#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
USP54	159195	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	75331190	75331190	+	Missense_Mutation	SNP	A	A	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr10:75331190A>C	ENST00000339859.4	-	3	329	c.229T>G	c.(229-231)Tgc>Ggc	p.C77G	USP54_ENST00000319786.7_Missense_Mutation_p.C77G|USP54_ENST00000428547.1_Missense_Mutation_p.C77G|USP54_ENST00000408019.1_Missense_Mutation_p.C77G|USP54_ENST00000394811.2_5'UTR			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	77	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					TTGAGAGCGCAAAAGATGCAG	0.428																																					Colon(195;880 2046 8854 25025 38456)	.											0													120.0	108.0	111.0					10																	75331190		1900	4131	6031	SO:0001583	missense	159195			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.229T>G	10.37:g.75331190A>C	ENSP00000345216:p.Cys77Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	A	19.41	3.822644	0.71028	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000319786;ENST00000451492;ENST00000413442;ENST00000433394	T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;3.37	5.61	5.61	0.85477	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	U	0.000000	T	0.60143	0.2246	M	0.82630	2.6	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.91635	0.998;0.918;0.999	T	0.65936	-0.6047	10	0.72032	D	0.01	-6.3501	16.0994	0.81158	1.0:0.0:0.0:0.0	.	77;77;77	B7Z7X1;Q70EL1-6;Q70EL1	.;.;UBP54_HUMAN	G	77	ENSP00000345216:C77G;ENSP00000386080:C77G;ENSP00000408714:C77G;ENSP00000326547:C77G;ENSP00000402435:C77G;ENSP00000404710:C77G;ENSP00000407245:C77G	ENSP00000326547:C77G	C	-	1	0	USP54	75001196	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.855000	0.92236	2.261000	0.74972	0.533000	0.62120	TGC		0.428	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
PTEN	5728	broad.mit.edu;hgsc.bcm.edu	37	10	89711960	89711962	+	In_Frame_Del	DEL	TGT	TGT	-	rs568851024	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr10:89711960_89711962delTGT	ENST00000371953.3	+	6	1935_1937	c.578_580delTGT	c.(577-582)ctgttg>ctg	p.193_194LL>L	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	193	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.G165fs*9(3)|p.Y27fs*1(2)|p.G165_*404del(1)|p.L193P(1)|p.V191fs*7(1)|p.L193del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CCAGTGGCACTGTTGTTTCACAA	0.399		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	55	Whole gene deletion(37)|Deletion - Frameshift(11)|Unknown(4)|Deletion - In frame(2)|Substitution - Missense(1)	central_nervous_system(16)|prostate(16)|skin(8)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)																																								SO:0001651	inframe_deletion	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.578_580delTGT	10.37:g.89711963_89711965delTGT	ENSP00000361021:p.Leu194del	Somatic		WXS	Illumina HiSeq	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	In_Frame_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.399	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
TRIM3	10612	hgsc.bcm.edu;ucsc.edu	37	11	6477762	6477762	+	Silent	SNP	C	C	A			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:6477762C>A	ENST00000525074.1	-	6	1588	c.1194G>T	c.(1192-1194)ctG>ctT	p.L398L	TRIM3_ENST00000345851.3_Silent_p.L398L|TRIM3_ENST00000529058.1_Intron|TRIM3_ENST00000536344.1_Silent_p.L279L|TRIM3_ENST00000359518.3_Silent_p.L398L|TRIM3_ENST00000537602.1_Silent_p.L320L	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	398					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGAGAGGAGCAGCTCGCCTT	0.672																																					Melanoma(6;5 510 1540 25169 29084)	.											0													23.0	20.0	21.0					11																	6477762		2198	4292	6490	SO:0001819	synonymous_variant	10612			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1194G>T	11.37:g.6477762C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Silent	SNP	ENST00000525074.1	37	CCDS7764.1																																																																																				0.672	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458	
LTBP3	4054	hgsc.bcm.edu;mdanderson.org	37	11	65314277	65314277	+	Missense_Mutation	SNP	G	G	C	rs148780991	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:65314277G>C	ENST00000301873.5	-	15	2490	c.2222C>G	c.(2221-2223)gCc>gGc	p.A741G	LTBP3_ENST00000530785.1_5'Flank|LTBP3_ENST00000532932.1_Missense_Mutation_p.A171G|LTBP3_ENST00000322147.4_Missense_Mutation_p.A741G|LTBP3_ENST00000529189.1_5'Flank|LTBP3_ENST00000536982.1_Missense_Mutation_p.A367G	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	741	Cys-rich.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						ACCGCGACAGGCCCCGCCCCC	0.726													G|||	44	0.00878594	0.0182	0.0101	5008	,	,		8681	0.002		0.0109	False		,,,				2504	0.0					.											0								G	GLY/ALA,GLY/ALA,GLY/ALA	68,4308		0,68,2120	20.0	23.0	22.0		2222,1871,2222	4.1	1.0	11	dbSNP_134	22	60,8500		1,58,4221	yes	missense,missense,missense	LTBP3	NM_001130144.2,NM_001164266.1,NM_021070.4	60,60,60	1,126,6341	CC,CG,GG		0.7009,1.5539,0.9895	benign,benign,benign	741/1304,624/1140,741/1257	65314277	128,12808	2188	4280	6468	SO:0001583	missense	4054			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2222C>G	11.37:g.65314277G>C	ENSP00000301873:p.Ala741Gly	Somatic		WXS	Illumina HiSeq	Phase_I	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	CCDS44647.1	16	0.007326007326007326	4	0.008130081300813009	4	0.011049723756906077	0	0.0	8	0.010554089709762533	G	12.27	1.887566	0.33348	0.015539	0.007009	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866;ENST00000527339	T;T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95;1.95	5.0	4.08	0.47627	EGF-like calcium-binding (2);	0.251841	0.39341	N	0.001386	T	0.04092	0.0114	N	0.03209	-0.39	0.23192	N	0.998141	B;B;B;B;B;B	0.29136	0.155;0.089;0.033;0.234;0.089;0.044	B;B;B;B;B;B	0.30029	0.09;0.046;0.041;0.11;0.075;0.077	T	0.29701	-1.0003	10	0.24483	T	0.36	.	9.2867	0.37762	0.1011:0.0:0.8989:0.0	.	652;367;624;741;741;171	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2	.;.;.;LTBP3_HUMAN;.;.	G	741;741;171;367;652;81	ENSP00000326647:A741G;ENSP00000301873:A741G;ENSP00000435530:A171G;ENSP00000441912:A367G;ENSP00000435276:A652G;ENSP00000432121:A81G	ENSP00000301873:A741G	A	-	2	0	LTBP3	65070853	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	0.698000	0.25571	1.109000	0.41680	0.449000	0.29647	GCC		0.726	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
KRT84	3890	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	52774146	52774146	+	Splice_Site	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr12:52774146C>T	ENST00000257951.3	-	7	1491		c.e7+1		RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84						hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGAGTACTCACCGGCTCTCCT	0.557											OREG0021848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													32.0	33.0	33.0					12																	52774146		2201	4296	6497	SO:0001630	splice_region_variant	3890			Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.1424+1G>A	12.37:g.52774146C>T		Somatic	987	WXS	Illumina HiSeq	Phase_I	B2RA43|Q6ISB0|Q701L6	Splice_Site	SNP	ENST00000257951.3	37	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888892	0.33348	.	.	ENSG00000161849	ENST00000257951	.	.	.	4.89	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.513	0.75798	0.0:0.8617:0.1383:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT84	51060413	1.000000	0.71417	0.989000	0.46669	0.293000	0.27360	3.815000	0.55651	1.276000	0.44395	0.655000	0.94253	.		0.557	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	Intron
MGA	23269	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	42003374	42003374	+	Missense_Mutation	SNP	C	C	T	rs372252914		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr15:42003374C>T	ENST00000570161.1	+	7	2911	c.2911C>T	c.(2911-2913)Cgg>Tgg	p.R971W	MGA_ENST00000566586.1_Missense_Mutation_p.R971W|MGA_ENST00000389936.4_Missense_Mutation_p.R971W|MGA_ENST00000545763.1_Missense_Mutation_p.R971W|MGA_ENST00000219905.7_Missense_Mutation_p.R971W			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	P-type 2. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GATTAGTTTGCGGCAGGCACA	0.458																																						.											0								C	TRP/ARG,TRP/ARG	0,4038		0,0,2019	63.0	67.0	66.0		2911,2911	3.7	1.0	15		66	1,8411		0,1,4205	no	missense,missense	MGA	NM_001080541.2,NM_001164273.1	101,101	0,1,6224	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging,probably-damaging	971/2857,971/3066	42003374	1,12449	2019	4206	6225	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2911C>T	15.37:g.42003374C>T	ENSP00000457035:p.Arg971Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.634468	0.67130	0.0	1.19E-4	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.17691	2.26;2.26;2.26	5.83	3.74	0.42951	.	0.665977	0.13693	N	0.369363	T	0.28566	0.0707	N	0.24115	0.695	0.26692	N	0.971333	D;D	0.89917	0.999;1.0	D;D	0.69479	0.963;0.964	T	0.21724	-1.0237	10	0.87932	D	0	.	15.5704	0.76330	0.3449:0.6551:0.0:0.0	.	971;971	F5H7K2;E7ENI0	.;.	W	971	ENSP00000219905:R971W;ENSP00000374586:R971W;ENSP00000442467:R971W	ENSP00000219905:R971W	R	+	1	2	MGA	39790666	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.467000	0.35321	1.453000	0.47775	0.650000	0.86243	CGG		0.458	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
TP53	7157	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7578455	7578455	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr17:7578455C>G	ENST00000269305.4	-	5	664	c.475G>C	c.(475-477)Gcc>Ccc	p.A159P	TP53_ENST00000445888.2_Missense_Mutation_p.A159P|TP53_ENST00000359597.4_Missense_Mutation_p.A159P|TP53_ENST00000455263.2_Missense_Mutation_p.A159P|TP53_ENST00000413465.2_Missense_Mutation_p.A159P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.A159P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	159	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A159P(19)|p.0?(8)|p.A159T(7)|p.R158fs(6)|p.R158fs*11(6)|p.A159fs*11(4)|p.A159S(4)|p.R65fs(2)|p.A27P(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R26fs(2)|p.A66P(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCCATGGCGCGGACGCGG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	85	Substitution - Missense(34)|Deletion - Frameshift(18)|Deletion - In frame(12)|Complex(10)|Whole gene deletion(8)|Complex - frameshift(2)|Insertion - In frame(1)	lung(20)|central_nervous_system(18)|oesophagus(8)|liver(6)|stomach(5)|breast(5)|upper_aerodigestive_tract(4)|urinary_tract(4)|bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|ovary(2)|thyroid(1)|soft_tissue(1)|pancreas(1)											50.0	51.0	50.0					17																	7578455		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.475G>C	17.37:g.7578455C>G	ENSP00000269305:p.Ala159Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209010	0.58343	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	5.59	2.4	0.29515	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.053992	0.64402	D	0.000001	D	0.99816	0.9919	M	0.89840	3.065	0.51767	D	0.999938	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;1.0;0.997;0.995;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.986;0.995;0.997;0.996;0.987;0.998	D	0.98681	1.0692	10	0.87932	D	0	-9.0177	6.1221	0.20159	0.0:0.6615:0.1535:0.185	.	120;159;159;66;159;159;159	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	159;159;159;159;159;159;148;66;27;66;27;159	ENSP00000410739:A159P;ENSP00000352610:A159P;ENSP00000269305:A159P;ENSP00000398846:A159P;ENSP00000391127:A159P;ENSP00000391478:A159P;ENSP00000425104:A27P;ENSP00000423862:A66P;ENSP00000424104:A159P	ENSP00000269305:A159P	A	-	1	0	TP53	7519180	1.000000	0.71417	0.149000	0.22428	0.179000	0.23085	4.930000	0.63462	0.333000	0.23563	0.655000	0.94253	GCC		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PER3	8863	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	7887260	7887260	+	Missense_Mutation	SNP	C	C	G	rs201449626		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:7887260C>G	ENST00000361923.2	+	17	2422	c.2247C>G	c.(2245-2247)gaC>gaG	p.D749E	PER3_ENST00000377532.3_Missense_Mutation_p.D757E|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	749	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		AGCCGCCAGACAGCAGCAGCT	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		14619	0.0		0.001	False		,,,				2504	0.0					.											0													25.0	31.0	29.0					1																	7887260		2190	4279	6469	SO:0001583	missense	8863			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2247C>G	1.37:g.7887260C>G	ENSP00000355031:p.Asp749Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.58	1.390390	0.25118	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.10477	2.87;2.87	4.43	0.178	0.15058	.	4.474110	0.00669	N	0.000634	T	0.13457	0.0326	L	0.56396	1.775	0.09310	N	1	P;P;P;P	0.44946	0.709;0.761;0.846;0.709	B;B;B;B	0.38683	0.202;0.145;0.279;0.202	T	0.38693	-0.9649	10	0.38643	T	0.18	.	8.3664	0.32389	0.0:0.5211:0.0:0.4789	.	749;757;757;749	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	E	757;749	ENSP00000366755:D757E;ENSP00000355031:D749E	ENSP00000355031:D749E	D	+	3	2	PER3	7809847	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.269000	0.18589	0.113000	0.18004	0.561000	0.74099	GAC		0.652	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
DSC3	1825	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	18	28611062	28611062	+	Silent	SNP	C	C	A			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr18:28611062C>A	ENST00000360428.4	-	3	311	c.231G>T	c.(229-231)ggG>ggT	p.G77G	DSC3_ENST00000434452.1_Silent_p.G77G	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	77					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TGTACACTGACCCATCATTTA	0.418																																						.											0													72.0	64.0	67.0					18																	28611062		2203	4300	6503	SO:0001819	synonymous_variant	1825			X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.231G>T	18.37:g.28611062C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NN35|Q14200|Q9HAZ9	Silent	SNP	ENST00000360428.4	37	CCDS32810.1																																																																																				0.418	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
ABCA12	26154	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	215812198	215812198	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr2:215812198C>T	ENST00000272895.7	-	48	7406	c.7187G>A	c.(7186-7188)aGa>aAa	p.R2396K	ABCA12_ENST00000389661.4_Missense_Mutation_p.R2078K|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2396	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GGATAATTTTCTTTTTGTGCC	0.418																																					Ovarian(66;664 1488 5121 34295)	.											0													160.0	158.0	159.0					2																	215812198		2203	4300	6503	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7187G>A	2.37:g.215812198C>T	ENSP00000272895:p.Arg2396Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	35	5.435377	0.96150	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.80566	-1.39;-1.39	5.86	5.86	0.93980	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.074464	0.56097	N	0.000024	D	0.89227	0.6655	M	0.64567	1.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89225	0.3573	10	0.87932	D	0	.	20.1931	0.98233	0.0:1.0:0.0:0.0	.	2396;2078	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	K	2396;2078	ENSP00000272895:R2396K;ENSP00000374312:R2078K	ENSP00000272895:R2396K	R	-	2	0	ABCA12	215520443	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.092000	0.76930	2.771000	0.95319	0.563000	0.77884	AGA		0.418	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
DAAM2	23500	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	39867902	39867902	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr6:39867902T>C	ENST00000398904.2	+	23	2911	c.2729T>C	c.(2728-2730)gTc>gCc	p.V910A	RP11-61I13.3_ENST00000606829.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.V909A|RP11-61I13.3_ENST00000430595.1_RNA|RP11-61I13.3_ENST00000437947.1_RNA|DAAM2_ENST00000274867.4_Missense_Mutation_p.V910A			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	910	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GACAAGTTTGTCCCTGTCATG	0.582																																						.											0													42.0	45.0	44.0					6																	39867902		2026	4169	6195	SO:0001583	missense	23500			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2729T>C	6.37:g.39867902T>C	ENSP00000381876:p.Val910Ala	Somatic		WXS	Illumina HiSeq	Phase_I	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.870333	0.51588	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.18174	2.23;2.23;2.23	5.13	5.13	0.70059	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.240484	0.34133	N	0.004225	T	0.16300	0.0392	M	0.65677	2.01	0.80722	D	1	B;B	0.30439	0.055;0.279	B;B	0.38712	0.089;0.28	T	0.02232	-1.1191	10	0.66056	D	0.02	.	14.7529	0.69540	0.0:0.0:0.0:1.0	.	909;910	G5EA45;Q86T65	.;DAAM2_HUMAN	A	910;910;909	ENSP00000274867:V910A;ENSP00000381876:V910A;ENSP00000437808:V909A	ENSP00000274867:V910A	V	+	2	0	DAAM2	39975880	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	6.019000	0.70818	2.154000	0.67381	0.459000	0.35465	GTC		0.582	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
CROT	54677	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	87006732	87006732	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:87006732C>T	ENST00000331536.3	+	10	1129	c.944C>T	c.(943-945)tCc>tTc	p.S315F	CROT_ENST00000419147.2_Missense_Mutation_p.S343F|CROT_ENST00000442291.1_Missense_Mutation_p.S315F	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	315					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	AACTTGATTTCCTTTTCTAAT	0.294																																						.											0													122.0	129.0	127.0					7																	87006732		2203	4300	6503	SO:0001583	missense	54677				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.944C>T	7.37:g.87006732C>T	ENSP00000331981:p.Ser315Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	C	7.739	0.700957	0.15172	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.89343	-2.5;-2.5;-2.5	6.17	6.17	0.99709	.	0.460969	0.26673	N	0.023082	D	0.82967	0.5152	L	0.31065	0.9	0.31304	N	0.687954	B;B	0.22276	0.011;0.067	B;B	0.23150	0.017;0.044	T	0.80632	-0.1296	10	0.59425	D	0.04	-6.977	11.7019	0.51575	0.0:0.8958:0.0:0.1042	.	343;315	E7EQF2;Q9UKG9	.;OCTC_HUMAN	F	343;315;315	ENSP00000413575:S343F;ENSP00000331981:S315F;ENSP00000411983:S315F	ENSP00000331981:S315F	S	+	2	0	CROT	86844668	0.782000	0.28689	1.000000	0.80357	0.996000	0.88848	1.675000	0.37555	2.941000	0.99782	0.655000	0.94253	TCC		0.294	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151	
GSN	2934	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	124089710	124089710	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr9:124089710T>C	ENST00000373818.4	+	13	1934	c.1865T>C	c.(1864-1866)cTc>cCc	p.L622P	GSN_ENST00000412819.1_Missense_Mutation_p.L571P|GSN_ENST00000436847.1_Missense_Mutation_p.L582P|GSN_ENST00000394353.2_Missense_Mutation_p.L582P|GSN_ENST00000373823.3_Missense_Mutation_p.L571P|GSN_ENST00000373807.1_Missense_Mutation_p.L353P|GSN_ENST00000449733.1_Missense_Mutation_p.L571P|GSN_ENST00000373806.1_Missense_Mutation_p.L47P|GSN_ENST00000341272.2_Missense_Mutation_p.L571P|GSN_ENST00000545652.1_Missense_Mutation_p.L579P|GSN_ENST00000373808.2_Missense_Mutation_p.L571P	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	622	Actin-binding, Ca-sensitive. {ECO:0000255}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						CAGGAGCTGCTCAGGGTGCTG	0.642																																						.											0													20.0	22.0	21.0					9																	124089710		2203	4298	6501	SO:0001583	missense	2934			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.1865T>C	9.37:g.124089710T>C	ENSP00000362924:p.Leu622Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Missense_Mutation	SNP	ENST00000373818.4	37	CCDS6828.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.366894	0.82463	.	.	ENSG00000148180	ENST00000373823;ENST00000436847;ENST00000394353;ENST00000449733;ENST00000412819;ENST00000341272;ENST00000373808;ENST00000394352;ENST00000456109;ENST00000545652;ENST00000373818;ENST00000373807;ENST00000373806;ENST00000373805	T;T;T;T;T;T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.74	5.86	5.86	0.93980	Gelsolin domain (1);	0.235112	0.44688	D	0.000424	T	0.71492	0.3346	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D	0.71674	0.972;0.988;0.983;0.972;0.998	P;D;D;P;D	0.66716	0.822;0.91;0.911;0.822;0.946	T	0.74070	-0.3783	10	0.59425	D	0.04	-18.3083	15.7408	0.77894	0.0:0.0:0.0:1.0	.	595;579;582;353;622	B7Z9A0;F5H1A8;B7Z373;Q5T0H9;P06396	.;.;.;.;GELS_HUMAN	P	571;582;582;571;571;571;571;555;545;579;622;353;47;47	ENSP00000362929:L571P;ENSP00000411293:L582P;ENSP00000377882:L582P;ENSP00000409358:L571P;ENSP00000416586:L571P;ENSP00000340888:L571P;ENSP00000362914:L571P;ENSP00000445823:L579P;ENSP00000362924:L622P;ENSP00000362913:L353P;ENSP00000362912:L47P	ENSP00000340888:L571P	L	+	2	0	GSN	123129531	1.000000	0.71417	0.971000	0.41717	0.962000	0.63368	5.376000	0.66178	2.367000	0.80283	0.528000	0.53228	CTC		0.642	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053861.1	NM_000177	
DCAF8L2	347442	hgsc.bcm.edu	37	X	27765387	27765407	+	In_Frame_Del	DEL	GGAGGAGGAGGAAGAGGAGGA	GGAGGAGGAGGAAGAGGAGGA	-	rs371896121		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	GGAGGAGGAGGAAGAGGAGGA	GGAGGAGGAGGAAGAGGAGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chrX:27765387_27765407delGGAGGAGGAGGAAGAGGAGGA	ENST00000451261.2	+	5	774_794	c.375_395delGGAGGAGGAGGAAGAGGAGGA	c.(373-396)ggggaggaggaggaagaggaggag>ggg	p.EEEEEEE140del		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	140	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aggagggaggggaggaggaggaagaggaggaggaggaggag	0.548																																						.											0																																										SO:0001651	inframe_deletion	347442				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.375_395delGGAGGAGGAGGAAGAGGAGGA	X.37:g.27765387_27765407delGGAGGAGGAGGAAGAGGAGGA	ENSP00000462745:p.Glu140_Glu146del	Somatic		WXS	Illumina HiSeq	Phase_I	B2RXH9|J3KT06	In_Frame_Del	DEL	ENST00000451261.2	37	CCDS59162.1																																																																																				0.548	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
HIP1	3092	hgsc.bcm.edu	37	7	75228522	75228522	+	Missense_Mutation	SNP	A	A	G	rs202058558|rs146838091		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:75228522A>G	ENST00000336926.6	-	2	190	c.164T>C	c.(163-165)gTa>gCa	p.V55A	HIP1_ENST00000434438.2_Missense_Mutation_p.V55A	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	55	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)	p.V55E(1)		breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TTTTTCCTTTACAGCCACTTC	0.502			T	PDGFRB	CMML																																	.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	1	Substitution - Missense(1)	lung(1)											158.0	157.0	157.0					7																	75228522		2203	4300	6503	SO:0001583	missense	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.164T>C	7.37:g.75228522A>G	ENSP00000336747:p.Val55Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591713	0.86953	.	.	ENSG00000127946	ENST00000336926;ENST00000434438;ENST00000420909	T;T;T	0.30981	1.51;1.51;1.51	5.13	5.13	0.70059	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	L	0.38953	1.18	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	T	0.13124	-1.0521	10	0.21014	T	0.42	-21.9336	14.2644	0.66107	1.0:0.0:0.0:0.0	.	55	O00291	HIP1_HUMAN	A	55;55;26	ENSP00000336747:V55A;ENSP00000410300:V55A;ENSP00000414280:V26A	ENSP00000336747:V55A	V	-	2	0	HIP1	75066458	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	8.757000	0.91657	2.154000	0.67381	0.459000	0.35465	GTA		0.502	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
DHX9	1660	hgsc.bcm.edu	37	1	182827873	182827873	+	Silent	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:182827873A>G	ENST00000367549.3	+	10	1016	c.906A>G	c.(904-906)gaA>gaG	p.E302E		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	302	Interaction with BRCA1.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AATAGCCTGAAGATCCTTCTG	0.413																																					Colon(69;210 1162 3697 13559 39565)	.											0													70.0	63.0	65.0					1																	182827873		1846	4096	5942	SO:0001819	synonymous_variant	1660			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.906A>G	1.37:g.182827873A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Silent	SNP	ENST00000367549.3	37	CCDS41444.1																																																																																				0.413	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
ARSE	415	hgsc.bcm.edu	37	X	2867365	2867365	+	Silent	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chrX:2867365C>T	ENST00000381134.3	-	6	900	c.834G>A	c.(832-834)gaG>gaA	p.E278E	ARSE_ENST00000545496.1_Silent_p.E303E|ARSE_ENST00000540563.1_Silent_p.E233E	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	278					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGGACGCAACCTCCTGCAGAA	0.488																																						.											0													65.0	56.0	59.0					X																	2867365		2203	4300	6503	SO:0001819	synonymous_variant	415			X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.834G>A	X.37:g.2867365C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q53FT2|Q53FU8	Silent	SNP	ENST00000381134.3	37	CCDS14122.1																																																																																				0.488	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
LRRC40	55631	broad.mit.edu;bcgsc.ca	37	1	70641632	70641632	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:70641632A>T	ENST00000370952.3	-	7	917	c.838T>A	c.(838-840)Tta>Ata	p.L280I		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	280						membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TCTGCCTCTAACATTTCAATC	0.318																																						.											0													107.0	105.0	106.0					1																	70641632		2203	4300	6503	SO:0001583	missense	55631				CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.838T>A	1.37:g.70641632A>T	ENSP00000359990:p.Leu280Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	ENST00000370952.3	37	CCDS646.1	.	.	.	.	.	.	.	.	.	.	A	10.79	1.449154	0.26074	.	.	ENSG00000066557	ENST00000370952	T	0.56776	0.44	5.46	1.48	0.22813	.	0.214009	0.39687	N	0.001289	T	0.17619	0.0423	N	0.12443	0.215	0.43835	D	0.996415	B	0.33477	0.413	B	0.42738	0.396	T	0.02844	-1.1103	10	0.23891	T	0.37	.	3.5059	0.07691	0.5349:0.0:0.2204:0.2448	.	280	Q9H9A6	LRC40_HUMAN	I	280	ENSP00000359990:L280I	ENSP00000359990:L280I	L	-	1	2	LRRC40	70414220	0.003000	0.15002	1.000000	0.80357	0.939000	0.58152	0.090000	0.15025	0.908000	0.36671	0.477000	0.44152	TTA		0.318	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768	
KCNN3	3782	broad.mit.edu	37	1	154841678	154841678	+	Missense_Mutation	SNP	A	A	G	rs35646025		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:154841678A>G	ENST00000271915.4	-	1	1078	c.763T>C	c.(763-765)Ttc>Ctc	p.F255L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	260					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GCTTTGGGGAAGGTGGTGCTG	0.567																																						.											0													114.0	107.0	110.0					1																	154841678		2203	4300	6503	SO:0001583	missense	3782			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.763T>C	1.37:g.154841678A>G	ENSP00000271915:p.Phe255Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	A	10.86	1.469018	0.26335	.	.	ENSG00000143603	ENST00000271915	D	0.94966	-3.57	4.88	4.88	0.63580	.	0.000000	0.49916	D	0.000129	T	0.79741	0.4498	N	0.08118	0	0.80722	D	1	B;B	0.30281	0.275;0.275	B;B	0.30029	0.11;0.076	T	0.79659	-0.1711	10	0.28530	T	0.3	-29.2671	10.8122	0.46553	1.0:0.0:0.0:0.0	.	261;260	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	L	255	ENSP00000271915:F255L	ENSP00000271915:F255L	F	-	1	0	KCNN3	153108302	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.920000	0.48844	2.047000	0.60756	0.533000	0.62120	TTC		0.567	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
IFI16	3428	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	159023498	159023498	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:159023498T>C	ENST00000295809.7	+	11	2516	c.2261T>C	c.(2260-2262)aTt>aCt	p.I754T	IFI16_ENST00000340979.6_Missense_Mutation_p.I642T|IFI16_ENST00000368131.4_Missense_Mutation_p.I698T|IFI16_ENST00000359709.3_Missense_Mutation_p.I698T|IFI16_ENST00000368132.3_Missense_Mutation_p.I698T|IFI16_ENST00000448393.2_Missense_Mutation_p.I642T|IFI16_ENST00000430894.2_Missense_Mutation_p.I702T			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	754	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					AGATCTGTAATTCATAGTCAC	0.393																																						.											0													121.0	121.0	121.0					1																	159023498		2203	4300	6503	SO:0001583	missense	3428			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.2261T>C	1.37:g.159023498T>C	ENSP00000295809:p.Ile754Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.598|4.598	0.111156|0.111156	0.08831|0.08831	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000448393|ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	.|T;T;T;T;T	.|0.21932	.|1.98;1.98;1.98;1.98;1.98	4.83|4.83	-3.69|-3.69	0.04450|0.04450	.|.	.|.	.|.	.|.	.|.	T|T	0.03178|0.03178	0.0093|0.0093	N|N	0.25380|0.25380	0.74|0.74	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.18741	.|0.002;0.03;0.0	.|B;B;B	.|0.23852	.|0.004;0.049;0.008	T|T	0.46076|0.46076	-0.9217|-0.9217	5|9	.|0.13108	.|T	.|0.6	.|.	5.7596|5.7596	0.18192|0.18192	0.0:0.3952:0.3196:0.2851|0.0:0.3952:0.3196:0.2851	.|.	.|702;642;698	.|E7EPR3;Q16666-3;Q16666-2	.|.;.;.	L|T	463|383;754;642;698;698;702	.|ENSP00000295809:I754T;ENSP00000342741:I642T;ENSP00000357113:I698T;ENSP00000357114:I698T;ENSP00000394935:I702T	.|ENSP00000295809:I754T	F|I	+|+	1|2	0|0	IFI16|IFI16	157290122|157290122	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.639000|0.639000	0.38242|0.38242	-1.761000|-1.761000	0.01805|0.01805	-0.563000|-0.563000	0.06078|0.06078	0.496000|0.496000	0.49642|0.49642	TTC|ATT		0.393	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
F5	2153	broad.mit.edu	37	1	169511773	169511773	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:169511773A>G	ENST00000367797.3	-	13	2756	c.2555T>C	c.(2554-2556)cTt>cCt	p.L852P	F5_ENST00000367796.3_Missense_Mutation_p.L857P	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	852	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TCCAGCACCAAGTGAAAGTAG	0.448																																						.											0													186.0	175.0	178.0					1																	169511773		2203	4300	6503	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.2555T>C	1.37:g.169511773A>G	ENSP00000356771:p.Leu852Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.765491	0.49574	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.21543	2.0;2.0	5.53	-7.37	0.01412	.	1.545810	0.04334	N	0.352893	T	0.11281	0.0275	L	0.42245	1.32	0.09310	N	1	D	0.64830	0.994	P	0.60173	0.87	T	0.32929	-0.9888	10	0.59425	D	0.04	0.0797	1.0413	0.01559	0.2441:0.1113:0.2096:0.4349	.	852	P12259	FA5_HUMAN	P	852;857	ENSP00000356771:L852P;ENSP00000356770:L857P	ENSP00000356770:L857P	L	-	2	0	F5	167778397	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.055000	0.14229	-1.317000	0.02292	-0.480000	0.04831	CTT		0.448	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
OR2C3	81472	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	247695452	247695452	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:247695452T>C	ENST00000366487.3	-	2	723	c.362A>G	c.(361-363)tAt>tGt	p.Y121C	GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366491.2_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GTAGCGGTCATAGGACATGGT	0.562																																						.											0													75.0	77.0	76.0					1																	247695452		2203	4300	6503	SO:0001583	missense	81472			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.362A>G	1.37:g.247695452T>C	ENSP00000355443:p.Tyr121Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	T	14.94	2.684637	0.47991	.	.	ENSG00000196242	ENST00000366487	T	0.01347	4.99	4.04	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34531	U	0.003895	T	0.05960	0.0155	M	0.81497	2.545	0.25863	N	0.983802	D	0.71674	0.998	P	0.60789	0.879	T	0.06162	-1.0842	10	0.87932	D	0	.	8.2015	0.31428	0.1787:0.0:0.0:0.8213	.	121	Q8N628	OR2C3_HUMAN	C	121	ENSP00000355443:Y121C	ENSP00000355443:Y121C	Y	-	2	0	OR2C3	245762075	0.972000	0.33761	0.399000	0.26333	0.888000	0.51559	1.604000	0.36804	0.690000	0.31570	0.528000	0.53228	TAT		0.562	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074	
KRTAP5-5	439915	broad.mit.edu	37	11	1651412	1651412	+	Silent	SNP	G	G	C	rs569811286		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:1651412G>C	ENST00000399676.2	+	1	380	c.342G>C	c.(340-342)ggG>ggC	p.G114G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	114	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.G114G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.706													N|||	1	0.000199681	0.0	0.0	5008	,	,		3556	0.001		0.0	False		,,,				2504	0.0					.											1	Substitution - coding silent(1)	prostate(1)											20.0	31.0	27.0					11																	1651412		2083	4147	6230	SO:0001819	synonymous_variant	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.342G>C	11.37:g.1651412G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																				0.706	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
OR52L1	338751	broad.mit.edu;mdanderson.org;bcgsc.ca	37	11	6007311	6007311	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:6007311G>A	ENST00000332249.4	-	1	904	c.850C>T	c.(850-852)Cat>Tat	p.H284Y		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTACATGATGACCAAAGCGG	0.493																																					Melanoma(121;653 1666 10547 22796 51255)	.											0													106.0	106.0	106.0					11																	6007311		2084	4245	6329	SO:0001583	missense	338751			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.850C>T	11.37:g.6007311G>A	ENSP00000330338:p.His284Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPA6|Q6IFK9	Missense_Mutation	SNP	ENST00000332249.4	37	CCDS44529.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.253796	0.22965	.	.	ENSG00000183313	ENST00000332249	T	0.37058	1.22	4.1	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.172439	0.28488	N	0.015173	T	0.44993	0.1320	L	0.51853	1.615	0.09310	N	1	P	0.46706	0.883	P	0.54060	0.741	T	0.30268	-0.9984	10	0.87932	D	0	.	12.1823	0.54218	0.0:0.1737:0.8263:0.0	.	284	Q8NGH7	O52L1_HUMAN	Y	284	ENSP00000330338:H284Y	ENSP00000330338:H284Y	H	-	1	0	OR52L1	5963887	0.000000	0.05858	0.423000	0.26634	0.010000	0.07245	0.072000	0.14617	1.987000	0.57996	0.313000	0.20887	CAT		0.493	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
NARS2	79731	broad.mit.edu;bcgsc.ca	37	11	78277251	78277251	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:78277251C>T	ENST00000281038.5	-	4	815	c.440G>A	c.(439-441)tGt>tAt	p.C147Y	NARS2_ENST00000528850.1_5'UTR	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	147					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	GTTAGTCCTACACCTAAAGTG	0.398																																						.											0													111.0	108.0	109.0					11																	78277251		2200	4291	6491	SO:0001583	missense	79731			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.440G>A	11.37:g.78277251C>T	ENSP00000281038:p.Cys147Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	G3V178	Missense_Mutation	SNP	ENST00000281038.5	37	CCDS8261.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.540877	0.27563	.	.	ENSG00000137513	ENST00000281038;ENST00000529880	T;T	0.78816	-1.21;-1.21	5.13	5.13	0.70059	Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.83982	0.5372	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.85672	0.1295	10	0.87932	D	0	-10.5576	17.7175	0.88342	0.0:1.0:0.0:0.0	.	147	Q96I59	SYNM_HUMAN	Y	147	ENSP00000281038:C147Y;ENSP00000432240:C147Y	ENSP00000281038:C147Y	C	-	2	0	NARS2	77954899	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	6.850000	0.75420	2.547000	0.85894	0.655000	0.94253	TGT		0.398	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391138.2	NM_024678	
DYNC2H1	79659	broad.mit.edu	37	11	103006273	103006273	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:103006273A>T	ENST00000375735.2	+	16	2399	c.2255A>T	c.(2254-2256)cAa>cTa	p.Q752L	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.Q752L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	752	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGGAATCATCAACTGTACAAA	0.348																																						.											0													78.0	74.0	75.0					11																	103006273		1838	4099	5937	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2255A>T	11.37:g.103006273A>T	ENSP00000364887:p.Gln752Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252082	0.80135	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.35789	1.29;1.3	5.62	5.62	0.85841	.	.	.	.	.	T	0.66228	0.2768	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.69187	-0.5211	9	0.28530	T	0.3	.	15.8286	0.78733	1.0:0.0:0.0:0.0	.	752;752	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	752	ENSP00000364887:Q752L;ENSP00000381167:Q752L	ENSP00000364887:Q752L	Q	+	2	0	DYNC2H1	102511483	1.000000	0.71417	0.928000	0.36995	0.794000	0.44872	8.962000	0.93254	2.141000	0.66446	0.460000	0.39030	CAA		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
PPFIA2	8499	broad.mit.edu	37	12	81657079	81657079	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr12:81657079A>G	ENST00000549396.1	-	31	3806	c.3646T>C	c.(3646-3648)Tca>Cca	p.S1216P	PPFIA2_ENST00000541017.1_Missense_Mutation_p.S402P|PPFIA2_ENST00000333447.7_Missense_Mutation_p.S1204P|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.S1216P|PPFIA2_ENST00000550359.2_Missense_Mutation_p.S1063P|PPFIA2_ENST00000548586.1_Missense_Mutation_p.S1210P|PPFIA2_ENST00000443686.3_Missense_Mutation_p.S1111P|PPFIA2_ENST00000549325.1_Missense_Mutation_p.S1201P|PPFIA2_ENST00000407050.4_Missense_Mutation_p.S1115P|PPFIA2_ENST00000541570.2_Missense_Mutation_p.S752P|PPFIA2_ENST00000552948.1_Missense_Mutation_p.S1195P	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1216					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						AATGTTTCTGAGGACCCAGGC	0.458																																						.											0													125.0	119.0	121.0					12																	81657079		1959	4156	6115	SO:0001583	missense	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3646T>C	12.37:g.81657079A>G	ENSP00000450337:p.Ser1216Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.687202	0.48097	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T;T	0.32515	2.19;2.19;1.87;1.45;1.84;2.19;2.2;1.87;2.17	5.23	4.01	0.46588	.	0.240193	0.34338	N	0.004060	T	0.18882	0.0453	N	0.19112	0.55	0.44555	D	0.997519	P	0.36048	0.534	B	0.31686	0.134	T	0.08889	-1.0700	10	0.62326	D	0.03	-10.3439	11.7843	0.52032	0.8531:0.1469:0.0:0.0	.	1216	O75334	LIPA2_HUMAN	P	1216;1201;752;402;1115;1229;1204;1210;1111;1195	ENSP00000450337:S1216P;ENSP00000450298:S1201P;ENSP00000438337:S752P;ENSP00000445532:S402P;ENSP00000385093:S1115P;ENSP00000327416:S1204P;ENSP00000449338:S1210P;ENSP00000388373:S1111P;ENSP00000447868:S1195P	ENSP00000327416:S1204P	S	-	1	0	PPFIA2	80181210	0.999000	0.42202	1.000000	0.80357	0.963000	0.63663	3.011000	0.49567	1.984000	0.57885	0.528000	0.53228	TCA		0.458	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
HAPLN3	145864	broad.mit.edu	37	15	89421386	89421386	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr15:89421386A>G	ENST00000359595.3	-	5	1112	c.898T>C	c.(898-900)Ttt>Ctt	p.F300L	HAPLN3_ENST00000562889.1_Missense_Mutation_p.F362L	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	300	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	CAGGCGGCAAAGAGCTGTCCC	0.627																																						.											0													159.0	147.0	151.0					15																	89421386		2200	4299	6499	SO:0001583	missense	145864			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.898T>C	15.37:g.89421386A>G	ENSP00000352606:p.Phe300Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7P0	Missense_Mutation	SNP	ENST00000359595.3	37	CCDS10346.1	.	.	.	.	.	.	.	.	.	.	A	34	5.368382	0.95900	.	.	ENSG00000140511	ENST00000359595	T	0.07688	3.17	4.7	4.7	0.59300	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.057786	0.64402	D	0.000001	T	0.13543	0.0328	L	0.52573	1.65	0.49687	D	0.999819	P;P	0.47604	0.898;0.898	P;P	0.47251	0.542;0.542	T	0.00978	-1.1493	10	0.72032	D	0.01	-10.134	13.3187	0.60421	1.0:0.0:0.0:0.0	.	300;300	A8K7T8;Q96S86	.;HPLN3_HUMAN	L	300	ENSP00000352606:F300L	ENSP00000352606:F300L	F	-	1	0	HAPLN3	87222390	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.817000	0.91985	1.871000	0.54225	0.533000	0.62120	TTT		0.627	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309070.1	NM_178232	
ATXN1L	342371	broad.mit.edu	37	16	71885173	71885173	+	Silent	SNP	C	C	T	rs149640121	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr16:71885173C>T	ENST00000427980.2	+	3	1823	c.1530C>T	c.(1528-1530)gtC>gtT	p.V510V	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	510	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						CTAGCACGGTCGTGGACATTC	0.582													C|||	7	0.00139776	0.0	0.0014	5008	,	,		19194	0.0		0.003	False		,,,				2504	0.0031					.											0								C		0,1384		0,0,692	117.0	119.0	118.0		1530	-6.6	1.0	16	dbSNP_134	118	3,3179		0,3,1588	no	coding-synonymous	ATXN1L	NM_001137675.2		0,3,2280	TT,TC,CC		0.0943,0.0,0.0657		510/690	71885173	3,4563	692	1591	2283	SO:0001819	synonymous_variant	342371				CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1530C>T	16.37:g.71885173C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000427980.2	37	CCDS45523.1																																																																																				0.582	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434171.1	NM_001137675.2	
ZZEF1	23140	broad.mit.edu	37	17	4046184	4046184	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr17:4046184delC	ENST00000381638.2	-	1	130	c.6delG	c.(4-6)gggfs	p.G2fs	CYB5D2_ENST00000573984.1_5'Flank|CYB5D2_ENST00000301391.3_5'Flank|CYB5D2_ENST00000575251.1_5'Flank|ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCGGAGCGTTCCCCATGGGGT	0.741																																						.											0													3.0	3.0	3.0					17																	4046184		1755	3358	5113	SO:0001589	frameshift_variant	23140			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.6delG	17.37:g.4046184delC	ENSP00000371051:p.Gly2fs	Somatic		WXS	Illumina HiSeq	Phase_I	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Frame_Shift_Del	DEL	ENST00000381638.2	37	CCDS11043.1																																																																																				0.741	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
NPTX1	4884	broad.mit.edu	37	17	78449421	78449421	+	Missense_Mutation	SNP	A	A	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr17:78449421A>C	ENST00000306773.4	-	2	699	c.542T>G	c.(541-543)gTg>gGg	p.V181G	NPTX1_ENST00000575212.1_5'UTR	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	181					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			CAGGGTGTTCACCCGGGACAG	0.632																																						.											0													49.0	40.0	43.0					17																	78449421		2201	4299	6500	SO:0001583	missense	4884			U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.542T>G	17.37:g.78449421A>C	ENSP00000307549:p.Val181Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.538851	0.45176	.	.	ENSG00000171246	ENST00000306773	T	0.12147	2.71	3.7	3.7	0.42460	.	0.000000	0.85682	D	0.000000	T	0.25121	0.0610	M	0.77313	2.365	0.80722	D	1	D	0.54047	0.964	P	0.49140	0.601	T	0.08229	-1.0732	10	0.72032	D	0.01	-23.0712	11.7908	0.52068	1.0:0.0:0.0:0.0	.	181	Q15818	NPTX1_HUMAN	G	181	ENSP00000307549:V181G	ENSP00000307549:V181G	V	-	2	0	NPTX1	76064016	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	5.641000	0.67881	1.682000	0.51000	0.459000	0.35465	GTG		0.632	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
ZNF525	170958	broad.mit.edu	37	19	53879127	53879127	+	Silent	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:53879127T>C	ENST00000475179.1	+	3	234	c.120T>C	c.(118-120)aaT>aaC	p.N40N	ZNF525_ENST00000474037.1_Silent_p.N40N|ZNF525_ENST00000467003.1_Silent_p.N4N|ZNF525_ENST00000593918.1_Silent_p.N40N|ZNF525_ENST00000491101.1_Silent_p.N40N			Q8N782	ZN525_HUMAN	zinc finger protein 525	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						TGCTGGAGAATTATAGGAACC	0.458																																						.											0																																										SO:0001819	synonymous_variant	170958			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000475179.1:c.120T>C	19.37:g.53879127T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q8TF23	RNA	SNP	ENST00000475179.1	37																																																																																					0.458	ZNF525-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000350553.1	NR_003699	
DNAH6	1768	broad.mit.edu	37	2	84811142	84811142	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr2:84811142A>G	ENST00000237449.6	+	14	2257	c.2249A>G	c.(2248-2250)gAg>gGg	p.E750G	DNAH6_ENST00000398278.2_Missense_Mutation_p.E750G|DNAH6_ENST00000389394.3_Missense_Mutation_p.E750G			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	750	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTTGAAGATGAGGGGAATATA	0.383																																						.											0													127.0	125.0	125.0					2																	84811142		2203	4300	6503	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2249A>G	2.37:g.84811142A>G	ENSP00000237449:p.Glu750Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	9.664	1.144826	0.21288	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.28069	1.63;1.74;1.63	5.73	5.73	0.89815	.	0.000000	0.44902	D	0.000406	T	0.50514	0.1620	M	0.63843	1.955	0.42205	D	0.991785	B;D	0.89917	0.029;1.0	B;D	0.69479	0.027;0.964	T	0.43458	-0.9390	10	0.27785	T	0.31	.	14.9947	0.71421	1.0:0.0:0.0:0.0	.	750;329	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	G	750	ENSP00000374045:E750G;ENSP00000381326:E750G;ENSP00000237449:E750G	ENSP00000237449:E750G	E	+	2	0	DNAH6	84664653	1.000000	0.71417	0.955000	0.39395	0.036000	0.12997	7.108000	0.77055	2.180000	0.69256	0.482000	0.46254	GAG		0.383	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
SLC35F5	80255	broad.mit.edu	37	2	114508020	114508020	+	Frame_Shift_Del	DEL	G	G	-	rs60727155	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr2:114508020delG	ENST00000245680.2	-	4	812	c.399delC	c.(397-399)cgcfs	p.R133fs	SLC35F5_ENST00000409342.1_Frame_Shift_Del_p.R127fs	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	133					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						CATGCTTTCCGCGAAGTCCTC	0.348																																						.											0													86.0	89.0	88.0					2																	114508020		2203	4300	6503	SO:0001589	frameshift_variant	80255			AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.399delC	2.37:g.114508020delG	ENSP00000245680:p.Arg133fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H6P8|Q9H7D8	Frame_Shift_Del	DEL	ENST00000245680.2	37	CCDS2119.1																																																																																				0.348	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181	
PANX2	56666	broad.mit.edu	37	22	50616699	50616699	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr22:50616699delT	ENST00000395842.2	+	2	1558	c.1558delT	c.(1558-1560)tacfs	p.Y520fs	PANX2_ENST00000159647.5_Frame_Shift_Del_p.Y520fs	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	520					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CGTGCACCCCTACATCCTCGG	0.776																																						.											0													3.0	3.0	3.0					22																	50616699		1646	3384	5030	SO:0001589	frameshift_variant	56666				CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1558delT	22.37:g.50616699delT	ENSP00000379183:p.Tyr520fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z684|Q96RD5|Q9UGX8	Frame_Shift_Del	DEL	ENST00000395842.2	37	CCDS14085.2																																																																																				0.776	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075010.3	NM_052839	
IL17RB	55540	broad.mit.edu	37	3	53886982	53886982	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr3:53886982A>G	ENST00000288167.3	+	5	448	c.439A>G	c.(439-441)Aat>Gat	p.N147D		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	147					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		TGCAAATATGAATGAAGATGG	0.418																																						.											0													149.0	142.0	144.0					3																	53886982		2203	4300	6503	SO:0001583	missense	55540			AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.439A>G	3.37:g.53886982A>G	ENSP00000288167:p.Asn147Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BPZ0|Q9NRL4|Q9NRM5	Missense_Mutation	SNP	ENST00000288167.3	37	CCDS2874.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.745677	0.49151	.	.	ENSG00000056736	ENST00000288167;ENST00000494338	T;T	0.15718	3.3;2.4	6.07	4.92	0.64577	.	0.102782	0.43260	N	0.000583	T	0.27027	0.0662	L	0.42245	1.32	0.31571	N	0.656263	D	0.76494	0.999	D	0.80764	0.994	T	0.10636	-1.0621	10	0.10902	T	0.67	-19.2642	8.7811	0.34792	0.916:0.0:0.084:0.0	.	147	Q9NRM6	I17RB_HUMAN	D	147	ENSP00000288167:N147D;ENSP00000418638:N147D	ENSP00000288167:N147D	N	+	1	0	IL17RB	53862022	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	0.998000	0.29744	1.128000	0.42052	0.533000	0.62120	AAT		0.418	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350563.1	NM_172234	
ECE2	9718	broad.mit.edu	37	3	184002787	184002787	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr3:184002787T>C	ENST00000402825.3	+	9	1396	c.1396T>C	c.(1396-1398)Tct>Cct	p.S466P	ECE2_ENST00000404464.3_Missense_Mutation_p.S348P|ECE2_ENST00000357474.5_Missense_Mutation_p.S394P|ECE2_ENST00000359140.4_Missense_Mutation_p.S319P|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	466	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGAGTTCCTGTCTTTCTTGCT	0.547											OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													83.0	81.0	82.0					3																	184002787		2203	4300	6503	SO:0001583	missense	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1396T>C	3.37:g.184002787T>C	ENSP00000384223:p.Ser466Pro	Somatic	1988	WXS	Illumina HiSeq	Phase_I	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	T	16.62	3.174854	0.57692	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93	4.21	4.21	0.49690	Peptidase M13 (1);	0.129673	0.53938	D	0.000052	T	0.76004	0.3927	L	0.43152	1.355	0.40643	D	0.981962	P;P;P;B;P;P;P	0.52463	0.853;0.953;0.953;0.011;0.942;0.823;0.943	P;P;P;B;P;P;P	0.59825	0.633;0.864;0.864;0.029;0.786;0.596;0.817	T	0.76471	-0.2947	10	0.49607	T	0.09	-9.1459	7.9437	0.29974	0.1832:0.0:0.0:0.8167	.	68;319;337;348;394;319;466	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	P	466;319;348;394;340	ENSP00000384223:S466P;ENSP00000352052:S319P;ENSP00000385846:S348P;ENSP00000350066:S394P;ENSP00000398444:S340P	ENSP00000350066:S394P	S	+	1	0	ECE2	185485481	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.263000	0.43293	1.777000	0.52277	0.523000	0.50628	TCT		0.547	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
PRMT9	90826	broad.mit.edu;bcgsc.ca	37	4	148594863	148594863	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr4:148594863A>T	ENST00000322396.6	-	3	743	c.501T>A	c.(499-501)aaT>aaA	p.N167K	PRMT10_ENST00000541232.1_Missense_Mutation_p.N54K	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		167	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						GGATTGCTGCATTATAAATTG	0.393																																						.											0													92.0	91.0	92.0					4																	148594863		2203	4300	6503	SO:0001583	missense	90826																														ENST00000322396.6:c.501T>A	4.37:g.148594863A>T	ENSP00000314396:p.Asn167Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	A	2.429	-0.331220	0.05314	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.20881	2.04;2.04	5.43	-0.181	0.13291	.	0.160534	0.56097	D	0.000027	T	0.10121	0.0248	L	0.28649	0.875	0.28223	N	0.926456	B	0.16166	0.016	B	0.18561	0.022	T	0.16364	-1.0405	10	0.21540	T	0.41	-4.7694	1.2249	0.01932	0.2977:0.213:0.3247:0.1646	.	167	Q6P2P2	ANM10_HUMAN	K	167;54	ENSP00000314396:N167K;ENSP00000439508:N54K	ENSP00000314396:N167K	N	-	3	2	PRMT10	148814313	0.928000	0.31464	0.991000	0.47740	0.716000	0.41182	0.127000	0.15790	0.044000	0.15775	0.533000	0.62120	AAT		0.393	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
ADCY2	108	broad.mit.edu;mdanderson.org;bcgsc.ca	37	5	7707862	7707862	+	Missense_Mutation	SNP	G	G	A	rs140842335		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr5:7707862G>A	ENST00000338316.4	+	9	1401	c.1312G>A	c.(1312-1314)Gct>Act	p.A438T	ADCY2_ENST00000537121.1_Missense_Mutation_p.A258T|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	438					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CTTGAATGGCGCTTATAAAGT	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17256	0.0		0.0	False		,,,				2504	0.0					.											0								G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	126.0	126.0	126.0		1312	6.0	0.9	5	dbSNP_134	126	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ADCY2	NM_020546.2	58	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	possibly-damaging	438/1092	7707862	3,13003	2203	4300	6503	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1312G>A	5.37:g.7707862G>A	ENSP00000342952:p.Ala438Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	31	5.083816	0.94050	2.27E-4	2.33E-4	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.81330	-1.48;-1.48	5.96	5.96	0.96718	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.178753	0.48286	D	0.000189	D	0.83519	0.5272	N	0.25647	0.755	0.44843	D	0.997853	D;D	0.62365	0.975;0.991	P;D	0.62955	0.698;0.909	T	0.81466	-0.0920	10	0.34782	T	0.22	.	20.4192	0.99033	0.0:0.0:1.0:0.0	.	258;438	B7Z2C1;Q08462	.;ADCY2_HUMAN	T	438;289;258	ENSP00000342952:A438T;ENSP00000444803:A258T	ENSP00000342952:A438T	A	+	1	0	ADCY2	7760862	1.000000	0.71417	0.938000	0.37757	0.949000	0.60115	4.894000	0.63206	2.831000	0.97527	0.650000	0.86243	GCT		0.413	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
AMACR	23600	broad.mit.edu	37	5	33989302	33989302	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr5:33989302G>C	ENST00000335606.6	-	5	1133	c.1045C>G	c.(1045-1047)Cac>Gac	p.H349D	AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000382072.2_3'UTR|AMACR_ENST00000382085.3_Missense_Mutation_p.H349D|AMACR_ENST00000502637.1_Missense_Mutation_p.H334D|RP11-1084J3.4_ENST00000382079.3_3'UTR	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	349					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						TCCTCAGTGTGTTCTCCTATG	0.448																																						.											0													89.0	92.0	91.0					5																	33989302		2203	4300	6503	SO:0001583	missense	23600			AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.1045C>G	5.37:g.33989302G>C	ENSP00000334424:p.His349Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	CCDS3902.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705693	0.48412	.	.	ENSG00000242110	ENST00000335606;ENST00000382085;ENST00000502637	T;T;T	0.74842	-0.88;-0.88;-0.88	5.6	5.6	0.85130	CoA-transferase family III domain (1);	0.000000	0.85682	D	0.000000	T	0.72700	0.3493	L	0.47078	1.49	0.80722	D	1	B;B;B	0.27997	0.197;0.063;0.063	B;B;B	0.35470	0.203;0.082;0.082	T	0.66031	-0.6024	10	0.19147	T	0.46	-26.3242	19.9797	0.97321	0.0:0.0:1.0:0.0	.	349;334;349	F8W9N1;D6RB81;Q9UHK6	.;.;AMACR_HUMAN	D	349;349;334	ENSP00000334424:H349D;ENSP00000371517:H349D;ENSP00000424351:H334D	ENSP00000334424:H349D	H	-	1	0	AMACR	34025059	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	9.456000	0.97628	2.791000	0.96007	0.637000	0.83480	CAC		0.448	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
WDR70	55100	broad.mit.edu	37	5	37721279	37721279	+	Silent	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr5:37721279A>G	ENST00000265107.4	+	14	1635	c.1479A>G	c.(1477-1479)ggA>ggG	p.G493G		NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	493							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTGGAAATGGATTGGCTAAAG	0.468																																						.											0													146.0	140.0	142.0					5																	37721279		2203	4300	6503	SO:0001819	synonymous_variant	55100			BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1479A>G	5.37:g.37721279A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H053	Silent	SNP	ENST00000265107.4	37	CCDS34147.1																																																																																				0.468	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034	
ZNF12	7559	broad.mit.edu	37	7	6732196	6732196	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:6732196T>C	ENST00000405858.1	-	5	918	c.377A>G	c.(376-378)aAc>aGc	p.N126S	AC073343.2_ENST00000577401.1_RNA|ZNF12_ENST00000342651.5_Intron|ZNF12_ENST00000404360.1_Intron|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	126					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		AGGAACAGGGTTCGTTTCTAC	0.373																																						.											0													192.0	187.0	189.0					7																	6732196		1837	4087	5924	SO:0001583	missense	7559			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.377A>G	7.37:g.6732196T>C	ENSP00000385939:p.Asn126Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	ENST00000405858.1	37	CCDS47538.1	.	.	.	.	.	.	.	.	.	.	T	0.124	-1.121875	0.01785	.	.	ENSG00000164631	ENST00000405858;ENST00000399476;ENST00000330442	T	0.05199	3.48	4.45	-1.97	0.07503	.	0.454658	0.18758	N	0.131981	T	0.02610	0.0079	N	0.11698	0.16	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46373	-0.9196	10	0.02654	T	1	.	9.7496	0.40468	0.0:0.4855:0.0:0.5145	.	126	P17014	ZNF12_HUMAN	S	126;184;90	ENSP00000385939:N126S	ENSP00000331039:N90S	N	-	2	0	ZNF12	6698721	.	.	0.000000	0.03702	0.007000	0.05969	.	.	-0.330000	0.08514	0.528000	0.53228	AAC		0.373	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265	
SLC4A2	6522	broad.mit.edu	37	7	150763999	150763999	+	Silent	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:150763999T>C	ENST00000485713.1	+	7	1925	c.885T>C	c.(883-885)ggT>ggC	p.G295G	SLC4A2_ENST00000413384.2_Silent_p.G295G|SLC4A2_ENST00000310317.5_Silent_p.G213G|SLC4A2_ENST00000461735.1_Silent_p.G281G|SLC4A2_ENST00000392826.2_Silent_p.G286G	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	295	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATGCCAAAGGTTCCACACAGA	0.657																																						.											0													51.0	56.0	55.0					7																	150763999		2203	4300	6503	SO:0001819	synonymous_variant	6522				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.885T>C	7.37:g.150763999T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	ENST00000485713.1	37	CCDS5917.1																																																																																				0.657	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
CXorf66	347487	broad.mit.edu	37	X	139038180	139038180	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chrX:139038180C>T	ENST00000370540.1	-	3	984	c.961G>A	c.(961-963)Ggt>Agt	p.G321S		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	321						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						ACATGATCACCGTATGCATTG	0.388																																						.											0													216.0	181.0	193.0					X																	139038180		2203	4300	6503	SO:0001583	missense	347487				CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.961G>A	X.37:g.139038180C>T	ENSP00000359571:p.Gly321Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000370540.1	37	CCDS35411.1	.	.	.	.	.	.	.	.	.	.	C	0.703	-0.789917	0.02884	.	.	ENSG00000203933	ENST00000370540	T	0.40225	1.04	4.03	-8.05	0.01106	.	3.323370	0.00914	N	0.002512	T	0.19927	0.0479	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.19976	-1.0289	9	.	.	.	11.0958	7.393	0.26921	0.1163:0.2536:0.5352:0.0949	.	321	Q5JRM2	CX066_HUMAN	S	321	ENSP00000359571:G321S	.	G	-	1	0	CXorf66	138865846	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.983000	0.00163	-3.667000	0.00124	-2.703000	0.00135	GGT		0.388	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058572.1	NM_001013403	
CTAGE15	441294	broad.mit.edu	37	7	143268925	143268926	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:143268925_143268926insC	ENST00000420911.2	+	1	32_33	c.15_16insC	c.(16-18)gctfs	p.A6fs	RNU6-162P_ENST00000516228.1_RNA	NM_001008747.1	NP_001008747.1	A4D2H0	CTGEF_HUMAN	CTAGE family, member 15	6						integral component of membrane (GO:0016021)											AGGAGCCCGGTGCTACCCCTCA	0.594																																						.											0																																										SO:0001589	frameshift_variant	441294				CCDS64788.1	7q35	2013-02-25	2013-02-25	2013-02-25	ENSG00000176227	ENSG00000271079			37295	protein-coding gene	gene with protein product			"""CTAGE family, member 15, pseudogene"""	CTAGE15P			Standard	NM_001008747		Approved		uc011kth.3	A4D2H0	OTTHUMG00000153233	Exception_encountered	7.37:g.143268925_143268926insC	ENSP00000474204:p.Ala6fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8Z8	Frame_Shift_Ins	INS	ENST00000420911.2	37																																																																																					0.594	CTAGE15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330280.2	NM_001008747	
BICD2	23299	ucsc.edu	37	9	95526797	95526797	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr9:95526797T>C	ENST00000375512.3	-	1	297	c.230A>G	c.(229-231)cAg>cGg	p.Q77R	BICD2_ENST00000356884.6_Missense_Mutation_p.Q77R	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	77					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTCCTTGAGCTGCTCCATCTC	0.697																																						.											0													13.0	8.0	9.0					9																	95526797		2017	3948	5965	SO:0001583	missense	23299			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.230A>G	9.37:g.95526797T>C	ENSP00000364662:p.Gln77Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	.	16.25	3.070864	0.55539	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.47177	0.85;0.86	4.88	3.72	0.42706	.	0.137012	0.49916	D	0.000130	T	0.42539	0.1207	M	0.64404	1.975	0.38996	D	0.959241	B;B	0.12013	0.005;0.001	B;B	0.11329	0.006;0.002	T	0.33033	-0.9884	10	0.33141	T	0.24	-35.5025	9.3407	0.38079	0.1607:0.0:0.0:0.8393	.	77;77	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	R	77	ENSP00000349351:Q77R;ENSP00000364662:Q77R	ENSP00000349351:Q77R	Q	-	2	0	BICD2	94566618	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.841000	0.55850	0.792000	0.33850	0.374000	0.22700	CAG		0.697	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
DAZAP1	26528	ucsc.edu	37	19	1432574	1432574	+	Silent	SNP	T	T	C	rs201283349	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:1432574T>C	ENST00000233078.4	+	11	1094	c.933T>C	c.(931-933)ccT>ccC	p.P311P	DAZAP1_ENST00000336761.6_Silent_p.P311P	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	311	Pro-rich.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTTCCTCCTCCACCAGCCA	0.647																																						.											0													63.0	73.0	70.0					19																	1432574		2203	4300	6503	SO:0001819	synonymous_variant	26528				CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.933T>C	19.37:g.1432574T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q96MJ3|Q9NRR9	Silent	SNP	ENST00000233078.4	37	CCDS12065.1																																																																																				0.647	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
FAT4	79633	ucsc.edu;mdanderson.org	37	4	126337737	126337737	+	Silent	SNP	A	A	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr4:126337737A>C	ENST00000394329.3	+	6	6991	c.6978A>C	c.(6976-6978)acA>acC	p.T2326T	FAT4_ENST00000335110.5_Silent_p.T624T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2326	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATCGGGAAACAAAAGAGCGCT	0.428																																						.											0													234.0	226.0	229.0					4																	126337737		2203	4300	6503	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6978A>C	4.37:g.126337737A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																				0.428	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
GPR179	440435	ucsc.edu	37	17	36483472	36483472	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr17:36483472C>A	ENST00000342292.4	-	11	6000	c.5980G>T	c.(5980-5982)Gcc>Tcc	p.A1994S	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1994					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ACGTCAGCGGCCCTGCCCCCA	0.572																																						.											0													58.0	58.0	58.0					17																	36483472		2022	4189	6211	SO:0001583	missense	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.5980G>T	17.37:g.36483472C>A	ENSP00000345060:p.Ala1994Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.838049	0.32513	.	.	ENSG00000188888	ENST00000342292	T	0.50548	0.74	4.78	-0.835	0.10775	.	2.989320	0.01141	N	0.006215	T	0.35941	0.0949	L	0.52573	1.65	0.09310	N	1	B	0.31910	0.346	B	0.24269	0.052	T	0.07252	-1.0782	10	0.08599	T	0.76	3.1037	6.0046	0.19539	0.0:0.5146:0.1542:0.3312	.	1994	Q6PRD1	GP179_HUMAN	S	1994	ENSP00000345060:A1994S	ENSP00000345060:A1994S	A	-	1	0	GPR179	33736998	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.142000	0.16096	-0.259000	0.09432	0.561000	0.74099	GCC		0.572	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
LRRC24	441381	ucsc.edu	37	8	145748410	145748410	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr8:145748410A>G	ENST00000529415.2	-	5	1108	c.991T>C	c.(991-993)Ttc>Ctc	p.F331L	LRRC14_ENST00000292524.1_3'UTR|LRRC14_ENST00000528528.1_3'UTR|LRRC24_ENST00000533758.1_Missense_Mutation_p.F328L			Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24	331	Ig-like C2-type.					integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(1)|lung(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TTGCTGAGGAAGAGCATGCCG	0.721																																						.											0													20.0	23.0	22.0					8																	145748410		2008	3952	5960	SO:0001583	missense	441381			AB178281	CCDS34969.1	8q24.3	2013-01-11			ENSG00000254402	ENSG00000254402		"""Immunoglobulin superfamily / I-set domain containing"""	28947	protein-coding gene	gene with protein product						7584026	Standard	NM_001024678		Approved	LRRC14OS	uc003zdm.3	Q50LG9	OTTHUMG00000165180	ENST00000529415.2:c.991T>C	8.37:g.145748410A>G	ENSP00000434849:p.Phe331Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000529415.2	37	CCDS34969.1	.	.	.	.	.	.	.	.	.	.	A	33	5.203611	0.95033	.	.	ENSG00000254402	ENST00000529415;ENST00000533758	T;T	0.66280	-0.2;-0.2	4.73	4.73	0.59995	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.106723	0.64402	D	0.000005	T	0.61123	0.2322	N	0.21324	0.655	0.51012	D	0.999903	P;D	0.56968	0.952;0.978	P;P	0.57911	0.652;0.829	T	0.61973	-0.6952	10	0.41790	T	0.15	.	12.2096	0.54371	1.0:0.0:0.0:0.0	.	328;331	G3V1D8;Q50LG9	.;LRC24_HUMAN	L	331;328	ENSP00000434849:F331L;ENSP00000435653:F328L	ENSP00000434849:F331L	F	-	1	0	LRRC24	145719218	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.396000	0.59684	1.992000	0.58205	0.459000	0.35465	TTC		0.721	LRRC24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382501.2	NM_001024678	
NCAPH	23397	ucsc.edu;bcgsc.ca	37	2	97034713	97034713	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr2:97034713A>G	ENST00000240423.4	+	16	2045	c.2002A>G	c.(2002-2004)Aac>Gac	p.N668D	NCAPH_ENST00000455200.1_Missense_Mutation_p.N657D|NCAPH_ENST00000427946.1_Missense_Mutation_p.N532D	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	668					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				CTGTTAGGCAAACCACAGGGA	0.498																																						.											0													29.0	28.0	28.0					2																	97034713		2174	4249	6423	SO:0001583	missense	23397			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.2002A>G	2.37:g.97034713A>G	ENSP00000240423:p.Asn668Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	CCDS2021.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.75|12.75	2.032861|2.032861	0.35893|0.35893	.|.	.|.	ENSG00000121152|ENSG00000121152	ENST00000435349|ENST00000240423;ENST00000427946;ENST00000455200	.|T;T;T	.|0.43688	.|0.94;0.94;0.94	5.97|5.97	3.58|3.58	0.41010|0.41010	.|.	.|0.937499	.|0.09187	.|N	.|0.836566	T|T	0.40222|0.40222	0.1108|0.1108	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	.|B;B	.|0.31125	.|0.202;0.309	.|B;B	.|0.34452	.|0.183;0.138	T|T	0.10451|0.10451	-1.0629|-1.0629	5|10	.|0.10111	.|T	.|0.7	-16.6939|-16.6939	6.0922|6.0922	0.20001|0.20001	0.7534:0.1639:0.0826:0.0|0.7534:0.1639:0.0826:0.0	.|.	.|644;668	.|B4DRG7;Q15003	.|.;CND2_HUMAN	R|D	108|668;532;657	.|ENSP00000240423:N668D;ENSP00000400774:N532D;ENSP00000407308:N657D	.|ENSP00000240423:N668D	K|N	+|+	2|1	0|0	NCAPH|NCAPH	96398440|96398440	0.964000|0.964000	0.33143|0.33143	0.968000|0.968000	0.41197|0.41197	0.673000|0.673000	0.39480|0.39480	1.321000|1.321000	0.33678|0.33678	0.502000|0.502000	0.28037|0.28037	0.533000|0.533000	0.62120|0.62120	AAA|AAC		0.498	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
QRICH1	54870	ucsc.edu;mdanderson.org;bcgsc.ca	37	3	49114159	49114159	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr3:49114159G>C	ENST00000395443.2	-	2	764	c.292C>G	c.(292-294)Cag>Gag	p.Q98E	QRICH1_ENST00000357496.2_Missense_Mutation_p.Q98E|QRICH1_ENST00000424300.1_Missense_Mutation_p.Q98E	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	98	Gln-rich.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGCTGCGGCTGCTGAACCTGG	0.483																																						.											0													253.0	262.0	259.0					3																	49114159		2203	4300	6503	SO:0001583	missense	54870				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.292C>G	3.37:g.49114159G>C	ENSP00000378830:p.Gln98Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.467285	0.26335	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300;ENST00000437939;ENST00000450685;ENST00000411682	.	.	.	5.37	5.37	0.77165	.	0.483859	0.22110	N	0.064497	T	0.38772	0.1053	N	0.08118	0	0.38317	D	0.943429	B	0.25486	0.127	B	0.19148	0.024	T	0.43750	-0.9372	9	0.66056	D	0.02	-2.655	14.6884	0.69065	0.0:0.1448:0.8552:0.0	.	98	Q2TAL8	QRIC1_HUMAN	E	98	.	ENSP00000350094:Q98E	Q	-	1	0	QRICH1	49089163	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.239000	0.65371	2.530000	0.85305	0.561000	0.74099	CAG		0.483	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
VPS53	55275	ucsc.edu	37	17	617869	617869	+	Silent	SNP	G	G	A	rs11558129	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr17:617869G>A	ENST00000571805.1	-	1	217	c.81C>T	c.(79-81)atC>atT	p.I27I	VPS53_ENST00000401468.3_Silent_p.I27I|VPS53_ENST00000437048.2_Silent_p.I27I|VPS53_ENST00000446250.2_5'UTR|VPS53_ENST00000574029.1_Silent_p.I27I|VPS53_ENST00000291074.5_Silent_p.I27I			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	27				I -> V (in Ref. 3; ABW03005). {ECO:0000305}.	protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		TTACCTGCTCGATGGCCAGCT	0.711													G|||	728	0.145367	0.0265	0.2435	5008	,	,		11887	0.0248		0.2356	False		,,,				2504	0.2679					.											0								G	,	240,4166	139.2+/-174.8	5,230,1968	56.0	57.0	57.0		81,81	0.7	1.0	17	dbSNP_120	57	2133,6467	361.9+/-332.5	268,1597,2435	no	coding-synonymous,coding-synonymous	VPS53	NM_001128159.2,NM_018289.3	,	273,1827,4403	AA,AG,GG		24.8023,5.4471,18.2454	,	27/833,27/671	617869	2373,10633	2203	4300	6503	SO:0001819	synonymous_variant	55275				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.81C>T	17.37:g.617869G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Silent	SNP	ENST00000571805.1	37																																																																																					0.711	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289	
ZNF785	146540	ucsc.edu;bcgsc.ca	37	16	30596805	30596805	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr16:30596805C>T	ENST00000395216.2	-	1	287	c.128G>A	c.(127-129)tGg>tAg	p.W43*	AC002310.7_ENST00000492040.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA|ZNF785_ENST00000470110.1_Nonsense_Mutation_p.W43*|AC002310.7_ENST00000486926.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	43	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						CAGGCATTCCCACTCCTCGGG	0.746																																						.											0													16.0	18.0	17.0					16																	30596805		2192	4292	6484	SO:0001587	stop_gained	146540			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.128G>A	16.37:g.30596805C>T	ENSP00000378642:p.Trp43*	Somatic		WXS	Illumina HiSeq	Phase_I	O75701|Q8IW91|Q8WV14|Q96MN0	Nonsense_Mutation	SNP	ENST00000395216.2	37	CCDS10685.1	.	.	.	.	.	.	.	.	.	.	c	14.96	2.691809	0.48097	.	.	ENSG00000197162	ENST00000470110;ENST00000395216	.	.	.	4.56	1.35	0.21983	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6933	0.28579	0.1762:0.4848:0.339:0.0	.	.	.	.	X	43	.	ENSP00000378642:W43X	W	-	2	0	ZNF785	30504306	0.002000	0.14202	0.014000	0.15608	0.180000	0.23129	0.325000	0.19628	0.140000	0.18849	0.586000	0.80456	TGG		0.746	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458	
ANKRD30B	374860	mdanderson.org	37	18	14779986	14779986	+	Missense_Mutation	SNP	G	G	A	rs76927023		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr18:14779986G>A	ENST00000358984.4	+	11	1628	c.1448G>A	c.(1447-1449)cGa>cAa	p.R483Q	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.R483Q	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	483										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GAATCCAAACGAGAGGAAGAT	0.284																																						.											0													169.0	160.0	163.0					18																	14779986		692	1591	2283	SO:0001583	missense	374860			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1448G>A	18.37:g.14779986G>A	ENSP00000351875:p.Arg483Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	0.006	-2.092170	0.00364	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.36520	1.51;1.25	1.69	0.451	0.16629	.	.	.	.	.	T	0.09905	0.0243	N	0.00926	-1.1	0.09310	N	1	B	0.23854	0.092	B	0.08055	0.003	T	0.28138	-1.0053	9	0.22109	T	0.4	.	3.9288	0.09275	0.7996:0.0:0.2004:0.0	.	483	F8WAG3	.	Q	483	ENSP00000351875:R483Q;ENSP00000399031:R483Q	ENSP00000351875:R483Q	R	+	2	0	ANKRD30B	14769986	0.999000	0.42202	0.002000	0.10522	0.094000	0.18550	1.139000	0.31504	0.127000	0.18452	-1.326000	0.01283	CGA		0.284	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
FFAR3	2865	mdanderson.org	37	19	35850829	35850829	+	Missense_Mutation	SNP	G	G	A	rs201080710		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:35850829G>A	ENST00000327809.4	+	2	1238	c.1037G>A	c.(1036-1038)aGc>aAc	p.S346N	FFAR3_ENST00000594310.1_Missense_Mutation_p.S346N	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	346			S -> N. {ECO:0000269|PubMed:19630535}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGTGCTGAAAGCTAGGTCCTC	0.632																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)	.											0													29.0	25.0	26.0					19																	35850829		2199	4279	6478	SO:0001583	missense	2865			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.1037G>A	19.37:g.35850829G>A	ENSP00000328230:p.Ser346Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RWM8|Q14CM7	Missense_Mutation	SNP	ENST00000327809.4	37	CCDS12459.1	.	.	.	.	.	.	.	.	.	.	G	9.237	1.037199	0.19669	.	.	ENSG00000185897	ENST00000327809	T	0.65364	-0.15	3.72	-0.0966	0.13636	.	.	.	.	.	T	0.41834	0.1176	.	.	.	0.09310	N	1	B	0.29432	0.244	B	0.24006	0.05	T	0.22591	-1.0212	8	0.41790	T	0.15	.	3.1652	0.06533	0.1058:0.1734:0.5425:0.1782	.	346	O14843	FFAR3_HUMAN	N	346	ENSP00000328230:S346N	ENSP00000328230:S346N	S	+	2	0	FFAR3	40542669	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.022000	0.12480	-0.163000	0.10946	0.455000	0.32223	AGC		0.632	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418873.2	NM_005304	
FRG1B	284802	mdanderson.org	37	20	29625956	29625956	+	Missense_Mutation	SNP	G	G	A	rs147809085		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr20:29625956G>A	ENST00000278882.3	+	5	580	c.200G>A	c.(199-201)aGa>aAa	p.R67K	FRG1B_ENST00000439954.2_Missense_Mutation_p.R72K|FRG1B_ENST00000358464.4_Missense_Mutation_p.R67K			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	67								p.R67K(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATTGGACCAAGAGAACAATGG	0.338																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.200G>A	20.37:g.29625956G>A	ENSP00000278882:p.Arg67Lys	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	9.648	1.140706	0.21205	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.46063	0.88	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	.	.	.	0.46901	D	0.99924	B	0.02656	0.0	B	0.15484	0.013	T	0.07986	-1.0744	9	0.28530	T	0.3	.	9.3557	0.38164	0.0:0.0:1.0:0.0	.	72	F5H5R5	.	K	67;72;67	ENSP00000408863:R72K	ENSP00000278882:R67K	R	+	2	0	FRG1B	28239617	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.360000	0.73064	1.250000	0.43966	0.184000	0.17185	AGA		0.338	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HSP90AB1	3326	mdanderson.org	37	6	44221047	44221047	+	Missense_Mutation	SNP	C	C	T	rs61729441		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr6:44221047C>T	ENST00000371554.1	+	11	2211	c.1997C>T	c.(1996-1998)tCt>tTt	p.S666F	HSP90AB1_ENST00000353801.3_Missense_Mutation_p.S666F|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.S666F|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000495706.1_5'Flank			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	666					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTGCTATCTTCTGGCTTTTCC	0.532																																						.											0													332.0	336.0	335.0					6																	44221047		2203	4300	6503	SO:0001583	missense	3326			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.1997C>T	6.37:g.44221047C>T	ENSP00000360609:p.Ser666Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	37	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.868141	0.51588	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.17854	2.25;2.25;2.25	4.56	4.56	0.56223	.	0.000000	0.64402	U	0.000002	T	0.57403	0.2051	H	0.99104	4.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78750	-0.2082	10	0.87932	D	0	-12.9647	17.6805	0.88241	0.0:1.0:0.0:0.0	rs61729441	628;656;666	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	F	666	ENSP00000360709:S666F;ENSP00000325875:S666F;ENSP00000360609:S666F	ENSP00000325875:S666F	S	+	2	0	HSP90AB1	44329025	1.000000	0.71417	0.209000	0.23619	0.048000	0.14542	7.779000	0.85648	2.265000	0.75225	0.508000	0.49915	TCT		0.532	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
INTS4	92105	mdanderson.org	37	11	77612478	77612478	+	Silent	SNP	T	T	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:77612478T>G	ENST00000534064.1	-	18	2251	c.2217A>C	c.(2215-2217)cgA>cgC	p.R739R	INTS4_ENST00000535943.1_Silent_p.R114R|AAMDC_ENST00000532481.1_Intron	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	739					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CTCGTGTAGTTCGTGCTGTTA	0.408																																						.											0													214.0	191.0	199.0					11																	77612478		2200	4292	6492	SO:0001819	synonymous_variant	92105			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.2217A>C	11.37:g.77612478T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	ENST00000534064.1	37	CCDS31644.1																																																																																				0.408	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
MUC17	140453	mdanderson.org	37	7	100678932	100678932	+	Missense_Mutation	SNP	A	A	G	rs114941002		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:100678932A>G	ENST00000306151.4	+	3	4299	c.4235A>G	c.(4234-4236)gAg>gGg	p.E1412G		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1412	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGTTCTGAGGCTAGCACC	0.502																																						.											0													272.0	277.0	275.0					7																	100678932		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4235A>G	7.37:g.100678932A>G	ENSP00000302716:p.Glu1412Gly	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	1.916	-0.449416	0.04572	.	.	ENSG00000169876	ENST00000306151	T	0.02737	4.18	0.838	-0.578	0.11724	.	.	.	.	.	T	0.01592	0.0051	N	0.17082	0.46	0.09310	N	1	B	0.27765	0.188	B	0.19946	0.027	T	0.48502	-0.9030	9	0.23891	T	0.37	.	3.0434	0.06146	0.6909:0.0:0.3091:0.0	.	1412	Q685J3	MUC17_HUMAN	G	1412	ENSP00000302716:E1412G	ENSP00000302716:E1412G	E	+	2	0	MUC17	100465652	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.362000	0.07602	-0.153000	0.11137	0.113000	0.15668	GAG		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	mdanderson.org	37	7	100681211	100681211	+	Missense_Mutation	SNP	G	G	C	rs147094151	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:100681211G>C	ENST00000306151.4	+	3	6578	c.6514G>C	c.(6514-6516)Gtg>Ctg	p.V2172L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2172	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGCACCACAGTGGTGGCCAG	0.468																																						.											0								C	LEU/VAL	33,4373		0,33,2170	246.0	241.0	243.0		6514	-1.4	0.0	7	dbSNP_134	243	373,8227		6,361,3933	no	missense	MUC17	NM_001040105.1	32	6,394,6103	CC,CG,GG		4.3372,0.749,3.1216	benign	2172/4494	100681211	406,12600	2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6514G>C	7.37:g.100681211G>C	ENSP00000302716:p.Val2172Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.655	-0.807913	0.02819	0.00749	0.043372	ENSG00000169876	ENST00000306151	T	0.02446	4.29	0.683	-1.37	0.09056	.	.	.	.	.	T	0.00328	0.0010	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44667	-0.9313	9	0.24483	T	0.36	.	3.5846	0.07966	0.3877:0.2157:0.3965:0.0	.	2172	Q685J3	MUC17_HUMAN	L	2172	ENSP00000302716:V2172L	ENSP00000302716:V2172L	V	+	1	0	MUC17	100467931	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.419000	0.00565	-1.314000	0.01303	GTG		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	mdanderson.org	37	7	100681947	100681947	+	Missense_Mutation	SNP	A	A	T	rs139220229		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:100681947A>T	ENST00000306151.4	+	3	7314	c.7250A>T	c.(7249-7251)cAt>cTt	p.H2417L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2417	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTAGCACCCATTCCACAACT	0.507																																						.											0													386.0	369.0	375.0					7																	100681947		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7250A>T	7.37:g.100681947A>T	ENSP00000302716:p.His2417Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	1.961	-0.438892	0.04636	.	.	ENSG00000169876	ENST00000306151	T	0.02472	4.28	1.43	0.404	0.16355	.	.	.	.	.	T	0.00998	0.0033	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47774	-0.9091	9	0.11485	T	0.65	.	3.3547	0.07164	0.245:0.5788:0.0:0.1763	.	2417	Q685J3	MUC17_HUMAN	L	2417	ENSP00000302716:H2417L	ENSP00000302716:H2417L	H	+	2	0	MUC17	100468667	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.019000	0.13444	-0.658000	0.05366	-1.625000	0.00788	CAT		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC21	394263	mdanderson.org	37	6	30954573	30954573	+	Silent	SNP	C	C	T	rs372719488		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr6:30954573C>T	ENST00000376296.3	+	2	862	c.621C>T	c.(619-621)gcC>gcT	p.A207A	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	207	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAGTGGGGCCAGCACAGCCA	0.627																																						.											0													152.0	149.0	150.0					6																	30954573		2203	4300	6503	SO:0001819	synonymous_variant	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.621C>T	6.37:g.30954573C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																				0.627	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC21	394263	mdanderson.org	37	6	30954890	30954890	+	Missense_Mutation	SNP	A	A	G	rs9262379		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr6:30954890A>G	ENST00000376296.3	+	2	1179	c.938A>G	c.(937-939)aAc>aGc	p.N313S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	313	28 X 15 AA approximate tandem repeats.|Ser-rich.		N -> S (in dbSNP:rs9262379). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14574404}.		cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGTGGGGCCAACACAGCCACC	0.612																																						.											0													159.0	154.0	156.0					6																	30954890		2203	4300	6503	SO:0001583	missense	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.938A>G	6.37:g.30954890A>G	ENSP00000365473:p.Asn313Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	0.142	-1.101159	0.01843	.	.	ENSG00000204544	ENST00000376296	T	0.01215	5.16	4.3	1.1	0.20463	.	.	.	.	.	T	0.00144	0.0004	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21827	-1.0234	8	.	.	.	-1.0265	1.6226	0.02716	0.1878:0.2961:0.3647:0.1514	rs9262379	313	Q5SSG8	MUC21_HUMAN	S	313	ENSP00000365473:N313S	.	N	+	2	0	MUC21	31062869	0.000000	0.05858	0.007000	0.13788	0.004000	0.04260	-1.270000	0.02831	0.150000	0.19136	-0.320000	0.08662	AAC		0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC2	4583	mdanderson.org	37	11	1093274	1093274	+	Missense_Mutation	SNP	C	C	T	rs11245949	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:1093274C>T	ENST00000441003.2	+	30	5120	c.5093C>T	c.(5092-5094)tCg>tTg	p.S1698L	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.S1665L	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accccaacatcgacacccatc	0.637													N|||	2435	0.486222	0.4826	0.4899	5008	,	,		22392	0.631		0.3608	False		,,,				2504	0.4683					.											0													129.0	167.0	154.0					11																	1093274		1842	3364	5206	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5093C>T	11.37:g.1093274C>T	ENSP00000415183:p.Ser1698Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	T	1.748	-0.490089	0.04322	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08370	3.13;3.1	0.851	-1.7	0.08159	.	227.466000	0.04577	U	0.394340	T	0.06005	0.0156	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40979	-0.9534	9	0.30854	T	0.27	.	5.5277	0.16967	0.0:0.5285:0.0:0.4715	rs11245949;rs59265712	1698	E7EUV1	.	L	1698;1665	ENSP00000415183:S1698L;ENSP00000351956:S1665L	ENSP00000351956:S1665L	S	+	2	0	MUC2	1083274	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.256000	0.18351	-1.248000	0.02503	-2.819000	0.00109	TCG		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195507721	195507721	+	Missense_Mutation	SNP	A	A	G	rs199985629		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr3:195507721A>G	ENST00000463781.3	-	2	11189	c.10730T>C	c.(10729-10731)gTa>gCa	p.V3577A	MUC4_ENST00000475231.1_Missense_Mutation_p.V3577A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAAG	0.587																																						.											0													10.0	9.0	9.0					3																	195507721		629	1514	2143	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10730T>C	3.37:g.195507721A>G	ENSP00000417498:p.Val3577Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	2.695	-0.272355	0.05716	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.41758	1.15;0.99	1.02	-2.03	0.07365	.	.	.	.	.	T	0.20495	0.0493	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.20075	-1.0286	8	.	.	.	.	2.7403	0.05251	0.4907:0.2623:0.2471:0.0	.	3449	E7ESK3	.	A	3577	ENSP00000417498:V3577A;ENSP00000420243:V3577A	.	V	-	2	0	MUC4	196992500	.	.	0.009000	0.14445	0.049000	0.14656	.	.	-0.423000	0.07394	0.055000	0.15244	GTA		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507735	195507735	+	Silent	SNP	G	G	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr3:195507735G>T	ENST00000463781.3	-	2	11175	c.10716C>A	c.(10714-10716)acC>acA	p.T3572T	MUC4_ENST00000475231.1_Silent_p.T3572T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAAGGCTGGTGACAGGAA	0.587																																						.											0													14.0	13.0	13.0					3																	195507735		652	1553	2205	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10716C>A	3.37:g.195507735G>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509099	195509099	+	Missense_Mutation	SNP	T	T	C	rs71319804	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr3:195509099T>C	ENST00000463781.3	-	2	9811	c.9352A>G	c.(9352-9354)Acc>Gcc	p.T3118A	MUC4_ENST00000475231.1_Missense_Mutation_p.T3118A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTGACCTGTG	0.587																																						.											0													19.0	10.0	13.0					3																	195509099		673	1554	2227	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9352A>G	3.37:g.195509099T>C	ENSP00000417498:p.Thr3118Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	t	6.294	0.422431	0.11928	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28895	1.6;1.59	.	.	.	.	.	.	.	.	T	0.14830	0.0358	N	0.19112	0.55	0.21325	N	0.999723	B	0.13594	0.008	B	0.08055	0.003	T	0.28038	-1.0056	7	.	.	.	.	2.9352	0.05812	0.0:0.362:0.0:0.638	.	2990	E7ESK3	.	A	3118	ENSP00000417498:T3118A;ENSP00000420243:T3118A	.	T	-	1	0	MUC4	196993878	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	-0.420000	0.07062	0.000000	0.14550	0.000000	0.15137	ACC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NBPF10	100132406	mdanderson.org	37	1	145296486	145296486	+	Silent	SNP	G	G	A			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr1:145296486G>A	ENST00000342960.5	+	3	443	c.408G>A	c.(406-408)ccG>ccA	p.P136P	NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	136						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CGGATGAGCCGGACAAGTCCC	0.587																																						.											0																																										SO:0001819	synonymous_variant	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.408G>A	1.37:g.145296486G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	CCDS53355.1																																																																																				0.587	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
PLIN4	729359	mdanderson.org	37	19	4512156	4512156	+	Missense_Mutation	SNP	C	C	T	rs112356938	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:4512156C>T	ENST00000301286.3	-	3	1773	c.1774G>A	c.(1774-1776)Gtg>Atg	p.V592M		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	592	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.V520M(1)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						ACTGCCCCCACGAGCCCAGTA	0.602																																						.											1	Substitution - Missense(1)	skin(1)											244.0	261.0	255.0					19																	4512156		2116	4235	6351	SO:0001583	missense	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1774G>A	19.37:g.4512156C>T	ENSP00000301286:p.Val592Met	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	T	10.94	1.492727	0.26774	.	.	ENSG00000167676	ENST00000301286	T	0.05717	3.4	5.1	-0.9	0.10544	.	1.053640	0.07562	N	0.917246	T	0.02807	0.0084	N	0.14661	0.345	0.09310	N	1	P	0.52170	0.951	B	0.37198	0.243	T	0.31138	-0.9954	10	0.48119	T	0.1	.	0.7342	0.00962	0.2575:0.1531:0.1331:0.4562	.	592	Q96Q06	PLIN4_HUMAN	M	592	ENSP00000301286:V592M	ENSP00000301286:V592M	V	-	1	0	PLIN4	4463156	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.480000	0.22244	-0.303000	0.08856	-0.374000	0.07098	GTG		0.602	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
PRKRIR	5612	mdanderson.org	37	11	76061913	76061913	+	Missense_Mutation	SNP	T	T	C	rs571473617	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr11:76061913T>C	ENST00000260045.3	-	5	2386	c.2281A>G	c.(2281-2283)Acc>Gcc	p.T761A	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	761					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						GTCTCTTAGGTATTTTCCACA	0.323													T|||	17	0.00339457	0.0061	0.0029	5008	,	,		19706	0.0069		0.0	False		,,,				2504	0.0					.											0													18.0	17.0	17.0					11																	76061913		2129	4241	6370	SO:0001583	missense	5612			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.2281A>G	11.37:g.76061913T>C	ENSP00000260045:p.Thr761Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.694577	0.30052	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	5.15	4.01	0.46588	.	0.499901	0.23281	N	0.049915	T	0.16342	0.0393	N	0.08118	0	0.24564	N	0.99396	B	0.02656	0.0	B	0.01281	0.0	T	0.10847	-1.0612	9	0.33940	T	0.23	.	4.7545	0.13077	0.167:0.1087:0.0:0.7243	.	761	O43422	P52K_HUMAN	A	586;761	.	ENSP00000260045:T761A	T	-	1	0	PRKRIR	75739561	1.000000	0.71417	0.996000	0.52242	0.878000	0.50629	0.512000	0.22755	1.089000	0.41292	0.524000	0.50904	ACC		0.323	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
SMARCA2	6595	mdanderson.org	37	9	2039818	2039818	+	Silent	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr9:2039818A>G	ENST00000382203.1	+	4	917	c.708A>G	c.(706-708)caA>caG	p.Q236Q	SMARCA2_ENST00000382194.1_Silent_p.Q236Q|SMARCA2_ENST00000491574.1_3'UTR|SMARCA2_ENST00000349721.2_Silent_p.Q236Q|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000357248.2_Silent_p.Q236Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	236	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcaacagcagccgc	0.587																																						.											0													11.0	13.0	13.0					9																	2039818		2170	4235	6405	SO:0001819	synonymous_variant	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.708A>G	9.37:g.2039818A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																				0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
TAS2R43	259289	mdanderson.org	37	12	11244602	11244602	+	Missense_Mutation	SNP	T	T	C	rs11535673		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr12:11244602T>C	ENST00000531678.1	-	1	310	c.227A>G	c.(226-228)aAt>aGt	p.N76S	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	76					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTCTACACTATTAAAAGCTGG	0.398																																						.											0													51.0	44.0	46.0					12																	11244602		1916	3972	5888	SO:0001583	missense	259289			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.227A>G	12.37:g.11244602T>C	ENSP00000431719:p.Asn76Ser	Somatic		WXS	Illumina HiSeq	Phase_I	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	.	.	.	.	.	.	.	.	.	.	-	1.580	-0.531857	0.04112	.	.	ENSG00000255374	ENST00000531678	T	0.36340	1.26	1.97	0.726	0.18248	.	.	.	.	.	T	0.09598	0.0236	N	0.00483	-1.445	0.09310	N	1	B	0.02656	0.0	B	0.12156	0.007	T	0.28744	-1.0034	9	0.30854	T	0.27	.	3.8604	0.08993	0.0:0.2087:0.0:0.7913	.	76	P59537	T2R43_HUMAN	S	76	ENSP00000431719:N76S	ENSP00000431719:N76S	N	-	2	0	TAS2R43	11135869	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.684000	0.05173	0.041000	0.15688	0.155000	0.16302	AAT		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
ZNF799	90576	mdanderson.org	37	19	12501852	12501852	+	Missense_Mutation	SNP	C	C	T	rs200077318		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:12501852C>T	ENST00000430385.3	-	4	1560	c.1360G>A	c.(1360-1362)Ggg>Agg	p.G454R	ZNF799_ENST00000419318.1_Missense_Mutation_p.G422R|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						AAGGCTTTCCCACATTTGCAT	0.383																																						.											0													75.0	80.0	78.0					19																	12501852		2202	4299	6501	SO:0001583	missense	90576			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1360G>A	19.37:g.12501852C>T	ENSP00000411084:p.Gly454Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033438	0.54896	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.21361	2.01;2.01	1.31	-1.12	0.09808	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27349	0.0671	M	0.86097	2.795	0.31959	N	0.608702	B	0.19200	0.034	B	0.28849	0.095	T	0.34179	-0.9839	9	0.72032	D	0.01	.	5.5527	0.17099	0.0:0.6435:0.0:0.3565	.	454	Q96GE5	ZN799_HUMAN	R	422;454	ENSP00000415278:G422R;ENSP00000411084:G454R	ENSP00000415278:G422R	G	-	1	0	ZNF799	12362852	0.004000	0.15560	0.000000	0.03702	0.966000	0.64601	1.363000	0.34159	-0.271000	0.09272	0.430000	0.28490	GGG		0.383	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
ZNF799	90576	mdanderson.org	37	19	12501855	12501855	+	Missense_Mutation	SNP	A	A	G	rs201077492|rs79480756		TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:12501855A>G	ENST00000430385.3	-	4	1557	c.1357T>C	c.(1357-1359)Tgt>Cgt	p.C453R	ZNF799_ENST00000419318.1_Missense_Mutation_p.C421R|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCTTTCCCACATTTGCATTTA	0.388																																						.											0													76.0	81.0	79.0					19																	12501855		2202	4299	6501	SO:0001583	missense	90576			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1357T>C	19.37:g.12501855A>G	ENSP00000411084:p.Cys453Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.790257	0.50102	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	D;D	0.85955	-2.05;-2.05	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.87791	0.6266	H	0.95950	3.745	0.58432	D	0.999998	B	0.02656	0.0	B	0.10450	0.005	D	0.85733	0.1332	9	0.72032	D	0.01	.	6.6913	0.23174	1.0:0.0:0.0:0.0	.	453	Q96GE5	ZN799_HUMAN	R	421;453	ENSP00000415278:C421R;ENSP00000411084:C453R	ENSP00000415278:C421R	C	-	1	0	ZNF799	12362855	0.997000	0.39634	0.001000	0.08648	0.965000	0.64279	5.185000	0.65076	0.846000	0.35142	0.352000	0.21897	TGT		0.388	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
ZNF836	162962	mdanderson.org;bcgsc.ca	37	19	52660631	52660631	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:52660631C>T	ENST00000322146.8	-	5	826	c.305G>A	c.(304-306)tGg>tAg	p.W102*	ZNF836_ENST00000597252.1_Nonsense_Mutation_p.W102*|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						ACCATCTTTCCATTGAAACTC	0.323																																						.											0													97.0	89.0	91.0					19																	52660631		1928	4149	6077	SO:0001587	stop_gained	162962			BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.305G>A	19.37:g.52660631C>T	ENSP00000325038:p.Trp102*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000322146.8	37	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	C	34	5.380885	0.95945	.	.	ENSG00000196267	ENST00000322146	.	.	.	2.06	0.971	0.19698	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	4.5989	0.12343	0.0:0.7965:0.0:0.2035	.	.	.	.	X	102	.	ENSP00000325038:W102X	W	-	2	0	ZNF836	57352443	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-0.030000	0.12308	0.204000	0.20548	0.485000	0.47835	TGG		0.323	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
DNAJB12	54788	bcgsc.ca	37	10	74095605	74095605	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr10:74095605C>T	ENST00000444643.2	-	8	1423	c.1091G>A	c.(1090-1092)aGc>aAc	p.S364N	DNAJB12_ENST00000338820.3_Missense_Mutation_p.S398N|DNAJB12_ENST00000461919.1_Missense_Mutation_p.S159N|DNAJB12_ENST00000394903.2_Missense_Mutation_p.S398N			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	364						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						TGACAGTCGGCTGCAGCTGGG	0.602																																						.											0													111.0	94.0	100.0					10																	74095605		2203	4300	6503	SO:0001583	missense	54788			AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.1091G>A	10.37:g.74095605C>T	ENSP00000403313:p.Ser364Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7I3|Q9H6H0	Missense_Mutation	SNP	ENST00000444643.2	37		.	.	.	.	.	.	.	.	.	.	C	13.32	2.203491	0.38905	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.45276	0.9;0.9;0.9	5.29	-4.69	0.03299	Domain of unknown function DUF1977, DnaJ-like (1);	0.575847	0.20614	N	0.088920	T	0.28599	0.0708	L	0.31926	0.97	0.25879	N	0.983617	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.11299	-1.0593	10	0.27082	T	0.32	-11.4477	17.147	0.86768	0.0:0.7521:0.0:0.2479	.	364;364	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	N	398;398;364	ENSP00000345575:S398N;ENSP00000378363:S398N;ENSP00000403313:S364N	ENSP00000345575:S398N	S	-	2	0	DNAJB12	73765611	0.996000	0.38824	0.966000	0.40874	0.993000	0.82548	0.341000	0.19909	-0.750000	0.04740	0.561000	0.74099	AGC		0.602	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048581.2		
PTEN	5728	bcgsc.ca	37	10	89711961	89711963	+	In_Frame_Del	DEL	TGT	TGT	-	rs568851024	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr10:89711961_89711963delTGT	ENST00000371953.3	+	6	1936_1938	c.579_581delTGT	c.(577-582)cttgtg>ctg	p.V194del	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	194	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.G165fs*9(3)|p.Y27fs*1(2)|p.G165_*404del(1)|p.V191fs*7(1)|p.L193del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAGTGGCACTGTTGTTTCACAAG	0.399		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	54	Whole gene deletion(37)|Deletion - Frameshift(11)|Unknown(4)|Deletion - In frame(2)	prostate(16)|central_nervous_system(15)|skin(8)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)																																								SO:0001651	inframe_deletion	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.579_581delTGT	10.37:g.89711961_89711963delTGT	ENSP00000361021:p.Val194del	Somatic		WXS	Illumina HiSeq	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	In_Frame_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.399	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
ARMC5	79798	bcgsc.ca	37	16	31476458	31476458	+	Intron	SNP	C	C	T	rs11150624	byFrequency	TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr16:31476458C>T	ENST00000563544.1	+	5	2410				ARMC5_ENST00000457010.2_Missense_Mutation_p.A705V|ARMC5_ENST00000408912.3_Intron|ARMC5_ENST00000268314.4_Intron|ARMC5_ENST00000538189.1_Intron|ARMC5_ENST00000412665.2_Intron			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5											central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						TGCAGCCCCGCGCCCAGGATC	0.622													C|||	1523	0.304113	0.0507	0.5735	5008	,	,		20389	0.4494		0.4463	False		,,,				2504	0.1595					.											0								C	,VAL/ALA	443,3739		26,391,1674	49.0	55.0	53.0		,2114	-7.3	0.0	16	dbSNP_120	53	3593,4857		780,2033,1412	yes	intron,missense	ARMC5	NM_001105247.1,NM_024742.2	,64	806,2424,3086	TT,TC,CC		42.5207,10.593,31.9506	,	,705/726	31476458	4036,8596	2091	4225	6316	SO:0001627	intron_variant	79798			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1864+250C>T	16.37:g.31476458C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	858	0.39285714285714285	28	0.056910569105691054	209	0.5773480662983426	277	0.48426573426573427	344	0.45382585751978893	C	8.087	0.773579	0.16051	0.10593	0.425207	ENSG00000140691	ENST00000457010	T	0.21543	2.0	3.63	-7.27	0.01461	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.20261	0.043	B	0.14578	0.011	T	0.45101	-0.9284	6	.	.	.	.	4.3423	0.11115	0.1614:0.4832:0.2508:0.1046	rs11150624;rs56855049;rs11150624	704	Q96C12-4	.	V	705	ENSP00000399561:A705V	.	A	+	2	0	ARMC5	31383959	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.168000	0.03123	-1.705000	0.01406	-1.359000	0.01217	GCG		0.622	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
PNPLA6	10908	bcgsc.ca	37	19	7607524	7607524	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:7607524G>T	ENST00000221249.6	+	14	1644	c.1213G>T	c.(1213-1215)Gcc>Tcc	p.A405S	PNPLA6_ENST00000450331.3_Missense_Mutation_p.A405S|PNPLA6_ENST00000414982.3_Missense_Mutation_p.A453S|PNPLA6_ENST00000545201.2_Missense_Mutation_p.A405S|PNPLA6_ENST00000600737.1_Missense_Mutation_p.A444S	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	444					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GCAGGAAGAGGCCTCCGGGGG	0.711																																						.											0													24.0	29.0	27.0					19																	7607524		2198	4295	6493	SO:0001583	missense	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.1213G>T	19.37:g.7607524G>T	ENSP00000221249:p.Ala405Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	G	7.434	0.639407	0.14386	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000544207;ENST00000450331	T;T;T;T	0.03920	3.78;3.84;3.76;3.78	5.24	4.15	0.48705	.	0.433679	0.26711	N	0.022882	T	0.01124	0.0037	N	0.00368	-1.59	0.34573	D	0.713646	B;B;B;B	0.12013	0.005;0.002;0.004;0.002	B;B;B;B	0.12837	0.006;0.006;0.008;0.004	T	0.39522	-0.9610	10	0.08599	T	0.76	.	5.84	0.18629	0.1648:0.0:0.8352:0.0	.	444;405;444;405	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	S	405;405;453;342;405	ENSP00000221249:A405S;ENSP00000443323:A405S;ENSP00000407509:A453S;ENSP00000394348:A405S	ENSP00000221249:A405S	A	+	1	0	PNPLA6	7513524	0.992000	0.36948	1.000000	0.80357	0.665000	0.39181	1.552000	0.36244	2.445000	0.82738	0.655000	0.94253	GCC		0.711	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
S1PR5	53637	bcgsc.ca	37	19	10625364	10625364	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr19:10625364C>T	ENST00000439028.3	-	2	449	c.324G>A	c.(322-324)tgG>tgA	p.W108*	S1PR5_ENST00000333430.4_Nonsense_Mutation_p.W108*	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	108					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	CCCGTGCGAACCAGAGCGCGG	0.697																																						.											0													13.0	16.0	15.0					19																	10625364		2189	4294	6483	SO:0001587	stop_gained	53637			AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.324G>A	19.37:g.10625364C>T	ENSP00000416915:p.Trp108*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NW11	Nonsense_Mutation	SNP	ENST00000439028.3	37	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	c	31	5.059320	0.93846	.	.	ENSG00000180739	ENST00000439028;ENST00000333430;ENST00000359134	.	.	.	4.11	3.06	0.35304	.	0.151751	0.47852	U	0.000206	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7323	0.57204	0.0:0.8325:0.1675:0.0	.	.	.	.	X	108	.	ENSP00000328472:W108X	W	-	3	0	S1PR5	10486364	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.481000	0.81124	0.935000	0.37341	0.306000	0.20318	TGG		0.697	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452015.1	NM_030760	
FRG1B	284802	bcgsc.ca	37	20	29623231	29623231	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr20:29623231C>T	ENST00000278882.3	+	3	423	c.43C>T	c.(43-45)Ccc>Tcc	p.P15S	FRG1B_ENST00000439954.2_Missense_Mutation_p.T16I|FRG1B_ENST00000358464.4_Missense_Mutation_p.P15S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	15										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGTCTTTTTACCCTGGGAGCT	0.418																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.43C>T	20.37:g.29623231C>T	ENSP00000278882:p.Pro15Ser	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	7.175|7.175	0.588401|0.588401	0.13812|0.13812	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.55052	.|0.54	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.341731|.	0.29924|.	U|.	0.010850|.	T|T	0.53658|0.53658	0.1810|0.1810	.|.	.|.	.|.	0.25299|0.25299	N|N	0.989298|0.989298	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50651|0.50651	-0.8803|-0.8803	6|6	0.72032|0.87932	D|D	0.01|0	.|.	9.8943|9.8943	0.41309|0.41309	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	S|I	15|16	.|ENSP00000408863:T16I	ENSP00000278882:P15S|ENSP00000408863:T16I	P|T	+|+	1|2	0|0	FRG1B|FRG1B	28236892|28236892	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.101000|0.101000	0.19017|0.19017	6.586000|6.586000	0.74067|0.74067	1.399000|1.399000	0.46721|0.46721	0.423000|0.423000	0.28283|0.28283	CCC|ACC		0.418	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29628233	29628233	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr20:29628233A>G	ENST00000278882.3	+	6	615	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	FRG1B_ENST00000439954.2_Missense_Mutation_p.M84V|FRG1B_ENST00000358464.4_Missense_Mutation_p.M79V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	79										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTAGGGGAAAATGGCTTTGTT	0.363																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.235A>G	20.37:g.29628233A>G	ENSP00000278882:p.Met79Val	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	3.138	-0.176853	0.06380	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41065	1.01	2.08	2.08	0.27032	Actin cross-linking (1);	0.040228	0.85682	D	0.000000	T	0.23370	0.0565	.	.	.	0.41063	D	0.985397	B;B	0.17852	0.002;0.024	B;B	0.25140	0.03;0.058	T	0.04593	-1.0940	9	0.11794	T	0.64	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	84;79	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	79;84;79	ENSP00000408863:M84V	ENSP00000278882:M79V	M	+	1	0	FRG1B	28241894	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	4.813000	0.62620	1.208000	0.43306	0.347000	0.21830	ATG		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
WDR70	55100	bcgsc.ca	37	5	37721278	37721278	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr5:37721278G>T	ENST00000265107.4	+	14	1634	c.1478G>T	c.(1477-1479)gGa>gTa	p.G493V		NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	493							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACTGGAAATGGATTGGCTAAA	0.468																																						.											0													146.0	140.0	142.0					5																	37721278		2203	4300	6503	SO:0001583	missense	55100			BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1478G>T	5.37:g.37721278G>T	ENSP00000265107:p.Gly493Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H053	Missense_Mutation	SNP	ENST00000265107.4	37	CCDS34147.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768127	0.90020	.	.	ENSG00000082068	ENST00000265107	T	0.02197	4.4	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00164	-1.1968	10	0.72032	D	0.01	-62.8479	20.8794	0.99867	0.0:0.0:1.0:0.0	.	493	Q9NW82	WDR70_HUMAN	V	493	ENSP00000265107:G493V	ENSP00000265107:G493V	G	+	2	0	WDR70	37757035	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	9.444000	0.97578	2.941000	0.99782	0.655000	0.94253	GGA		0.468	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034	
MUC17	140453	bcgsc.ca	37	7	100677833	100677833	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8336-01A-11D-2310-10	TCGA-KL-8336-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3918e04-066f-49f7-9abd-22d7b896c2a5	cebdaef5-4d74-4bf2-88a3-0be1bd198029	g.chr7:100677833C>A	ENST00000306151.4	+	3	3200	c.3136C>A	c.(3136-3138)Cgt>Agt	p.R1046S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1046	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCCATTAACACGTATGCCTGT	0.507																																						.											0													524.0	402.0	443.0					7																	100677833		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3136C>A	7.37:g.100677833C>A	ENSP00000302716:p.Arg1046Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	1.205	-0.631341	0.03584	.	.	ENSG00000169876	ENST00000306151	T	0.02787	4.16	0.74	-1.48	0.08745	.	.	.	.	.	T	0.01029	0.0034	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43196	-0.9406	9	0.07990	T	0.79	.	0.3405	0.00332	0.4111:0.2076:0.1754:0.2059	.	1046	Q685J3	MUC17_HUMAN	S	1046	ENSP00000302716:R1046S	ENSP00000302716:R1046S	R	+	1	0	MUC17	100464553	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.689000	0.00198	-2.469000	0.00531	-1.596000	0.00833	CGT		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
