252-1254)attfs	p.I418fs	FANCB_ENST00000398334.1_Frame_Shift_Ins_p.I418fs	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	418					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TTTTGAAATAATTTTTTCCTTA	0.312								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc004cwg.1		NA																	0				lung(1)	1						c.(1252-1254)ATTfs	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B																																				SO:0001589	frameshift_variant	2187	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14871234_14871235insT	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1253dupA	X.37:g.14871240_14871240dupT	ENSP00000326819:p.Ile418fs		Somatic				FANCB_uc004cwh.1_Frame_Shift_Ins_p.I418fs	p.I418fs	NM_001018113	NP_001018123	WXS	Illumina HiSeq	Unspecified	Q8NB91	FANCB_HUMAN			6	1520_1521	-	Hepatocellular(33;0.183)		418					B2RMZ4|Q7Z2U2|Q86XG1	Frame_Shift_Ins	INS	ENST00000324138.3	37	c.1252_1253insA	CCDS14161.1																																																																																				0.312	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		9	82	NA	NA	NA	NA	9	82	---	---	---	---
