#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MICALCL	84953	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	12316009	12316009	+	Missense_Mutation	SNP	G	G	A	rs201723344		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:12316009G>A	ENST00000256186.2	+	3	1322	c.1031G>A	c.(1030-1032)cGc>cAc	p.R344H		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	344					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		CCTGCCCTCCGCACCCACAGT	0.552																																						.											0								G	HIS/ARG	0,3962		0,0,1981	79.0	88.0	85.0		1031	1.2	0.0	11		85	2,8300		0,2,4149	yes	missense	MICALCL	NM_032867.2	29	0,2,6130	AA,AG,GG		0.0241,0.0,0.0163	probably-damaging	344/696	12316009	2,12262	1981	4151	6132	SO:0001583	missense	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1031G>A	11.37:g.12316009G>A	ENSP00000256186:p.Arg344His	Somatic		WXS	Illumina HiSeq	Phase_I	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	.	.	.	.	.	.	.	.	.	.	G	11.00	1.511542	0.27036	0.0	2.41E-4	ENSG00000133808	ENST00000256186	T	0.12039	2.72	5.38	1.16	0.20824	.	0.325455	0.22417	N	0.060323	T	0.09202	0.0227	L	0.53249	1.67	0.09310	N	1	B	0.33841	0.428	B	0.20577	0.03	T	0.22034	-1.0228	10	0.38643	T	0.18	.	3.9085	0.09193	0.2706:0.0:0.5639:0.1656	.	344	Q6ZW33	MICLK_HUMAN	H	344	ENSP00000256186:R344H	ENSP00000256186:R344H	R	+	2	0	MICALCL	12272585	0.000000	0.05858	0.029000	0.17559	0.656000	0.38851	0.255000	0.18333	0.253000	0.21552	0.460000	0.39030	CGC		0.552	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
HSPG2	3339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	22176895	22176895	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:22176895A>T	ENST00000374695.3	-	56	7334	c.7255T>A	c.(7255-7257)Tct>Act	p.S2419T	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2419	Ig-like C2-type 9.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACCAGGACAGAGGCCTCTAGA	0.677																																						.											0													28.0	28.0	28.0					1																	22176895		2202	4299	6501	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.7255T>A	1.37:g.22176895A>T	ENSP00000363827:p.Ser2419Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	A	14.04	2.416217	0.42918	.	.	ENSG00000142798	ENST00000374695	T	0.67171	-0.25	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38217	N	0.001776	T	0.74038	0.3664	L	0.49455	1.56	0.41410	D	0.987733	D;D	0.64830	0.965;0.994	P;D	0.78314	0.775;0.991	T	0.69525	-0.5122	10	0.10902	T	0.67	.	13.4578	0.61210	1.0:0.0:0.0:0.0	.	359;2419	Q59EG0;P98160	.;PGBM_HUMAN	T	2419	ENSP00000363827:S2419T	ENSP00000363827:S2419T	S	-	1	0	HSPG2	22049482	1.000000	0.71417	0.948000	0.38648	0.410000	0.31052	3.281000	0.51685	2.077000	0.62373	0.459000	0.35465	TCT		0.677	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
HDAC7	51564	broad.mit.edu;hgsc.bcm.edu	37	12	48189416	48189416	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr12:48189416delG	ENST00000427332.2	-	10	1080	c.924delC	c.(922-924)cccfs	p.P308fs	HDAC7_ENST00000380610.4_Frame_Shift_Del_p.P364fs|HDAC7_ENST00000080059.7_Frame_Shift_Del_p.P347fs|HDAC7_ENST00000354334.3_Frame_Shift_Del_p.P310fs|HDAC7_ENST00000552960.1_Frame_Shift_Del_p.P330fs			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	308	Transcription repression 2. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GGAGGAGAATGGGCTGCAGGC	0.677																																						.											0													15.0	17.0	17.0					12																	48189416		2166	4269	6435	SO:0001589	frameshift_variant	51564			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.924delC	12.37:g.48189416delG	ENSP00000404394:p.Pro308fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Frame_Shift_Del	DEL	ENST00000427332.2	37																																																																																					0.677	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
TENC1	23371	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	53449591	53449591	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr12:53449591C>G	ENST00000314250.6	+	10	1013	c.723C>G	c.(721-723)atC>atG	p.I241M	TENC1_ENST00000546602.1_Missense_Mutation_p.I241M|TENC1_ENST00000552570.1_Missense_Mutation_p.I241M|TENC1_ENST00000549700.1_Missense_Mutation_p.I241M|TENC1_ENST00000314276.3_Missense_Mutation_p.I251M|RP11-983P16.4_ENST00000550601.1_RNA|TENC1_ENST00000379902.3_Missense_Mutation_p.I117M|RP11-983P16.4_ENST00000546793.1_RNA|RP11-983P16.4_ENST00000551890.1_RNA|TENC1_ENST00000451358.1_Missense_Mutation_p.I241M	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	241	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						TTGGGGTCATCGTTTCTGCCT	0.597																																						.											0													206.0	194.0	198.0					12																	53449591		2203	4300	6503	SO:0001583	missense	23371			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.723C>G	12.37:g.53449591C>G	ENSP00000319684:p.Ile241Met	Somatic		WXS	Illumina HiSeq	Phase_I	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	ENST00000314250.6	37	CCDS8843.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418345	0.62622	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06	5.2	2.34	0.29019	Phosphatase tensin type (1);	0.062030	0.64402	D	0.000006	D	0.96935	0.8999	N	0.05259	-0.085	0.43683	D	0.996128	D;D;D;D	0.89917	1.0;0.991;1.0;0.997	D;D;D;D	0.75484	0.968;0.957;0.986;0.98	D	0.95934	0.8941	10	0.87932	D	0	-3.0417	9.7567	0.40508	0.0:0.7503:0.0:0.2497	.	241;241;251;248	Q63HR2;F8W661;Q63HR2-4;Q6ZMJ1	TENC1_HUMAN;.;.;.	M	117;251;241;241;241;241;241;241	ENSP00000369232:I117M;ENSP00000319756:I251M;ENSP00000319684:I241M;ENSP00000393362:I241M;ENSP00000449363:I241M;ENSP00000447021:I241M;ENSP00000449361:I241M	ENSP00000319684:I241M	I	+	3	3	TENC1	51735858	0.939000	0.31865	1.000000	0.80357	0.936000	0.57629	0.049000	0.14099	0.710000	0.31997	-0.258000	0.10820	ATC		0.597	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
RBBP6	5930	broad.mit.edu;hgsc.bcm.edu	37	16	24582960	24582960	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr16:24582960delG	ENST00000319715.4	+	18	5005	c.4573delG	c.(4573-4575)ggafs	p.G1525fs	RBBP6_ENST00000381039.3_Frame_Shift_Del_p.G685fs|RBBP6_ENST00000348022.2_Frame_Shift_Del_p.G1491fs	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1525	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GCCTAAAAAAGGAACAGGAGA	0.378																																						.											0													38.0	38.0	38.0					16																	24582960		2197	4297	6494	SO:0001589	frameshift_variant	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4573delG	16.37:g.24582960delG	ENSP00000317872:p.Gly1525fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Frame_Shift_Del	DEL	ENST00000319715.4	37	CCDS10621.1																																																																																				0.378	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
ADCY7	113	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	16	50348998	50348998	+	Silent	SNP	T	T	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr16:50348998T>A	ENST00000394697.2	+	25	3385	c.3045T>A	c.(3043-3045)acT>acA	p.T1015T	ADCY7_ENST00000254235.3_Silent_p.T1015T			P51828	ADCY7_HUMAN	adenylate cyclase 7	1015	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		GGGGAAACACTGTCAATGTGG	0.483																																						.											0													115.0	117.0	116.0					16																	50348998		2198	4300	6498	SO:0001819	synonymous_variant	113			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.3045T>A	16.37:g.50348998T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0AVA6	Silent	SNP	ENST00000394697.2	37	CCDS10741.1																																																																																				0.483	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256877.3		
PLCB1	23236	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	20	8770880	8770880	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr20:8770880G>A	ENST00000338037.6	+	31	3422	c.3395G>A	c.(3394-3396)cGt>cAt	p.R1132H	PLCB1_ENST00000378641.3_Missense_Mutation_p.R1132H|PLCB1_ENST00000378637.2_Missense_Mutation_p.R1132H	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	1132					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AAGGAAATACGTCAGCAGATC	0.338																																						.											0													64.0	64.0	64.0					20																	8770880		2203	4300	6503	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.3395G>A	20.37:g.8770880G>A	ENSP00000338185:p.Arg1132His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848790	0.91277	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719;ENST00000437439	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.98	5.98	0.97165	PLC-beta, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	L	0.44542	1.39	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.63957	0.86;0.92	T	0.49322	-0.8952	10	0.40728	T	0.16	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	1132;1132	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	H	1132;1132;1132;1052;1052;19	ENSP00000367908:R1132H;ENSP00000338185:R1132H;ENSP00000367904:R1132H;ENSP00000389911:R19H	ENSP00000338185:R1132H	R	+	2	0	PLCB1	8718880	1.000000	0.71417	0.559000	0.28332	0.988000	0.76386	6.710000	0.74670	2.835000	0.97688	0.650000	0.86243	CGT		0.338	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
FAM168B	130074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	2	131813240	131813240	+	Silent	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr2:131813240C>T	ENST00000409185.1	-	4	290	c.183G>A	c.(181-183)gtG>gtA	p.V61V	FAM168B_ENST00000389915.3_Silent_p.V61V	NM_001009993.2	NP_001009993.2	A1KXE4	F168B_HUMAN	family with sequence similarity 168, member B	61						cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|lung(2)	5						GGGAACAGGACACTTTGTAAG	0.617																																						.											0													43.0	47.0	46.0					2																	131813240		2037	4191	6228	SO:0001819	synonymous_variant	130074				CCDS42755.1	2q21.1	2008-08-08			ENSG00000152102	ENSG00000152102			27016	protein-coding gene	gene with protein product							Standard	NM_001009993		Approved	KIAA0280L	uc002tsd.3	A1KXE4	OTTHUMG00000153473	ENST00000409185.1:c.183G>A	2.37:g.131813240C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2TAZ6|Q6NZ40	Silent	SNP	ENST00000409185.1	37	CCDS42755.1																																																																																				0.617	FAM168B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331299.2	NM_001009993	
BPIFC	254240	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	22	32831775	32831775	+	Silent	SNP	A	A	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr22:32831775A>T	ENST00000397452.1	-	9	950	c.840T>A	c.(838-840)atT>atA	p.I280I	BPIFC_ENST00000432451.2_Silent_p.I94I|BPIFC_ENST00000534972.1_Silent_p.I4I|BPIFC_ENST00000300399.3_Silent_p.I280I			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	280						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										CGGCGATTCCAATGTAGAGCA	0.498																																						.											0													84.0	88.0	87.0					22																	32831775		2203	4300	6503	SO:0001819	synonymous_variant	254240			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.840T>A	22.37:g.32831775A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRF1	Silent	SNP	ENST00000397452.1	37	CCDS13906.1																																																																																				0.498	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
RMDN2	151393	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	38224599	38224599	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr2:38224599C>T	ENST00000406384.1	+	8	1180	c.986C>T	c.(985-987)aCt>aTt	p.T329I	RMDN2_ENST00000417700.2_Missense_Mutation_p.T184I|RMDN2_ENST00000354545.2_Missense_Mutation_p.T329I|RMDN2_ENST00000407257.1_Missense_Mutation_p.T507I|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000234195.3_Missense_Mutation_p.T507I	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	329						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											ATGGCTGCTACTCTGTTTGGA	0.348																																						.											0													133.0	132.0	132.0					2																	38224599		2203	4300	6503	SO:0001583	missense	151393			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.986C>T	2.37:g.38224599C>T	ENSP00000386004:p.Thr329Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	ENST00000406384.1	37	CCDS54351.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704670	0.68615	.	.	ENSG00000115841	ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857	T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43	5.82	4.93	0.64822	Tetratricopeptide-like helical (1);	0.240802	0.42053	D	0.000768	T	0.49372	0.1553	M	0.67700	2.07	0.40775	D	0.983123	P;D;D;D	0.64830	0.876;0.994;0.987;0.994	P;P;P;P	0.61940	0.743;0.896;0.733;0.896	T	0.49283	-0.8956	10	0.56958	D	0.05	-10.3645	13.0422	0.58906	0.0:0.9204:0.0:0.0796	.	507;184;329;184	Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3	.;.;RMD2_HUMAN;.	I	329;329;507;184;507;184	ENSP00000346549:T329I;ENSP00000386004:T329I;ENSP00000385049:T507I;ENSP00000392977:T184I;ENSP00000234195:T507I;ENSP00000416367:T184I	ENSP00000234195:T507I	T	+	2	0	FAM82A1	38078103	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.722000	0.54948	2.752000	0.94435	0.655000	0.94253	ACT		0.348	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
GOLGA4	2803	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	37360554	37360554	+	Splice_Site	SNP	A	A	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr3:37360554A>T	ENST00000361924.2	+	12	1788	c.1414A>T	c.(1414-1416)Aaa>Taa	p.K472*	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000356847.4_Splice_Site_p.K494*	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	472	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TCATTTTCAGAAATCCTCAGA	0.348																																						.											0													65.0	75.0	72.0					3																	37360554		2203	4300	6503	SO:0001630	splice_region_variant	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1414-1A>T	3.37:g.37360554A>T		Somatic		WXS	Illumina HiSeq	Phase_I	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Nonsense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	41	8.557562	0.98861	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	.	.	.	6.02	6.02	0.97574	.	0.000000	0.38492	N	0.001674	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	.	.	.	X	472;494;343	.	.	K	+	1	0	GOLGA4	37335558	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.396000	0.90190	2.311000	0.77944	0.533000	0.62120	AAA		0.348	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Nonsense_Mutation
UROC1	131669	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	126220079	126220079	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr3:126220079C>T	ENST00000290868.2	-	10	1000	c.947G>A	c.(946-948)gGc>gAc	p.G316D	UROC1_ENST00000383579.3_Missense_Mutation_p.G376D	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	316					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		CACCACGTTGCCATGGTAACC	0.572																																						.											0													241.0	231.0	234.0					3																	126220079		2203	4300	6503	SO:0001583	missense	131669			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.947G>A	3.37:g.126220079C>T	ENSP00000290868:p.Gly316Asp	Somatic		WXS	Illumina HiSeq	Phase_I	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	37	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	c	19.08	3.757346	0.69648	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.63417	-0.04;-0.04	4.94	4.94	0.65067	Urocanase domain (2);	0.000000	0.85682	D	0.000000	D	0.86306	0.5901	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91262	0.5037	10	0.87932	D	0	-9.3404	15.6633	0.77206	0.0:1.0:0.0:0.0	.	376;316	E9PE13;Q96N76	.;HUTU_HUMAN	D	316;376	ENSP00000290868:G316D;ENSP00000373073:G376D	ENSP00000290868:G316D	G	-	2	0	UROC1	127702769	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	7.194000	0.77789	2.300000	0.77407	0.486000	0.48141	GGC		0.572	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	
LARP7	51574	hgsc.bcm.edu	37	4	113565882	113565883	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr4:113565882_113565883insA	ENST00000344442.5	+	2	335_336	c.57_58insA	c.(58-60)aaafs	p.K20fs	MIR302B_ENST00000509938.1_RNA|LARP7_ENST00000509061.1_Frame_Shift_Ins_p.K27fs|MIR302B_ENST00000510655.1_RNA|LARP7_ENST00000324052.6_Frame_Shift_Ins_p.K20fs|MIR302B_ENST00000505215.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	20					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GCACTGAAAAGAAAAAAGAAGT	0.356																																						.											0																																										SO:0001589	frameshift_variant	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.63dupA	4.37:g.113565888_113565888dupA	ENSP00000344950:p.Lys20fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Frame_Shift_Ins	INS	ENST00000344442.5	37	CCDS3701.2																																																																																				0.356	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
PNMA5	114824	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	152159197	152159197	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chrX:152159197G>A	ENST00000439251.1	-	2	1384	c.946C>T	c.(946-948)Ccc>Tcc	p.P316S	PNMA5_ENST00000452693.1_Missense_Mutation_p.P316S|PNMA5_ENST00000361887.5_Missense_Mutation_p.P316S|PNMA5_ENST00000535214.1_Missense_Mutation_p.P316S	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	316					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					AGAAAATTGGGAGGACACCCT	0.532																																						.											0													36.0	37.0	37.0					X																	152159197		2203	4300	6503	SO:0001583	missense	114824			AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.946C>T	X.37:g.152159197G>A	ENSP00000388850:p.Pro316Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	ENST00000439251.1	37	CCDS14718.1	.	.	.	.	.	.	.	.	.	.	g	18.24	3.579632	0.65992	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	3.07	3.07	0.35406	.	.	.	.	.	T	0.64853	0.2636	M	0.84948	2.725	0.20074	N	0.999937	D	0.89917	1.0	D	0.97110	1.0	T	0.52019	-0.8631	9	0.72032	D	0.01	.	8.8853	0.35400	0.0:0.0:1.0:0.0	.	316	Q96PV4	PNMA5_HUMAN	S	316	ENSP00000354834:P316S;ENSP00000445775:P316S;ENSP00000388850:P316S;ENSP00000392342:P316S	ENSP00000354834:P316S	P	-	1	0	PNMA5	151909853	0.970000	0.33590	0.113000	0.21522	0.434000	0.31775	3.652000	0.54439	1.830000	0.53286	0.287000	0.19450	CCC		0.532	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	NM_052926	
DOCK7	85440	hgsc.bcm.edu;bcgsc.ca	37	1	63005305	63005305	+	Missense_Mutation	SNP	T	T	A	rs371894094		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:63005305T>A	ENST00000340370.5	-	26	3135	c.3118A>T	c.(3118-3120)Aat>Tat	p.N1040Y	DOCK7_ENST00000251157.5_Missense_Mutation_p.N1071Y	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1071					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AGGCTTGTATTGAGTCTCTCA	0.348																																						.											0													90.0	100.0	96.0					1																	63005305		2203	4300	6503	SO:0001583	missense	85440				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3118A>T	1.37:g.63005305T>A	ENSP00000340742:p.Asn1040Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.1|25.1	4.602421|4.602421	0.87157|0.87157	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370|ENST00000454575	T;T|.	0.29397|.	1.57;1.57|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83917|0.83917	0.5358|0.5358	M|M	0.90145|0.90145	3.09|3.09	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.91635|.	0.999;0.998;0.997;0.993;0.993|.	D|D	0.87095|0.87095	0.2175|0.2175	10|5	0.87932|.	D|.	0|.	.|.	15.8711|15.8711	0.79119|0.79119	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1071;1040;1040;1040;1071|.	Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6|.	.;.;.;.;.|.	Y|L	1071;1071;1040|242	ENSP00000251157:N1071Y;ENSP00000340742:N1040Y|.	ENSP00000251157:N1071Y|.	N|Q	-|-	1|2	0|0	DOCK7|DOCK7	62777893|62777893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.772000|7.772000	0.85439|0.85439	2.334000|2.334000	0.79466|0.79466	0.528000|0.528000	0.53228|0.53228	AAT|CAA		0.348	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
PTGFRN	5738	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	117491967	117491967	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:117491967G>A	ENST00000393203.2	+	4	1133	c.986G>A	c.(985-987)cGc>cAc	p.R329H		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	329	Ig-like C2-type 3.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CCTGGCTCCCGCGTGTTGGCG	0.592																																						.											0													111.0	92.0	99.0					1																	117491967		2203	4300	6503	SO:0001583	missense	5738			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.986G>A	1.37:g.117491967G>A	ENSP00000376899:p.Arg329His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014082	0.19277	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.66460	-0.21	5.57	-9.03	0.00737	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.709830	0.14938	N	0.289670	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.12156	0.007	T	0.14227	-1.0480	10	0.42905	T	0.14	-4.1024	8.1169	0.30948	0.2011:0.1105:0.5803:0.1082	.	329	Q9P2B2	FPRP_HUMAN	H	329;188	ENSP00000376899:R329H	ENSP00000376899:R329H	R	+	2	0	PTGFRN	117293490	0.000000	0.05858	0.000000	0.03702	0.655000	0.38815	0.091000	0.15046	-2.101000	0.00846	-0.291000	0.09656	CGC		0.592	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
SDHA	6389	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	256467	256467	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr5:256467C>G	ENST00000264932.6	+	15	2042	c.1927C>G	c.(1927-1929)Ccc>Gcc	p.P643A	SDHA_ENST00000504309.1_Missense_Mutation_p.P562A|SDHA_ENST00000510361.1_Missense_Mutation_p.P595A|SDHA_ENST00000507522.1_3'UTR	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	643					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GGAATATAGACCCGTGATCGA	0.433									Familial Paragangliomas																													.											0													93.0	105.0	101.0					5																	256467		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1927C>G	5.37:g.256467C>G	ENSP00000264932:p.Pro643Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	N|N|N	12.65|12.65|12.65	2.002169|2.002169|2.002169	0.35320|0.35320|0.35320	.|.|.	.|.|.	ENSG00000073578|ENSG00000073578|ENSG00000073578	ENST00000509564|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361|ENST00000515815	D|D;D;D|.	0.84660|0.83419|.	-1.88|-1.72;-1.72;-1.72|.	4.12|4.12|4.12	4.12|4.12|4.12	0.48240|0.48240|0.48240	.|Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (1);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);|.	.|0.000000|.	.|0.85682|.	.|U|.	.|0.000000|.	T|T|T	0.75133|0.75133|0.75133	0.3808|0.3808|0.3808	M|M|M	0.79693|0.79693|0.79693	2.465|2.465|2.465	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B;D;D;B|.	.|0.69078|.	.|0.299;0.994;0.997;0.094|.	.|B;P;D;B|.	.|0.77004|.	.|0.219;0.835;0.989;0.037|.	T|T|T	0.77525|0.77525|0.77525	-0.2555|-0.2555|-0.2555	7|10|5	0.87932|0.48119|.	D|T|.	0|0.1|.	.|.|.	13.8591|13.8591|13.8591	0.63548|0.63548|0.63548	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|595;237;562;643|.	.|E9PBJ5;B3KYA5;D6RFM5;P31040|.	.|.;.;.;DHSA_HUMAN|.	E|A|S	100|643;498;562;595|125	ENSP00000421911:D100E|ENSP00000264932:P643A;ENSP00000426514:P562A;ENSP00000427703:P595A|.	ENSP00000421911:D100E|ENSP00000264932:P643A|.	D|P|T	+|+|+	3|1|2	2|0|0	SDHA|SDHA|SDHA	309467|309467|309467	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.982000|0.982000|0.982000	0.44146|0.44146|0.44146	0.264000|0.264000|0.264000	0.26372|0.26372|0.26372	6.951000|6.951000|6.951000	0.75983|0.75983|0.75983	1.861000|1.861000|1.861000	0.53984|0.53984|0.53984	0.305000|0.305000|0.305000	0.20034|0.20034|0.20034	GAC|CCC|ACC		0.433	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
AGRN	375790	broad.mit.edu	37	1	983491	983493	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:983491_983493delTGA	ENST00000379370.2	+	23	3901_3903	c.3851_3853delTGA	c.(3850-3855)gtgacc>gcc	p.1284_1285VT>A		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1284	Ser/Thr-rich.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCCTCTGCTGTGACCCCTCGGGC	0.695																																						.											0																																										SO:0001651	inframe_deletion	375790			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.3851_3853delTGA	1.37:g.983491_983493delTGA	ENSP00000368678:p.Val1284_Thr1285delinsAla	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	In_Frame_Del	DEL	ENST00000379370.2	37	CCDS30551.1																																																																																				0.695	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
CROCC	9696	broad.mit.edu	37	1	17280821	17280821	+	Missense_Mutation	SNP	G	G	C	rs6669627	byFrequency	TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:17280821G>C	ENST00000375541.5	+	22	3359	c.3290G>C	c.(3289-3291)cGa>cCa	p.R1097P	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CGGCAGAAACGAGATGCCCAG	0.627																																						.											0													43.0	48.0	46.0					1																	17280821		2203	4300	6503	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3290G>C	1.37:g.17280821G>C	ENSP00000364691:p.Arg1097Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	18	0.008241758241758242	4	0.008130081300813009	3	0.008287292817679558	2	0.0034965034965034965	9	0.011873350923482849	G	17.39	3.377554	0.61735	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.56941	0.43	4.5	4.5	0.54988	.	.	.	.	.	T	0.65749	0.2721	M	0.77313	2.365	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.72839	-0.4171	9	0.52906	T	0.07	.	15.5037	0.75722	0.0:0.0:1.0:0.0	rs6669627	960;400;1097	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	P	1097;978	ENSP00000364691:R1097P	ENSP00000364691:R1097P	R	+	2	0	CROCC	17153408	0.997000	0.39634	1.000000	0.80357	0.750000	0.42670	2.928000	0.48908	2.428000	0.82296	0.561000	0.74099	CGA		0.627	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
GJB3	2707	broad.mit.edu	37	1	35250386	35250386	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:35250386C>A	ENST00000373366.2	+	2	638	c.23C>A	c.(22-24)gCc>gAc	p.A8D	RP1-34M23.5_ENST00000542839.1_RNA|GJB3_ENST00000373362.3_Missense_Mutation_p.A8D	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	8					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				ACACTCCAGGCCCTACTGAGC	0.552																																						.											0													88.0	69.0	76.0					1																	35250386		2203	4300	6503	SO:0001583	missense	2707			BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	ENST00000373366.2:c.23C>A	1.37:g.35250386C>A	ENSP00000362464:p.Ala8Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2R790|Q2TAZ8	Missense_Mutation	SNP	ENST00000373366.2	37	CCDS384.1	.	.	.	.	.	.	.	.	.	.	c	0.018	-1.467938	0.01053	.	.	ENSG00000188910	ENST00000373366;ENST00000373362;ENST00000543647	D;D	0.99089	-5.41;-5.41	5.85	-1.61	0.08399	Connexin, N-terminal (1);	0.621249	0.16477	N	0.212733	D	0.95459	0.8525	N	0.17723	0.515	0.09310	N	1	B	0.06786	0.001	B	0.15484	0.013	D	0.85997	0.1492	10	0.12430	T	0.62	.	14.2953	0.66308	0.2538:0.1754:0.5708:0.0	.	8	O75712	CXB3_HUMAN	D	8	ENSP00000362464:A8D;ENSP00000362460:A8D	ENSP00000362460:A8D	A	+	2	0	GJB3	35022973	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.592000	0.05747	-0.458000	0.07023	-1.131000	0.01979	GCC		0.552	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011559.1	NM_024009	
BCAN	63827	broad.mit.edu	37	1	156622489	156622489	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:156622489G>A	ENST00000329117.5	+	8	2083	c.1747G>A	c.(1747-1749)Gag>Aag	p.E583K	BCAN_ENST00000361588.5_Missense_Mutation_p.E583K|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	583					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGGAGAGAGCGAGGAGACAGG	0.622																																						.											0													51.0	54.0	53.0					1																	156622489		2203	4300	6503	SO:0001583	missense	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1747G>A	1.37:g.156622489G>A	ENSP00000331210:p.Glu583Lys	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334596	0.81801	.	.	ENSG00000132692	ENST00000329117;ENST00000361588	T;T	0.14391	2.51;3.14	4.29	4.29	0.51040	.	0.275036	0.21601	N	0.071951	T	0.09905	0.0243	N	0.24115	0.695	0.40596	D	0.981538	D;D	0.71674	0.957;0.998	B;P	0.57846	0.284;0.828	T	0.17531	-1.0366	10	0.30854	T	0.27	-13.5208	12.1032	0.53796	0.0:0.0:1.0:0.0	.	583;583	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	K	583	ENSP00000331210:E583K;ENSP00000354925:E583K	ENSP00000331210:E583K	E	+	1	0	BCAN	154889113	0.986000	0.35501	0.998000	0.56505	0.793000	0.44817	3.354000	0.52254	2.228000	0.72767	0.455000	0.32223	GAG		0.622	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
OR5M3	219482	broad.mit.edu	37	11	56237919	56237919	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:56237919G>A	ENST00000312240.2	-	1	95	c.55C>T	c.(55-57)Cga>Tga	p.R19*		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TGCCATTCTCGACGGCTCGTT	0.403																																						.											0													80.0	70.0	74.0					11																	56237919		2201	4295	6496	SO:0001587	stop_gained	219482			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.55C>T	11.37:g.56237919G>A	ENSP00000312208:p.Arg19*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNM7|Q6IEW4|Q96RC0	Nonsense_Mutation	SNP	ENST00000312240.2	37	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.265447	0.23136	.	.	ENSG00000174937	ENST00000312240	.	.	.	5.0	1.8	0.24995	.	1.011540	0.07959	N	0.982069	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	1.5831	7.0203	0.24910	0.0845:0.0:0.6007:0.3148	.	.	.	.	X	19	.	ENSP00000312208:R19X	R	-	1	2	OR5M3	55994495	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.043000	0.13971	0.462000	0.27095	0.478000	0.44815	CGA		0.403	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
FAT3	120114	broad.mit.edu	37	11	92531376	92531376	+	Missense_Mutation	SNP	C	C	T	rs374615122		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:92531376C>T	ENST00000298047.6	+	9	5214	c.5197C>T	c.(5197-5199)Cgc>Tgc	p.R1733C	FAT3_ENST00000409404.2_Missense_Mutation_p.R1733C|FAT3_ENST00000525166.1_Missense_Mutation_p.R1583C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1733	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGATTATGAGCGCACATCCTC	0.403										TCGA Ovarian(4;0.039)			C|||	1	0.000199681	0.0	0.0	5008	,	,		21623	0.0		0.0	False		,,,				2504	0.001					.											0								C	CYS/ARG	0,3938		0,0,1969	91.0	88.0	89.0		5197	5.9	0.9	11		89	1,8341		0,1,4170	no	missense	FAT3	NM_001008781.2	180	0,1,6139	TT,TC,CC		0.012,0.0,0.0081	possibly-damaging	1733/4558	92531376	1,12279	1969	4171	6140	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5197C>T	11.37:g.92531376C>T	ENSP00000298047:p.Arg1733Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	19.26	3.792567	0.70452	0.0	1.2E-4	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.52983	0.64;0.64;0.64	5.93	5.93	0.95920	.	.	.	.	.	T	0.55970	0.1954	M	0.81112	2.525	0.80722	D	1	D	0.55385	0.971	P	0.45138	0.471	T	0.62798	-0.6778	9	0.56958	D	0.05	.	15.0942	0.72220	0.1416:0.8584:0.0:0.0	.	1733	Q8TDW7-3	.	C	1733;1733;1583	ENSP00000298047:R1733C;ENSP00000387040:R1733C;ENSP00000432586:R1583C	ENSP00000298047:R1733C	R	+	1	0	FAT3	92171024	0.805000	0.28982	0.912000	0.35992	0.897000	0.52465	1.595000	0.36708	2.818000	0.97014	0.591000	0.81541	CGC		0.403	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
LPAR5	57121	broad.mit.edu	37	12	6729661	6729663	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr12:6729661_6729663delTGT	ENST00000329858.4	-	2	1508_1510	c.752_754delACA	c.(751-756)aacagc>agc	p.N251del	LPAR5_ENST00000431922.1_In_Frame_Del_p.N251del|LPAR5_ENST00000540335.1_5'UTR	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						GCCAGCGTGCTGTTGTAGGGCAC	0.7																																					NSCLC(74;891 2312 37538)	.											0																																										SO:0001651	inframe_deletion	57121			AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0		ENST00000329858.4:c.752_754delACA	12.37:g.6729664_6729666delTGT	ENSP00000327875:p.Asn251del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000329858.4	37	CCDS8553.1																																																																																				0.700	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400699.1	NM_020400	
TUBA3C	7278	broad.mit.edu	37	13	19751676	19751676	+	Silent	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr13:19751676G>A	ENST00000400113.3	-	4	551	c.447C>T	c.(445-447)ttC>ttT	p.F149F		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	149					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GCAGAGATGCGAACCCAGAGC	0.567																																						.											0													71.0	73.0	72.0					13																	19751676		2203	4300	6503	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.447C>T	13.37:g.19751676G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				0.567	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
EBPL	84650	broad.mit.edu	37	13	50235138	50235138	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr13:50235138T>G	ENST00000242827.6	-	4	637	c.587A>C	c.(586-588)cAg>cCg	p.Q196P	EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378270.5_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	196					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.Q196P(2)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		GGTTTCTTTCTGATGCATTTT	0.383																																					NSCLC(39;857 1083 36109 42364 51411)	.											2	Substitution - Missense(2)	endometrium(2)											73.0	73.0	73.0					13																	50235138		2203	4300	6503	SO:0001583	missense	84650			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.587A>C	13.37:g.50235138T>G	ENSP00000242827:p.Gln196Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.722268	0.48728	.	.	ENSG00000123179	ENST00000242827	D	0.97994	-4.65	5.61	-2.45	0.06481	.	1.466260	0.03646	N	0.240220	D	0.94876	0.8344	L	0.47716	1.5	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	D	0.86530	0.1821	10	0.30078	T	0.28	-0.1548	6.1064	0.20075	0.3657:0.0:0.2518:0.3825	.	196	Q9BY08	EBPL_HUMAN	P	196	ENSP00000242827:Q196P	ENSP00000242827:Q196P	Q	-	2	0	EBPL	49133139	0.002000	0.14202	0.003000	0.11579	0.996000	0.88848	-0.059000	0.11731	-0.151000	0.11176	0.528000	0.53228	CAG		0.383	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr13:50235160G>C	ENST00000242827.6	-	4	615	c.565C>G	c.(565-567)Cta>Gta	p.L189V	EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378270.5_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	189					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.L189V(9)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418																																					NSCLC(39;857 1083 36109 42364 51411)	.											9	Substitution - Missense(9)	endometrium(6)|kidney(3)											67.0	67.0	67.0					13																	50235160		2203	4300	6503	SO:0001583	missense	84650			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.565C>G	13.37:g.50235160G>C	ENSP00000242827:p.Leu189Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	3.076	-0.189988	0.06299	.	.	ENSG00000123179	ENST00000242827	D	0.97850	-4.57	5.61	2.84	0.33178	.	0.689671	0.14945	N	0.289287	D	0.88179	0.6367	N	0.00621	-1.32	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.79482	-0.1785	10	0.25751	T	0.34	-0.2032	8.3049	0.32036	0.0:0.4998:0.3595:0.1406	.	189	Q9BY08	EBPL_HUMAN	V	189	ENSP00000242827:L189V	ENSP00000242827:L189V	L	-	1	2	EBPL	49133161	0.000000	0.05858	0.303000	0.25071	0.899000	0.52679	-1.071000	0.03437	0.397000	0.25310	-0.127000	0.14921	CTA		0.418	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
TSR1	55720	broad.mit.edu	37	17	2228035	2228035	+	Silent	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr17:2228035A>G	ENST00000301364.5	-	13	3188	c.2109T>C	c.(2107-2109)ccT>ccC	p.P703P	SRR_ENST00000344595.5_3'UTR	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	703					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						AAATTTTGAAAGGATGACCAC	0.418																																						.											0													119.0	119.0	119.0					17																	2228035		2203	4300	6503	SO:0001819	synonymous_variant	55720			AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.2109T>C	17.37:g.2228035A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8WUY5|Q9NVT0|Q9P2E6	Silent	SNP	ENST00000301364.5	37	CCDS32525.1																																																																																				0.418	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438180.2	NM_018128	
PLA2R1	22925	broad.mit.edu	37	2	160807853	160807853	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr2:160807853C>T	ENST00000283243.7	-	24	3744	c.3538G>A	c.(3538-3540)Gat>Aat	p.D1180N	PLA2R1_ENST00000392771.1_Missense_Mutation_p.D1180N	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1180	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ATACCTACATCTGTGGTGAAC	0.448																																						.											0													156.0	145.0	149.0					2																	160807853		2203	4300	6503	SO:0001583	missense	22925			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3538G>A	2.37:g.160807853C>T	ENSP00000283243:p.Asp1180Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572165	0.28092	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.18810	2.19;2.19	4.94	3.13	0.36017	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.332772	0.32028	N	0.006692	T	0.23649	0.0572	L	0.52206	1.635	0.48452	D	0.999656	B;B;B	0.28470	0.032;0.104;0.213	B;B;B	0.38106	0.182;0.126;0.265	T	0.03534	-1.1027	10	0.28530	T	0.3	.	11.2165	0.48830	0.0:0.8504:0.0:0.1496	.	1180;1180;1180	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	N	1180	ENSP00000283243:D1180N;ENSP00000376524:D1180N	ENSP00000283243:D1180N	D	-	1	0	PLA2R1	160516099	0.995000	0.38212	0.785000	0.31869	0.242000	0.25591	2.858000	0.48356	0.782000	0.33613	0.557000	0.71058	GAT		0.448	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PECR	55825	broad.mit.edu;bcgsc.ca	37	2	216946400	216946400	+	Missense_Mutation	SNP	A	A	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr2:216946400A>C	ENST00000265322.7	-	1	139	c.65T>G	c.(64-66)aTc>aGc	p.I22S	TMEM169_ENST00000437356.2_5'Flank|TMEM169_ENST00000406027.2_5'Flank|PECR_ENST00000497889.1_5'UTR|TMEM169_ENST00000295658.4_5'Flank|TMEM169_ENST00000454545.1_5'Flank	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	22				I -> F (in Ref. 2; CAB89810). {ECO:0000305}.	fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	GCCGGTGACGATGGCCACTTG	0.682																																						.											0													36.0	36.0	36.0					2																	216946400		2201	4299	6500	SO:0001583	missense	55825			AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.65T>G	2.37:g.216946400A>C	ENSP00000265322:p.Ile22Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Missense_Mutation	SNP	ENST00000265322.7	37	CCDS33375.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.828406	0.90955	.	.	ENSG00000115425	ENST00000265322	T	0.26957	1.7	4.53	4.53	0.55603	NAD(P)-binding domain (1);	0.177601	0.49305	D	0.000144	T	0.52964	0.1767	M	0.87900	2.915	0.47698	D	0.999492	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.952	T	0.60084	-0.7332	10	0.87932	D	0	.	10.1616	0.42855	1.0:0.0:0.0:0.0	.	22;22	B4DJS2;Q9BY49	.;PECR_HUMAN	S	22	ENSP00000265322:I22S	ENSP00000265322:I22S	I	-	2	0	PECR	216654645	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.217000	0.58547	1.905000	0.55150	0.460000	0.39030	ATC		0.682	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
CAV3	859	broad.mit.edu	37	3	8775578	8775578	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr3:8775578C>T	ENST00000343849.2	+	1	93	c.16C>T	c.(16-18)Cac>Tac	p.H6Y	SSUH2_ENST00000478513.1_Intron|CAV3_ENST00000472766.1_3'UTR|CAV3_ENST00000397368.2_Missense_Mutation_p.H6Y	NM_001234.4|NM_033337.2	NP_001225.1|NP_203123.1	P56539	CAV3_HUMAN	caveolin 3	6					actin filament organization (GO:0007015)|cardiac muscle cell development (GO:0055013)|caveola assembly (GO:0070836)|cell differentiation (GO:0030154)|cell growth (GO:0016049)|cholesterol homeostasis (GO:0042632)|cytoplasmic microtubule organization (GO:0031122)|endocytosis (GO:0006897)|establishment of protein localization to plasma membrane (GO:0090002)|glucose homeostasis (GO:0042593)|heart trabecula formation (GO:0060347)|membrane raft organization (GO:0031579)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of cell size (GO:0045792)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sarcomere organization (GO:0060299)|nucleus localization (GO:0051647)|plasma membrane organization (GO:0007009)|plasma membrane repair (GO:0001778)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein localization (GO:0008104)|protein localization to plasma membrane (GO:0072659)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of calcium ion import (GO:0090279)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart contraction (GO:0008016)|regulation of heart rate (GO:0002027)|regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900825)|regulation of membrane potential (GO:0042391)|regulation of nerve growth factor receptor activity (GO:0051394)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase B signaling (GO:0051896)|regulation of signal transduction by receptor internalization (GO:0038009)|regulation of skeletal muscle contraction (GO:0014819)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|T-tubule organization (GO:0033292)|triglyceride metabolic process (GO:0006641)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|dystrophin-associated glycoprotein complex (GO:0016010)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|connexin binding (GO:0071253)|ion channel binding (GO:0044325)|potassium channel inhibitor activity (GO:0019870)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein complex scaffold (GO:0032947)|sodium channel regulator activity (GO:0017080)			breast(1)|kidney(2)|large_intestine(4)|lung(3)|prostate(1)	11						GGCAGAAGAGCACACAGATCT	0.547																																						.											0													107.0	92.0	97.0					3																	8775578		2203	4300	6503	SO:0001583	missense	859			AF043101	CCDS2569.1	3p25	2014-09-17			ENSG00000182533	ENSG00000182533			1529	protein-coding gene	gene with protein product	"""M-caveolin"""	601253				9536092, 9537420	Standard	NM_033337		Approved	VIP-21, LGMD1C, VIP21, LQT9	uc003brb.3	P56539	OTTHUMG00000090519	ENST00000343849.2:c.16C>T	3.37:g.8775578C>T	ENSP00000341940:p.His6Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K777|Q3T1A4	Missense_Mutation	SNP	ENST00000343849.2	37	CCDS2569.1	.	.	.	.	.	.	.	.	.	.	C	0.274	-0.990711	0.02162	.	.	ENSG00000182533	ENST00000343849;ENST00000397368	D;D	0.91945	-2.94;-2.94	5.08	4.19	0.49359	.	0.287903	0.34435	N	0.003971	T	0.77136	0.4086	N	0.00926	-1.1	0.29110	N	0.88096	B	0.02656	0.0	B	0.01281	0.0	T	0.69826	-0.5040	10	0.36615	T	0.2	-20.4026	11.9305	0.52843	0.1742:0.8258:0.0:0.0	.	6	P56539	CAV3_HUMAN	Y	6	ENSP00000341940:H6Y;ENSP00000380525:H6Y	ENSP00000341940:H6Y	H	+	1	0	CAV3	8750578	0.809000	0.29036	0.988000	0.46212	0.251000	0.25915	1.119000	0.31258	1.106000	0.41623	0.511000	0.50034	CAC		0.547	CAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207008.2	NM_033337	
FGA	2243	broad.mit.edu;mdanderson.org;bcgsc.ca	37	4	155506759	155506759	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr4:155506759C>T	ENST00000302053.3	-	5	1900	c.1822G>A	c.(1822-1824)Gga>Aga	p.G608R	FGA_ENST00000403106.3_Missense_Mutation_p.G608R	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	608					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GCTTCACTTCCGGCCTCATCT	0.453																																					NSCLC(143;340 1922 20892 22370 48145)	.											0													146.0	134.0	138.0					4																	155506759		2203	4300	6503	SO:0001583	missense	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1822G>A	4.37:g.155506759C>T	ENSP00000306361:p.Gly608Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757512	0.69648	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.56776	0.44;2.88	5.5	4.66	0.58398	.	5.596130	0.00166	N	0.000001	T	0.64800	0.2631	L	0.50333	1.59	0.09310	N	1	D;D	0.63880	0.993;0.987	P;P	0.52424	0.698;0.502	T	0.54536	-0.8279	10	0.42905	T	0.14	.	13.9898	0.64359	0.1516:0.8484:0.0:0.0	.	608;608	P02671-2;P02671	.;FIBA_HUMAN	R	608	ENSP00000306361:G608R;ENSP00000385981:G608R	ENSP00000306361:G608R	G	-	1	0	FGA	155726209	0.003000	0.15002	0.002000	0.10522	0.146000	0.21551	1.715000	0.37971	1.549000	0.49425	-0.152000	0.13540	GGA		0.453	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
PCDHGA8	9708	broad.mit.edu	37	5	140774176	140774176	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr5:140774176G>T	ENST00000398604.2	+	1	1796	c.1796G>T	c.(1795-1797)gGc>gTc	p.G599V	PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G599V(3)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.706																																						.											3	Substitution - Missense(3)	kidney(3)																																								SO:0001583	missense	9708			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1796G>T	5.37:g.140774176G>T	ENSP00000381605:p.Gly599Val	Somatic		WXS	Illumina HiSeq	Phase_I	A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	18.62	3.662262	0.67700	.	.	ENSG00000253767	ENST00000398604	T	0.21361	2.01	4.96	4.96	0.65561	Cadherin (4);Cadherin-like (1);	0.000000	0.31624	U	0.007336	T	0.68751	0.3035	H	0.99697	4.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85054	0.0930	10	0.87932	D	0	.	17.843	0.88720	0.0:0.0:1.0:0.0	.	599;599	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	V	599	ENSP00000381605:G599V	ENSP00000381605:G599V	G	+	2	0	PCDHGA8	140754360	1.000000	0.71417	0.974000	0.42286	0.997000	0.91878	7.609000	0.82925	2.308000	0.77769	0.655000	0.94253	GGC		0.706	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
VARS2	57176	broad.mit.edu	37	6	30889464	30889464	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr6:30889464G>C	ENST00000321897.5	+	17	2363	c.1731G>C	c.(1729-1731)gaG>gaC	p.E577D	VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000416670.2_Missense_Mutation_p.E577D|VARS2_ENST00000542001.1_Missense_Mutation_p.E437D|VARS2_ENST00000541562.1_Missense_Mutation_p.E607D			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	577					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TGACCCTGGAGAGGGGTGAGT	0.632																																						.											0													20.0	19.0	20.0					6																	30889464		1508	2707	4215	SO:0001583	missense	57176			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1731G>C	6.37:g.30889464G>C	ENSP00000316092:p.Glu577Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519454	0.44866	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.05	4.18	0.49190	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.234323	0.43110	D	0.000602	T	0.21347	0.0514	M	0.67700	2.07	0.29534	N	0.852599	B;B;B	0.20780	0.048;0.039;0.018	B;B;B	0.25506	0.061;0.048;0.018	T	0.21861	-1.0233	10	0.87932	D	0	-5.4286	10.9229	0.47176	0.0919:0.0:0.9081:0.0	.	575;607;577	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	D	577;577;437;607	ENSP00000316092:E577D;ENSP00000394802:E577D;ENSP00000438200:E437D;ENSP00000441000:E607D	ENSP00000316092:E577D	E	+	3	2	VARS2	30997443	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	3.455000	0.52993	1.124000	0.41980	0.555000	0.69702	GAG		0.632	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
DLX6	1750	broad.mit.edu	37	7	96635389	96635391	+	In_Frame_Del	DEL	CAG	CAG	-	rs35478952		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr7:96635389_96635391delCAG	ENST00000518156.2	+	1	530_532	c.100_102delCAG	c.(100-102)cagdel	p.Q44del	DLX6-AS1_ENST00000431497.2_RNA|DLX6_ENST00000007660.5_Intron|DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000458352.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	0					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					gcagcagcaacagcagcagcagc	0.68																																						.											0										71,2005		9,53,976						-0.1	1.0			6	237,4797		8,221,2288	no	coding	DLX6	NM_005222.3		17,274,3264	A1A1,A1R,RR		4.708,3.42,4.3319				308,6802				SO:0001651	inframe_deletion	1750				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.100_102delCAG	7.37:g.96635398_96635400delCAG	ENSP00000428480:p.Gln44del	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	In_Frame_Del	DEL	ENST00000518156.2	37	CCDS47647.2																																																																																				0.680	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222	
RPGR	6103	broad.mit.edu	37	X	38145423	38145423	+	Intron	DEL	A	A	-	rs201655057		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chrX:38145423delA	ENST00000339363.3	-	14	2688				RPGR_ENST00000309513.3_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000378505.2_Frame_Shift_Del_p.D943fs|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ccccttctccatcctcccctt	0.612																																						.											0													6.0	4.0	4.0					X																	38145423		1681	3119	4800	SO:0001627	intron_variant	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+923T>-	X.37:g.38145423delA		Somatic		WXS	Illumina HiSeq	Phase_I	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Frame_Shift_Del	DEL	ENST00000339363.3	37																																																																																					0.612	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
MAGEC1	9947	broad.mit.edu	37	X	140994357	140994357	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chrX:140994357C>A	ENST00000285879.4	+	4	1453	c.1167C>A	c.(1165-1167)ttC>ttA	p.F389L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	389										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGTCTTTTCCAGAGTTCCC	0.488										HNSCC(15;0.026)																												.											0													103.0	112.0	109.0					X																	140994357		2203	4294	6497	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1167C>A	X.37:g.140994357C>A	ENSP00000285879:p.Phe389Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	2.057	-0.416395	0.04766	.	.	ENSG00000155495	ENST00000285879	T	0.02085	4.46	.	.	.	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	0.09310	N	0.999999	B	0.17667	0.023	B	0.09377	0.004	T	0.46555	-0.9183	8	0.87932	D	0	.	5.9409	0.19192	0.0:0.9994:0.0:6.0E-4	.	389	O60732	MAGC1_HUMAN	L	389	ENSP00000285879:F389L	ENSP00000285879:F389L	F	+	3	2	MAGEC1	140822023	0.064000	0.20934	0.054000	0.19295	0.054000	0.15201	0.203000	0.17315	0.148000	0.19059	0.150000	0.16122	TTC		0.488	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
AAK1	22848	ucsc.edu	37	2	69732801	69732801	+	Silent	SNP	T	T	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr2:69732801T>C	ENST00000409085.4	-	16	2545	c.2169A>G	c.(2167-2169)aaA>aaG	p.K723K	AAK1_ENST00000409068.1_Intron|AAK1_ENST00000406297.3_Silent_p.K723K	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	723					endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						TCTCGGGATGTTTGCCTGGAG	0.493																																						.											0													59.0	60.0	60.0					2																	69732801		1933	4128	6061	SO:0001819	synonymous_variant	22848			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.2169A>G	2.37:g.69732801T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q4ZFZ3|Q53RX6|Q9UPV4	Silent	SNP	ENST00000409085.4	37	CCDS1893.2																																																																																				0.493	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
CEND1	51286	ucsc.edu	37	11	788570	788570	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:788570A>G	ENST00000330106.4	-	2	182	c.7T>C	c.(7-9)Tcc>Ccc	p.S3P	CEND1_ENST00000524587.1_Intron	NM_016564.3	NP_057648.2	Q8N111	CEND_HUMAN	cell cycle exit and neuronal differentiation 1	3					adult walking behavior (GO:0007628)|cerebellar granular layer maturation (GO:0021686)|cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|radial glia guided migration of cerebellar granule cell (GO:0021933)	integral component of membrane (GO:0016021)				prostate(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCCCTCTGGACTCCATGGTG	0.667																																						.											0													52.0	67.0	62.0					11																	788570		2170	4253	6423	SO:0001583	missense	51286			AK074547	CCDS7714.1	11p15.5	2006-06-14			ENSG00000184524	ENSG00000184524			24153	protein-coding gene	gene with protein product		608213				11311134	Standard	NM_016564		Approved	FLJ90066, BM88	uc001lrh.1	Q8N111	OTTHUMG00000133308	ENST00000330106.4:c.7T>C	11.37:g.788570A>G	ENSP00000328336:p.Ser3Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NYM6	Missense_Mutation	SNP	ENST00000330106.4	37	CCDS7714.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.682094	0.68042	.	.	ENSG00000184524	ENST00000330106	.	.	.	4.63	1.98	0.26296	.	0.093185	0.44285	D	0.000462	T	0.52092	0.1713	L	0.29908	0.895	0.41335	D	0.987262	D	0.61080	0.989	P	0.58454	0.839	T	0.54536	-0.8279	9	0.87932	D	0	-11.3684	9.6985	0.40171	0.6721:0.3279:0.0:0.0	.	3	Q8N111	CEND_HUMAN	P	3	.	ENSP00000328336:S3P	S	-	1	0	CEND1	778570	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	1.336000	0.33850	0.685000	0.31468	0.379000	0.24179	TCC		0.667	CEND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257105.1	NM_016564	
COL20A1	57642	ucsc.edu	37	20	61950862	61950862	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr20:61950862T>C	ENST00000358894.6	+	23	2930	c.2830T>C	c.(2830-2832)Ttc>Ctc	p.F944L	COL20A1_ENST00000326996.6_Missense_Mutation_p.F944L|COL20A1_ENST00000435874.1_Missense_Mutation_p.F951L|COL20A1_ENST00000422202.1_Missense_Mutation_p.F951L	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	944	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CCTGACCTACTTCCACCGTGA	0.637																																						.											0													27.0	30.0	29.0					20																	61950862		1985	4152	6137	SO:0001583	missense	57642			BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2830T>C	20.37:g.61950862T>C	ENSP00000351767:p.Phe944Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.183948	0.57800	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202;ENST00000415763	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03	4.12	4.12	0.48240	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.061074	0.64402	D	0.000003	T	0.46833	0.1413	M	0.82323	2.585	0.44380	D	0.997287	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.989	T	0.51841	-0.8654	10	0.87932	D	0	.	10.6802	0.45811	0.0:0.0:0.0:1.0	.	951;944	Q9P218-2;Q9P218	.;COKA1_HUMAN	L	944;944;951;951;47	ENSP00000351767:F944L;ENSP00000323077:F944L;ENSP00000408690:F951L;ENSP00000414753:F951L;ENSP00000410799:F47L	ENSP00000323077:F944L	F	+	1	0	COL20A1	61421307	1.000000	0.71417	0.998000	0.56505	0.134000	0.20937	3.596000	0.54024	1.512000	0.48834	0.260000	0.18958	TTC		0.637	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
DCAF4	26094	ucsc.edu	37	14	73425508	73425508	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr14:73425508A>G	ENST00000358377.2	+	14	1703	c.1483A>G	c.(1483-1485)Agc>Ggc	p.S495G	DCAF4_ENST00000509153.1_Missense_Mutation_p.S435G|DCAF4_ENST00000555042.1_Missense_Mutation_p.S489G|DCAF4_ENST00000353777.3_Missense_Mutation_p.S325G|DCAF4_ENST00000394234.2_Missense_Mutation_p.S395G	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	495					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						TTACTCCTACAGCTAATTCTG	0.562																																						.											0													39.0	46.0	43.0					14																	73425508		2201	4296	6497	SO:0001583	missense	26094			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.1483A>G	14.37:g.73425508A>G	ENSP00000351147:p.Ser495Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	ENST00000358377.2	37	CCDS9809.1	.	.	.	.	.	.	.	.	.	.	A	11.80	1.747798	0.30955	.	.	ENSG00000119599	ENST00000358377;ENST00000353777;ENST00000394234;ENST00000509153;ENST00000555042	T;T;T;T;T	0.68479	0.39;-0.33;-0.01;0.41;-0.01	4.92	3.73	0.42828	.	0.243282	0.46758	N	0.000269	T	0.51176	0.1659	N	0.22421	0.69	0.80722	D	1	B;B;B;P;B	0.49559	0.245;0.245;0.239;0.925;0.245	B;B;B;B;B	0.42062	0.118;0.08;0.167;0.374;0.08	T	0.54016	-0.8356	10	0.66056	D	0.02	.	9.8467	0.41032	0.914:0.0:0.086:0.0	.	435;474;489;325;495	B4DUT6;B4DN30;G3V522;Q86SY2;Q8WV16	.;.;.;.;DCAF4_HUMAN	G	495;325;395;435;489	ENSP00000351147:S495G;ENSP00000345176:S325G;ENSP00000377781:S395G;ENSP00000426178:S435G;ENSP00000452131:S489G	ENSP00000345176:S325G	S	+	1	0	DCAF4	72495261	1.000000	0.71417	0.566000	0.28421	0.027000	0.11550	3.391000	0.52530	0.857000	0.35407	-0.366000	0.07423	AGC		0.562	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
FAM20A	54757	ucsc.edu	37	17	66538262	66538262	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr17:66538262T>C	ENST00000592554.1	-	7	1695	c.973A>G	c.(973-975)Acg>Gcg	p.T325A	PRKAR1A_ENST00000588188.2_Intron|AC079210.1_ENST00000600820.1_5'Flank|FAM20A_ENST00000226094.5_5'UTR	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	325					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					GCATACTCCGTCTTGCACATG	0.602																																						.											0													111.0	85.0	94.0					17																	66538262		2203	4300	6503	SO:0001583	missense	54757			AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.973A>G	17.37:g.66538262T>C	ENSP00000468308:p.Thr325Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN47|B2RN49|Q9UF95	Missense_Mutation	SNP	ENST00000592554.1	37	CCDS11679.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469067	0.84533	.	.	ENSG00000108950	ENST00000226094	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	M	0.87758	2.905	0.80722	D	1	D	0.63046	0.992	D	0.63192	0.912	D	0.85708	0.1317	9	0.62326	D	0.03	-33.4943	16.5885	0.84745	0.0:0.0:0.0:1.0	.	325	Q96MK3	FA20A_HUMAN	A	325	.	ENSP00000226094:T325A	T	-	1	0	FAM20A	64049857	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.850000	0.69473	2.317000	0.78254	0.460000	0.39030	ACG		0.602	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
FAM73A	374986	ucsc.edu	37	1	78269049	78269049	+	Silent	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:78269049A>G	ENST00000370791.3	+	4	500	c.468A>G	c.(466-468)ggA>ggG	p.G156G	FAM73A_ENST00000443751.2_Silent_p.G118G	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	156						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		CTAATGGAGGACTTTTCAGTA	0.318																																						.											0													58.0	57.0	57.0					1																	78269049		2202	4294	6496	SO:0001819	synonymous_variant	374986				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.468A>G	1.37:g.78269049A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6MZG0	Silent	SNP	ENST00000370791.3	37	CCDS681.1																																																																																				0.318	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
PTPDC1	138639	ucsc.edu	37	9	96857597	96857597	+	Splice_Site	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr9:96857597A>G	ENST00000375360.3	+	6	794		c.e6-1		PTPDC1_ENST00000288976.3_Splice_Site	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1						cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CTTTTTTCCTAGTTTACTTCT	0.358																																						.											0													115.0	119.0	118.0					9																	96857597		2203	4300	6503	SO:0001630	splice_region_variant	138639			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.455-1A>G	9.37:g.96857597A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Splice_Site	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	13.20	2.166092	0.38217	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7685	0.69657	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPDC1	95897418	1.000000	0.71417	0.970000	0.41538	0.219000	0.24729	8.696000	0.91302	2.221000	0.72209	0.528000	0.53228	.		0.358	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	Intron
RPIA	22934	ucsc.edu	37	2	88991370	88991370	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr2:88991370C>T	ENST00000283646.4	+	1	209	c.154C>T	c.(154-156)Cgt>Tgt	p.R52C		NM_144563.2	NP_653164.2	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	52					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|ribose phosphate metabolic process (GO:0019693)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	monosaccharide binding (GO:0048029)|ribose-5-phosphate isomerase activity (GO:0004751)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				GTCTGGGACCCGTGGCGGTGC	0.731																																						.											0													6.0	11.0	9.0					2																	88991370		1813	3966	5779	SO:0001583	missense	22934			L35035	CCDS2004.2	2p11.2	2008-07-31	2008-07-31		ENSG00000153574	ENSG00000153574	5.3.1.6		10297	protein-coding gene	gene with protein product	"""ribose 5-phosphate epimerase"""	180430				7758956	Standard	NM_144563		Approved		uc002ste.3	P49247	OTTHUMG00000130333	ENST00000283646.4:c.154C>T	2.37:g.88991370C>T	ENSP00000283646:p.Arg52Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q541P9|Q96BJ6	Missense_Mutation	SNP	ENST00000283646.4	37	CCDS2004.2	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847640	0.32606	.	.	ENSG00000153574	ENST00000283646	T	0.79749	-1.3	4.66	-0.221	0.13126	.	.	.	.	.	T	0.58666	0.2138	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48305	-0.9047	9	0.62326	D	0.03	1.4726	4.0815	0.09929	0.0:0.3702:0.3553:0.2745	.	52	P49247	RPIA_HUMAN	C	52	ENSP00000283646:R52C	ENSP00000283646:R52C	R	+	1	0	RPIA	88772485	0.000000	0.05858	0.005000	0.12908	0.747000	0.42532	-0.012000	0.12699	-0.139000	0.11414	0.484000	0.47621	CGT		0.731	RPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252683.2		
SLC1A2	6506	ucsc.edu	37	11	35338967	35338967	+	Silent	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:35338967A>G	ENST00000278379.3	-	2	396	c.114T>C	c.(112-114)tgT>tgC	p.C38C	SLC1A2_ENST00000395753.1_Silent_p.C29C|SLC1A2_ENST00000395750.1_Silent_p.C29C|SLC1A2_ENST00000606205.1_Silent_p.C38C	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	38					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			CCAGCTTGTCACACAGGCGCA	0.602																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)	.											0													107.0	108.0	108.0					11																	35338967		2202	4298	6500	SO:0001819	synonymous_variant	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.114T>C	11.37:g.35338967A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DQE9|Q14417|Q541G6|U3KQQ4	Silent	SNP	ENST00000278379.3	37	CCDS31459.1																																																																																				0.602	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171	
SPOCD1	90853	ucsc.edu;bcgsc.ca	37	1	32280705	32280705	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:32280705T>C	ENST00000360482.2	-	2	359	c.230A>G	c.(229-231)gAg>gGg	p.E77G	SPOCD1_ENST00000257100.3_Intron|SPOCD1_ENST00000533231.1_Missense_Mutation_p.E77G|SPOCD1_ENST00000373648.2_Missense_Mutation_p.E77G	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	77					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TGGCCGGACCTCAGCAGCACC	0.672																																						.											0													29.0	32.0	31.0					1																	32280705		2203	4300	6503	SO:0001583	missense	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.230A>G	1.37:g.32280705T>C	ENSP00000353670:p.Glu77Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	.	.	.	.	.	.	.	.	.	.	T	5.069	0.198303	0.09652	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.35973	1.72;1.28;1.72	3.4	-3.04	0.05412	.	.	.	.	.	T	0.17492	0.0420	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21075	-1.0256	9	0.59425	D	0.04	-0.1588	8.8639	0.35274	0.0:0.3432:0.0:0.6568	.	77;77	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	G	77	ENSP00000353670:E77G;ENSP00000362752:E77G;ENSP00000435851:E77G	ENSP00000353670:E77G	E	-	2	0	SPOCD1	32053292	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.337000	0.07852	-0.725000	0.04901	-0.132000	0.14878	GAG		0.672	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
TMEM104	54868	ucsc.edu	37	17	72787131	72787131	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr17:72787131A>G	ENST00000335464.5	+	6	545	c.383A>G	c.(382-384)gAc>gGc	p.D128G	TMEM104_ENST00000582330.1_Missense_Mutation_p.D128G|TMEM104_ENST00000582773.1_Missense_Mutation_p.D128G|TMEM104_ENST00000417024.2_Missense_Mutation_p.D141G	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	128						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					GAAATCACAGACCGGGTGGAA	0.527																																						.											0													110.0	81.0	90.0					17																	72787131		2203	4300	6503	SO:0001583	missense	54868			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.383A>G	17.37:g.72787131A>G	ENSP00000334849:p.Asp128Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	ENST00000335464.5	37	CCDS32723.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044754	0.55110	.	.	ENSG00000109066	ENST00000335464;ENST00000417024	T;T	0.45668	1.51;0.89	5.15	4.07	0.47477	.	0.098626	0.64402	D	0.000002	T	0.40322	0.1112	L	0.48642	1.525	0.48830	D	0.999714	P;P;B	0.45672	0.864;0.769;0.196	P;B;B	0.46362	0.514;0.275;0.165	T	0.10567	-1.0624	10	0.30078	T	0.28	-33.1063	10.796	0.46461	0.9252:0.0:0.0748:0.0	.	141;128;128	B4DKL7;Q8NE00-2;Q8NE00	.;.;TM104_HUMAN	G	128;141	ENSP00000334849:D128G;ENSP00000397676:D141G	ENSP00000334849:D128G	D	+	2	0	TMEM104	70298726	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	8.568000	0.90741	0.915000	0.36847	0.397000	0.26171	GAC		0.527	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
TMEM201	199953	ucsc.edu	37	1	9661448	9661448	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:9661448A>G	ENST00000340381.6	+	5	901	c.892A>G	c.(892-894)Acg>Gcg	p.T298A	TMEM201_ENST00000340305.5_Missense_Mutation_p.T298A|TMEM201_ENST00000377376.4_Missense_Mutation_p.T298A	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	298					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GAGCCACCAGACGGGCGTCGT	0.697																																						.											0													47.0	52.0	50.0					1																	9661448		2203	4298	6501	SO:0001583	missense	199953				CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.892A>G	1.37:g.9661448A>G	ENSP00000344503:p.Thr298Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B9EH90|Q5SNT3	Missense_Mutation	SNP	ENST00000340381.6	37	CCDS44055.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.936|9.936	1.216223|1.216223	0.22373|0.22373	.|.	.|.	ENSG00000188807|ENSG00000188807	ENST00000416541|ENST00000377376;ENST00000340305;ENST00000340381	.|.	.|.	.|.	4.92|4.92	2.56|2.56	0.30785|0.30785	.|.	.|0.709593	.|0.13717	.|N	.|0.367656	T|T	0.20210|0.20210	0.0486|0.0486	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	0.999997|0.999997	.|B;B	.|0.25206	.|0.12;0.041	.|B;B	.|0.27262	.|0.078;0.047	T|T	0.18650|0.18650	-1.0330|-1.0330	5|9	.|0.35671	.|T	.|0.21	-0.5121|-0.5121	6.1404|6.1404	0.20257|0.20257	0.7205:0.0:0.2795:0.0|0.7205:0.0:0.2795:0.0	.|.	.|298;298	.|E9PBR6;Q5SNT2-2	.|.;.	G|A	207|298	.|.	.|ENSP00000344772:T298A	D|T	+|+	2|1	0|0	TMEM201|TMEM201	9584035|9584035	0.020000|0.020000	0.18652|0.18652	0.722000|0.722000	0.30670|0.30670	0.762000|0.762000	0.43233|0.43233	-0.055000|-0.055000	0.11807|0.11807	0.734000|0.734000	0.32515|0.32515	0.460000|0.460000	0.39030|0.39030	GAC|ACG		0.697	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866	
ZNF469	84627	ucsc.edu;bcgsc.ca	37	16	88497524	88497524	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr16:88497524C>T	ENST00000437464.1	+	2	3562	c.3562C>T	c.(3562-3564)Cgc>Tgc	p.R1188C	ZNF469_ENST00000565624.1_Missense_Mutation_p.R1216C	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						AGAGGAAACCCGCCCGTCGCT	0.647																																						.											0													15.0	22.0	20.0					16																	88497524		692	1591	2283	SO:0001583	missense	84627			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3562C>T	16.37:g.88497524C>T	ENSP00000402343:p.Arg1188Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	8.882	0.951840	0.18431	.	.	ENSG00000225614	ENST00000437464	T	0.06142	3.34	4.15	-1.18	0.09617	.	.	.	.	.	T	0.03520	0.0101	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.41466	-0.9507	9	0.62326	D	0.03	.	4.4124	0.11439	0.0:0.4708:0.178:0.3512	.	1188	Q96JG9	ZN469_HUMAN	C	1188	ENSP00000402343:R1188C	ENSP00000402343:R1188C	R	+	1	0	ZNF469	87025025	0.574000	0.26684	0.000000	0.03702	0.006000	0.05464	0.000000	0.12993	-0.109000	0.12044	0.313000	0.20887	CGC		0.647	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ADAM29	11086	mdanderson.org	37	4	175899001	175899001	+	Silent	SNP	T	T	C	rs111240604	byFrequency	TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr4:175899001T>C	ENST00000359240.3	+	5	2995	c.2325T>C	c.(2323-2325)tcT>tcC	p.S775S	ADAM29_ENST00000445694.1_Silent_p.S775S|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Silent_p.S775S|ADAM29_ENST00000514159.1_Silent_p.S775S	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	775	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TGATGCCTTCTCAGAGTCAAC	0.567																																					Ovarian(140;1727 1835 21805 25838 41440)	.											0													175.0	158.0	163.0					4																	175899001		2203	4300	6503	SO:0001819	synonymous_variant	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2325T>C	4.37:g.175899001T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	37	CCDS3823.1																																																																																				0.567	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
CDC27	996	mdanderson.org	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																						.											0													44.0	48.0	47.0					17																	45234397		2191	4293	6484	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	17.37:g.45234397G>A	ENSP00000066544:p.Pro242Ser	Somatic		WXS	Illumina HiSeq	Phase_I	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
DHRS4L2	317749	mdanderson.org	37	14	24464310	24464310	+	Missense_Mutation	SNP	C	C	A	rs61999853	byFrequency	TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr14:24464310C>A	ENST00000335125.6	+	3	502	c.376C>A	c.(376-378)Cta>Ata	p.L126I	DHRS4L2_ENST00000558753.1_Intron|DHRS4L2_ENST00000534993.1_Missense_Mutation_p.L25I|DHRS4L2_ENST00000545240.1_Missense_Mutation_p.L126I|DHRS4L2_ENST00000382755.4_Missense_Mutation_p.L124I|DHRS4L2_ENST00000397071.1_Missense_Mutation_p.L126I|DHRS4L2_ENST00000543805.1_Intron|DHRS4L2_ENST00000537912.1_Intron	NM_198083.3	NP_932349.2	Q6PKH6	DR4L2_HUMAN	dehydrogenase/reductase (SDR family) member 4 like 2	124						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	10				GBM - Glioblastoma multiforme(265;0.00962)		CTTTGGAAGCCTAATGGATGT	0.532																																						.											0													424.0	384.0	397.0					14																	24464310		2203	4300	6503	SO:0001583	missense	317749				CCDS9606.2, CCDS73621.1	14q11.2	2011-09-14			ENSG00000187630	ENSG00000187630	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	19731	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 3"""	615196					Standard	NM_001193635		Approved	SDR25C3	uc001wlf.3	Q6PKH6	OTTHUMG00000028778	ENST00000335125.6:c.376C>A	14.37:g.24464310C>A	ENSP00000334801:p.Leu126Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q3YLD4	Missense_Mutation	SNP	ENST00000335125.6	37	CCDS9606.2	51	0.023351648351648352	13	0.026422764227642278	10	0.027624309392265192	8	0.013986013986013986	20	0.026385224274406333	-	0.017	-1.492049	0.01009	.	.	ENSG00000187630	ENST00000534993;ENST00000397071;ENST00000335125;ENST00000545240;ENST00000382755	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	4.64	0.0778	0.14409	NAD(P)-binding domain (1);	0.297403	0.28895	N	0.013795	T	0.55114	0.1900	N	0.25380	0.74	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.51576	-0.8688	10	0.07325	T	0.83	.	7.8688	0.29554	0.5146:0.4044:0.0:0.081	rs61999853	124	Q6PKH6	DR4L2_HUMAN	I	25;126;126;126;124	ENSP00000380261:L126I;ENSP00000334801:L126I;ENSP00000437883:L126I;ENSP00000372203:L124I	ENSP00000334801:L126I	L	+	1	2	DHRS4L2	23534150	0.459000	0.25768	0.013000	0.15412	0.726000	0.41606	0.387000	0.20718	-0.358000	0.08162	-0.522000	0.04353	CTA		0.532	DHRS4L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000071858.4		
FOLH1	2346	mdanderson.org	37	11	49204732	49204732	+	Missense_Mutation	SNP	T	T	C	rs199782232		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:49204732T>C	ENST00000256999.2	-	7	1149	c.889A>G	c.(889-891)Att>Gtt	p.I297V	FOLH1_ENST00000356696.3_Missense_Mutation_p.I297V|FOLH1_ENST00000533034.1_Missense_Mutation_p.I282V|FOLH1_ENST00000340334.7_Missense_Mutation_p.I282V|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	297	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TAGTATCCAATTGGATGAACA	0.363																																						.											0													78.0	79.0	78.0					11																	49204732		2201	4298	6499	SO:0001583	missense	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.889A>G	11.37:g.49204732T>C	ENSP00000256999:p.Ile297Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	T	7.025	0.559465	0.13436	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	2.76	1.59	0.23543	.	0.125811	0.35349	N	0.003276	T	0.50582	0.1624	M	0.78344	2.41	0.80722	D	1	B;B;B;B	0.20459	0.007;0.001;0.045;0.02	B;B;B;B	0.28139	0.046;0.018;0.086;0.035	T	0.47355	-0.9124	10	0.54805	T	0.06	.	6.1691	0.20406	0.0:0.1358:0.0:0.8642	.	282;282;297;297	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	V	297;297;282;282;297	ENSP00000256999:I297V;ENSP00000349129:I297V;ENSP00000344131:I282V;ENSP00000431463:I282V	ENSP00000256999:I297V	I	-	1	0	FOLH1	49161308	1.000000	0.71417	0.994000	0.49952	0.146000	0.21551	3.347000	0.52200	0.301000	0.22738	0.163000	0.16589	ATT		0.363	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
FRG1B	284802	mdanderson.org	37	20	29631562	29631562	+	Missense_Mutation	SNP	A	A	G	rs75398190		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr20:29631562A>G	ENST00000278882.3	+	7	738	c.358A>G	c.(358-360)Acc>Gcc	p.T120A	FRG1B_ENST00000358464.4_Missense_Mutation_p.T120A			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	120										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGAAAAAGAAACCAAGAAAAA	0.328																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.358A>G	20.37:g.29631562A>G	ENSP00000278882:p.Thr120Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	4.325	0.059770	0.08339	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	2.03	2.03	0.26663	.	0.490245	0.22945	N	0.053734	T	0.13586	0.0329	.	.	.	0.24816	N	0.992611	B	0.02656	0.0	B	0.08055	0.003	T	0.22487	-1.0215	8	0.08381	T	0.77	.	3.812	0.08801	0.8129:0.0:0.1871:0.0	.	120	Q9BZ01	FRG1B_HUMAN	A	120	.	ENSP00000278882:T120A	T	+	1	0	FRG1B	28245223	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	2.035000	0.41155	1.193000	0.43086	0.409000	0.27619	ACC		0.328	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
GOLGA8I	283796	mdanderson.org	37	15	23261950	23261950	+	Silent	SNP	A	A	G	rs11857654	byFrequency	TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr15:23261950A>G	ENST00000450802.3	+	12	1160	c.1062A>G	c.(1060-1062)gaA>gaG	p.E354E	RN7SL495P_ENST00000461817.2_RNA|AC091565.1_ENST00000459619.1_RNA	NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	354						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											GGAAGCAGGAAGAGAGGATTC	0.597													.|||	4238	0.846246	0.8707	0.7795	5008	,	,		10506	0.998		0.6362	False		,,,				2504	0.9202					.											0																																										SO:0001819	synonymous_variant	283796			AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.1062A>G	15.37:g.23261950A>G		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000450802.3	37																																																																																					0.597	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251213.2	NR_024074	
RP3-470B24.5	0	mdanderson.org	37	6	168377178	168377178	+	lincRNA	SNP	T	T	G	rs71545159|rs4708616		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr6:168377178T>G	ENST00000538528.1	-	0	441																											TGCAGTGTGTTGGGAGGAGAA	0.622																																						.											0													5.0	5.0	5.0					6																	168377178		671	1527	2198			0																															6.37:g.168377178T>G		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.622	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
HLA-DRB1	3123	mdanderson.org	37	6	32551996	32551996	+	Missense_Mutation	SNP	G	G	T	rs1059584	byFrequency	TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr6:32551996G>T	ENST00000360004.5	-	2	365	c.260C>A	c.(259-261)gCt>gAt	p.A87D		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	87	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						CCAGTACTCAGCGTCAGGCCG	0.627										Multiple Myeloma(14;0.17)			G|||	412	0.0822684	0.1445	0.0663	5008	,	,		7448	0.0427		0.0885	False		,,,				2504	0.044					.											0													37.0	40.0	39.0					6																	32551996		2186	4282	6468	SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.260C>A	6.37:g.32551996G>T	ENSP00000353099:p.Ala87Asp	Somatic		WXS	Illumina HiSeq	Phase_I	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	15.38	2.815741	0.50527	.	.	ENSG00000196126	ENST00000360004	T	0.00420	7.47	3.52	2.62	0.31277	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	0.288263	0.31554	N	0.007451	T	0.01092	0.0036	H	0.99357	4.53	0.09310	N	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.38067	-0.9678	10	0.87932	D	0	.	9.9904	0.41868	0.0:0.0:0.7957:0.2042	rs1059584;rs1059585;rs2308717;rs17886576;rs35220740	87	P01911	2B1F_HUMAN	D	87	ENSP00000353099:A87D	ENSP00000353099:A87D	A	-	2	0	HLA-DRB1	32659974	0.396000	0.25262	0.002000	0.10522	0.002000	0.02628	3.831000	0.55776	0.790000	0.33803	0.453000	0.30009	GCT		0.627	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
RP3-470B24.5	0	mdanderson.org	37	6	168377262	168377262	+	lincRNA	SNP	T	T	G	rs200098500		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr6:168377262T>G	ENST00000538528.1	-	0	357																											TGCAGTGTGTTGGGAGGAGGA	0.632																																						.											0													9.0	11.0	10.0					6																	168377262		686	1579	2265			0																															6.37:g.168377262T>G		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																					0.632	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
KMT2C	58508	mdanderson.org	37	7	151932923	151932923	+	Silent	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr7:151932923G>A	ENST00000262189.6	-	16	2966	c.2748C>T	c.(2746-2748)atC>atT	p.I916I	KMT2C_ENST00000355193.2_Silent_p.I916I	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	916					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CAACAGCTCCGATTCCACTTT	0.478																																						.											0													74.0	67.0	69.0					7																	151932923		2202	4284	6486	SO:0001819	synonymous_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2748C>T	7.37:g.151932923G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	9.270	1.045395	0.19748	.	.	ENSG00000055609	ENST00000418673	.	.	.	5.0	-5.63	0.02474	.	.	.	.	.	T	0.48003	0.1476	.	.	.	0.54753	D	0.999984	.	.	.	.	.	.	T	0.48198	-0.9056	4	.	.	.	.	7.2844	0.26330	0.4461:0.1266:0.4273:0.0	.	.	.	.	W	72	.	.	R	-	1	2	MLL3	151563856	0.145000	0.22656	0.658000	0.29665	0.991000	0.79684	-0.279000	0.08479	-1.230000	0.02561	-0.225000	0.12378	CGG		0.478	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MUC21	394263	mdanderson.org	37	6	30954932	30954932	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr6:30954932C>T	ENST00000376296.3	+	2	1221	c.980C>T	c.(979-981)gCc>gTc	p.A327V	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	327	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TCCAGTGGGGCCAGCACAGCC	0.627																																						.											0													140.0	140.0	140.0					6																	30954932		2203	4298	6501	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.980C>T	6.37:g.30954932C>T	ENSP00000365473:p.Ala327Val	Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	c	10.42	1.344802	0.24426	.	.	ENSG00000204544	ENST00000376296	T	0.04119	3.7	4.03	1.23	0.21249	.	.	.	.	.	T	0.00695	0.0023	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.46721	-0.9171	8	.	.	.	-0.5435	6.5251	0.22297	0.0:0.5892:0.0:0.4108	.	327	Q5SSG8	MUC21_HUMAN	V	327	ENSP00000365473:A327V	.	A	+	2	0	MUC21	31062911	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	0.017000	0.13399	0.245000	0.21373	-0.216000	0.12614	GCC		0.627	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC2	4583	mdanderson.org	37	11	1092973	1092973	+	Missense_Mutation	SNP	C	C	T	rs55847666		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr11:1092973C>T	ENST00000441003.2	+	30	4819	c.4792C>T	c.(4792-4794)Ccc>Tcc	p.P1598S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1598S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aaccccaacacccaccggcac	0.637																																						.											1	Substitution - Missense(1)	endometrium(1)											47.0	83.0	70.0					11																	1092973		1782	3238	5020	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4792C>T	11.37:g.1092973C>T	ENSP00000415183:p.Pro1598Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.622	-0.077443	0.07184	.	.	ENSG00000198788	ENST00000441003	T	0.13778	2.56	1.75	-2.88	0.05682	.	.	.	.	.	T	0.04363	0.0120	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.43686	-0.9376	8	0.07482	T	0.82	.	3.4241	0.07403	0.4105:0.429:0.0:0.1605	rs55847666	1598	E7EUV1	.	S	1598	ENSP00000415183:P1598S	ENSP00000415183:P1598S	P	+	1	0	MUC2	1082973	0.007000	0.16637	0.000000	0.03702	0.120000	0.20174	0.230000	0.17852	-0.314000	0.08716	0.121000	0.15741	CCC		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR11H12	440153	mdanderson.org	37	14	19378135	19378135	+	Missense_Mutation	SNP	T	T	A	rs202226673		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr14:19378135T>A	ENST00000550708.1	+	1	614	c.542T>A	c.(541-543)aTg>aAg	p.M181K		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATCTCTCAGATGCCCTTCTGT	0.478																																						.											0																																										SO:0001583	missense	440153				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.542T>A	14.37:g.19378135T>A	ENSP00000449002:p.Met181Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000550708.1	37	CCDS32017.1	.	.	.	.	.	.	.	.	.	.	t	8.805	0.933852	0.18206	.	.	ENSG00000257115	ENST00000550708	T	0.00115	8.71	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.284112	0.24580	N	0.037314	T	0.00144	0.0004	L	0.50333	1.59	0.25517	N	0.987402	P	0.40282	0.711	B	0.41646	0.362	T	0.36432	-0.9748	9	0.72032	D	0.01	.	5.5303	0.16980	0.0:1.0E-4:0.0:0.9999	.	181	B2RN74	O11HC_HUMAN	K	181	ENSP00000449002:M181K	ENSP00000449002:M181K	M	+	2	0	CR383656.1	18448135	0.130000	0.22417	0.951000	0.38953	0.105000	0.19272	3.659000	0.54489	0.518000	0.28383	0.055000	0.15244	ATG		0.478	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354	
PLIN4	729359	mdanderson.org	37	19	4511494	4511494	+	Silent	SNP	G	G	A	rs201001883		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr19:4511494G>A	ENST00000301286.3	-	3	2435	c.2436C>T	c.(2434-2436)acC>acT	p.T812T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	812	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CCTTGGTACCGGTCAGCACGG	0.602																																						.											0													97.0	128.0	118.0					19																	4511494		2078	4204	6282	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2436C>T	19.37:g.4511494G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																				0.602	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
TUBA3C	7278	mdanderson.org	37	13	19751274	19751274	+	Silent	SNP	G	G	A	rs143115179	byFrequency	TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr13:19751274G>A	ENST00000400113.3	-	4	953	c.849C>T	c.(847-849)caC>caT	p.H283H		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	283					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ACAGCTGCTCGTGGTAGGCCT	0.607																																						.											0													143.0	128.0	133.0					13																	19751274		2203	4300	6503	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.849C>T	13.37:g.19751274G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
FAS	355	bcgsc.ca	37	10	90774008	90774008	+	Missense_Mutation	SNP	C	C	T	rs121913081		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr10:90774008C>T	ENST00000355740.2	+	9	1029	c.809C>T	c.(808-810)aCa>aTa	p.T270I	FAS_ENST00000355279.2_3'UTR|FAS_ENST00000357339.2_Missense_Mutation_p.T249I|RP11-399O19.9_ENST00000562983.1_RNA|FAS_ENST00000352159.4_3'UTR	NM_000043.4|NM_152871.2|NM_152872.2	NP_000034.1|NP_690610.1|NP_690611.1	P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	GTCCAAGACACAGCAGAACAG	0.378																																						.											0			GRCh37	CD951864|CM991190|CM994523	FAS	D|M	rs121913081						129.0	120.0	123.0					10																	90774008		2203	4300	6503	SO:0001583	missense	355			M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355740.2:c.809C>T	10.37:g.90774008C>T	ENSP00000347979:p.Thr270Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355740.2	37	CCDS7393.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315426	0.40996	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000357339	D;D	0.85171	-1.95;-1.95	4.65	4.65	0.58169	Death (3);DEATH-like (2);	7.859800	0.00357	N	0.000033	D	0.92835	0.7721	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.80764	0.994;0.958	T	0.81680	-0.0823	10	0.41790	T	0.15	-18.6218	13.767	0.63002	0.0:1.0:0.0:0.0	.	249;270	P25445-6;P25445	.;TNR6_HUMAN	I	297;270;249	ENSP00000347979:T270I;ENSP00000349896:T249I	ENSP00000347979:T270I	T	+	2	0	FAS	90763988	0.279000	0.24239	0.974000	0.42286	0.059000	0.15707	2.342000	0.43992	2.523000	0.85059	0.650000	0.86243	ACA		0.378	FAS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049274.3		
HDAC7	51564	bcgsc.ca	37	12	48189417	48189417	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr12:48189417delG	ENST00000427332.2	-	10	1079	c.923delC	c.(922-924)cccfs	p.P308fs	HDAC7_ENST00000380610.4_Frame_Shift_Del_p.P364fs|HDAC7_ENST00000080059.7_Frame_Shift_Del_p.P347fs|HDAC7_ENST00000354334.3_Frame_Shift_Del_p.P310fs|HDAC7_ENST00000552960.1_Frame_Shift_Del_p.P330fs			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	308	Transcription repression 2. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GAGGAGAATGGGCTGCAGGCG	0.677																																						.											0													15.0	17.0	17.0					12																	48189417		2166	4271	6437	SO:0001589	frameshift_variant	51564			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.923delC	12.37:g.48189417delG	ENSP00000404394:p.Pro308fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Frame_Shift_Del	DEL	ENST00000427332.2	37																																																																																					0.677	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
RBBP6	5930	bcgsc.ca	37	16	24582961	24582961	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr16:24582961delG	ENST00000319715.4	+	18	5006	c.4574delG	c.(4573-4575)ggafs	p.G1525fs	RBBP6_ENST00000381039.3_Frame_Shift_Del_p.G685fs|RBBP6_ENST00000348022.2_Frame_Shift_Del_p.G1491fs	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1525	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CCTAAAAAAGGAACAGGAGAT	0.373																																						.											0													39.0	38.0	38.0					16																	24582961		2197	4297	6494	SO:0001589	frameshift_variant	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4574delG	16.37:g.24582961delG	ENSP00000317872:p.Gly1525fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Frame_Shift_Del	DEL	ENST00000319715.4	37	CCDS10621.1																																																																																				0.373	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
TCEB3C	162699	bcgsc.ca	37	18	44555274	44555274	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr18:44555274G>A	ENST00000330682.2	-	1	1175	c.940C>T	c.(940-942)Cgc>Tgc	p.R314C	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_145653.3	NP_663628.2	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide 3C (elongin A3)	314	Activation domain. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(16)|skin(2)	30						TTCACTCTGCGTCCAGGGAAA	0.637																																						.											0													251.0	258.0	256.0					18																	44555274		1909	3726	5635	SO:0001583	missense	162699			AB076840	CCDS11931.1	18q21.1	2008-08-13			ENSG00000183791	ENSG00000183791			24617	protein-coding gene	gene with protein product	"""elongin A3"""					11932239, 11994304	Standard	NM_145653		Approved	HsT829, TCEB3L2	uc010xdb.2	Q8NG57	OTTHUMG00000132651	ENST00000330682.2:c.940C>T	18.37:g.44555274G>A	ENSP00000328232:p.Arg314Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000330682.2	37	CCDS11931.1	.	.	.	.	.	.	.	.	.	.	g	8.358	0.832394	0.16820	.	.	ENSG00000183791	ENST00000330682	T	0.15487	2.42	1.1	-2.21	0.06973	.	1.173820	0.06346	N	0.708878	T	0.07863	0.0197	L	0.29908	0.895	0.19300	N	0.999974	D	0.57899	0.981	B	0.26094	0.066	T	0.21655	-1.0239	10	0.59425	D	0.04	-0.3943	4.3463	0.11134	0.0:0.454:0.316:0.2301	.	314	Q8NG57	ELOA3_HUMAN	C	314	ENSP00000328232:R314C	ENSP00000328232:R314C	R	-	1	0	TCEB3C	42809272	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.162000	0.16501	-2.006000	0.00958	-1.780000	0.00649	CGC		0.637	TCEB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255902.1	NM_145653	
BRWD1	54014	bcgsc.ca	37	21	40649185	40649185	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr21:40649185T>C	ENST00000333229.2	-	11	1423	c.1096A>G	c.(1096-1098)Agc>Ggc	p.S366G	BRWD1_ENST00000342449.3_Missense_Mutation_p.S366G|BRWD1_ENST00000380800.3_Missense_Mutation_p.S366G	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	366					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ACAGTGTGGCTTTCAAGTTCT	0.343																																					Melanoma(170;988 1986 4794 16843 39731)	.											0													82.0	79.0	80.0					21																	40649185		2203	4300	6503	SO:0001583	missense	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.1096A>G	21.37:g.40649185T>C	ENSP00000330753:p.Ser366Gly	Somatic		WXS	Illumina HiSeq	Phase_I	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.093|9.093	1.002321|1.002321	0.19121|0.19121	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000455867|ENST00000333229;ENST00000342449;ENST00000380800	.|T;T;T	.|0.44881	.|0.91;0.91;0.91	4.71|4.71	4.71|4.71	0.59529|0.59529	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.071818	.|0.56097	.|D	.|0.000021	T|T	0.30039|0.30039	0.0752|0.0752	N|N	0.01405|0.01405	-0.89|-0.89	0.80722|0.80722	D|D	1|1	.|P;D;B	.|0.53619	.|0.906;0.961;0.217	.|P;P;B	.|0.62813	.|0.629;0.907;0.121	T|T	0.41324|0.41324	-0.9515|-0.9515	5|10	.|0.40728	.|T	.|0.16	-5.8987|-5.8987	9.1131|9.1131	0.36741|0.36741	0.0:0.0826:0.0:0.9174|0.0:0.0826:0.0:0.9174	.|.	.|77;366;366	.|Q5R2U6;Q9NSI6-2;Q9NSI6	.|.;.;BRWD1_HUMAN	R|G	77|366	.|ENSP00000330753:S366G;ENSP00000344333:S366G;ENSP00000370178:S366G	.|ENSP00000330753:S366G	K|S	-|-	2|1	0|0	BRWD1|BRWD1	39571055|39571055	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	1.785000|1.785000	0.38684|0.38684	1.878000|1.878000	0.54408|0.54408	0.482000|0.482000	0.46254|0.46254	AAG|AGC		0.343	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
SLC6A19	340024	bcgsc.ca	37	5	1208864	1208864	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr5:1208864C>T	ENST00000304460.10	+	2	262	c.206C>T	c.(205-207)gCc>gTc	p.A69V		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	69					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			ATTGCAGGAGCCTTCATGATC	0.662																																						.											0													105.0	101.0	102.0					5																	1208864		2203	4300	6503	SO:0001583	missense	340024			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.206C>T	5.37:g.1208864C>T	ENSP00000305302:p.Ala69Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573808	0.65765	.	.	ENSG00000174358	ENST00000304460	T	0.79141	-1.24	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.83908	0.5356	M	0.82193	2.58	0.80722	D	1	P	0.46512	0.879	P	0.47827	0.558	D	0.87742	0.2586	10	0.87932	D	0	.	17.3733	0.87384	0.0:1.0:0.0:0.0	.	69	Q695T7	S6A19_HUMAN	V	69	ENSP00000305302:A69V	ENSP00000305302:A69V	A	+	2	0	SLC6A19	1261864	1.000000	0.71417	0.919000	0.36401	0.559000	0.35586	7.565000	0.82337	2.091000	0.63221	0.485000	0.47835	GCC		0.662	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
MT-ATP6	4508	bcgsc.ca	37	M	9002	9002	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chrM:9002G>A	ENST00000361899.2	+	1	476	c.476G>A	c.(475-477)cGc>cAc	p.R159H	MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	159					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						CCTGGCCGTACGCCTAACCGC	0.478																																						.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.476G>A	M.37:g.9002G>A	ENSP00000354632:p.Arg159His	Somatic		WXS	Illumina HiSeq	Phase_I	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	37																																																																																					0.478	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
MT-ND5	4540	bcgsc.ca	37	M	13477	13477	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chrM:13477G>A	ENST00000361567.2	+	1	1141	c.1141G>A	c.(1141-1143)Gca>Aca	p.A381T	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	381					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GCCTAGCATTAGCAGGAATAC	0.428																																						.											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1141G>A	M.37:g.13477G>A	ENSP00000354813:p.Ala381Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	37																																																																																					0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	bcgsc.ca	37	M	15812	15812	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chrM:15812G>A	ENST00000361789.2	+	1	1066	c.1066G>A	c.(1066-1068)Gta>Ata	p.V356I	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	356			V -> M (in LHON; secondary mutation; does not seem to directly cause the disease). {ECO:0000269|PubMed:11130070, ECO:0000269|PubMed:1732158}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						AAGTAGCATCCGTACTATACT	0.393																																						.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.1066G>A	M.37:g.15812G>A	ENSP00000354554:p.Val356Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																					0.393	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
SLC9A1	6548	bcgsc.ca	37	1	27436145	27436146	+	Frame_Shift_Ins	INS	-	-	A	rs529383211		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr1:27436145_27436146insA	ENST00000263980.3	-	3	1511_1512	c.936_937insT	c.(934-939)tacgggfs	p.G313fs	SLC9A1_ENST00000374086.3_Frame_Shift_Ins_p.G313fs|SLC9A1_ENST00000545949.1_5'UTR	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	313					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GCGATGACCCCGTAGACCACGC	0.594																																						.											0																																										SO:0001589	frameshift_variant	6548			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.936_937insT	1.37:g.27436145_27436146insA	ENSP00000263980:p.Gly313fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1ALD6|D3DPL4|Q96EM2	Frame_Shift_Ins	INS	ENST00000263980.3	37	CCDS295.1																																																																																				0.594	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
LARP7	51574	bcgsc.ca	37	4	113565883	113565884	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr4:113565883_113565884insA	ENST00000344442.5	+	2	336_337	c.58_59insA	c.(58-60)aaafs	p.K20fs	MIR302B_ENST00000509938.1_RNA|LARP7_ENST00000509061.1_Frame_Shift_Ins_p.K27fs|MIR302B_ENST00000510655.1_RNA|LARP7_ENST00000324052.6_Frame_Shift_Ins_p.K20fs|MIR302B_ENST00000505215.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	20					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CACTGAAAAGAAAAAAGAAGTT	0.356																																						.											0																																										SO:0001589	frameshift_variant	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.63dupA	4.37:g.113565888_113565888dupA	ENSP00000344950:p.Lys20fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Frame_Shift_Ins	INS	ENST00000344442.5	37	CCDS3701.2																																																																																				0.356	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
KIAA0408	9729	bcgsc.ca	37	6	127771252	127771253	+	Frame_Shift_Ins	INS	-	-	T	rs370114599		TCGA-KL-8332-01A-11D-2310-10	TCGA-KL-8332-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6d6f49e-6e95-4e41-8388-71f6fe017d80	1f3af48c-ba6b-4db5-ba11-75b7f50fae1e	g.chr6:127771252_127771253insT	ENST00000483725.3	-	3	716_717	c.380_381insA	c.(379-381)aaafs	p.K127fs	SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	127										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		CTACTTTTGATTTTTTTGTTGC	0.416																																						.											0																																										SO:0001589	frameshift_variant	9729			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.382dupA	6.37:g.127771258_127771258dupT	ENSP00000435150:p.Lys127fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Frame_Shift_Ins	INS	ENST00000483725.3	37	CCDS34531.1																																																																																				0.416	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	NM_014702	
