#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MARCH5	54708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	10	94071001	94071001	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr10:94071001C>T	ENST00000358935.2	+	2	477	c.145C>T	c.(145-147)Cgc>Tgc	p.R49C	MARCH5_ENST00000467521.2_3'UTR	NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	49					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CTGTCTACAACGCTGGGTGGA	0.448																																						.											0													88.0	76.0	80.0					10																	94071001		2203	4300	6503	SO:0001583	missense	54708			BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.145C>T	10.37:g.94071001C>T	ENSP00000351813:p.Arg49Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000358935.2	37	CCDS7420.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438339	0.83885	.	.	ENSG00000198060	ENST00000358935	T	0.47177	0.85	5.46	5.46	0.80206	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.83125	-0.0116	10	0.87932	D	0	-0.4	14.182	0.65580	0.1497:0.8503:0.0:0.0	.	49	Q9NX47	MARH5_HUMAN	C	49	ENSP00000351813:R49C	ENSP00000351813:R49C	R	+	1	0	MARCH5	94060981	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.540000	0.53611	2.559000	0.86315	0.655000	0.94253	CGC		0.448	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049388.1	NM_017824	
DMBT1	1755	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	10	124399735	124399735	+	Silent	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr10:124399735C>T	ENST00000338354.3	+	52	6841	c.6735C>T	c.(6733-6735)gtC>gtT	p.V2245V	DMBT1_ENST00000359586.6_Silent_p.V965V|DMBT1_ENST00000368955.3_Silent_p.V2235V|DMBT1_ENST00000368956.2_Silent_p.V1617V|DMBT1_ENST00000330163.4_Silent_p.V1617V|DMBT1_ENST00000344338.3_Silent_p.V2235V|DMBT1_ENST00000368909.3_Silent_p.V2245V			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2245	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCATCCAGGTCGAGGAAGTCC	0.468																																					Ovarian(182;93 2026 18125 22222 38972)	.											0													270.0	253.0	259.0					10																	124399735		2060	4205	6265	SO:0001819	synonymous_variant	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.6735C>T	10.37:g.124399735C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																					0.468	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
AICDA	57379	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	8759502	8759502	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr12:8759502C>T	ENST00000229335.6	-	2	218	c.115G>A	c.(115-117)Gct>Act	p.A39T	AICDA_ENST00000537228.1_Missense_Mutation_p.A39T	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	39	Important for interaction with CTNNBL1.				B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					AAGGATGTAGCACTGTCACGC	0.453																																					GBM(62;896 1067 5527 26594 30137)	.											0													92.0	89.0	90.0					12																	8759502		1990	4153	6143	SO:0001583	missense	57379			AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.115G>A	12.37:g.8759502C>T	ENSP00000229335:p.Ala39Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6QJ81|Q8NFC1	Missense_Mutation	SNP	ENST00000229335.6	37	CCDS41747.1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.764473	0.49574	.	.	ENSG00000111732	ENST00000229335;ENST00000537228	T;T	0.65549	-0.16;-0.16	5.36	4.46	0.54185	APOBEC-like, N-terminal (1);	0.155473	0.64402	D	0.000017	T	0.47764	0.1463	N	0.19112	0.55	0.41782	D	0.989827	P;B;P	0.39352	0.454;0.042;0.669	B;B;B	0.41374	0.192;0.089;0.355	T	0.46386	-0.9195	10	0.38643	T	0.18	-18.6958	9.9657	0.41723	0.1563:0.6929:0.1508:0.0	.	39;39;39	Q9GZX7;Q6QJ80;Q6QJ81	AICDA_HUMAN;.;.	T	39	ENSP00000229335:A39T;ENSP00000445691:A39T	ENSP00000229335:A39T	A	-	1	0	AICDA	8650769	1.000000	0.71417	0.991000	0.47740	0.872000	0.50106	3.930000	0.56522	1.239000	0.43787	0.467000	0.42956	GCT		0.453	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400575.1	NM_020661	
SOAT2	8435	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	53517645	53517645	+	Silent	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr12:53517645C>T	ENST00000301466.3	+	14	1566	c.1506C>T	c.(1504-1506)tgC>tgT	p.C502C		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	502					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	GGCGGCACTGCCCCTTACCCC	0.612																																						.											0													98.0	79.0	85.0					12																	53517645		2203	4300	6503	SO:0001819	synonymous_variant	8435			AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.1506C>T	12.37:g.53517645C>T		Somatic		WXS	Illumina HiSeq	Phase_I	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Silent	SNP	ENST00000301466.3	37	CCDS8847.1																																																																																				0.612	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1		
PAN3	255967	hgsc.bcm.edu;ucsc.edu	37	13	28840991	28840991	+	Silent	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr13:28840991A>G	ENST00000380958.3	+	10	1703	c.1551A>G	c.(1549-1551)ccA>ccG	p.P517P	PAN3_ENST00000282391.5_Silent_p.P205P|PAN3_ENST00000399613.1_Silent_p.P317P	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		ATGATCTGCCATATTGCCTTC	0.353																																						.											0													64.0	60.0	62.0					13																	28840991		2203	4300	6503	SO:0001819	synonymous_variant	255967			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.1551A>G	13.37:g.28840991A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000380958.3	37	CCDS9329.2																																																																																				0.353	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	
PSMC6	5706	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	53175080	53175080	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr14:53175080C>G	ENST00000606149.1	+	2	155	c.139C>G	c.(139-141)Ctg>Gtg	p.L47V	PSMC6_ENST00000445930.2_Missense_Mutation_p.L61V	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	47					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TGAAAATGATCTGAAGGCCCT	0.353																																						.											0													121.0	120.0	120.0					14																	53175080		2203	4300	6503	SO:0001583	missense	5706				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.139C>G	14.37:g.53175080C>G	ENSP00000475721:p.Leu47Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	ENST00000606149.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.78|15.78	2.934302|2.934302	0.52866|0.52866	.|.	.|.	ENSG00000100519|ENSG00000100519	ENST00000445930|ENST00000556813	D|.	0.94092|.	-3.35|.	5.17|5.17	2.33|2.33	0.28932|0.28932	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53802|0.53802	0.1819|0.1819	L|L	0.41906|0.41906	1.305|1.305	0.80722|0.80722	D|D	1|1	B|.	0.17852|.	0.024|.	B|.	0.22386|.	0.039|.	T|T	0.41431|0.41431	-0.9509|-0.9509	10|5	0.56958|.	D|.	0.05|.	.|.	10.8766|10.8766	0.46915|0.46915	0.0:0.791:0.0:0.209|0.0:0.791:0.0:0.209	.|.	47|.	P62333|.	PRS10_HUMAN|.	V|C	61|46	ENSP00000401802:L61V|.	ENSP00000401802:L61V|.	L|S	+|+	1|2	2|0	PSMC6|PSMC6	52244830|52244830	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	3.033000|3.033000	0.49743|0.49743	0.276000|0.276000	0.22118|0.22118	0.561000|0.561000	0.74099|0.74099	CTG|TCT		0.353	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1	NM_002806	
C1orf177	163747	hgsc.bcm.edu	37	1	55273584	55273584	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr1:55273584delC	ENST00000371273.3	+	4	395	c.380delC	c.(379-381)tccfs	p.S127fs	C1orf177_ENST00000358193.3_Frame_Shift_Del_p.S127fs	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	127										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						GGCCCCGGCTCCTACAACCTC	0.552																																						.											0													71.0	81.0	78.0					1																	55273584		2203	4300	6503	SO:0001589	frameshift_variant	163747			AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.380delC	1.37:g.55273584delC	ENSP00000360320:p.Ser127fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7WPL2|Q8N7Y9	Frame_Shift_Del	DEL	ENST00000371273.3	37	CCDS44153.1																																																																																				0.552	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027674.1	NM_152607	
NOB1	28987	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	16	69786144	69786144	+	Splice_Site	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr16:69786144C>T	ENST00000268802.5	-	3	356	c.327G>A	c.(325-327)aaG>aaA	p.K109K		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	109					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTTGATTTACCTTCTGTGGTT	0.453																																						.											0													167.0	160.0	162.0					16																	69786144		2198	4300	6498	SO:0001630	splice_region_variant	28987			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.327+1G>A	16.37:g.69786144C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Silent	SNP	ENST00000268802.5	37	CCDS10884.1																																																																																				0.453	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268958.2	NM_014062	Silent
CPNE7	27132	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	89650494	89650494	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr16:89650494G>A	ENST00000268720.5	+	6	846	c.716G>A	c.(715-717)aGg>aAg	p.R239K	CPNE7_ENST00000319518.8_Missense_Mutation_p.R164K	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	239	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		TTCCGGGCCAGGAAGCTGGAC	0.687																																						.											0													57.0	54.0	55.0					16																	89650494		2197	4300	6497	SO:0001583	missense	27132			AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.716G>A	16.37:g.89650494G>A	ENSP00000268720:p.Arg239Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000268720.5	37	CCDS10980.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332841	0.41297	.	.	ENSG00000178773	ENST00000319518;ENST00000268720	T;T	0.67345	-0.26;-0.26	3.85	-4.18	0.03846	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.886047	0.09884	N	0.743348	T	0.43144	0.1234	N	0.21508	0.67	0.30051	N	0.811796	B;B	0.14805	0.001;0.011	B;B	0.17979	0.003;0.02	T	0.29397	-1.0013	10	0.45353	T	0.12	2.4518	2.2349	0.04005	0.5547:0.1444:0.1562:0.1447	.	164;239	Q9UBL6-2;Q9UBL6	.;CPNE7_HUMAN	K	164;239	ENSP00000317374:R164K;ENSP00000268720:R239K	ENSP00000268720:R239K	R	+	2	0	CPNE7	88177995	1.000000	0.71417	0.974000	0.42286	0.882000	0.50991	1.392000	0.34486	-0.429000	0.07329	0.491000	0.48974	AGG		0.687	CPNE7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269929.2		
AKAP10	11216	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	19823386	19823386	+	Silent	SNP	T	T	C	rs1049591		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr17:19823386T>C	ENST00000225737.6	-	12	1954	c.1797A>G	c.(1795-1797)cgA>cgG	p.R599R	AKAP10_ENST00000395536.3_Silent_p.R541R	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	599					blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					GCTCAGATTCTCGGATGAATT	0.348																																						.											0													119.0	110.0	113.0					17																	19823386		2203	4300	6503	SO:0001819	synonymous_variant	11216			AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1797A>G	17.37:g.19823386T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R650|Q96AJ7	Silent	SNP	ENST00000225737.6	37	CCDS11214.1																																																																																				0.348	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
ZNF831	128611	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	20	57768140	57768140	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr20:57768140C>T	ENST00000371030.2	+	1	2066	c.2066C>T	c.(2065-2067)aCg>aTg	p.T689M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	689							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCAGGGGCAACGCCAGAGCCT	0.617																																						.											0													29.0	36.0	34.0					20																	57768140		2050	4184	6234	SO:0001583	missense	128611			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2066C>T	20.37:g.57768140C>T	ENSP00000360069:p.Thr689Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337178	0.24253	.	.	ENSG00000124203	ENST00000371030	T	0.04454	3.62	4.54	-9.07	0.00724	.	1.784740	0.02778	N	0.120580	T	0.01835	0.0058	N	0.08118	0	0.09310	N	1	D	0.53151	0.958	B	0.35182	0.197	T	0.44862	-0.9300	10	0.66056	D	0.02	-0.8026	4.1301	0.10146	0.304:0.1204:0.4648:0.1108	.	689	Q5JPB2	ZN831_HUMAN	M	689	ENSP00000360069:T689M	ENSP00000360069:T689M	T	+	2	0	ZNF831	57201535	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.345000	0.02637	-2.321000	0.00641	-0.902000	0.02854	ACG		0.617	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
POTEF	728378	hgsc.bcm.edu;mdanderson.org	37	2	130832597	130832597	+	Silent	SNP	G	G	A	rs562326654		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr2:130832597G>A	ENST00000409914.2	-	17	2847	c.2448C>T	c.(2446-2448)cgC>cgT	p.R816R	POTEF_ENST00000357462.5_Silent_p.R816R	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	816	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						TCATCTTCTCGCGGTTGGCCT	0.592													.|||	1	0.000199681	0.0	0.0	5008	,	,		20870	0.001		0.0	False		,,,				2504	0.0					.											0													117.0	129.0	125.0					2																	130832597		2203	4300	6503	SO:0001819	synonymous_variant	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2448C>T	2.37:g.130832597G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1																																																																																				0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
GRIK1	2897	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	21	30963507	30963507	+	Silent	SNP	C	C	T	rs144528849		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr21:30963507C>T	ENST00000399907.1	-	10	1701	c.1290G>A	c.(1288-1290)acG>acA	p.T430T	GRIK1_ENST00000327783.4_Silent_p.T430T|GRIK1_ENST00000399913.1_Silent_p.T430T|GRIK1_ENST00000535441.1_Silent_p.T432T|GRIK1_ENST00000399914.1_Silent_p.T415T|GRIK1_ENST00000399909.1_Silent_p.T415T|GRIK1_ENST00000389124.2_Silent_p.T430T|GRIK1_ENST00000309434.7_Silent_p.T432T|GRIK1_ENST00000389125.3_Silent_p.T415T	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	430					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.T430T(1)|p.T415T(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TGTTGCTGTCCGTCATGTTAA	0.448																																						.											2	Substitution - coding silent(2)	large_intestine(2)						C	,	2,4404	4.2+/-10.8	0,2,2201	397.0	313.0	341.0		1290,1245	-10.1	0.1	21	dbSNP_134	341	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GRIK1	NM_000830.3,NM_175611.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	430/919,415/906	30963507	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	2897				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1290G>A	21.37:g.30963507C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q13001|Q86SU9	Silent	SNP	ENST00000399907.1	37	CCDS42913.1																																																																																				0.448	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
SCN2A	6326	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	166211041	166211041	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr2:166211041G>A	ENST00000375437.2	+	17	3549	c.3259G>A	c.(3259-3261)Gtg>Atg	p.V1087M	SCN2A_ENST00000375427.2_Missense_Mutation_p.V1087M|SCN2A_ENST00000283256.6_Missense_Mutation_p.V1087M|SCN2A_ENST00000357398.3_Missense_Mutation_p.V1087M	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1087					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAAATATGTCGTGGATGAAAG	0.378																																						.											0													112.0	110.0	110.0					2																	166211041		2203	4300	6503	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3259G>A	2.37:g.166211041G>A	ENSP00000364586:p.Val1087Met	Somatic		WXS	Illumina HiSeq	Phase_I	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	7.286	0.610124	0.14066	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	5.26	4.26	0.50523	Sodium ion transport-associated (1);	0.221616	0.30979	N	0.008492	T	0.61874	0.2382	N	0.02765	-0.5	0.35063	D	0.761745	B;B	0.14012	0.009;0.008	B;B	0.19391	0.012;0.025	T	0.64188	-0.6466	10	0.25751	T	0.34	.	10.2776	0.43519	0.1701:0.0:0.8299:0.0	.	1087;1087	Q99250-2;Q99250	.;SCN2A_HUMAN	M	1087	ENSP00000364586:V1087M;ENSP00000349973:V1087M;ENSP00000283256:V1087M;ENSP00000364576:V1087M	ENSP00000283256:V1087M	V	+	1	0	SCN2A	165919287	0.995000	0.38212	0.987000	0.45799	0.994000	0.84299	2.576000	0.46033	2.447000	0.82792	0.591000	0.81541	GTG		0.378	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
FGG	2266	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	155529663	155529663	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr4:155529663G>A	ENST00000336098.3	-	7	844	c.806C>T	c.(805-807)cCa>cTa	p.P269L	FGG_ENST00000405164.1_Missense_Mutation_p.P277L|FGG_ENST00000407946.1_Missense_Mutation_p.P277L|FGG_ENST00000404648.3_Missense_Mutation_p.P269L	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	269	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TAATGCATATGGGATGGCAGA	0.403																																						.											0													93.0	84.0	87.0					4																	155529663		2203	4300	6503	SO:0001583	missense	2266				CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.806C>T	4.37:g.155529663G>A	ENSP00000336829:p.Pro269Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	ENST00000336098.3	37	CCDS3788.1	.	.	.	.	.	.	.	.	.	.	G	33	5.268247	0.95429	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946	D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33	6.17	6.17	0.99709	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.98513	0.9504	M	0.78344	2.41	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0	D	0.98818	1.0746	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	166;277;269;277;269	D3DP16;C9JC84;P02679;C9JEU5;P02679-2	.;.;FIBG_HUMAN;.;.	L	269;277;269;277	ENSP00000384860:P269L;ENSP00000384101:P277L;ENSP00000336829:P269L;ENSP00000384552:P277L	ENSP00000336829:P269L	P	-	2	0	FGG	155749113	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	9.199000	0.95003	2.941000	0.99782	0.655000	0.94253	CCA		0.403	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870	
GJA1	2697	hgsc.bcm.edu	37	6	121768925	121768925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:121768925delC	ENST00000282561.3	+	2	1089	c.932delC	c.(931-933)gctfs	p.A311fs		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	311					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	CAAAACTGGGCTAATTACAGT	0.478																																						.											0			GRCh37	CD073645	GJA1	D							72.0	73.0	73.0					6																	121768925		2203	4300	6503	SO:0001589	frameshift_variant	2697			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.932delC	6.37:g.121768925delC	ENSP00000282561:p.Ala311fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5U9|Q6FHU1|Q9Y5I8	Frame_Shift_Del	DEL	ENST00000282561.3	37	CCDS5123.1																																																																																				0.478	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
TNXB	7148	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	32052298	32052298	+	Missense_Mutation	SNP	G	G	A	rs367775946		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:32052298G>A	ENST00000375244.3	-	8	3538	c.3337C>T	c.(3337-3339)Cgc>Tgc	p.R1113C	TNXB_ENST00000375247.2_Missense_Mutation_p.R1113C			P22105	TENX_HUMAN	tenascin XB	1200	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						ACGGCCGAGCGCTGGGGTCCT	0.617																																						.											0								G	CYS/ARG	0,2602		0,0,1301	42.0	46.0	45.0		3337	4.2	1.0	6		45	1,5097		0,1,2548	no	missense	TNXB	NM_019105.6	180	0,1,3849	AA,AG,GG		0.0196,0.0,0.013	probably-damaging	1113/4243	32052298	1,7699	1301	2549	3850	SO:0001583	missense	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3337C>T	6.37:g.32052298G>A	ENSP00000364393:p.Arg1113Cys	Somatic		WXS	Illumina HiSeq	Phase_I	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	18.00	3.524889	0.64747	0.0	1.96E-4	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.55052	0.54;0.54	4.23	4.23	0.50019	.	0.157128	0.30383	N	0.009750	T	0.73032	0.3535	M	0.91038	3.17	0.47037	D	0.99929	D	0.89917	1.0	D	0.74348	0.983	T	0.80339	-0.1424	10	0.66056	D	0.02	.	15.5671	0.76303	0.0:0.0:1.0:0.0	.	1113	P22105-3	.	C	1113	ENSP00000364393:R1113C;ENSP00000364396:R1113C	ENSP00000364393:R1113C	R	-	1	0	TNXB	32160276	1.000000	0.71417	0.995000	0.50966	0.591000	0.36615	6.136000	0.71703	2.200000	0.70718	0.655000	0.94253	CGC		0.617	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
CDKN1A	1026	broad.mit.edu;hgsc.bcm.edu	37	6	36652011	36652012	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:36652011_36652012insC	ENST00000405375.1	+	2	368_369	c.133_134insC	c.(133-135)gccfs	p.A45fs	CDKN1A_ENST00000448526.2_Frame_Shift_Ins_p.A79fs|CDKN1A_ENST00000244741.5_Frame_Shift_Ins_p.A45fs|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000373711.2_Frame_Shift_Ins_p.A45fs	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	45					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CATCCAGGAGGCCCGTGAGCGA	0.658																																						.											0																																										SO:0001589	frameshift_variant	1026			U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.136dupC	6.37:g.36652014_36652014dupC	ENSP00000384849:p.Ala45fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14010|Q6FI05|Q9BUT4	Frame_Shift_Ins	INS	ENST00000405375.1	37	CCDS4824.1																																																																																				0.658	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	
PTPRZ1	5803	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	121699937	121699937	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:121699937G>T	ENST00000393386.2	+	29	7213	c.6802G>T	c.(6802-6804)Gac>Tac	p.D2268Y	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.D1401Y	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2268	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AGTCTTTGCTGACATTGTAAG	0.393																																						.											0													99.0	90.0	93.0					7																	121699937		2203	4300	6503	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6802G>T	7.37:g.121699937G>T	ENSP00000377047:p.Asp2268Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076232	0.76415	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.11495	2.77;2.77	6.07	6.07	0.98685	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.36744	0.0978	M	0.71581	2.175	0.52099	D	0.999941	P;D;D	0.89917	0.937;0.994;1.0	P;D;D	0.87578	0.628;0.953;0.998	T	0.01405	-1.1363	10	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1407;1401;2268	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	Y	2268;1401	ENSP00000377047:D2268Y;ENSP00000410000:D1401Y	ENSP00000377047:D2268Y	D	+	1	0	PTPRZ1	121487173	1.000000	0.71417	0.993000	0.49108	0.956000	0.61745	4.146000	0.58072	2.885000	0.99019	0.655000	0.94253	GAC		0.393	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
SLC29A4	222962	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	7	5342510	5342510	+	Silent	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:5342510C>T	ENST00000396872.3	+	11	1694	c.1533C>T	c.(1531-1533)gaC>gaT	p.D511D	SLC29A4_ENST00000297195.4_Silent_p.D511D|SLC29A4_ENST00000406453.3_Silent_p.D497D|SLC29A4_ENST00000439491.2_Intron			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	511					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	TCACCCGCGACGCTCACGGCA	0.682																																						.											0													33.0	26.0	28.0					7																	5342510		2198	4293	6491	SO:0001819	synonymous_variant	222962			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.1533C>T	7.37:g.5342510C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	ENST00000396872.3	37	CCDS5340.1																																																																																				0.682	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	NM_153247	
ABCF2	10061	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	150921103	150921103	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:150921103G>T	ENST00000287844.2	-	4	574	c.465C>A	c.(463-465)gaC>gaA	p.D155E	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Missense_Mutation_p.D155E	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	155	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGGGTGTCTTGTCACTAGGGG	0.562																																						.											0													122.0	103.0	109.0					7																	150921103		2203	4300	6503	SO:0001583	missense	10061			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.465C>A	7.37:g.150921103G>T	ENSP00000287844:p.Asp155Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	ENST00000287844.2	37	CCDS5923.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833471	0.32421	.	.	ENSG00000033050	ENST00000222388;ENST00000287844;ENST00000468073;ENST00000441774	D;D;T;T	0.91996	-2.9;-2.95;3.92;3.92	5.81	-1.61	0.08399	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.220386	0.53938	N	0.000048	T	0.81489	0.4833	L	0.32530	0.975	0.38767	D	0.954457	B;B	0.06786	0.001;0.001	B;B	0.16289	0.008;0.015	T	0.62728	-0.6793	10	0.25751	T	0.34	-3.7129	1.7619	0.02994	0.24:0.1044:0.4416:0.214	.	155;155	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	E	155	ENSP00000222388:D155E;ENSP00000287844:D155E;ENSP00000419720:D155E;ENSP00000395785:D155E	ENSP00000222388:D155E	D	-	3	2	ABCF2	150552036	0.781000	0.28676	0.995000	0.50966	0.993000	0.82548	-0.353000	0.07691	-0.121000	0.11787	0.655000	0.94253	GAC		0.562	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336086.1	NM_005692	
RP1L1	94137	hgsc.bcm.edu;ucsc.edu	37	8	10467237	10467237	+	Silent	SNP	G	G	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr8:10467237G>T	ENST00000382483.3	-	4	4594	c.4371C>A	c.(4369-4371)ctC>ctA	p.L1457L		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1537					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCGTCTCGCTGAGATGACTAG	0.632																																						.											0													76.0	85.0	82.0					8																	10467237		1999	4191	6190	SO:0001819	synonymous_variant	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4371C>A	8.37:g.10467237G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																				0.632	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
HS6ST2	90161	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	132091342	132091342	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:132091342C>A	ENST00000370836.2	-	3	856	c.441G>T	c.(439-441)atG>atT	p.M147I	HS6ST2_ENST00000521489.1_Missense_Mutation_p.M147I|HS6ST2_ENST00000370833.2_Start_Codon_SNP_p.M1I	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	147					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					ATTTCTCATCCATGTTCCCGA	0.617																																						.											0													40.0	41.0	41.0					X																	132091342		2044	4167	6211	SO:0001583	missense	90161			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.441G>T	X.37:g.132091342C>A	ENSP00000359873:p.Met147Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	ENST00000370836.2	37	CCDS48169.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781470	0.49891	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000370833	T;T;T;T	0.79749	-1.2;-0.83;-0.98;-1.3	5.48	4.56	0.56223	.	0.466802	0.24211	N	0.040537	T	0.68210	0.2976	N	0.08118	0	0.80722	D	1	D;D	0.59357	0.985;0.985	P;P	0.47251	0.542;0.542	T	0.74791	-0.3545	10	0.87932	D	0	-13.3626	11.6659	0.51372	0.1775:0.8225:0.0:0.0	.	147;147	Q96MM7;E9PDY5	H6ST2_HUMAN;.	I	1;147;147;1	ENSP00000359874:M1I;ENSP00000359873:M147I;ENSP00000429473:M147I;ENSP00000359870:M1I	ENSP00000359870:M1I	M	-	3	0	HS6ST2	131919024	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.358000	0.66064	2.292000	0.77174	0.529000	0.55759	ATG		0.617	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058332.3	NM_147174	
MAGEA10	4109	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	151303811	151303811	+	Silent	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:151303811G>A	ENST00000370323.4	-	4	598	c.282C>T	c.(280-282)ccC>ccT	p.P94P	MAGEA10_ENST00000244096.3_Silent_p.P94P|RP11-1007I13.4_ENST00000509345.2_RNA	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	94						nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CAACGACCGAGGGGGAGGAGC	0.547																																						.											0													172.0	174.0	174.0					X																	151303811		2203	4300	6503	SO:0001819	synonymous_variant	4109				CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.282C>T	X.37:g.151303811G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000370323.4	37	CCDS14705.1																																																																																				0.547	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048	
ZNF185	7739	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	152091354	152091354	+	Splice_Site	SNP	G	G	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:152091354G>T	ENST00000370268.4	+	11	864		c.e11+1		ZNF185_ENST00000370270.2_Splice_Site|ZNF185_ENST00000539731.1_Splice_Site|ZNF185_ENST00000318529.8_Intron|ZNF185_ENST00000324823.6_Intron|ZNF185_ENST00000318504.7_Intron|ZNF185_ENST00000535861.1_Splice_Site|ZNF185_ENST00000449285.2_Splice_Site			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGAGCTCAGGTGGGTGCCGA	0.637																																						.											0													26.0	28.0	28.0					X																	152091354		2165	4249	6414	SO:0001630	splice_region_variant	7739			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.827+1G>T	X.37:g.152091354G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Splice_Site	SNP	ENST00000370268.4	37	CCDS48184.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.394119	0.42410	.	.	ENSG00000147394	ENST00000535861;ENST00000539731;ENST00000449285;ENST00000433245;ENST00000370268;ENST00000447088;ENST00000447792	.	.	.	3.57	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7633	0.40545	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF185	151842010	1.000000	0.71417	0.819000	0.32651	0.323000	0.28346	3.518000	0.53451	2.051000	0.60960	0.436000	0.28706	.		0.637	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	Intron
PDXDC1	23042	hgsc.bcm.edu	37	16	15122751	15122751	+	Silent	SNP	C	C	T	rs117411702		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr16:15122751C>T	ENST00000396410.4	+	15	1318	c.1221C>T	c.(1219-1221)gcC>gcT	p.A407A	PDXDC1_ENST00000450288.2_Silent_p.A379A|PDXDC1_ENST00000447912.2_Silent_p.A316A|PDXDC1_ENST00000569715.1_Silent_p.A380A|PDXDC1_ENST00000455313.2_Silent_p.A384A|PDXDC1_ENST00000563679.1_Silent_p.A425A|PDXDC1_ENST00000325823.7_Silent_p.A392A|PDXDC1_ENST00000535621.2_Silent_p.A407A	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	407					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.A407A(2)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTTTAAAGCCGTCCCAGTGC	0.552																																						.											2	Substitution - coding silent(2)	prostate(1)|skin(1)											95.0	85.0	88.0					16																	15122751		2197	4300	6497	SO:0001819	synonymous_variant	23042			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1221C>T	16.37:g.15122751C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	CCDS32393.1																																																																																				0.552	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
SETD1A	9739	hgsc.bcm.edu;ucsc.edu	37	16	30991933	30991933	+	Silent	SNP	C	C	T	rs56788559	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr16:30991933C>T	ENST00000262519.8	+	15	5222	c.4536C>T	c.(4534-4536)gaC>gaT	p.D1512D		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1512	Interaction with ASH2L, RBBP5 and WDR5.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						AGTACCTGGACGTGTGCCCAG	0.682													C|||	85	0.0169728	0.0582	0.0101	5008	,	,		12515	0.0		0.001	False		,,,				2504	0.0					.											0								C		209,4185	127.0+/-164.0	6,197,1994	68.0	54.0	59.0		4536	-1.8	1.0	16	dbSNP_129	59	13,8587	8.4+/-32.0	0,13,4287	no	coding-synonymous	SETD1A	NM_014712.1		6,210,6281	TT,TC,CC		0.1512,4.7565,1.7085		1512/1708	30991933	222,12772	2197	4300	6497	SO:0001819	synonymous_variant	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4536C>T	16.37:g.30991933C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	37	CCDS32435.1																																																																																				0.682	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
BCLAF1	9774	hgsc.bcm.edu	37	6	136596668	136596668	+	Splice_Site	SNP	A	A	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:136596668A>C	ENST00000531224.1	-	6	2105		c.e6+1		BCLAF1_ENST00000530767.1_Splice_Site|BCLAF1_ENST00000353331.4_Splice_Site|BCLAF1_ENST00000392348.2_Splice_Site|BCLAF1_ENST00000527759.1_Splice_Site|BCLAF1_ENST00000527536.1_Splice_Site	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1						apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TACTAAGCATACCTTTAACAT	0.358																																					Colon(142;1534 1789 5427 7063 28491)	.											0													146.0	131.0	136.0					6																	136596668		2203	4300	6503	SO:0001630	splice_region_variant	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1852+1T>G	6.37:g.136596668A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Splice_Site	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813243	0.50527	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6834	0.62502	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BCLAF1	136638361	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.987000	0.88182	2.149000	0.67028	0.377000	0.23210	.		0.358	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	Intron
MUC2	4583	broad.mit.edu	37	11	1092920	1092920	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr11:1092920C>A	ENST00000441003.2	+	30	4766	c.4739C>A	c.(4738-4740)aCc>aAc	p.T1580N	MUC2_ENST00000359061.5_Missense_Mutation_p.T1581N|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ggcacacagaccccaacatcg	0.632																																						.											0													74.0	113.0	100.0					11																	1092920		1924	3573	5497	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4739C>A	11.37:g.1092920C>A	ENSP00000415183:p.Thr1580Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228278	0.06022	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.38;2.53	1.75	-3.51	0.04696	.	7739.210000	0.00597	U	0.000365	T	0.08492	0.0211	.	.	.	0.09310	N	1	B	0.28026	0.198	B	0.17098	0.017	T	0.10776	-1.0615	9	0.27082	T	0.32	.	2.0197	0.03506	0.1703:0.3607:0.3305:0.1386	.	1580	E7EUV1	.	N	1580;1581	ENSP00000415183:T1580N;ENSP00000351956:T1581N	ENSP00000351956:T1581N	T	+	2	0	MUC2	1082920	0.001000	0.12720	0.000000	0.03702	0.071000	0.16799	1.304000	0.33482	-1.223000	0.02584	0.121000	0.15741	ACC		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
LOC646214	646214	broad.mit.edu	37	15	21937915	21937915	+	IGR	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr15:21937915C>T								RP11-854K16.3 (602491 upstream) : RP11-32B5.7 (3231 downstream)																							AATTTCTGGCCGTTCCTTTTC	0.438																																						.											0																																										SO:0001628	intergenic_variant	0																															15.37:g.21937915C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.438								
WASH3P	374666	broad.mit.edu	37	15	102516466	102516466	+	RNA	SNP	C	C	G	rs373564005		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr15:102516466C>G	ENST00000557932.1	+	0	1414				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.S463S(2)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						ACTGGGAATCCTAGGGGGCTC	0.642																																						.											2	Substitution - coding silent(2)	endometrium(2)																																										374666					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516466C>G		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000557932.1	37																																																																																					0.642	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163	
TNRC6A	27327	broad.mit.edu	37	16	24817998	24817998	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr16:24817998T>C	ENST00000395799.3	+	17	4562	c.4433T>C	c.(4432-4434)cTc>cCc	p.L1478P	TNRC6A_ENST00000432286.2_5'Flank|TNRC6A_ENST00000315183.7_Missense_Mutation_p.L1429P|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1478					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CAGCAGCCACTCCATCAGCCA	0.493																																						.											0													133.0	113.0	120.0					16																	24817998		2197	4300	6497	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4433T>C	16.37:g.24817998T>C	ENSP00000379144:p.Leu1478Pro	Somatic		WXS	Illumina HiSeq	Phase_I	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	T	19.35	3.810610	0.70797	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.14022	2.57;2.54	6.06	6.06	0.98353	.	0.162970	0.43579	D	0.000553	T	0.35799	0.0944	M	0.68317	2.08	0.80722	D	1	B;D;B;D	0.89917	0.012;1.0;0.009;1.0	B;D;B;D	0.74023	0.016;0.982;0.02;0.963	T	0.01982	-1.1235	10	0.32370	T	0.25	-3.8091	16.6154	0.84909	0.0:0.0:0.0:1.0	.	145;617;1429;1478	B3KSX2;C9JA83;Q8NDV7-6;Q8NDV7	.;.;.;TNR6A_HUMAN	P	1429;1478	ENSP00000326900:L1429P;ENSP00000379144:L1478P	ENSP00000326900:L1429P	L	+	2	0	TNRC6A	24725499	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.239000	0.43079	2.315000	0.78130	0.533000	0.62120	CTC		0.493	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
CD33	945	broad.mit.edu	37	19	51738423	51738423	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr19:51738423A>G	ENST00000262262.4	+	5	778	c.757A>G	c.(757-759)Acc>Gcc	p.T253A	CD33_ENST00000421133.2_Missense_Mutation_p.T126A|CD33_ENST00000436584.2_Missense_Mutation_p.T126A|CD33_ENST00000391796.3_Missense_Mutation_p.T253A	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	253					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	GAAACAAGAGACCAGAGCAGG	0.478																																						.											0													115.0	101.0	106.0					19																	51738423		2203	4300	6503	SO:0001583	missense	945			M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.757A>G	19.37:g.51738423A>G	ENSP00000262262:p.Thr253Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	ENST00000262262.4	37	CCDS33084.1	.	.	.	.	.	.	.	.	.	.	.	0.579	-0.837998	0.02692	.	.	ENSG00000105383	ENST00000436584;ENST00000262262;ENST00000421133;ENST00000391796	T;T;T;T	0.36699	1.24;3.53;3.53;2.3	3.94	-2.66	0.06077	.	.	.	.	.	T	0.23806	0.0576	L	0.54323	1.7	0.09310	N	1	B;B;B	0.17667	0.006;0.023;0.022	B;B;B	0.12837	0.002;0.007;0.008	T	0.31888	-0.9927	9	0.20519	T	0.43	.	0.8704	0.01213	0.3285:0.3269:0.1846:0.16	.	126;253;253	C9JEN7;F8WAL2;P20138	.;.;CD33_HUMAN	A	126;253;126;253	ENSP00000403331:T126A;ENSP00000262262:T253A;ENSP00000410126:T126A;ENSP00000375673:T253A	ENSP00000262262:T253A	T	+	1	0	CD33	56430235	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.492000	0.00973	-0.322000	0.08615	-0.496000	0.04628	ACC		0.478	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	NM_001772	
IGLON5	402665	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	51828628	51828628	+	Silent	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr19:51828628G>A	ENST00000270642.8	+	4	420	c.420G>A	c.(418-420)tcG>tcA	p.S140S		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	140	Ig-like C2-type 2.					extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						ACATCTCGTCGCCTGTGACGG	0.647																																						.											0													36.0	40.0	39.0					19																	51828628		2099	4214	6313	SO:0001819	synonymous_variant	402665				CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.420G>A	19.37:g.51828628G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000270642.8	37	CCDS46158.1																																																																																				0.647	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372	
NCOA3	8202	broad.mit.edu;bcgsc.ca	37	20	46266522	46266522	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr20:46266522C>A	ENST00000371998.3	+	13	2698	c.2507C>A	c.(2506-2508)tCt>tAt	p.S836Y	NCOA3_ENST00000371997.3_Missense_Mutation_p.S846Y|NCOA3_ENST00000372004.3_Missense_Mutation_p.S836Y|NCOA3_ENST00000341724.6_Missense_Mutation_p.S846Y			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	836					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GGAACTAATTCTCTGGGTAAG	0.358																																						.											0													148.0	146.0	147.0					20																	46266522		2203	4300	6503	SO:0001583	missense	8202			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.2507C>A	20.37:g.46266522C>A	ENSP00000361066:p.Ser836Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289393	0.40494	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02345	4.36;4.49;4.48;4.33	5.38	5.38	0.77491	.	0.328975	0.30383	N	0.009756	T	0.06826	0.0174	L	0.59436	1.845	0.40523	D	0.98085	P;P;B;P;P;P	0.50272	0.823;0.933;0.437;0.823;0.573;0.732	B;P;B;B;B;B	0.44477	0.321;0.451;0.223;0.321;0.397;0.321	T	0.11470	-1.0586	10	0.56958	D	0.05	-11.602	19.0809	0.93180	0.0:1.0:0.0:0.0	.	836;846;840;836;836;836	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	Y	836;846;836;836;846	ENSP00000342123:S846Y;ENSP00000361073:S836Y;ENSP00000361066:S836Y;ENSP00000361065:S846Y	ENSP00000345671:S836Y	S	+	2	0	NCOA3	45699929	0.310000	0.24527	0.995000	0.50966	0.367000	0.29736	2.668000	0.46816	2.680000	0.91292	0.655000	0.94253	TCT		0.358	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
LMBRD2	92255	broad.mit.edu	37	5	36123063	36123063	+	Splice_Site	DEL	A	A	-			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr5:36123063delA	ENST00000296603.4	-	8	1285	c.823delT	c.(823-825)tgc>gc	p.C275fs		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	275						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCTGTAGGGCACtaaaaaaaa	0.249																																						.											0													40.0	43.0	42.0					5																	36123063		2200	4285	6485	SO:0001630	splice_region_variant	92255				CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.823-1T>-	5.37:g.36123063delA		Somatic		WXS	Illumina HiSeq	Phase_I	B3KRB6|Q9NTC7	Frame_Shift_Del	DEL	ENST00000296603.4	37	CCDS34145.1																																																																																				0.249	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367552.1	NM_001007527	Frame_Shift_Del
SLC30A5	64924	broad.mit.edu	37	5	68390134	68390134	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr5:68390134delG	ENST00000396591.3	+	1	662	c.52delG	c.(52-54)ggcfs	p.G18fs	SLC30A5_ENST00000502979.1_Frame_Shift_Del_p.G18fs|SLC30A5_ENST00000380860.4_Frame_Shift_Del_p.G18fs	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	18	Poly-Gly.				cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		cggcggcggcggccTTGGGCC	0.741																																						.											0													2.0	4.0	3.0					5																	68390134		1267	2522	3789	SO:0001589	frameshift_variant	64924			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.52delG	5.37:g.68390134delG	ENSP00000379836:p.Gly18fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Frame_Shift_Del	DEL	ENST00000396591.3	37	CCDS3996.1																																																																																				0.741	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2		
SOWAHA	134548	broad.mit.edu	37	5	132150835	132150835	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr5:132150835G>A	ENST00000378693.2	+	1	1803	c.1522G>A	c.(1522-1524)Gcc>Acc	p.A508T	AC004775.5_ENST00000607389.1_lincRNA	NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	508																	GTTCTTGAGCGCCTCGCCCAT	0.582																																						.											0													44.0	49.0	48.0					5																	132150835		2203	4300	6503	SO:0001583	missense	134548			AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.1522G>A	5.37:g.132150835G>A	ENSP00000367965:p.Ala508Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116714	0.56505	.	.	ENSG00000198944	ENST00000378693	T	0.21932	1.98	6.15	4.3	0.51218	.	0.395022	0.20050	N	0.100303	T	0.14313	0.0346	L	0.46157	1.445	0.33529	D	0.593311	P	0.42456	0.78	B	0.27887	0.084	T	0.16837	-1.0389	10	0.30854	T	0.27	-23.571	11.5851	0.50914	0.0677:0.126:0.8062:0.0	.	508	Q2M3V2	ANR43_HUMAN	T	508	ENSP00000367965:A508T	ENSP00000367965:A508T	A	+	1	0	ANKRD43	132178734	0.972000	0.33761	0.998000	0.56505	0.496000	0.33645	1.574000	0.36482	2.932000	0.99384	0.643000	0.83706	GCC		0.582	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
DHX16	8449	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	30623374	30623374	+	Splice_Site	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:30623374C>T	ENST00000376442.3	-	17	2694	c.2499G>A	c.(2497-2499)aaG>aaA	p.K833K	DHX16_ENST00000376437.5_Splice_Site_p.K352K	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	833					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						AACAGCTGTACCTGGGACAGG	0.498																																						.											0													65.0	62.0	63.0					6																	30623374		1510	2709	4219	SO:0001630	splice_region_variant	8449			AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2499-1G>A	6.37:g.30623374C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																				0.498	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	Silent
C4A	720	broad.mit.edu	37	6	31963559	31963559	+	Missense_Mutation	SNP	A	A	G	rs147162052		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:31963559A>G	ENST00000428956.2	+	25	3302	c.3218A>G	c.(3217-3219)gAc>gGc	p.D1073G	C4A_ENST00000498271.1_Missense_Mutation_p.D1073G	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1073			D -> G (in allotype C4A1, allotype C4A2; dbSNP:rs147162052). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:3696167, ECO:0000269|Ref.8}.		complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	TTGTCACGGGACAGCAGCACC	0.612																																						.											0													101.0	86.0	91.0					6																	31963559		1499	2656	4155	SO:0001583	missense	720			L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3218A>G	6.37:g.31963559A>G	ENSP00000396688:p.Asp1073Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Silent	SNP	ENST00000428956.2	37	CCDS47404.1	.	.	.	.	.	.	.	.	.	.	A	1.712	-0.498842	0.04291	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.37915	1.17;1.17	3.11	1.88	0.25563	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.	.	.	.	T	0.16642	0.0400	M	0.64170	1.965	0.80722	D	1	B;B	0.19200	0.015;0.034	B;B	0.23150	0.026;0.044	T	0.04885	-1.0920	9	0.46703	T	0.11	.	5.4739	0.16686	0.8606:0.0:0.1394:0.0	.	1073;1073	A6H8M8;P0C0L4	.;CO4A_HUMAN	G	1073	ENSP00000396688:D1073G;ENSP00000420212:D1073G	ENSP00000396688:D1073G	D	+	2	0	C4A	32071538	0.168000	0.22989	0.910000	0.35882	0.043000	0.13939	0.471000	0.22100	0.399000	0.25367	-1.226000	0.01582	GAC		0.612	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293	
AP5Z1	9907	broad.mit.edu	37	7	4830447	4830447	+	Silent	SNP	C	C	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:4830447C>A	ENST00000348624.4	+	16	2176	c.2082C>A	c.(2080-2082)ccC>ccA	p.P694P	AP5Z1_ENST00000490487.1_3'UTR|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	694					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CCAGGTGTCCCCCCCAGGTGG	0.642																																						.											0													31.0	35.0	34.0					7																	4830447		2027	4172	6199	SO:0001819	synonymous_variant	9907			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.2082C>A	7.37:g.4830447C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N3X2|Q96H80	Silent	SNP	ENST00000348624.4	37	CCDS47528.1																																																																																				0.642	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
GRM3	2913	broad.mit.edu;mdanderson.org;bcgsc.ca	37	7	86479790	86479790	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:86479790G>T	ENST00000361669.2	+	5	3595	c.2496G>T	c.(2494-2496)aaG>aaT	p.K832N	GRM3_ENST00000536043.1_Missense_Mutation_p.K704N|GRM3_ENST00000394720.2_Nonsense_Mutation_p.E475*|GRM3_ENST00000546348.1_Missense_Mutation_p.K424N|GRM3_ENST00000439827.1_Nonsense_Mutation_p.E477*	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	832					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AACCCCAGAAGAATGTTGTCA	0.488																																					GBM(52;969 1098 3139 52280)	.											0													200.0	152.0	168.0					7																	86479790		2203	4300	6503	SO:0001583	missense	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2496G>T	7.37:g.86479790G>T	ENSP00000355316:p.Lys832Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.249934|7.249934	0.98164|0.98164	.|.	.|.	ENSG00000198822|ENSG00000198822	ENST00000439827;ENST00000394720|ENST00000361669;ENST00000546348;ENST00000536043	.|D;D;D	.|0.89485	.|-2.52;-2.41;-2.29	6.08|6.08	5.2|5.2	0.72013|0.72013	.|GPCR, family 3, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.90277	.|0.6959	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	A|A	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;0.999	.|D;D;D	.|0.79108	.|0.989;0.992;0.982	.|D	.|0.92864	.|0.6308	.|9	0.05721|0.72032	T|D	0.95|0.01	.|.	10.395|10.395	0.44196|0.44196	0.1466:0.0:0.8534:0.0|0.1466:0.0:0.8534:0.0	.|.	.|424;704;832	.|B7Z204;F5GYZ2;Q14832	.|.;.;GRM3_HUMAN	X|N	477;475|832;424;704	.|ENSP00000355316:K832N;ENSP00000444064:K424N;ENSP00000441407:K704N	ENSP00000378209:E475X|ENSP00000355316:K832N	E|K	+|+	1|3	0|2	GRM3|GRM3	86317726|86317726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	5.834000|5.834000	0.69361|0.69361	1.590000|1.590000	0.49995|0.49995	0.655000|0.655000	0.94253|0.94253	GAA|AAG		0.488	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
PON3	5446	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	95024006	95024006	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:95024006C>T	ENST00000265627.5	-	2	105	c.95G>A	c.(94-96)cGa>cAa	p.R32Q	PON3_ENST00000475439.1_5'UTR|PON3_ENST00000451904.1_Missense_Mutation_p.R32Q|PON3_ENST00000427422.1_Missense_Mutation_p.R32Q|PON1_ENST00000542556.1_Missense_Mutation_p.R32Q	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	32				R -> Q (in Ref. 8; AAC41996). {ECO:0000305}.	aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	CTCCACTTCTCGAGAGGCATT	0.443																																						.											0													148.0	119.0	129.0					7																	95024006		2203	4300	6503	SO:0001583	missense	5446			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.95G>A	7.37:g.95024006C>T	ENSP00000265627:p.Arg32Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	ENST00000265627.5	37	CCDS5639.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560643	0.45590	.	.	ENSG00000005421;ENSG00000105852;ENSG00000105852	ENST00000542556;ENST00000265627;ENST00000427422	T;T;T	0.42513	0.97;0.97;0.97	4.75	1.89	0.25635	Six-bladed beta-propeller, TolB-like (1);	0.194041	0.42682	D	0.000671	T	0.33206	0.0855	M	0.70108	2.13	0.23198	N	0.998135	B;D;P	0.56968	0.287;0.978;0.625	B;B;B	0.38562	0.016;0.276;0.034	T	0.38373	-0.9664	10	0.56958	D	0.05	-5.999	3.9929	0.09545	0.1878:0.6158:0.0:0.1963	.	32;32;32	B4E2I0;F5H4W9;Q15166	.;.;PON3_HUMAN	Q	32	ENSP00000444854:R32Q;ENSP00000265627:R32Q;ENSP00000413276:R32Q	ENSP00000444854:R32Q	R	-	2	0	PON1;PON3	94861942	0.004000	0.15560	0.809000	0.32408	0.023000	0.10783	0.491000	0.22419	0.706000	0.31912	-0.188000	0.12872	CGA		0.443	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333007.1	NM_000940	
STRA8	346673	broad.mit.edu	37	7	134925328	134925328	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:134925328C>A	ENST00000275764.3	+	2	118	c.118C>A	c.(118-120)Ctg>Atg	p.L40M		NM_182489.1	NP_872295.1			stimulated by retinoic acid 8									p.L40M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(1)	16						AACACCCCAGCTGCCAGCACA	0.537																																						.											1	Substitution - Missense(1)	endometrium(1)											49.0	56.0	53.0					7																	134925328		2203	4300	6503	SO:0001583	missense	346673			AF513502	CCDS5839.1	7q33	2012-12-07	2012-12-07		ENSG00000146857	ENSG00000146857			30653	protein-coding gene	gene with protein product		609987	"""stimulated by retinoic acid gene 8 homolog (mouse)"", ""stimulated by retinoic acid 8 homolog (mouse)"""			12489526	Standard	NM_182489		Approved		uc011kpx.2	Q7Z7C7	OTTHUMG00000155415	ENST00000275764.3:c.118C>A	7.37:g.134925328C>A	ENSP00000275764:p.Leu40Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000275764.3	37	CCDS5839.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.471636	0.26423	.	.	ENSG00000146857	ENST00000275764	.	.	.	4.44	0.198	0.15168	.	0.882556	0.09763	N	0.759043	T	0.28499	0.0705	L	0.34521	1.04	0.09310	N	1	P	0.43094	0.799	B	0.42386	0.386	T	0.17107	-1.0380	9	0.35671	T	0.21	2.1207	8.9823	0.35972	0.2614:0.3107:0.4279:0.0	.	40	Q7Z7C7	STRA8_HUMAN	M	40	.	ENSP00000275764:L40M	L	+	1	2	STRA8	134575868	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.211000	0.09332	-0.150000	0.11195	0.455000	0.32223	CTG		0.537	STRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340028.1	NM_182489	
RNF5P1	286140	broad.mit.edu	37	8	38458656	38458656	+	IGR	SNP	C	C	T	rs577390626		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr8:38458656C>T								RP11-675F6.4 (42118 upstream) : RP11-495O10.1 (99487 downstream)																							AGGTCGCGCCCGCCCCGCCCC	0.627																																						.											0																																										SO:0001628	intergenic_variant	286140																															8.37:g.38458656C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.627								
ZNF34	80778	broad.mit.edu	37	8	145999670	145999670	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr8:145999670delT	ENST00000343459.4	-	6	729	c.664delA	c.(664-666)acafs	p.T222fs	ZNF34_ENST00000429371.2_Frame_Shift_Del_p.T201fs			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		ACTGTATTTGTTTTTTTTGAC	0.353																																						.											0													56.0	55.0	56.0					8																	145999670		1878	4108	5986	SO:0001589	frameshift_variant	80778			BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.664delA	8.37:g.145999670delT	ENSP00000341528:p.Thr222fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DWN1|Q9BSZ0	Frame_Shift_Del	DEL	ENST00000343459.4	37	CCDS47945.1																																																																																				0.353	ZNF34-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382936.1	NM_030580	
ARSF	416	broad.mit.edu	37	X	2986145	2986145	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:2986145delA	ENST00000381127.1	+	2	225	c.4delA	c.(4-6)aggfs	p.R2fs	ARSF_ENST00000537104.1_Intron|ARSF_ENST00000359361.2_Frame_Shift_Del_p.R2fs	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	2					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGCACAATGAGGCCCAGGTA	0.363																																						.											0													112.0	91.0	98.0					X																	2986145		2203	4300	6503	SO:0001589	frameshift_variant	416			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.4delA	X.37:g.2986145delA	ENSP00000370519:p.Arg2fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCC5	Frame_Shift_Del	DEL	ENST00000381127.1	37	CCDS14123.1																																																																																				0.363	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
USP9X	8239	broad.mit.edu	37	X	41029423	41029423	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:41029423G>A	ENST00000324545.8	+	19	3445	c.2812G>A	c.(2812-2814)Ggt>Agt	p.G938S	USP9X_ENST00000378308.2_Missense_Mutation_p.G938S	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	938					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						CTTTGTGGGCGGTGAGCTGAT	0.343																																					Ovarian(172;1807 2695 35459 49286)	.											0													80.0	73.0	75.0					X																	41029423		2109	4244	6353	SO:0001583	missense	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.2812G>A	X.37:g.41029423G>A	ENSP00000316357:p.Gly938Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	G	30	5.052267	0.93793	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03468	3.93;3.92	5.85	5.85	0.93711	.	0.092526	0.85682	D	0.000000	T	0.16896	0.0406	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.65140	0.706;0.932	T	0.00052	-1.2191	10	0.54805	T	0.06	.	19.0483	0.93030	0.0:0.0:1.0:0.0	.	938;938	Q93008-1;Q93008	.;USP9X_HUMAN	S	938	ENSP00000367558:G938S;ENSP00000316357:G938S	ENSP00000316357:G938S	G	+	1	0	USP9X	40914367	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.863000	0.87023	2.448000	0.82819	0.594000	0.82650	GGT		0.343	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
PCDH19	57526	broad.mit.edu;mdanderson.org	37	X	99661925	99661925	+	Silent	SNP	G	G	A	rs267606933		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:99661925G>A	ENST00000373034.4	-	1	3346	c.1671C>T	c.(1669-1671)aaC>aaT	p.N557N	PCDH19_ENST00000255531.7_Silent_p.N557N|PCDH19_ENST00000420881.2_Silent_p.N557N	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	557	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		N -> K (in EIEE9). {ECO:0000269|PubMed:18469813, ECO:0000269|PubMed:19752159}.		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GGGTGTTGTCGTTGACGTCGA	0.582																																						.											0			GRCh37	CM081730	PCDH19	M							125.0	122.0	123.0					X																	99661925		2158	4240	6398	SO:0001819	synonymous_variant	57526			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1671C>T	X.37:g.99661925G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	ENST00000373034.4	37	CCDS55462.1																																																																																				0.582	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
PASD1	139135	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	150817086	150817086	+	Splice_Site	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrX:150817086G>A	ENST00000370357.4	+	9	874		c.e9-1			NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1							nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CCTATTTATAGTAGCTCTCAA	0.383																																						.											0													140.0	134.0	136.0					X																	150817086		2203	4300	6503	SO:0001630	splice_region_variant	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.630-1G>A	X.37:g.150817086G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q3MNE0|Q69HD7|Q8N7X9	Splice_Site	SNP	ENST00000370357.4	37	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830713	0.32329	.	.	ENSG00000166049	ENST00000370357	.	.	.	4.14	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5831	0.50902	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PASD1	150567742	0.038000	0.19896	0.028000	0.17463	0.176000	0.22953	1.554000	0.36266	2.014000	0.59158	0.422000	0.28245	.		0.383	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	Intron
TAS2R30	259293	broad.mit.edu	37	12	11286136	11286137	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr12:11286136_11286137insA	ENST00000539585.1	-	1	1106_1107	c.707_708insT	c.(706-708)ctgfs	p.L236fs	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	236					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TGGCACATAACAGAAGAAAGGA	0.411																																						.											0																																										SO:0001589	frameshift_variant	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.708dupT	12.37:g.11286137_11286137dupA	ENSP00000444736:p.Leu236fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q645X7	Frame_Shift_Ins	INS	ENST00000539585.1	37	CCDS53750.1																																																																																				0.411	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
C7orf71	285941	ucsc.edu	37	7	26686159	26686159	+	Nonstop_Mutation	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr7:26686159A>G	ENST00000409974.3	+	4	1226	c.510A>G	c.(508-510)tgA>tgG	p.*170W		NM_001145531.1	NP_001139003.1	A4D174	CG071_HUMAN	chromosome 7 open reading frame 71	0																	TGCTTCTGTGAAACCCAAGCA	0.458																																						.											0													83.0	71.0	75.0					7																	26686159		692	1591	2283	SO:0001578	stop_lost	285941				CCDS47565.1	7p15.2	2009-09-11			ENSG00000222004	ENSG00000222004			22364	protein-coding gene	gene with protein product							Standard	NM_001145531		Approved		uc003syb.3	A4D174	OTTHUMG00000152860	ENST00000409974.3:c.510A>G	7.37:g.26686159A>G	ENSP00000386749:p.*170Trpext*36	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000409974.3	37	CCDS47565.1	.	.	.	.	.	.	.	.	.	.	A	7.203	0.593930	0.13875	.	.	ENSG00000222004	ENST00000409974	.	.	.	5.53	1.6	0.23607	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3309	0.07084	0.1396:0.075:0.1351:0.6502	.	.	.	.	W	170	.	.	X	+	3	0	C7orf71	26652684	0.063000	0.20901	0.004000	0.12327	0.011000	0.07611	0.468000	0.22051	0.078000	0.16900	-0.649000	0.03915	TGA		0.458	C7orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328272.1	NM_001145531	
CDC42BPG	55561	ucsc.edu	37	11	64601933	64601933	+	Silent	SNP	T	T	C	rs7933683	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr11:64601933T>C	ENST00000342711.5	-	19	2291	c.2292A>G	c.(2290-2292)acA>acG	p.T764T	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CCTGCACCTGTGTCAGCCGCT	0.706													C|||	1376	0.27476	0.0424	0.2147	5008	,	,		15170	0.4921		0.2575	False		,,,				2504	0.4254					.											0								C		284,3850		12,260,1795	6.0	7.0	6.0		2292	-6.1	0.8	11	dbSNP_116	6	1681,6531		171,1339,2596	no	coding-synonymous	CDC42BPG	NM_017525.2		183,1599,4391	CC,CT,TT		20.47,6.8699,15.9161		764/1552	64601933	1965,10381	2067	4106	6173	SO:0001819	synonymous_variant	55561			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2292A>G	11.37:g.64601933T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																				0.706	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
CRB2	286204	ucsc.edu;bcgsc.ca	37	9	126137497	126137497	+	Splice_Site	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr9:126137497T>C	ENST00000373631.3	+	12	3509	c.3508T>C	c.(3508-3510)Tgt>Cgt	p.C1170R	CRB2_ENST00000373629.2_Splice_Site_p.C838R	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1170	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)	p.C1170S(1)		NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CCTCTCCAGGTGTCAGGTCCC	0.617																																						.											1	Substitution - Missense(1)	lung(1)											60.0	65.0	63.0					9																	126137497		2203	4300	6503	SO:0001630	splice_region_variant	286204			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3507-1T>C	9.37:g.126137497T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	.	21.2	4.106936	0.77096	.	.	ENSG00000148204	ENST00000373631;ENST00000373629	D;D	0.95656	-2.67;-3.77	4.87	4.87	0.63330	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.48286	D	0.000189	D	0.98280	0.9430	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99552	1.0966	10	0.87932	D	0	.	14.6481	0.68774	0.0:0.0:0.0:1.0	.	1170	Q5IJ48	CRUM2_HUMAN	R	1170;838	ENSP00000362734:C1170R;ENSP00000362732:C838R	ENSP00000362732:C838R	C	+	1	0	CRB2	125177318	1.000000	0.71417	0.997000	0.53966	0.218000	0.24690	4.723000	0.61965	2.052000	0.61016	0.459000	0.35465	TGT		0.617	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	Missense_Mutation
DTL	51514	ucsc.edu	37	1	212254059	212254059	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr1:212254059T>C	ENST00000366991.4	+	13	1542	c.1228T>C	c.(1228-1230)Tct>Cct	p.S410P	DTL_ENST00000542077.1_Missense_Mutation_p.S368P|DTL_ENST00000475419.1_3'UTR	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	410					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		GGGTTGGGCCTCTCAGAAGAA	0.418																																						.											0													123.0	134.0	131.0					1																	212254059		2203	4300	6503	SO:0001583	missense	51514			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.1228T>C	1.37:g.212254059T>C	ENSP00000355958:p.Ser410Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	ENST00000366991.4	37	CCDS1502.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.439703	0.63067	.	.	ENSG00000143476	ENST00000366991;ENST00000542077;ENST00000420235	T;T	0.71341	-0.49;-0.56	5.27	5.27	0.74061	.	0.659654	0.16073	N	0.230900	T	0.57198	0.2037	L	0.36672	1.1	0.32356	N	0.557877	P;P;P	0.39717	0.684;0.682;0.627	B;B;B	0.37144	0.242;0.239;0.184	T	0.59611	-0.7422	10	0.02654	T	1	-39.257	14.4635	0.67467	0.0:0.0:0.0:1.0	.	368;410;368	F5GZ90;Q9NZJ0;B4E0E6	.;DTL_HUMAN;.	P	410;368;89	ENSP00000355958:S410P;ENSP00000443870:S368P	ENSP00000355958:S410P	S	+	1	0	DTL	210320682	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	2.100000	0.41777	2.124000	0.65301	0.529000	0.55759	TCT		0.418	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448	
EIF2AK4	440275	ucsc.edu	37	15	40268998	40268998	+	Missense_Mutation	SNP	G	G	C	rs200699205|rs377237751	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr15:40268998G>C	ENST00000263791.5	+	12	2245	c.2202G>C	c.(2200-2202)gaG>gaC	p.E734D	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.E734D	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	734	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GCGATGACGAGGACGACGACG	0.682																																						.											0													48.0	51.0	50.0					15																	40268998		1792	3898	5690	SO:0001583	missense	440275			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2202G>C	15.37:g.40268998G>C	ENSP00000263791:p.Glu734Asp	Somatic		WXS	Illumina HiSeq	Phase_I	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	G	5.494	0.276174	0.10403	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.70749	-0.51;-0.41	5.34	1.05	0.20165	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.232344	0.43579	D	0.000550	T	0.38772	0.1053	N	0.11201	0.11	0.43330	D	0.995364	B	0.02656	0.0	B	0.01281	0.0	T	0.31668	-0.9935	10	0.02654	T	1	-11.3049	3.9743	0.09467	0.0737:0.2643:0.3683:0.2937	.	734	Q9P2K8	E2AK4_HUMAN	D	734	ENSP00000263791:E734D;ENSP00000372174:E734D	ENSP00000263791:E734D	E	+	3	2	EIF2AK4	38056290	0.212000	0.23540	0.997000	0.53966	0.175000	0.22909	-0.226000	0.09139	0.323000	0.23307	-0.196000	0.12772	GAG		0.682	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
IRGQ	126298	ucsc.edu	37	19	44099393	44099393	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr19:44099393T>C	ENST00000602269.1	-	1	283	c.98A>G	c.(97-99)gAg>gGg	p.E33G	ZNF576_ENST00000528387.1_5'Flank|ZNF576_ENST00000525771.1_5'Flank|L34079.2_ENST00000594374.1_5'Flank|ZNF576_ENST00000533118.1_5'Flank|ZNF576_ENST00000529930.1_5'Flank|ZNF576_ENST00000336564.4_5'Flank|SRRM5_ENST00000526798.1_5'Flank|IRGQ_ENST00000422989.1_Missense_Mutation_p.E33G|SRRM5_ENST00000607544.1_5'Flank|IRGQ_ENST00000601520.1_5'Flank|ZNF576_ENST00000391965.2_5'Flank			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	33										endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CTCGAGCGTCTCCACATCCTT	0.701																																						.											0													21.0	21.0	21.0					19																	44099393		2150	4193	6343	SO:0001583	missense	126298			AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.98A>G	19.37:g.44099393T>C	ENSP00000472250:p.Glu33Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNP3	Missense_Mutation	SNP	ENST00000602269.1	37	CCDS33040.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.041069	0.55003	.	.	ENSG00000167378	ENST00000422989	T	0.53857	0.6	4.0	4.0	0.46444	.	0.317825	0.23060	N	0.052388	T	0.34919	0.0914	N	0.24115	0.695	0.26975	N	0.965488	P	0.40731	0.728	B	0.36186	0.219	T	0.28459	-1.0043	10	0.52906	T	0.07	-6.2115	9.4967	0.38993	0.0:0.0:0.0:1.0	.	33	Q8WZA9	IRGQ_HUMAN	G	33	ENSP00000387535:E33G	ENSP00000387535:E33G	E	-	2	0	IRGQ	48791233	0.971000	0.33674	0.921000	0.36526	0.587000	0.36485	1.979000	0.40608	1.802000	0.52723	0.459000	0.35465	GAG		0.701	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
KCNQ1	3784	ucsc.edu	37	11	2797283	2797283	+	Splice_Site	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr11:2797283A>G	ENST00000155840.5	+	13	1792	c.1684A>G	c.(1684-1686)Agg>Ggg	p.R562G	KCNQ1_ENST00000335475.5_Splice_Site_p.R435G	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	562					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	GCTGCAGAGGAGGTGGGCACG	0.677																																						.											0			GRCh37	CD044138	KCNQ1	D							59.0	45.0	50.0					11																	2797283		2179	4266	6445	SO:0001630	splice_region_variant	3784			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1685+1A>G	11.37:g.2797283A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	ENST00000155840.5	37	CCDS7736.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041555	0.75732	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99882	-7.48;-7.48	3.78	3.78	0.43462	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.279693	0.34700	N	0.003753	D	0.99859	0.9934	M	0.86178	2.8	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.96474	0.9351	10	0.87932	D	0	-37.0564	10.783	0.46388	1.0:0.0:0.0:0.0	.	435;435;562	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	G	562;435	ENSP00000155840:R562G;ENSP00000334497:R435G	ENSP00000155840:R562G	R	+	1	2	KCNQ1	2753859	1.000000	0.71417	0.999000	0.59377	0.898000	0.52572	2.557000	0.45871	1.720000	0.51447	0.459000	0.35465	AGG		0.677	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	Missense_Mutation
KIF13B	23303	ucsc.edu	37	8	29035051	29035051	+	Silent	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr8:29035051A>G	ENST00000524189.1	-	9	803	c.765T>C	c.(763-765)gcT>gcC	p.A255A	KIF13B_ENST00000521515.1_Silent_p.A255A	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	255	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GTTCACTGCCAGCTAAATCCA	0.473																																						.											0													143.0	144.0	144.0					8																	29035051		1949	4158	6107	SO:0001819	synonymous_variant	23303			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.765T>C	8.37:g.29035051A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	ENST00000524189.1	37	CCDS55217.1																																																																																				0.473	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
LRRC38	126755	ucsc.edu;bcgsc.ca	37	1	13839511	13839511	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr1:13839511T>C	ENST00000376085.3	-	1	1032	c.578A>G	c.(577-579)gAc>gGc	p.D193G	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	193	LRRCT.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GTGGGCGAAGTCACAGTCGCA	0.687																																						.											0																																										SO:0001583	missense	126755			BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.578A>G	1.37:g.13839511T>C	ENSP00000365253:p.Asp193Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	37	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.683800	0.47991	.	.	ENSG00000162494	ENST00000376085	T	0.02446	4.29	4.96	4.96	0.65561	Cysteine-rich flanking region, C-terminal (1);	0.355245	0.31323	N	0.007847	T	0.04543	0.0124	L	0.48642	1.525	0.43835	D	0.996413	B	0.32051	0.354	B	0.34301	0.179	T	0.43212	-0.9405	10	0.52906	T	0.07	.	13.4711	0.61283	0.0:0.0:0.0:1.0	.	193	Q5VT99	LRC38_HUMAN	G	193	ENSP00000365253:D193G	ENSP00000365253:D193G	D	-	2	0	LRRC38	13712098	0.996000	0.38824	1.000000	0.80357	0.975000	0.68041	3.342000	0.52159	1.852000	0.53769	0.443000	0.29094	GAC		0.687	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
MAPK4	5596	ucsc.edu	37	18	48248403	48248403	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr18:48248403T>C	ENST00000400384.2	+	4	1823	c.787T>C	c.(787-789)Ttt>Ctt	p.F263L	MAPK4_ENST00000592595.1_Intron|MAPK4_ENST00000540640.1_Missense_Mutation_p.F52L	NM_002747.3	NP_002738.2	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			lung(4)|skin(3)|upper_aerodigestive_tract(1)	8		Colorectal(6;0.0297)		Colorectal(21;0.156)		GATGCCTTCCTTTGTCAGCAG	0.597																																						.											0													73.0	82.0	79.0					18																	48248403		2074	4217	6291	SO:0001583	missense	5596			X59727	CCDS42437.1	18q21.1	2012-10-02			ENSG00000141639	ENSG00000141639		"""Mitogen-activated protein kinase cascade / Kinases"""	6878	protein-coding gene	gene with protein product		176949		PRKM4		8290275	Standard	XM_005258299		Approved	Erk3-related, Erk4	uc002lev.3	P31152	OTTHUMG00000179853	ENST00000400384.2:c.787T>C	18.37:g.48248403T>C	ENSP00000383234:p.Phe263Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4C4|Q0VG04	Missense_Mutation	SNP	ENST00000400384.2	37	CCDS42437.1	.	.	.	.	.	.	.	.	.	.	T	15.84	2.953295	0.53293	.	.	ENSG00000141639	ENST00000400384;ENST00000540640	T;T	0.40756	1.02;1.02	5.24	5.24	0.73138	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.31040	0.0784	L	0.35542	1.07	0.80722	D	1	B	0.15719	0.014	B	0.21360	0.034	T	0.10086	-1.0645	10	0.08381	T	0.77	-8.0962	14.108	0.65104	0.0:0.0:0.0:1.0	.	263	P31152	MK04_HUMAN	L	263;52	ENSP00000383234:F263L;ENSP00000439231:F52L	ENSP00000383234:F263L	F	+	1	0	MAPK4	46502401	1.000000	0.71417	0.692000	0.30179	0.993000	0.82548	5.037000	0.64170	1.982000	0.57802	0.459000	0.35465	TTT		0.597	MAPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448631.2	NM_002747	
PDE4DIP	9659	ucsc.edu;mdanderson.org;bcgsc.ca	37	1	144931626	144931626	+	Intron	SNP	T	T	C	rs79158320	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr1:144931626T>C	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000369351.3_Intron|PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.N28S|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.N28S			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AACCTGGAGATTGAGCTTGGA	0.567			T	PDGFRB	MPD								T|||	49	0.00978435	0.0325	0.0058	5008	,	,		34556	0.002		0.0	False		,,,				2504	0.0					.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0								T	SER/ASN,,,,	128,4278	84.4+/-122.9	0,128,2075	65.0	65.0	65.0		83,,,,	5.3	1.0	1	dbSNP_131	65	3,8597	2.2+/-6.3	0,3,4297	yes	missense,intron,intron,intron,intron	PDE4DIP	NM_001002811.1,NM_001002812.1,NM_001198832.1,NM_001198834.2,NM_014644.4	46,,,,	0,131,6372	CC,CT,TT		0.0349,2.9051,1.0072	,,,,	28/1133,,,,	144931626	131,12875	2203	4300	6503	SO:0001627	intron_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7805A>G	1.37:g.144931626T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	22	0.010073260073260074	19	0.03861788617886179	1	0.0027624309392265192	2	0.0034965034965034965	0	0.0	T	14.81	2.646949	0.47258	0.029051	3.49E-4	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.14144	2.53;2.53	5.3	5.3	0.74995	.	.	.	.	.	T	0.08846	0.0219	L	0.42245	1.32	0.80722	D	1	P	0.51537	0.946	P	0.50270	0.636	T	0.19712	-1.0297	9	0.12103	T	0.63	.	13.1866	0.59684	0.0:0.0:0.0:1.0	.	28	Q5VU43-2	.	S	28	ENSP00000316434:N28S;ENSP00000433392:N28S	ENSP00000316434:N28S	N	-	2	0	PDE4DIP	143642983	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.031000	0.57267	1.996000	0.58369	0.379000	0.24179	AAT		0.567	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PTPRM	5797	ucsc.edu	37	18	8376084	8376084	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr18:8376084T>C	ENST00000332175.8	+	23	4210	c.3173T>C	c.(3172-3174)tTc>tCc	p.F1058S	PTPRM_ENST00000580170.1_Missense_Mutation_p.F1071S|PTPRM_ENST00000400060.4_Missense_Mutation_p.F1072S|PTPRM_ENST00000400053.4_Missense_Mutation_p.F996S|PTPRM_ENST00000444013.1_Missense_Mutation_p.F845S	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1058	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CAGTTTCACTTCACTGGCTGG	0.547																																						.											0													85.0	83.0	84.0					18																	8376084		2203	4300	6503	SO:0001583	missense	5797			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3173T>C	18.37:g.8376084T>C	ENSP00000331418:p.Phe1058Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	T	34	5.315556	0.95655	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	6.04	6.04	0.98038	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.094058	0.85682	D	0.000000	T	0.70753	0.3260	M	0.93150	3.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79200	-0.1901	10	0.87932	D	0	.	16.6349	0.85050	0.0:0.0:0.0:1.0	.	845;1071;1058	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	S	1058;1072;996;845	ENSP00000331418:F1058S;ENSP00000382933:F1072S;ENSP00000382927:F996S;ENSP00000387608:F845S	ENSP00000331418:F1058S	F	+	2	0	PTPRM	8366084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.330000	0.79161	0.477000	0.44152	TTC		0.547	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
SLC6A13	6540	ucsc.edu	37	12	332318	332318	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr12:332318A>G	ENST00000343164.4	-	12	1446	c.1394T>C	c.(1393-1395)cTc>cCc	p.L465P	SLC6A13_ENST00000445055.2_Missense_Mutation_p.L373P|SLC6A13_ENST00000539668.1_5'UTR	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	465					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			AGCCACACAGAGGGACTCGAA	0.547																																						.											0													151.0	118.0	129.0					12																	332318		2203	4300	6503	SO:0001583	missense	6540			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1394T>C	12.37:g.332318A>G	ENSP00000339260:p.Leu465Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471544	0.84533	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.77229	-1.08;-1.08	4.8	4.8	0.61643	.	0.646127	0.16228	N	0.223738	D	0.87402	0.6168	M	0.76433	2.335	0.80722	D	1	P;P;P	0.52463	0.779;0.953;0.953	P;D;D	0.70487	0.718;0.969;0.924	D	0.88156	0.2854	10	0.87932	D	0	.	14.3492	0.66688	1.0:0.0:0.0:0.0	.	373;444;465	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	P	373;444;465	ENSP00000407104:L373P;ENSP00000339260:L465P	ENSP00000318097:L444P	L	-	2	0	SLC6A13	202579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.519000	0.81809	1.796000	0.52611	0.459000	0.35465	CTC		0.547	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
TMC1	117531	ucsc.edu;mdanderson.org;bcgsc.ca	37	9	75309495	75309495	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr9:75309495G>A	ENST00000297784.5	+	7	641	c.101G>A	c.(100-102)cGa>cAa	p.R34Q	TMC1_ENST00000340019.3_Missense_Mutation_p.R34Q|TMC1_ENST00000396237.3_Missense_Mutation_p.R34Q	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	34	Arg/Asp/Glu/Lys-rich (highly charged).				auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						AAGCTACCTCGAAGAGAGAGC	0.448																																					Pancreas(75;173 1345 14232 34245 43413)	.											0													133.0	121.0	125.0					9																	75309495		2202	4300	6502	SO:0001583	missense	117531			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.101G>A	9.37:g.75309495G>A	ENSP00000297784:p.Arg34Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608970	0.87258	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.13420	2.59;2.59;2.59	5.33	5.33	0.75918	.	0.068124	0.56097	D	0.000022	T	0.25121	0.0610	L	0.36672	1.1	0.26515	N	0.974527	D;D	0.58620	0.983;0.983	P;P	0.61201	0.885;0.885	T	0.03025	-1.1081	10	0.40728	T	0.16	-12.3627	15.7578	0.78051	0.0:0.0:1.0:0.0	.	43;34	A4FUA6;Q8TDI8	.;TMC1_HUMAN	Q	34;34;43;43;43;28;34	ENSP00000297784:R34Q;ENSP00000341433:R34Q;ENSP00000379538:R34Q	ENSP00000297784:R34Q	R	+	2	0	TMC1	74499315	0.994000	0.37717	0.976000	0.42696	0.990000	0.78478	4.741000	0.62095	2.484000	0.83849	0.650000	0.86243	CGA		0.448	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
TRIM16	10626	ucsc.edu	37	17	15539560	15539560	+	Silent	SNP	C	C	T	rs9911397	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr17:15539560C>T	ENST00000578237.1	-	8	1494	c.639G>A	c.(637-639)gcG>gcA	p.A213A	TRIM16_ENST00000416464.2_Silent_p.A83A|TRIM16_ENST00000581224.1_5'UTR|TRIM16_ENST00000577886.1_5'UTR|TRIM16_ENST00000579219.1_5'UTR|TRIM16_ENST00000336708.7_Silent_p.A213A|RP11-385D13.1_ENST00000455584.2_Silent_p.A213A			O95361	TRI16_HUMAN	tripartite motif containing 16	213					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TTTCAGCCACCGCTTTGACCT	0.542													T|||	103	0.0205671	0.056	0.0058	5008	,	,		18784	0.0159		0.0	False		,,,				2504	0.0092					.											0								T		128,4238		10,108,2065	88.0	87.0	87.0		639	-2.5	0.0	17	dbSNP_119	87	7,8585		0,7,4289	no	coding-synonymous	TRIM16	NM_006470.3		10,115,6354	TT,TC,CC		0.0815,2.9317,1.0418		213/565	15539560	135,12823	2183	4296	6479	SO:0001819	synonymous_variant	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.639G>A	17.37:g.15539560C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Silent	SNP	ENST00000578237.1	37	CCDS11171.1	75	0.034340659340659344	26	0.052845528455284556	2	0.0055248618784530384	17	0.02972027972027972	30	0.0395778364116095	N	2.714	-0.268218	0.05716	0.029317	8.15E-4	ENSG00000251537	ENST00000455584	.	.	.	3.97	-2.49	0.06403	.	.	.	.	.	T	0.05318	0.0141	.	.	.	0.29227	P	0.8735310000000001	.	.	.	.	.	.	T	0.29761	-1.0001	3	.	.	.	.	5.9626	0.19308	0.1152:0.4782:0.3216:0.0851	rs9911397	.	.	.	Q	228	.	.	R	-	2	0	RP11-385D13.1	15480285	0.014000	0.17966	0.006000	0.13384	0.385000	0.30292	0.258000	0.18387	-0.436000	0.07254	-1.246000	0.01523	CGG		0.542	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2	NM_006470	
TRIM37	4591	ucsc.edu;bcgsc.ca	37	17	57153067	57153067	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr17:57153067T>C	ENST00000262294.7	-	8	884	c.625A>G	c.(625-627)Aca>Gca	p.T209A	TRIM37_ENST00000376149.3_Missense_Mutation_p.T87A|TRIM37_ENST00000393066.3_Missense_Mutation_p.T209A|TRIM37_ENST00000393065.2_Missense_Mutation_p.T175A	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	209					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GTTAGAGATGTCTTCTGACCT	0.323									Mulibrey Nanism																													.											0													93.0	88.0	90.0					17																	57153067		2203	4300	6503	SO:0001583	missense	4591	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.625A>G	17.37:g.57153067T>C	ENSP00000262294:p.Thr209Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.832688	0.50845	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	T;T;T;T	0.64438	1.67;1.67;-0.1;1.25	5.4	5.4	0.78164	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63390	0.2507	N	0.19112	0.55	0.58432	D	0.999991	B;D;B	0.71674	0.175;0.998;0.011	B;D;B	0.63283	0.088;0.913;0.024	T	0.62581	-0.6824	10	0.30078	T	0.28	-0.6	14.5977	0.68419	0.0:0.0:0.0:1.0	.	175;87;209	F8WEE6;O94972-2;O94972	.;.;TRI37_HUMAN	A	209;209;87;175	ENSP00000376785:T209A;ENSP00000262294:T209A;ENSP00000365319:T87A;ENSP00000376784:T175A	ENSP00000262294:T209A	T	-	1	0	TRIM37	54507849	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.847000	0.86896	2.043000	0.60533	0.477000	0.44152	ACA		0.323	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294	
ZFYVE28	57732	ucsc.edu;mdanderson.org	37	4	2307125	2307125	+	Silent	SNP	G	G	A	rs143836367	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr4:2307125G>A	ENST00000290974.2	-	8	1281	c.942C>T	c.(940-942)ctC>ctT	p.L314L	RP11-478C1.7_ENST00000510632.1_RNA|ZFYVE28_ENST00000511071.1_Silent_p.L284L|ZFYVE28_ENST00000515312.1_Silent_p.L244L	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	314					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						CCTCAGGGGGGAGAGGGGCAG	0.662																																						.											0													39.0	42.0	41.0					4																	2307125		2203	4298	6501	SO:0001819	synonymous_variant	57732			AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.942C>T	4.37:g.2307125G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	ENST00000290974.2	37	CCDS33942.1																																																																																				0.662	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
CHST3	9469	mdanderson.org	37	10	73767859	73767859	+	Missense_Mutation	SNP	G	G	A	rs3740129	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr10:73767859G>A	ENST00000373115.4	+	3	1507	c.1070G>A	c.(1069-1071)cGg>cAg	p.R357Q		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	357			R -> Q (in dbSNP:rs3740129). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:18513679}.		carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						CTGGGGCTGCGGCAGCCCGCC	0.731													G|||	1372	0.273962	0.2474	0.3804	5008	,	,		13396	0.0893		0.4314	False		,,,				2504	0.2628					.											0								G	GLN/ARG	926,2546		181,564,991	5.0	4.0	5.0		1070	1.5	1.0	10	dbSNP_107	5	2693,3941		661,1371,1285	no	missense	CHST3	NM_004273.4	43	842,1935,2276	AA,AG,GG		40.5939,26.6705,35.8104	benign	357/480	73767859	3619,6487	1736	3317	5053	SO:0001583	missense	9469			AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1070G>A	10.37:g.73767859G>A	ENSP00000362207:p.Arg357Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O75099|Q52M30	Missense_Mutation	SNP	ENST00000373115.4	37	CCDS7312.1	626	0.2866300366300366	130	0.26422764227642276	137	0.3784530386740331	53	0.09265734265734266	306	0.40369393139841686	G	11.05	1.523657	0.27299	0.266705	0.405939	ENSG00000122863	ENST00000373115	D	0.82344	-1.6	5.55	1.52	0.23074	Sulfotransferase domain (1);	0.352881	0.31554	N	0.007455	T	0.00012	0.0000	N	0.11789	0.175	0.80722	P	0.0	B	0.09022	0.002	B	0.12837	0.008	T	0.27806	-1.0063	9	0.17369	T	0.5	-21.3549	8.2168	0.31516	0.403:0.0:0.597:0.0	rs3740129	357	Q7LGC8	CHST3_HUMAN	Q	357	ENSP00000362207:R357Q	ENSP00000362207:R357Q	R	+	2	0	CHST3	73437865	0.005000	0.15991	0.982000	0.44146	0.988000	0.76386	0.338000	0.19858	0.021000	0.15133	-0.258000	0.10820	CGG		0.731	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
CSNK2A1	1457	mdanderson.org	37	20	464702	464702	+	Missense_Mutation	SNP	G	G	A	rs61747403		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr20:464702G>A	ENST00000217244.3	-	14	1454	c.1079C>T	c.(1078-1080)aCc>aTc	p.T360I	CSNK2A1_ENST00000400227.3_Intron|CSNK2A1_ENST00000349736.5_Missense_Mutation_p.T360I|CSNK2A1_ENST00000400217.2_Missense_Mutation_p.T224I	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	360					axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			GGGTGAAGGGGTTGGCACTGA	0.547																																						.											0													30.0	28.0	28.0					20																	464702		2202	4300	6502	SO:0001583	missense	1457			M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.1079C>T	20.37:g.464702G>A	ENSP00000217244:p.Thr360Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Missense_Mutation	SNP	ENST00000217244.3	37	CCDS13003.1	.	.	.	.	.	.	.	.	.	.	G	9.824	1.186681	0.21870	.	.	ENSG00000101266	ENST00000349736;ENST00000217244;ENST00000381973;ENST00000400217	T;T;T	0.63096	0.37;0.37;-0.02	5.29	5.29	0.74685	.	0.330353	0.37178	N	0.002217	T	0.48840	0.1522	N	0.19112	0.55	0.53688	D	0.999978	B	0.19583	0.037	B	0.14578	0.011	T	0.36212	-0.9757	10	0.25751	T	0.34	-23.4981	18.1087	0.89528	0.0:0.0:1.0:0.0	.	360	P68400	CSK21_HUMAN	I	360;360;360;224	ENSP00000339247:T360I;ENSP00000217244:T360I;ENSP00000383076:T224I	ENSP00000217244:T360I	T	-	2	0	CSNK2A1	412702	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.856000	0.69518	2.749000	0.94314	0.655000	0.94253	ACC		0.547	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
MEF2A	4205	mdanderson.org	37	15	100252741	100252741	+	Missense_Mutation	SNP	A	A	C	rs560400205|rs199811207	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr15:100252741A>C	ENST00000557785.1	+	11	1608	c.1259A>C	c.(1258-1260)cAg>cCg	p.Q420P	MEF2A_ENST00000558812.1_Missense_Mutation_p.Q360P|MEF2A_ENST00000453228.2_Missense_Mutation_p.Q420P|MEF2A_ENST00000557942.1_Missense_Mutation_p.Q428P|MEF2A_ENST00000338042.6_Missense_Mutation_p.Q429P|MEF2A_ENST00000354410.5_Missense_Mutation_p.Q422P|MEF2A_ENST00000449277.2_Missense_Mutation_p.Q352P	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	430	Gln/Pro-rich.				apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			cagcagcagcagcCGCCGCCA	0.637																																						.											0													4.0	8.0	7.0					15																	100252741		1603	3215	4818	SO:0001583	missense	4205				CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1259A>C	15.37:g.100252741A>C	ENSP00000453441:p.Gln420Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	37	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.206880	0.00292	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T;T	0.36340	2.91;2.91;2.91;1.26	3.68	-5.59	0.02505	.	.	.	.	.	T	0.14098	0.0341	N	0.02011	-0.69	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0	T	0.29119	-1.0022	9	0.27785	T	0.31	.	15.1199	0.72434	0.7463:0.2537:0.0:0.0	.	430;360;341;420;422;428	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	P	420;422;429;360	ENSP00000404110:Q420P;ENSP00000346389:Q422P;ENSP00000337202:Q429P;ENSP00000399460:Q360P	ENSP00000337202:Q429P	Q	+	2	0	MEF2A	98070264	0.968000	0.33430	0.000000	0.03702	0.025000	0.11179	-0.272000	0.08560	-1.152000	0.02832	-2.562000	0.00173	CAG		0.637	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
MUC21	394263	mdanderson.org	37	6	30954600	30954600	+	Missense_Mutation	SNP	A	A	C	rs552812759	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:30954600A>C	ENST00000376296.3	+	2	889	c.648A>C	c.(646-648)agA>agC	p.R216S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	216	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTGAGTCCAGAACGACCTCCA	0.617													a|||	17	0.00339457	0.0023	0.0101	5008	,	,		23080	0.003		0.003	False		,,,				2504	0.001					.											0													154.0	152.0	153.0					6																	30954600		2203	4300	6503	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.648A>C	6.37:g.30954600A>C	ENSP00000365473:p.Arg216Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	a	0.015	-1.570408	0.00895	.	.	ENSG00000204544	ENST00000376296	T	0.01165	5.24	3.65	-7.29	0.01451	.	.	.	.	.	T	0.00109	0.0003	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39035	-0.9633	8	.	.	.	0.2248	6.4041	0.21654	0.4184:0.1401:0.0:0.4415	.	216	Q5SSG8	MUC21_HUMAN	S	216	ENSP00000365473:R216S	.	R	+	3	2	MUC21	31062579	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.119000	0.00080	-3.816000	0.00103	-1.775000	0.00657	AGA		0.617	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC4	4585	mdanderson.org	37	3	195506398	195506398	+	Missense_Mutation	SNP	G	G	T	rs74573747		TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr3:195506398G>T	ENST00000463781.3	-	2	12512	c.12053C>A	c.(12052-12054)cCt>cAt	p.P4018H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4018H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGGGGT	0.587																																						.											0													17.0	14.0	15.0					3																	195506398		659	1393	2052	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12053C>A	3.37:g.195506398G>T	ENSP00000417498:p.Pro4018His	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	2.754	-0.259437	0.05791	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.33;1.44	.	.	.	.	0.000000	0.25881	U	0.027698	T	0.35828	0.0945	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.74348	0.983	T	0.10428	-1.0630	8	.	.	.	.	6.5141	0.22239	2.0E-4:0.0:0.9998:0.0	.	3890	E7ESK3	.	H	4018	ENSP00000417498:P4018H;ENSP00000420243:P4018H	.	P	-	2	0	MUC4	196991177	0.122000	0.22280	0.005000	0.12908	0.029000	0.11900	0.476000	0.22180	0.419000	0.25927	0.064000	0.15345	CCT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TAS2R43	259289	mdanderson.org	37	12	11244369	11244369	+	Missense_Mutation	SNP	G	G	A	rs200586631	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr12:11244369G>A	ENST00000531678.1	-	1	543	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	154					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TCTTTTGTCCGCACAATCTCA	0.368													.|||	2	0.000399361	0.0015	0.0	5008	,	,		14006	0.0		0.0	False		,,,				2504	0.0					.											0													76.0	68.0	71.0					12																	11244369		1796	3334	5130	SO:0001583	missense	259289			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.460C>T	12.37:g.11244369G>A	ENSP00000431719:p.Arg154Trp	Somatic		WXS	Illumina HiSeq	Phase_I	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	.	.	.	.	.	.	.	.	.	.	-	0.004	-2.315340	0.00235	.	.	ENSG00000255374	ENST00000531678	T	0.37584	1.19	2.01	1.05	0.20165	.	.	.	.	.	T	0.09069	0.0224	N	0.01009	-1.055	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35500	-0.9786	9	0.02654	T	1	.	4.5717	0.12214	0.2129:0.0:0.7871:0.0	.	154	P59537	T2R43_HUMAN	W	154	ENSP00000431719:R154W	ENSP00000431719:R154W	R	-	1	2	TAS2R43	11135636	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.836000	0.04382	0.165000	0.19558	0.195000	0.17529	CGG		0.368	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
ZNF676	163223	mdanderson.org	37	19	22363631	22363631	+	Silent	SNP	G	G	A	rs75683199	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr19:22363631G>A	ENST00000397121.2	-	3	1205	c.888C>T	c.(886-888)ctC>ctT	p.L296L		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	296					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TATGTTCCATGAGCTTTGAGG	0.438																																						.											0													96.0	100.0	98.0					19																	22363631		2141	4270	6411	SO:0001819	synonymous_variant	163223			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.888C>T	19.37:g.22363631G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																				0.438	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
ZNF676	163223	mdanderson.org	37	19	22363634	22363634	+	Missense_Mutation	SNP	C	C	A	rs76456473	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr19:22363634C>A	ENST00000397121.2	-	3	1202	c.885G>T	c.(883-885)aaG>aaT	p.K295N		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	295					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GTTCCATGAGCTTTGAGGACG	0.433																																						.											0													98.0	102.0	100.0					19																	22363634		2149	4273	6422	SO:0001583	missense	163223			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.885G>T	19.37:g.22363634C>A	ENSP00000380310:p.Lys295Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.874663	0.00003	.	.	ENSG00000196109	ENST00000397121	T	0.07908	3.15	0.85	-1.7	0.08159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02156	0.0067	N	0.02775	-0.495	0.09310	N	1	P	0.40731	0.728	B	0.37833	0.259	T	0.20940	-1.0260	9	0.08381	T	0.77	.	0.8725	0.01217	0.1932:0.2181:0.3753:0.2135	.	295	Q8N7Q3	ZN676_HUMAN	N	295	ENSP00000380310:K295N	ENSP00000380310:K295N	K	-	3	2	ZNF676	22155474	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.885000	0.01620	-1.157000	0.02815	-1.151000	0.01829	AAG		0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
MLLT10	8028	bcgsc.ca	37	10	21884308	21884308	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr10:21884308C>T	ENST00000307729.7	+	5	522	c.344C>T	c.(343-345)gCc>gTc	p.A115V	MLLT10_ENST00000377059.3_Missense_Mutation_p.A115V|MLLT10_ENST00000377072.3_Missense_Mutation_p.A115V|MLLT10_ENST00000446906.2_Missense_Mutation_p.A115V|MLLT10_ENST00000495130.1_3'UTR			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	115	Self-association.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GTACAATTTGCCAATGTTTCC	0.328			T	"""MLL, PICALM, CDK6"""	AL																																	.		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													114.0	105.0	108.0					10																	21884308		2203	4300	6503	SO:0001583	missense	8028			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.344C>T	10.37:g.21884308C>T	ENSP00000307411:p.Ala115Val	Somatic		WXS	Illumina HiSeq	Phase_I	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	ENST00000307729.7	37	CCDS55708.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939134	0.92526	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000377059	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	4.1	4.1	0.47936	.	0.147655	0.44688	U	0.000437	T	0.13713	0.0332	L	0.33624	1.015	0.80722	D	1	P;P;P	0.41188	0.741;0.643;0.741	B;B;B	0.39771	0.309;0.187;0.309	T	0.06935	-1.0799	10	0.87932	D	0	.	16.4955	0.84242	0.0:1.0:0.0:0.0	.	115;115;115	E9PBP4;Q5VX90;P55197	.;.;AF10_HUMAN	V	115	ENSP00000366272:A115V;ENSP00000401406:A115V;ENSP00000307411:A115V;ENSP00000366258:A115V	ENSP00000307411:A115V	A	+	2	0	MLLT10	21924314	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.647000	0.83462	2.098000	0.63641	0.313000	0.20887	GCC		0.328	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		
TAS2R31	259290	bcgsc.ca	37	12	11183042	11183042	+	Missense_Mutation	SNP	C	C	G	rs3759246	byFrequency	TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr12:11183042C>G	ENST00000390675.2	-	1	964	c.893G>C	c.(892-894)aGg>aCg	p.R298T	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	298					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						CACCCAGTACCTCACTTGCCG	0.418																																						.											0													200.0	202.0	201.0					12																	11183042		1968	4187	6155	SO:0001583	missense	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.893G>C	12.37:g.11183042C>G	ENSP00000375093:p.Arg298Thr	Somatic		WXS	Illumina HiSeq	Phase_I	P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	37	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323373	0.24080	.	.	ENSG00000256436	ENST00000390675	T	0.38077	1.16	2.61	-0.464	0.12160	.	.	.	.	.	T	0.32285	0.0824	L	0.33792	1.035	0.09310	N	1	P	0.40681	0.727	P	0.49085	0.6	T	0.23440	-1.0188	9	0.44086	T	0.13	.	5.1028	0.14768	0.0:0.5087:0.0:0.4913	rs3759246	298	P59538	T2R31_HUMAN	T	298	ENSP00000375093:R298T	ENSP00000375093:R298T	R	-	2	0	TAS2R31	11074309	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	-2.166000	0.01273	-0.264000	0.09365	0.184000	0.17185	AGG		0.418	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
ATP8A2	51761	bcgsc.ca	37	13	26133897	26133897	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr13:26133897A>G	ENST00000381655.2	+	15	1533	c.1391A>G	c.(1390-1392)gAc>gGc	p.D464G	ATP8A2_ENST00000255283.8_Missense_Mutation_p.D424G	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	424					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TCTTCAGATGACTTCTGGTAA	0.373																																						.											0													109.0	101.0	103.0					13																	26133897		1813	4076	5889	SO:0001583	missense	51761			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1391A>G	13.37:g.26133897A>G	ENSP00000371070:p.Asp464Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	a	15.21	2.765965	0.49574	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.67345	-0.26;-0.26	5.03	5.03	0.67393	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.113760	0.64402	D	0.000015	T	0.66015	0.2747	L	0.42632	1.34	0.58432	D	0.999999	B;P;B	0.48503	0.126;0.911;0.126	B;P;B	0.48227	0.096;0.571;0.138	T	0.68051	-0.5511	10	0.48119	T	0.1	.	14.4278	0.67227	1.0:0.0:0.0:0.0	.	424;424;424	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	G	464;424;244	ENSP00000371070:D464G;ENSP00000255283:D424G	ENSP00000255283:D424G	D	+	2	0	ATP8A2	25031897	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	6.997000	0.76270	1.883000	0.54544	0.363000	0.22086	GAC		0.373	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
EAPP	55837	bcgsc.ca	37	14	34998579	34998579	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr14:34998579T>C	ENST00000250454.3	-	4	536	c.455A>G	c.(454-456)gAt>gGt	p.D152G		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	152					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		TCTCTGTGCATCAACCCAGGC	0.318																																						.											0													156.0	138.0	143.0					14																	34998579		1824	4080	5904	SO:0001583	missense	55837			AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.455A>G	14.37:g.34998579T>C	ENSP00000250454:p.Asp152Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	ENST00000250454.3	37	CCDS41941.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.336998	0.81801	.	.	ENSG00000129518	ENST00000250454;ENST00000554792	T;T	0.45276	0.9;0.9	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.69296	0.3095	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74982	-0.3478	10	0.59425	D	0.04	-21.4515	15.7004	0.77538	0.0:0.0:0.0:1.0	.	152	Q56P03	EAPP_HUMAN	G	152;131	ENSP00000250454:D152G;ENSP00000450908:D131G	ENSP00000250454:D152G	D	-	2	0	EAPP	34068330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.040000	0.76551	2.183000	0.69458	0.477000	0.44152	GAT		0.318	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409847.1	NM_018453	
HAPLN1	1404	bcgsc.ca	37	5	82937410	82937410	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr5:82937410G>A	ENST00000274341.4	-	5	1820	c.970C>T	c.(970-972)Cgc>Tgc	p.R324C		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	324	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	GGACTGCAGCGCCTTCTTGGC	0.532																																						.											0													107.0	113.0	111.0					5																	82937410		2203	4300	6503	SO:0001583	missense	1404				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.970C>T	5.37:g.82937410G>A	ENSP00000274341:p.Arg324Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9A9	Missense_Mutation	SNP	ENST00000274341.4	37	CCDS4061.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215621	0.39102	.	.	ENSG00000145681	ENST00000274341	T	0.31769	1.48	5.22	5.22	0.72569	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.65228	-0.6219	10	0.87932	D	0	.	19.1617	0.93535	0.0:0.0:1.0:0.0	.	324	P10915	HPLN1_HUMAN	C	324	ENSP00000274341:R324C	ENSP00000274341:R324C	R	-	1	0	HAPLN1	82973166	0.997000	0.39634	1.000000	0.80357	0.169000	0.22640	2.513000	0.45494	2.581000	0.87130	0.655000	0.94253	CGC		0.532	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
MT-ATP6	4508	bcgsc.ca	37	M	9025	9025	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chrM:9025G>A	ENST00000361899.2	+	1	499	c.499G>A	c.(499-501)Ggc>Agc	p.G167S	MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	167					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						ACATTACTGCAGGCCACCTAC	0.453																																						.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.499G>A	M.37:g.9025G>A	ENSP00000354632:p.Gly167Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	37																																																																																					0.453	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
CDKN1A	1026	bcgsc.ca	37	6	36652012	36652013	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8331-01A-11D-2310-10	TCGA-KL-8331-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7087a2b6-7fc4-45b0-8c48-248864f03deb	2ca67854-9fef-4b3e-a4e0-0432df5a5800	g.chr6:36652012_36652013insC	ENST00000405375.1	+	2	369_370	c.134_135insC	c.(133-138)gcccgtfs	p.R46fs	CDKN1A_ENST00000448526.2_Frame_Shift_Ins_p.R80fs|CDKN1A_ENST00000244741.5_Frame_Shift_Ins_p.R46fs|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000373711.2_Frame_Shift_Ins_p.R46fs	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	46					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						ATCCAGGAGGCCCGTGAGCGAT	0.658																																						.											0																																										SO:0001589	frameshift_variant	1026			U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.136dupC	6.37:g.36652014_36652014dupC	ENSP00000384849:p.Arg46fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q14010|Q6FI05|Q9BUT4	Frame_Shift_Ins	INS	ENST00000405375.1	37	CCDS4824.1																																																																																				0.658	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	
