#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCHHL1	126637	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	152060616	152060616	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:152060616G>A	ENST00000368806.1	-	2	68	c.4C>T	c.(4-6)Cct>Tct	p.P2S		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	2							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			AGGAGCTGAGGCATCTTTACA	0.448																																						.											0													78.0	74.0	76.0					1																	152060616		2203	4300	6503	SO:0001583	missense	126637				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.4C>T	1.37:g.152060616G>A	ENSP00000357796:p.Pro2Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	ENST00000368806.1	37	CCDS30857.1	.	.	.	.	.	.	.	.	.	.	.	11.63	1.695254	0.30052	.	.	ENSG00000182898	ENST00000368806	T	0.11821	2.74	5.9	4.02	0.46733	EF-hand-like domain (1);	0.000000	0.36101	N	0.002784	T	0.08492	0.0211	L	0.35542	1.07	0.31578	N	0.655416	D	0.67145	0.996	D	0.66084	0.941	T	0.04294	-1.0962	10	0.09843	T	0.71	-2.446	9.5029	0.39028	0.165:0.0:0.835:0.0	.	2	Q5QJ38	TCHL1_HUMAN	S	2	ENSP00000357796:P2S	ENSP00000357796:P2S	P	-	1	0	TCHHL1	150327240	0.999000	0.42202	0.987000	0.45799	0.256000	0.26092	0.457000	0.21875	0.813000	0.34350	0.655000	0.94253	CCT		0.448	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73073258	73073258	+	Silent	SNP	G	G	T	rs148923147	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:73073258G>T	ENST00000263674.3	+	13	5018	c.4668G>T	c.(4666-4668)gtG>gtT	p.V1556V		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1556					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						TCGGGGCGGTGCCCGGGCTGC	0.741													G|||	51	0.0101837	0.0023	0.0101	5008	,	,		11811	0.0		0.0129	False		,,,				2504	0.0286					.											0								G		8,4170		0,8,2081	9.0	9.0	9.0		4668	2.0	1.0	11	dbSNP_134	9	59,8021		1,57,3982	no	coding-synonymous	ARHGEF17	NM_014786.3		1,65,6063	TT,TG,GG		0.7302,0.1915,0.5466		1556/2064	73073258	67,12191	2089	4040	6129	SO:0001819	synonymous_variant	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4668G>T	11.37:g.73073258G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	37	CCDS8221.1																																																																																				0.741	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
TMEM132B	114795	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	126137027	126137027	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:126137027C>T	ENST00000299308.3	+	8	1948	c.1940C>T	c.(1939-1941)aCg>aTg	p.T647M	TMEM132B_ENST00000535886.1_Missense_Mutation_p.T159M	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	647						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GCTGAGAAGACGGTGATTGTC	0.567																																						.											0													32.0	34.0	34.0					12																	126137027		2073	4228	6301	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1940C>T	12.37:g.126137027C>T	ENSP00000299308:p.Thr647Met	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988608	0.74589	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.54866	0.55;0.55	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000002	T	0.69260	0.3091	L	0.54965	1.715	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.69146	-0.5222	10	0.49607	T	0.09	.	19.0468	0.93022	0.0:1.0:0.0:0.0	.	647	Q14DG7	T132B_HUMAN	M	647;159	ENSP00000299308:T647M;ENSP00000440436:T159M	ENSP00000299308:T647M	T	+	2	0	TMEM132B	124702980	1.000000	0.71417	0.947000	0.38551	0.510000	0.34073	4.569000	0.60865	2.471000	0.83476	0.655000	0.94253	ACG		0.567	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
PPT1	5538	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	40537164	40537164	+	IGR	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:40537164G>A	ENST00000433473.3	-	0	2740				CAP1_ENST00000372798.1_Missense_Mutation_p.G462R|CAP1_ENST00000479759.1_3'UTR|CAP1_ENST00000340450.3_Missense_Mutation_p.G462R|CAP1_ENST00000372802.1_Missense_Mutation_p.G462R|PPT1_ENST00000372775.2_5'Flank|CAP1_ENST00000372797.3_Missense_Mutation_p.G463R|CAP1_ENST00000372792.2_Missense_Mutation_p.G463R|CAP1_ENST00000372805.3_Missense_Mutation_p.G463R	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCTATGGAACGGGCAGAAGTT	0.463																																						.											0													73.0	66.0	68.0					1																	40537164		1897	4098	5995	SO:0001628	intergenic_variant	10487			U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495		1.37:g.40537164G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DY24|Q6FGQ4	Missense_Mutation	SNP	ENST00000433473.3	37	CCDS447.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736430	0.89482	.	.	ENSG00000131236	ENST00000372797;ENST00000372802;ENST00000372792;ENST00000538246;ENST00000372798;ENST00000340450;ENST00000372805	T;T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02;3.02	5.45	5.45	0.79879	Cyclase-associated protein CAP/septum formation inhibitor MinC, C-terminal (1);Adenylate cyclase-associated CAP, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	M	0.90082	3.085	0.80722	D	1	P;D	0.64830	0.925;0.994	B;P	0.56474	0.409;0.799	T	0.23940	-1.0174	10	0.87932	D	0	-6.457	18.4515	0.90705	0.0:0.0:1.0:0.0	.	410;463	E7ENY9;Q01518	.;CAP1_HUMAN	R	463;462;463;440;462;462;463	ENSP00000361883:G463R;ENSP00000361888:G462R;ENSP00000361878:G463R;ENSP00000361884:G462R;ENSP00000344832:G462R;ENSP00000361891:G463R	ENSP00000344832:G462R	G	+	1	0	CAP1	40309751	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.507000	0.97996	2.838000	0.97847	0.650000	0.86243	GGG		0.463	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	
OR2M2	391194	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	248343361	248343361	+	Missense_Mutation	SNP	C	C	T	rs146796261		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:248343361C>T	ENST00000359682.2	+	1	74	c.74C>T	c.(73-75)aCg>aTg	p.T25M		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCACCACACACGTTCCTCTTC	0.498																																						.											0								C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	255.0	248.0	250.0		74	-2.9	0.0	1	dbSNP_134	250	0,8600		0,0,4300	no	missense	OR2M2	NM_001004688.1	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	25/348	248343361	1,13005	2203	4300	6503	SO:0001583	missense	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.74C>T	1.37:g.248343361C>T	ENSP00000352710:p.Thr25Met	Somatic		WXS	Illumina HiSeq	Phase_I	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	c	4.933	0.173437	0.09391	2.27E-4	0.0	ENSG00000198601	ENST00000359682	T	0.00441	7.41	1.44	-2.87	0.05700	.	1.263570	0.06373	U	0.713836	T	0.00178	0.0005	N	0.20574	0.59	0.09310	N	1	P	0.42337	0.776	B	0.28991	0.097	T	0.30060	-0.9991	10	0.34782	T	0.22	.	0.3199	0.00301	0.3623:0.2502:0.1964:0.191	.	25	Q96R28	OR2M2_HUMAN	M	25	ENSP00000352710:T25M	ENSP00000352710:T25M	T	+	2	0	OR2M2	246409984	0.000000	0.05858	0.015000	0.15790	0.152000	0.21847	-1.494000	0.02296	-0.693000	0.05121	0.298000	0.19748	ACG		0.498	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
HEATR5A	25938	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	14	31844040	31844040	+	Nonsense_Mutation	SNP	G	G	A	rs376522134		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr14:31844040G>A	ENST00000389961.3	-	11	1824	c.1825C>T	c.(1825-1827)Cga>Tga	p.R609*	HEATR5A_ENST00000543095.2_Nonsense_Mutation_p.R615*|HEATR5A_ENST00000439348.1_Nonsense_Mutation_p.R609*|HEATR5A_ENST00000404677.3_Nonsense_Mutation_p.R615*|HEATR5A_ENST00000439727.1_Nonsense_Mutation_p.R322*			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	609										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GCACCAGCTCGTCCTTCCAGG	0.443																																						.											0								G	stop/ARG	0,3952		0,0,1976	61.0	65.0	64.0		1843	2.8	1.0	14		64	1,8323		0,1,4161	no	stop-gained	HEATR5A	NM_015473.3		0,1,6137	AA,AG,GG		0.012,0.0,0.0081		615/2047	31844040	1,12275	1976	4162	6138	SO:0001587	stop_gained	25938			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.1825C>T	14.37:g.31844040G>A	ENSP00000374611:p.Arg609*	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Nonsense_Mutation	SNP	ENST00000389961.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.474218|7.474218	0.98306|0.98306	0.0|0.0	1.2E-4|1.2E-4	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677|ENST00000550366	.|.	.|.	.|.	5.75|5.75	2.84|2.84	0.33178|0.33178	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.50137	.|0.1598	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.58070	.|-0.7701	.|3	0.02654|.	T|.	1|.	.|.	8.9064|8.9064	0.35526|0.35526	0.131:0.0:0.7483:0.1206|0.131:0.0:0.7483:0.1206	.|.	.|.	.|.	.|.	X|M	609;609;322;615;615|257	.|.	ENSP00000374611:R609X|.	R|T	-|-	1|2	2|0	HEATR5A|HEATR5A	30913791|30913791	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.887000|7.887000	0.87295|0.87295	0.734000|0.734000	0.32515|0.32515	0.650000|0.650000	0.86243|0.86243	CGA|ACG		0.443	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
SDR42E1	93517	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	82032717	82032717	+	Nonstop_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:82032717C>A	ENST00000328945.5	-	3	1308	c.1181G>T	c.(1180-1182)tGa>tTa	p.*394L	SDR42E1_ENST00000534209.1_5'Flank	NM_145168.2	NP_660151.2	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E, member 1	0					steroid biosynthetic process (GO:0006694)	integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)			NS(2)|endometrium(1)|lung(4)|skin(3)	10						GCCCCTCCTTCACAGTGACAG	0.453																																						.											0													52.0	50.0	51.0					16																	82032717		1924	4143	6067	SO:0001578	stop_lost	93517			AF161368	CCDS42205.1	16q23.3	2011-09-14				ENSG00000184860	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	29834	protein-coding gene	gene with protein product						19027726	Standard	NM_145168		Approved	HSPC105	uc002fgu.3	Q8WUS8		ENST00000328945.5:c.1181G>T	16.37:g.82032717C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RDS1|Q9P0D1	Missense_Mutation	SNP	ENST00000328945.5	37	CCDS42205.1	.	.	.	.	.	.	.	.	.	.	C	8.094	0.775064	0.16051	.	.	ENSG00000184860	ENST00000328945	.	.	.	5.52	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0364	0.53427	0.0:0.9198:0.0:0.0802	.	.	.	.	L	394	.	.	X	-	2	2	SDR42E1	80590218	0.065000	0.20965	0.785000	0.31869	0.099000	0.18886	0.580000	0.23803	1.310000	0.45006	0.655000	0.94253	TGA		0.453	SDR42E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388081.2	NM_145168	
USP10	9100	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	84793019	84793019	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:84793019C>A	ENST00000219473.7	+	6	1448	c.1335C>A	c.(1333-1335)ttC>ttA	p.F445L	USP10_ENST00000570191.1_Missense_Mutation_p.F449L	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	445	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						TGATGAAGTTCATTCCTCTGT	0.463																																						.											0													119.0	108.0	112.0					16																	84793019		2002	4166	6168	SO:0001583	missense	9100			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1335C>A	16.37:g.84793019C>A	ENSP00000219473:p.Phe445Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	37	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156402	0.38119	.	.	ENSG00000103194	ENST00000219473;ENST00000397953	T	0.29397	1.57	5.51	5.51	0.81932	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.496131	0.22318	N	0.061647	T	0.15998	0.0385	N	0.03324	-0.35	0.35949	D	0.833793	B;B	0.09022	0.002;0.0	B;B	0.10450	0.002;0.005	T	0.14868	-1.0457	10	0.10636	T	0.68	-11.3568	18.7823	0.91939	0.0:1.0:0.0:0.0	.	449;445	Q14694-3;Q14694	.;UBP10_HUMAN	L	445;7	ENSP00000219473:F445L	ENSP00000219473:F445L	F	+	3	2	USP10	83350520	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.322000	0.59215	2.746000	0.94184	0.591000	0.81541	TTC		0.463	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
MYH1	4619	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	10395792	10395792	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:10395792C>T	ENST00000226207.5	-	40	5855	c.5761G>A	c.(5761-5763)Gtc>Atc	p.V1921I	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1921					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AGCTTGTTGACCTGGGACTCA	0.483																																						.											0													196.0	179.0	185.0					17																	10395792		2203	4300	6503	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5761G>A	17.37:g.10395792C>T	ENSP00000226207:p.Val1921Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213942	0.79352	.	.	ENSG00000109061	ENST00000226207	T	0.77750	-1.12	4.63	4.63	0.57726	Myosin tail (1);	0.000000	0.36234	U	0.002701	T	0.79370	0.4434	M	0.79258	2.445	0.54753	D	0.999985	B	0.14805	0.011	B	0.20577	0.03	T	0.76729	-0.2852	10	0.39692	T	0.17	.	18.0186	0.89249	0.0:1.0:0.0:0.0	.	1921	P12882	MYH1_HUMAN	I	1921	ENSP00000226207:V1921I	ENSP00000226207:V1921I	V	-	1	0	MYH1	10336517	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.568000	0.82369	2.546000	0.85860	0.655000	0.94253	GTC		0.483	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
ESCO1	114799	hgsc.bcm.edu;ucsc.edu	37	18	19116141	19116141	+	Silent	SNP	G	G	A	rs369669502		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr18:19116141G>A	ENST00000269214.5	-	10	2986	c.2049C>T	c.(2047-2049)gaC>gaT	p.D683D		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	683					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						CTCTAATCTCGTCAACCTGCC	0.308																																						.											0								G		1,4405	2.1+/-5.4	0,1,2202	89.0	87.0	88.0		2049	-4.2	1.0	18		88	0,8600		0,0,4300	no	coding-synonymous	ESCO1	NM_052911.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		683/841	19116141	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	114799			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2049C>T	18.37:g.19116141G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Silent	SNP	ENST00000269214.5	37	CCDS32800.1																																																																																				0.308	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
FAM69C	125704	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	18	72114400	72114400	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr18:72114400G>T	ENST00000343998.6	-	2	325	c.317C>A	c.(316-318)gCc>gAc	p.A106D	FAM69C_ENST00000400291.2_Intron	NM_001044369.2	NP_001037834.2	Q0P6D2	FA69C_HUMAN	family with sequence similarity 69, member C	106						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|ovary(2)	5						GCGCCAGTCGGCCTGCAGCAC	0.677																																						.											0													9.0	10.0	10.0					18																	72114400		688	1586	2274	SO:0001583	missense	125704			BC019628	CCDS42445.2	18q22.3	2012-08-03	2009-07-23	2009-07-23	ENSG00000187773	ENSG00000187773			31729	protein-coding gene	gene with protein product		614544	"""chromosome 18 open reading frame 51"""	C18orf51		21334309	Standard	NM_001044369		Approved		uc002llk.3	Q0P6D2	OTTHUMG00000156984	ENST00000343998.6:c.317C>A	18.37:g.72114400G>T	ENSP00000344331:p.Ala106Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000343998.6	37	CCDS42445.2	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432118	0.62844	.	.	ENSG00000187773	ENST00000343998	T	0.54071	0.59	3.77	3.77	0.43336	.	.	.	.	.	T	0.65396	0.2687	L	0.46157	1.445	0.58432	D	0.999999	D	0.76494	0.999	D	0.70935	0.971	T	0.69989	-0.4995	9	0.66056	D	0.02	.	16.1637	0.81739	0.0:0.0:1.0:0.0	.	106	Q0P6D2	FA69C_HUMAN	D	106	ENSP00000344331:A106D	ENSP00000344331:A106D	A	-	2	0	FAM69C	70265380	1.000000	0.71417	0.952000	0.39060	0.348000	0.29142	9.115000	0.94336	2.084000	0.62774	0.491000	0.48974	GCC		0.677	FAM69C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346971.2	XM_058931	
MYH7B	57644	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	20	33575696	33575696	+	Silent	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr20:33575696C>T	ENST00000262873.7	+	16	1613	c.1521C>T	c.(1519-1521)atC>atT	p.I507I	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	465	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TTCTGGACATCGCTGGGTTTG	0.602																																						.											0													55.0	64.0	61.0					20																	33575696		2159	4287	6446	SO:0001819	synonymous_variant	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1521C>T	20.37:g.33575696C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	ENST00000262873.7	37	CCDS42869.1																																																																																				0.602	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
HIC2	23119	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	22	21800335	21800335	+	Missense_Mutation	SNP	C	C	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr22:21800335C>G	ENST00000443632.2	+	2	1523	c.1151C>G	c.(1150-1152)cCt>cGt	p.P384R	HIC2_ENST00000407464.2_Missense_Mutation_p.P384R|HIC2_ENST00000407598.2_Missense_Mutation_p.P384R			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	384					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				GGGGCTGGCCCTAGCGGGCCC	0.687																																					NSCLC(23;437 858 2282 27947 40366)	.											0																																										SO:0001583	missense	23119			AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1151C>G	22.37:g.21800335C>G	ENSP00000387757:p.Pro384Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Missense_Mutation	SNP	ENST00000443632.2	37	CCDS13789.1	.	.	.	.	.	.	.	.	.	.	C	2.050	-0.417999	0.04766	.	.	ENSG00000169635	ENST00000407464;ENST00000407598;ENST00000443632	T;T;T	0.10763	2.84;2.84;2.84	4.63	3.58	0.41010	.	1.024570	0.07770	N	0.951539	T	0.05868	0.0153	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35699	-0.9778	10	0.33141	T	0.24	.	5.5125	0.16888	0.2208:0.6782:0.0:0.101	.	384	Q96JB3	HIC2_HUMAN	R	384	ENSP00000385319:P384R;ENSP00000384889:P384R;ENSP00000387757:P384R	ENSP00000385319:P384R	P	+	2	0	HIC2	20130335	0.004000	0.15560	0.801000	0.32222	0.286000	0.27126	0.749000	0.26320	1.235000	0.43724	0.655000	0.94253	CCT		0.687	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2		
ZNF280B	140883	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	22	22842485	22842485	+	Silent	SNP	C	C	T	rs141102079	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr22:22842485C>T	ENST00000406426.1	-	4	1981	c.1239G>A	c.(1237-1239)tcG>tcA	p.S413S	ZNF280B_ENST00000360412.2_Silent_p.S413S			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CAGCAAAGACCGACGATCTAT	0.403													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19648	0.0		0.0	False		,,,				2504	0.0					.											0								C		3,4403	6.2+/-15.9	0,3,2200	131.0	122.0	125.0		1239	-9.2	0.0	22	dbSNP_134	125	0,8600		0,0,4300	no	coding-synonymous	ZNF280B	NM_080764.2		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		413/544	22842485	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	140883			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1239G>A	22.37:g.22842485C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																				0.403	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
MGAT3	4248	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	22	39884300	39884300	+	Silent	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr22:39884300C>T	ENST00000341184.6	+	2	1163	c.948C>T	c.(946-948)gaC>gaT	p.D316D		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	316					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					TCATCATTGACGATGCGGACG	0.647																																						.											0													72.0	74.0	73.0					22																	39884300		2203	4297	6500	SO:0001819	synonymous_variant	4248			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.948C>T	22.37:g.39884300C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Silent	SNP	ENST00000341184.6	37	CCDS13994.2																																																																																				0.647	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409	
GK2	2712	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	80327734	80327734	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr4:80327734C>T	ENST00000358842.3	-	1	1638	c.1621G>A	c.(1621-1623)Gta>Ata	p.V541I		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	44					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						ATTAGCATTACCATGCTACTC	0.398																																						.											0													84.0	82.0	83.0					4																	80327734		2203	4300	6503	SO:0001583	missense	2712			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1621G>A	4.37:g.80327734C>T	ENSP00000351706:p.Val541Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	C	2.028	-0.423139	0.04734	.	.	ENSG00000196475	ENST00000358842	T	0.14022	2.54	4.11	2.9	0.33743	.	0.620022	0.16540	N	0.210016	T	0.06188	0.0160	N	0.14661	0.345	0.22330	N	0.999192	B	0.02656	0.0	B	0.04013	0.001	T	0.41466	-0.9507	10	0.11485	T	0.65	-11.0196	4.7749	0.13175	0.0:0.3368:0.0:0.6632	.	541	Q14410	GLPK2_HUMAN	I	541	ENSP00000351706:V541I	ENSP00000351706:V541I	V	-	1	0	GK2	80546758	0.627000	0.27129	0.998000	0.56505	0.950000	0.60333	-0.533000	0.06157	0.881000	0.35993	0.585000	0.79938	GTA		0.398	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
FLT4	2324	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	180053237	180053237	+	Missense_Mutation	SNP	G	G	A	rs372947534		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr5:180053237G>A	ENST00000261937.6	-	9	1210	c.1132C>T	c.(1132-1134)Cgc>Tgc	p.R378C	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.R378C|FLT4_ENST00000393347.3_Missense_Mutation_p.R378C	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	378	Ig-like C2-type 4.		R -> C (in a renal clear cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R378C(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGACTGTGGCGCCCGGACAGT	0.647																																					Colon(97;1075 1466 27033 27547 35871)	.											1	Substitution - Missense(1)	kidney(1)						G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	94.0	99.0	98.0		1132,1132	4.5	1.0	5		98	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FLT4	NM_002020.4,NM_182925.4	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	378/1299,378/1364	180053237	1,13005	2203	4300	6503	SO:0001583	missense	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1132C>T	5.37:g.180053237G>A	ENSP00000261937:p.Arg378Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.251534	0.59212	0.0	1.16E-4	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.13307	2.6;2.6;2.6	4.5	4.5	0.54988	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.36936	0.0985	M	0.84683	2.71	0.46874	D	0.999231	D;D;D	0.89917	1.0;0.997;0.998	D;P;P	0.71184	0.972;0.901;0.901	T	0.22173	-1.0224	9	0.72032	D	0.01	.	8.8586	0.35242	0.1038:0.0:0.8962:0.0	.	378;378;378	P35916-3;E9PD35;P35916	.;.;VGFR3_HUMAN	C	378;378;378;188	ENSP00000261937:R378C;ENSP00000377016:R378C;ENSP00000426057:R378C	ENSP00000261937:R378C	R	-	1	0	FLT4	179985843	0.049000	0.20398	0.995000	0.50966	0.593000	0.36681	1.754000	0.38369	2.236000	0.73375	0.561000	0.74099	CGC		0.647	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
HIVEP1	3096	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	12162043	12162043	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr6:12162043G>A	ENST00000379388.2	+	8	7191	c.6859G>A	c.(6859-6861)Gac>Aac	p.D2287N	HIVEP1_ENST00000541134.1_Missense_Mutation_p.D152N	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2287					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AGATGAAAACGACACAATTCC	0.512																																						.											0													98.0	100.0	99.0					6																	12162043		2095	4234	6329	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6859G>A	6.37:g.12162043G>A	ENSP00000368698:p.Asp2287Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777903	0.31502	.	.	ENSG00000095951	ENST00000379388;ENST00000442081;ENST00000541134;ENST00000542327	T;T	0.31769	3.0;1.48	5.77	2.92	0.33932	.	1.573320	0.04254	N	0.339229	T	0.08447	0.0210	N	0.22421	0.69	0.09310	N	1	B	0.25850	0.136	B	0.18871	0.023	T	0.31696	-0.9934	10	0.29301	T	0.29	-0.2298	10.3306	0.43820	0.0695:0.3587:0.5718:0.0	.	2287	P15822	ZEP1_HUMAN	N	2287;214;152;269	ENSP00000368698:D2287N;ENSP00000445617:D152N	ENSP00000368698:D2287N	D	+	1	0	HIVEP1	12270029	0.002000	0.14202	0.001000	0.08648	0.015000	0.08874	1.237000	0.32695	0.310000	0.22990	0.655000	0.94253	GAC		0.512	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
ADCY8	114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	131922101	131922101	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr8:131922101G>A	ENST00000286355.5	-	6	3585	c.1493C>T	c.(1492-1494)tCa>tTa	p.S498L	ADCY8_ENST00000377928.3_Missense_Mutation_p.S498L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	498					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TTTTGTCCTTGACCGCACATA	0.448										HNSCC(32;0.087)																												.											0													169.0	129.0	143.0					8																	131922101		2203	4300	6503	SO:0001583	missense	114			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1493C>T	8.37:g.131922101G>A	ENSP00000286355:p.Ser498Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318073	0.81469	.	.	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	T;T;T	0.80653	-1.4;-1.4;-1.4	5.8	5.8	0.92144	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.120729	0.64402	D	0.000017	T	0.79540	0.4463	N	0.11789	0.175	0.36692	D	0.879639	P;D	0.54047	0.948;0.964	P;P	0.57204	0.682;0.815	D	0.84098	0.0394	10	0.54805	T	0.06	.	19.0419	0.93004	0.0:0.0:1.0:0.0	.	498;498	E7EVL1;P40145	.;ADCY8_HUMAN	L	498;498;113	ENSP00000286355:S498L;ENSP00000367161:S498L;ENSP00000428010:S113L	ENSP00000286355:S498L	S	-	2	0	ADCY8	131991283	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.658000	0.61497	2.758000	0.94735	0.561000	0.74099	TCA		0.448	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
PCSK5	5125	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	78749078	78749078	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr9:78749078C>T	ENST00000545128.1	+	10	1800	c.1262C>T	c.(1261-1263)gCg>gTg	p.A421V	PCSK5_ENST00000376752.4_Missense_Mutation_p.A421V|PCSK5_ENST00000376767.3_Missense_Mutation_p.A421V	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	421	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ACTTCCCGTGCGGGACATTTG	0.398																																						.											0													129.0	119.0	122.0					9																	78749078		2203	4299	6502	SO:0001583	missense	5125				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1262C>T	9.37:g.78749078C>T	ENSP00000446280:p.Ala421Val	Somatic		WXS	Illumina HiSeq	Phase_I	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579348	0.86645	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29	5.65	5.65	0.86999	.	0.210963	0.49916	D	0.000139	T	0.81403	0.4815	N	0.25789	0.76	0.45704	D	0.998616	P;P	0.45957	0.599;0.869	B;B	0.41666	0.248;0.363	D	0.84046	0.0367	10	0.72032	D	0.01	-19.0199	14.869	0.70441	0.1436:0.8564:0.0:0.0	.	421;421	Q92824-2;B1AMG5	.;.	V	421;124;421;421;421;94	ENSP00000446280:A421V;ENSP00000365958:A421V;ENSP00000365943:A421V;ENSP00000411654:A94V	ENSP00000365943:A421V	A	+	2	0	PCSK5	77938898	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.581000	0.67471	2.817000	0.96982	0.563000	0.77884	GCG		0.398	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PPAPDC3	84814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	134165625	134165625	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr9:134165625G>A	ENST00000372264.3	+	1	545	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	PPAPDC3_ENST00000372261.1_Missense_Mutation_p.A81T	NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	81	interaction with MTOR. {ECO:0000250}.				negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		CAAGGGCATCGCCTTCAACTC	0.657																																						.											0													77.0	73.0	75.0					9																	134165625		2203	4300	6503	SO:0001583	missense	84814			AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.241G>A	9.37:g.134165625G>A	ENSP00000361338:p.Ala81Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T6P0|Q96SS7|Q9BRC3	Missense_Mutation	SNP	ENST00000372264.3	37	CCDS6942.1	.	.	.	.	.	.	.	.	.	.	G	35	5.433692	0.96150	.	.	ENSG00000160539	ENST00000372264;ENST00000372261	T;T	0.58506	1.31;0.33	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.72003	0.3407	L	0.55213	1.73	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.69997	-0.4993	10	0.39692	T	0.17	-31.0681	18.1257	0.89585	0.0:0.0:1.0:0.0	.	81	Q8NBV4	PPAC3_HUMAN	T	81	ENSP00000361338:A81T;ENSP00000361335:A81T	ENSP00000361335:A81T	A	+	1	0	PPAPDC3	133155446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.424000	0.97464	2.530000	0.85305	0.561000	0.74099	GCC		0.657	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
NRAP	4892	hgsc.bcm.edu;mdanderson.org	37	10	115381805	115381805	+	Silent	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr10:115381805G>A	ENST00000359988.3	-	24	2836	c.2592C>T	c.(2590-2592)ttC>ttT	p.F864F	NRAP_ENST00000360478.3_Silent_p.F829F|NRAP_ENST00000369360.3_Silent_p.F837F|NRAP_ENST00000369358.4_Silent_p.F872F	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGGTGTCCTCGAATCCCTTCT	0.527																																						.											0													230.0	174.0	193.0					10																	115381805		2203	4300	6503	SO:0001819	synonymous_variant	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2592C>T	10.37:g.115381805G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000359988.3	37	CCDS7579.1																																																																																				0.527	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
GALNT8	26290	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	4854614	4854614	+	Missense_Mutation	SNP	C	C	T	rs202166380	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:4854614C>T	ENST00000252318.2	+	5	1217	c.880C>T	c.(880-882)Cgg>Tgg	p.R294W		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	294	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						AATCTTGGCTCGGATTCAGGA	0.483													C|||	3	0.000599042	0.0008	0.0	5008	,	,		23971	0.001		0.0	False		,,,				2504	0.001				Colon(108;631 1558 7270 20097 39846)	.											0								C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	113.0	92.0	99.0		880	-1.5	0.9	12		99	0,8600		0,0,4300	no	missense	GALNT8	NM_017417.1	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	294/638	4854614	1,13005	2203	4300	6503	SO:0001583	missense	26290			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.880C>T	12.37:g.4854614C>T	ENSP00000252318:p.Arg294Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	CCDS8533.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.19	3.326160	0.60743	2.27E-4	0.0	ENSG00000130035	ENST00000252318	T	0.62105	0.05	4.11	-1.5	0.08691	Glycosyl transferase, family 2 (1);	0.081559	0.48767	N	0.000161	T	0.71459	0.3342	M	0.83953	2.67	0.26121	N	0.980544	D	0.89917	1.0	D	0.85130	0.997	T	0.62704	-0.6798	10	0.87932	D	0	.	1.1486	0.01781	0.425:0.2546:0.1392:0.1812	.	294	Q9NY28	GALT8_HUMAN	W	294	ENSP00000252318:R294W	ENSP00000252318:R294W	R	+	1	2	GALNT8	4724875	0.027000	0.19231	0.903000	0.35520	0.955000	0.61496	-0.254000	0.08781	-0.573000	0.05998	0.491000	0.48974	CGG		0.483	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417	
XYLT1	64131	hgsc.bcm.edu	37	16	17202636	17202636	+	Silent	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:17202636G>A	ENST00000261381.6	-	12	2880	c.2796C>T	c.(2794-2796)acC>acT	p.T932T		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	932					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTGGCTGCAGGTCTGCATGA	0.667																																						.											0													34.0	30.0	31.0					16																	17202636		2197	4300	6497	SO:0001819	synonymous_variant	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2796C>T	16.37:g.17202636G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H1B6	Silent	SNP	ENST00000261381.6	37	CCDS10569.1																																																																																				0.667	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
DNAH1	25981	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	52365211	52365211	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:52365211G>A	ENST00000420323.2	+	7	1180	c.919G>A	c.(919-921)Gtc>Atc	p.V307I		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	307	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGAGGTCGGCGTCCTGGACTA	0.577																																						.											0													56.0	59.0	58.0					3																	52365211		2039	4188	6227	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.919G>A	3.37:g.52365211G>A	ENSP00000401514:p.Val307Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883725	0.51908	.	.	ENSG00000114841	ENST00000420323	T	0.25912	1.77	5.38	5.38	0.77491	.	0.000000	0.46145	D	0.000309	T	0.49355	0.1552	M	0.77820	2.39	0.50467	D	0.999876	P;D	0.64830	0.939;0.994	B;P	0.57009	0.292;0.811	T	0.51803	-0.8659	10	0.54805	T	0.06	.	19.1396	0.93443	0.0:0.0:1.0:0.0	.	307;307	C9JXH6;Q9P2D7-3	.;.	I	307	ENSP00000401514:V307I	ENSP00000401514:V307I	V	+	1	0	DNAH1	52340251	1.000000	0.71417	0.945000	0.38365	0.215000	0.24574	6.830000	0.75319	2.521000	0.84997	0.462000	0.41574	GTC		0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
ABTB1	80325	hgsc.bcm.edu	37	3	127396057	127396057	+	Silent	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:127396057C>T	ENST00000232744.8	+	8	776	c.690C>T	c.(688-690)ccC>ccT	p.P230P	ABTB1_ENST00000468137.1_Silent_p.P88P|ABTB1_ENST00000453791.2_Silent_p.P88P|ABTB1_ENST00000393363.3_Silent_p.P88P					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						CCATCGAGCCCCCACCTGCAG	0.682																																						.											0													32.0	29.0	30.0					3																	127396057		2200	4298	6498	SO:0001819	synonymous_variant	80325			AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.690C>T	3.37:g.127396057C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000232744.8	37	CCDS3045.1																																																																																				0.682	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027	
GRIA1	2890	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	5	153065877	153065877	+	Silent	SNP	C	C	T	rs140876127		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr5:153065877C>T	ENST00000285900.5	+	8	1465	c.1122C>T	c.(1120-1122)gaC>gaT	p.D374D	GRIA1_ENST00000448073.4_Silent_p.D384D|GRIA1_ENST00000340592.5_Silent_p.D374D|GRIA1_ENST00000518783.1_Silent_p.D384D|GRIA1_ENST00000521843.2_Silent_p.D305D|GRIA1_ENST00000518142.1_Silent_p.D294D	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	374					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.D374D(2)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGAAACATGACGGCATCCGAA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		17294	0.001		0.0	False		,,,				2504	0.0					.											2	Substitution - coding silent(2)	large_intestine(2)						C	,	0,4406		0,0,2203	116.0	104.0	108.0		1122,1122	-10.5	0.8	5	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GRIA1	NM_000827.3,NM_001114183.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	374/907,374/907	153065877	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2890				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1122C>T	5.37:g.153065877C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	CCDS4322.1																																																																																				0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
MFHAS1	9258	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	8	8748357	8748357	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr8:8748357T>A	ENST00000276282.6	-	1	2798	c.2212A>T	c.(2212-2214)Aat>Tat	p.N738Y		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	738										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		AAGAAGACATTGAGGATGTCG	0.587																																					Melanoma(103;1201 2045 17515 28966)	.											0													71.0	67.0	68.0					8																	8748357		2203	4300	6503	SO:0001583	missense	9258			AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2212A>T	8.37:g.8748357T>A	ENSP00000276282:p.Asn738Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.251286	0.59212	.	.	ENSG00000147324	ENST00000276282	T	0.36157	1.27	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	L	0.56769	1.78	0.58432	D	0.999999	D	0.76494	0.999	D	0.81914	0.995	T	0.57429	-0.7813	10	0.59425	D	0.04	.	13.6484	0.62297	0.0:0.0:0.0:1.0	.	738	Q9Y4C4	MFHA1_HUMAN	Y	738	ENSP00000276282:N738Y	ENSP00000276282:N738Y	N	-	1	0	MFHAS1	8785767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.499000	0.81566	2.008000	0.58898	0.533000	0.62120	AAT		0.587	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
RBM3	5935	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	48434802	48434802	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chrX:48434802C>T	ENST00000376759.3	+	4	374	c.311C>T	c.(310-312)tCt>tTt	p.S104F	RBM3_ENST00000466764.1_3'UTR|RBM3_ENST00000376755.1_Missense_Mutation_p.S104F|RBM3_ENST00000430348.2_Silent_p.L77L|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000354480.2_Silent_p.L77L	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	104	Gly-rich.				positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						CGCAGCTACTCTAGAGGTGAG	0.537																																						.											0													69.0	57.0	61.0					X																	48434802		2203	4300	6503	SO:0001583	missense	5935			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.311C>T	X.37:g.48434802C>T	ENSP00000365950:p.Ser104Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000376759.3	37	CCDS14301.1	.	.	.	.	.	.	.	.	.	.	C	4.891	0.165533	0.09339	.	.	ENSG00000102317	ENST00000376759;ENST00000376755	T;T	0.74632	-0.86;-0.86	5.05	4.17	0.49024	.	0.406828	0.17473	U	0.173017	T	0.57607	0.2065	L	0.29908	0.895	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51482	-0.8700	10	0.19147	T	0.46	-10.0799	6.7782	0.23630	0.0:0.7154:0.1801:0.1044	.	104	P98179	RBM3_HUMAN	F	104	ENSP00000365950:S104F;ENSP00000365946:S104F	ENSP00000365946:S104F	S	+	2	0	RBM3	48319746	0.997000	0.39634	0.999000	0.59377	0.978000	0.69477	2.732000	0.47352	2.222000	0.72286	0.513000	0.50165	TCT		0.537	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	
ZCCHC5	203430	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	77913571	77913571	+	Missense_Mutation	SNP	G	G	A	rs144237768		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chrX:77913571G>A	ENST00000321110.1	-	2	642	c.347C>T	c.(346-348)gCg>gTg	p.A116V		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	116	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.A116V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGCTGGAGGCGCCAGGGACTC	0.627																																						.											1	Substitution - Missense(1)	prostate(1)						G	VAL/ALA	1,3834		0,1,1631,571	23.0	26.0	25.0		347	1.8	0.0	X	dbSNP_134	25	0,6724		0,0,2428,1868	no	missense	ZCCHC5	NM_152694.2	64	0,1,4059,2439	AA,AG,GG,G		0.0,0.0261,0.0095	benign	116/476	77913571	1,10558	2203	4296	6499	SO:0001583	missense	203430			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.347C>T	X.37:g.77913571G>A	ENSP00000316794:p.Ala116Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	9.004	0.980926	0.18812	2.61E-4	0.0	ENSG00000179300	ENST00000321110	T	0.18502	2.21	3.01	1.84	0.25277	.	.	.	.	.	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.11329	0.006	T	0.31223	-0.9951	9	0.51188	T	0.08	.	7.1902	0.25821	0.0:0.0:0.2253:0.7747	.	116	Q8N8U3	ZCHC5_HUMAN	V	116	ENSP00000316794:A116V	ENSP00000316794:A116V	A	-	2	0	ZCCHC5	77800227	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-0.294000	0.08309	0.411000	0.25702	-0.623000	0.04022	GCG		0.627	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
ANK3	288	broad.mit.edu	37	10	61832802	61832802	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr10:61832802C>T	ENST00000280772.2	-	37	8028	c.7837G>A	c.(7837-7839)Gca>Aca	p.A2613T	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2613					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTAGGGCGTGCCTTTTTCTCT	0.443																																						.											0																																										SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7837G>A	10.37:g.61832802C>T	ENSP00000280772:p.Ala2613Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828684	0.32329	.	.	ENSG00000151150	ENST00000280772	T	0.63255	-0.03	5.66	-1.93	0.07594	.	1.079830	0.07306	N	0.874907	T	0.40670	0.1126	N	0.14661	0.345	0.80722	D	1	B	0.12630	0.006	B	0.12156	0.007	T	0.19321	-1.0309	10	0.18710	T	0.47	.	8.9934	0.36037	0.1972:0.339:0.4638:0.0	.	2613	Q12955	ANK3_HUMAN	T	2613	ENSP00000280772:A2613T	ENSP00000280772:A2613T	A	-	1	0	ANK3	61502808	0.995000	0.38212	0.991000	0.47740	0.990000	0.78478	0.581000	0.23819	-0.208000	0.10171	0.462000	0.41574	GCA		0.443	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
TCERG1L	256536	broad.mit.edu	37	10	132932683	132932683	+	Silent	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr10:132932683T>C	ENST00000368642.4	-	8	1303	c.1218A>G	c.(1216-1218)gaA>gaG	p.E406E		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	406										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CCCTGTTGTCTTCAGAACTGG	0.507																																						.											0													119.0	94.0	102.0					10																	132932683		2203	4299	6502	SO:0001819	synonymous_variant	256536			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1218A>G	10.37:g.132932683T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VWI2|Q86XM8	Silent	SNP	ENST00000368642.4	37	CCDS7662.2																																																																																				0.507	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
SIRT3	23410	broad.mit.edu	37	11	224195	224195	+	Silent	SNP	G	G	A	rs202035351	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:224195G>A	ENST00000382743.4	-	5	954	c.852C>T	c.(850-852)acC>acT	p.T284T	SIRT3_ENST00000532956.1_Intron|SIRT3_ENST00000528702.1_5'Flank|SIRT3_ENST00000529382.1_Silent_p.T142T|SIRT3_ENST00000524564.1_Silent_p.T220T|SIRT3_ENST00000525319.1_Silent_p.T203T	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	284	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		TCACAACGCCGGTGCAGACCG	0.572													G|||	2	0.000399361	0.0	0.0	5008	,	,		17366	0.001		0.0	False		,,,				2504	0.001					.											0													61.0	55.0	57.0					11																	224195		2203	4300	6503	SO:0001819	synonymous_variant	23410			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.852C>T	11.37:g.224195G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z5U6|Q9Y6E8	Silent	SNP	ENST00000382743.4	37	CCDS7691.1																																																																																				0.572	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239288.3		
SLC43A1	8501	broad.mit.edu	37	11	57268329	57268329	+	Splice_Site	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:57268329C>T	ENST00000278426.3	-	5	744		c.e5-1		SLC43A1_ENST00000533515.1_5'Flank|SLC43A1_ENST00000528450.1_Splice_Site	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GGAGACAGAGCTGGAAAGGGG	0.562																																						.											0													104.0	106.0	105.0					11																	57268329		2201	4296	6497	SO:0001630	splice_region_variant	8501			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.389-1G>A	11.37:g.57268329C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Splice_Site	SNP	ENST00000278426.3	37	CCDS7958.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867231	0.51588	.	.	ENSG00000149150	ENST00000278426;ENST00000528450;ENST00000525764;ENST00000533066	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7628	0.78101	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC43A1	57024905	1.000000	0.71417	0.969000	0.41365	0.446000	0.32137	6.810000	0.75216	2.445000	0.82738	0.655000	0.94253	.		0.562	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627	Intron
CASP4	837	broad.mit.edu	37	11	104825546	104825546	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:104825546T>C	ENST00000444739.2	-	2	1100	c.190A>G	c.(190-192)Aag>Gag	p.K64E	CASP4_ENST00000531333.1_5'UTR|CASP4_ENST00000393150.3_Missense_Mutation_p.K8E	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	64	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		ATACGTTGCTTCTCTTGCATA	0.363																																						.											0													213.0	199.0	204.0					11																	104825546		2202	4299	6501	SO:0001583	missense	837			U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.190A>G	11.37:g.104825546T>C	ENSP00000388566:p.Lys64Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	37	CCDS8327.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.288516	0.40494	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000417440	T;T;T	0.29397	1.57;4.16;1.57	3.46	2.24	0.28232	DEATH-like (2);Caspase Recruitment (3);	0.171234	0.51477	D	0.000082	T	0.48132	0.1483	M	0.71871	2.18	0.09310	N	1	P;D;D	0.69078	0.943;0.997;0.975	P;D;D	0.71414	0.672;0.973;0.933	T	0.29427	-1.0012	10	0.72032	D	0.01	.	7.8029	0.29185	0.0:0.0:0.2125:0.7875	.	64;64;64	B4DJH5;B4E2D2;P49662	.;.;CASP4_HUMAN	E	64;8;64	ENSP00000388566:K64E;ENSP00000376857:K8E;ENSP00000401673:K64E	ENSP00000376857:K8E	K	-	1	0	CASP4	104330756	0.040000	0.19996	0.001000	0.08648	0.002000	0.02628	1.676000	0.37565	0.457000	0.26962	0.459000	0.35465	AAG		0.363	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
EIF4B	1975	broad.mit.edu	37	12	53416356	53416356	+	Silent	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:53416356T>C	ENST00000262056.9	+	6	938	c.612T>C	c.(610-612)gcT>gcC	p.A204A	EIF4B_ENST00000416762.3_Silent_p.A165A|RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000420463.3_Silent_p.A204A	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	204	Arg-rich.|Asp-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						CTCGTCCTGCTACAGACAGCT	0.433																																						.											0													105.0	90.0	94.0					12																	53416356		1879	4110	5989	SO:0001819	synonymous_variant	1975			X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.612T>C	12.37:g.53416356T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Silent	SNP	ENST00000262056.9	37	CCDS41788.1																																																																																				0.433	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417	
ACACB	32	broad.mit.edu	37	12	109577282	109577282	+	Silent	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:109577282G>A	ENST00000338432.7	+	2	191	c.72G>A	c.(70-72)ggG>ggA	p.G24G	ACACB_ENST00000377854.5_Silent_p.G24G|ACACB_ENST00000377848.3_Silent_p.G24G			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	24					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AAATCTGGGGGAAAATGACGG	0.463																																						.											0													95.0	95.0	95.0					12																	109577282		2203	4300	6503	SO:0001819	synonymous_variant	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.72G>A	12.37:g.109577282G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	CCDS31898.1																																																																																				0.463	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
MYO5A	4644	broad.mit.edu;mdanderson.org	37	15	52613683	52613683	+	Silent	SNP	A	A	G	rs368705747		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr15:52613683A>G	ENST00000399231.3	-	37	4992	c.4749T>C	c.(4747-4749)tcT>tcC	p.S1583S	MYO5A_ENST00000356338.6_Silent_p.S1556S|MYO5A_ENST00000399233.2_Silent_p.S1580S|MYO5A_ENST00000553916.1_Silent_p.S1581S|MYO5A_ENST00000358212.6_Silent_p.S1608S	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1583	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CATTCTGGCGAGATGTGTTGT	0.458																																						.											0								A	,	0,4092		0,0,2046	142.0	141.0	141.0		4749,4668	2.6	1.0	15		141	1,8413		0,1,4206	no	coding-synonymous,coding-synonymous	MYO5A	NM_000259.3,NM_001142495.1	,	0,1,6252	GG,GA,AA		0.0119,0.0,0.0080	,	1583/1856,1556/1829	52613683	1,12505	2046	4207	6253	SO:0001819	synonymous_variant	4644				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.4749T>C	15.37:g.52613683A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	ENST00000399231.3	37	CCDS42037.1																																																																																				0.458	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
SLC24A1	9187	broad.mit.edu;mdanderson.org	37	15	65946296	65946296	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr15:65946296C>T	ENST00000261892.6	+	10	3466	c.3179C>T	c.(3178-3180)gCg>gTg	p.A1060V	SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000537259.1_Intron|SLC24A1_ENST00000399033.4_Missense_Mutation_p.A1030V|SLC24A1_ENST00000339868.6_Missense_Mutation_p.A1042V|SLC24A1_ENST00000544319.2_Missense_Mutation_p.A946V|SLC24A1_ENST00000546330.1_Missense_Mutation_p.A1042V	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	1060					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.A1060V(1)		breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						TCTTCAATTGCGTCATGTAAA	0.383																																						.											1	Substitution - Missense(1)	large_intestine(1)											288.0	268.0	274.0					15																	65946296		1952	4142	6094	SO:0001583	missense	9187			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.3179C>T	15.37:g.65946296C>T	ENSP00000261892:p.Ala1060Val	Somatic		WXS	Illumina HiSeq	Phase_I	O43485|O75184|Q17RM9	Missense_Mutation	SNP	ENST00000261892.6	37	CCDS45284.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480885	0.84747	.	.	ENSG00000074621	ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05	5.51	5.51	0.81932	Sodium/calcium exchanger membrane region (1);	0.115247	0.64402	D	0.000014	T	0.77883	0.4197	M	0.73753	2.245	0.80722	D	1	D;D;D;D	0.76494	0.999;0.985;0.973;0.999	D;D;D;D	0.79108	0.983;0.915;0.919;0.992	T	0.72956	-0.4134	10	0.16896	T	0.51	.	18.3861	0.90466	0.0:1.0:0.0:0.0	.	387;1042;1030;1060	B4DUG1;O60721-2;Q17RM9;O60721	.;.;.;NCKX1_HUMAN	V	1060;1042;946;1030;1042	ENSP00000261892:A1060V;ENSP00000341837:A1042V;ENSP00000445163:A946V;ENSP00000381991:A1030V;ENSP00000439190:A1042V	ENSP00000261892:A1060V	A	+	2	0	SLC24A1	63733350	1.000000	0.71417	0.210000	0.23637	0.748000	0.42578	7.818000	0.86416	2.572000	0.86782	0.585000	0.79938	GCG		0.383	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
ARIH1	25820	broad.mit.edu	37	15	72873082	72873082	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr15:72873082C>A	ENST00000379887.4	+	12	1540	c.1226C>A	c.(1225-1227)gCa>gAa	p.A409E	ARIH1_ENST00000562891.1_3'UTR	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	409					cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A409E(4)		endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						CGATCTAGGGCAGCCCTGCAG	0.383																																						.											4	Substitution - Missense(4)	prostate(2)|kidney(2)											57.0	49.0	52.0					15																	72873082		2198	4297	6495	SO:0001583	missense	25820			AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.1226C>A	15.37:g.72873082C>A	ENSP00000369217:p.Ala409Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Missense_Mutation	SNP	ENST00000379887.4	37	CCDS10244.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155042	0.78114	.	.	ENSG00000166233	ENST00000379887;ENST00000299305	D	0.83673	-1.75	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.78629	0.4313	L	0.43701	1.375	0.80722	D	1	B	0.32467	0.372	B	0.23018	0.043	T	0.77225	-0.2666	10	0.54805	T	0.06	.	20.0756	0.97742	0.0:1.0:0.0:0.0	.	409	Q9Y4X5	ARI1_HUMAN	E	409;379	ENSP00000369217:A409E	ENSP00000299305:A379E	A	+	2	0	ARIH1	70660136	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.394000	0.79862	2.763000	0.94921	0.650000	0.86243	GCA		0.383	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257350.1	NM_005744	
SH3GL3	6457	broad.mit.edu	37	15	84286962	84286962	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr15:84286962T>C	ENST00000427482.2	+	9	1273	c.967T>C	c.(967-969)Tat>Cat	p.Y323H	SH3GL3_ENST00000324537.5_Missense_Mutation_p.Y331H|SH3GL3_ENST00000564054.1_3'UTR|SH3GL3_ENST00000535412.1_3'UTR|SH3GL3_ENST00000434347.1_Missense_Mutation_p.Y331H|AC087738.1_ENST00000411248.1_RNA	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	323	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						TGAAAACTGGTATGAAGGAAT	0.398																																						.											0													116.0	106.0	110.0					15																	84286962		2203	4300	6503	SO:0001583	missense	6457			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.967T>C	15.37:g.84286962T>C	ENSP00000391372:p.Tyr323His	Somatic		WXS	Illumina HiSeq	Phase_I	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	37	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	T	25.2	4.609438	0.87258	.	.	ENSG00000140600	ENST00000427482;ENST00000324537;ENST00000434347	T;T;T	0.31769	1.48;1.48;1.48	5.54	5.54	0.83059	Src homology-3 domain (5);	0.181657	0.51477	D	0.000100	T	0.63070	0.2480	M	0.91354	3.2	0.80722	D	1	D;D	0.71674	0.998;0.978	D;P	0.69479	0.964;0.707	T	0.72747	-0.4200	10	0.87932	D	0	-17.6148	14.8615	0.70384	0.0:0.0:0.0:1.0	.	323;331	Q99963;Q99963-3	SH3G3_HUMAN;.	H	323;331;331	ENSP00000391372:Y323H;ENSP00000320092:Y331H;ENSP00000397871:Y331H	ENSP00000320092:Y331H	Y	+	1	0	SH3GL3	82077966	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.590000	0.82653	2.101000	0.63845	0.460000	0.39030	TAT		0.398	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027	
IL4R	3566	broad.mit.edu	37	16	27374339	27374339	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:27374339C>T	ENST00000395762.2	+	11	1925	c.1666C>T	c.(1666-1668)Cga>Tga	p.R556*	IL4R_ENST00000543915.2_Nonsense_Mutation_p.R556*|IL4R_ENST00000170630.2_Nonsense_Mutation_p.R556*|IL4R_ENST00000380922.3_Nonsense_Mutation_p.R541*	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	556	Required for IRS1 activation and IL4- induced cell growth.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GATCCTCCGCCGAAATGTCCT	0.637																																						.											0													29.0	33.0	31.0					16																	27374339		2196	4300	6496	SO:0001587	stop_gained	3566			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1666C>T	16.37:g.27374339C>T	ENSP00000379111:p.Arg556*	Somatic		WXS	Illumina HiSeq	Phase_I	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Nonsense_Mutation	SNP	ENST00000395762.2	37	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	C	37	6.259888	0.97421	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	.	.	.	5.16	3.14	0.36123	.	6.252000	0.00166	N	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-6.6276	6.1989	0.20565	0.1908:0.7127:0.0:0.0965	.	.	.	.	X	556;556;541;556	.	ENSP00000170630:R556X	R	+	1	2	IL4R	27281840	0.010000	0.17322	0.005000	0.12908	0.109000	0.19521	1.471000	0.35365	0.532000	0.28657	0.555000	0.69702	CGA		0.637	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
MAPK3	5595	broad.mit.edu	37	16	30128535	30128535	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:30128535A>G	ENST00000263025.4	-	6	931	c.847T>C	c.(847-849)Tct>Cct	p.S283P	MAPK3_ENST00000395202.1_Intron|MAPK3_ENST00000484663.1_Missense_Mutation_p.S169P|MAPK3_ENST00000494643.1_5'Flank|MAPK3_ENST00000322266.5_Intron|MAPK3_ENST00000403394.1_Missense_Mutation_p.S283P|MAPK3_ENST00000395199.3_Missense_Mutation_p.S283P|MAPK3_ENST00000395200.1_Missense_Mutation_p.S215P	NM_002746.2	NP_002737.2	P27361	MK03_HUMAN	mitogen-activated protein kinase 3	283	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage induced protein phosphorylation (GO:0006975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-1-mediated signaling pathway (GO:0070498)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apolipoprotein binding (GO:2000657)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to exogenous dsRNA (GO:0043330)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)									Arsenic trioxide(DB01169)|Sulindac(DB00605)	GAGGGCAGAGACTGTAGGTAG	0.532																																						.											0													137.0	126.0	129.0					16																	30128535		2197	4300	6497	SO:0001583	missense	5595			M84490	CCDS10672.1, CCDS42148.1, CCDS42149.1	16p11.2	2011-06-10			ENSG00000102882	ENSG00000102882	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6877	protein-coding gene	gene with protein product		601795		PRKM3		9628824	Standard	NM_001109891		Approved	ERK1, p44mapk, p44erk1	uc002dws.3	P27361	OTTHUMG00000132149	ENST00000263025.4:c.847T>C	16.37:g.30128535A>G	ENSP00000263025:p.Ser283Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8CZ58|B0LPG3|Q8NHX1	Missense_Mutation	SNP	ENST00000263025.4	37	CCDS10672.1	.	.	.	.	.	.	.	.	.	.	A	32	5.128040	0.94473	.	.	ENSG00000102882	ENST00000263025;ENST00000484663;ENST00000403394;ENST00000395200;ENST00000478356;ENST00000395199	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;2.77;0.95	5.7	5.7	0.88788	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.056597	0.64402	D	0.000001	T	0.49695	0.1572	L	0.49256	1.55	0.80722	D	1	P;P	0.49559	0.925;0.891	P;P	0.50617	0.594;0.646	T	0.52815	-0.8525	10	0.87932	D	0	0.1679	14.9339	0.70938	1.0:0.0:0.0:0.0	.	283;283	P27361-3;P27361	.;MK03_HUMAN	P	283;169;283;215;46;283	ENSP00000263025:S283P;ENSP00000432742:S169P;ENSP00000384895:S283P;ENSP00000378626:S215P;ENSP00000432292:S46P;ENSP00000378625:S283P	ENSP00000263025:S283P	S	-	1	0	MAPK3	30036036	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.269000	0.95684	2.171000	0.68590	0.482000	0.46254	TCT		0.532	MAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255196.2		
ST3GAL2	6483	broad.mit.edu	37	16	70432188	70432188	+	Silent	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:70432188G>A	ENST00000393640.4	-	1	2353	c.246C>T	c.(244-246)tcC>tcT	p.S82S	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Silent_p.S82S|ST3GAL2_ENST00000566097.1_5'Flank			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	82					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)	p.S82S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				CAAACCAGTCGGAGGCACCGG	0.627																																						.											1	Substitution - coding silent(1)	large_intestine(1)											65.0	62.0	63.0					16																	70432188		2198	4300	6498	SO:0001819	synonymous_variant	6483			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.246C>T	16.37:g.70432188G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00654	Silent	SNP	ENST00000393640.4	37	CCDS10890.1																																																																																				0.627	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268968.1	NM_006927	
TRIM16	10626	broad.mit.edu	37	17	15534987	15534987	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:15534987G>A	ENST00000578237.1	-	10	1912	c.1057C>T	c.(1057-1059)Cgc>Tgc	p.R353C	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.R353C|TRIM16_ENST00000416464.2_Missense_Mutation_p.R223C|TRIM16_ENST00000336708.7_Missense_Mutation_p.R353C|TRIM16_ENST00000579219.1_Intron|TRIM16_ENST00000577886.1_Missense_Mutation_p.R137C			O95361	TRI16_HUMAN	tripartite motif containing 16	353					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CAATATTTGCGCTGAACAACG	0.483																																						.											0													163.0	133.0	143.0					17																	15534987		2203	4300	6503	SO:0001583	missense	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.1057C>T	17.37:g.15534987G>A	ENSP00000463188:p.Arg353Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	.	.	.	.	.	.	.	.	.	.	.	9.308	1.054847	0.19907	.	.	ENSG00000221926	ENST00000336708;ENST00000416464	T;T	0.69040	-0.13;-0.37	4.61	4.61	0.57282	.	1.272180	0.05169	N	0.499214	T	0.66587	0.2804	L	0.47716	1.5	0.09310	N	1	D;D;D	0.63880	0.987;0.987;0.993	P;P;B	0.46144	0.505;0.505;0.446	T	0.55179	-0.8181	10	0.39692	T	0.17	.	10.5666	0.45175	0.0:0.0:0.8072:0.1928	.	223;353;367	B3KP96;O95361;Q59EB2	.;TRI16_HUMAN;.	C	353;223	ENSP00000338989:R353C;ENSP00000399918:R223C	ENSP00000338989:R353C	R	-	1	0	TRIM16	15475712	0.505000	0.26131	0.009000	0.14445	0.923000	0.55619	1.783000	0.38664	2.262000	0.75019	0.555000	0.69702	CGC		0.483	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2	NM_006470	
ATP9B	374868	broad.mit.edu	37	18	77090010	77090010	+	Splice_Site	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr18:77090010A>G	ENST00000426216.2	+	17	1952		c.e17-1		ATP9B_ENST00000543761.1_5'Flank|ATP9B_ENST00000307671.7_Splice_Site	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B						establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		GTTCTTTGATAGGATGAATCC	0.423																																						.											0													117.0	108.0	111.0					18																	77090010		2203	4300	6503	SO:0001630	splice_region_variant	374868			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.1936-1A>G	18.37:g.77090010A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O60872|Q08AD8|Q08AD9	Splice_Site	SNP	ENST00000426216.2	37	CCDS12014.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040743	0.35989	.	.	ENSG00000166377	ENST00000426216;ENST00000307671	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1027	0.72292	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP9B	75190998	1.000000	0.71417	0.984000	0.44739	0.294000	0.27393	8.880000	0.92407	2.018000	0.59344	0.533000	0.62120	.		0.423	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	Intron
QTRT1	81890	broad.mit.edu	37	19	10823283	10823283	+	Silent	SNP	C	C	T	rs568267343		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr19:10823283C>T	ENST00000250237.5	+	7	850	c.840C>T	c.(838-840)tgC>tgT	p.C280C		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	280					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			TGTTCGACTGCGTCTTCCCCA	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		14819	0.0		0.001	False		,,,				2504	0.0					.											0													130.0	119.0	123.0					19																	10823283		2203	4300	6503	SO:0001819	synonymous_variant	81890			AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.840C>T	19.37:g.10823283C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DFM7|Q96BQ4|Q9BXQ9	Silent	SNP	ENST00000250237.5	37	CCDS12248.1																																																																																				0.642	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209	
ZNF181	339318	broad.mit.edu	37	19	35232200	35232200	+	Missense_Mutation	SNP	T	T	G	rs143797666	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr19:35232200T>G	ENST00000492450.1	+	4	1003	c.914T>G	c.(913-915)gTc>gGc	p.V305G	ZNF181_ENST00000459757.2_Missense_Mutation_p.V304G|ZNF181_ENST00000392232.3_Missense_Mutation_p.V349G			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V241G(4)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTAGCCATGTCTCATCACTT	0.413													T|||	3	0.000599042	0.0	0.0	5008	,	,		22105	0.002		0.0	False		,,,				2504	0.001					.											4	Substitution - Missense(4)	lung(2)|endometrium(2)											91.0	88.0	89.0					19																	35232200		2203	4300	6503	SO:0001583	missense	339318			BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.914T>G	19.37:g.35232200T>G	ENSP00000420727:p.Val305Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	37	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	T	1.102	-0.660828	0.03454	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.38560	2.43;1.13;1.13	2.89	2.89	0.33648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16642	0.0400	N	0.10733	0.035	0.09310	N	0.999999	P;B	0.38978	0.652;0.0	B;B	0.30179	0.112;0.001	T	0.04017	-1.0984	9	0.22109	T	0.4	.	5.4169	0.16378	0.2509:0.0:0.0:0.749	.	304;305	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	G	349;304;305;304	ENSP00000376065:V349G;ENSP00000420727:V305G;ENSP00000419435:V304G	ENSP00000376065:V349G	V	+	2	0	ZNF181	39924040	0.000000	0.05858	0.880000	0.34516	0.765000	0.43378	-0.861000	0.04268	1.565000	0.49641	0.402000	0.26972	GTC		0.413	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
ZNF701	55762	broad.mit.edu;mdanderson.org	37	19	53086657	53086657	+	Nonsense_Mutation	SNP	C	C	T	rs370144367		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr19:53086657C>T	ENST00000540331.1	+	5	1768	c.1543C>T	c.(1543-1545)Cga>Tga	p.R515*	ZNF701_ENST00000301093.2_Nonsense_Mutation_p.R515*|ZNF701_ENST00000391785.3_Nonsense_Mutation_p.R449*|CTD-3099C6.7_ENST00000599222.1_RNA	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R449*(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		GGTTTTTAATCGAAAATCAAA	0.358													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22676	0.0		0.0	False		,,,				2504	0.0				NSCLC(89;451 1475 9611 20673 52284)	.											1	Substitution - Nonsense(1)	large_intestine(1)						C	stop/ARG,stop/ARG	0,4396		0,0,2198	41.0	41.0	41.0		1543,1345	0.6	0.0	19		41	1,8591	1.2+/-3.3	0,1,4295	no	stop-gained,stop-gained	ZNF701	NM_001172655.1,NM_018260.2	,	0,1,6493	TT,TC,CC		0.0116,0.0,0.0077	,	515/532,449/466	53086657	1,12987	2198	4296	6494	SO:0001587	stop_gained	55762			AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		ENST00000540331.1:c.1543C>T	19.37:g.53086657C>T	ENSP00000444339:p.Arg515*	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRM8|B9EGF2|F5GZM6|Q66K42	Nonsense_Mutation	SNP	ENST00000540331.1	37	CCDS54311.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500805	0.85176	0.0	1.16E-4	ENSG00000167562	ENST00000391785;ENST00000301093;ENST00000540331	.	.	.	1.81	0.618	0.17624	.	.	.	.	.	.	.	.	.	.	.	0.23834	N	0.996711	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	8.7109	0.34382	0.0:0.7615:0.2385:0.0	.	.	.	.	X	449;515;515	.	ENSP00000301093:R515X	R	+	1	2	ZNF701	57778469	.	.	0.000000	0.03702	0.027000	0.11550	.	.	0.072000	0.16694	0.306000	0.20318	CGA		0.358	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463467.1	NM_018260	
LILRA3	11026	broad.mit.edu	37	19	54803112	54803112	+	Missense_Mutation	SNP	G	G	A	rs568235562		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr19:54803112G>A	ENST00000251390.3	-	4	656	c.565C>T	c.(565-567)Cca>Tca	p.P189S	LILRA3_ENST00000391744.3_Intron|LILRA3_ENST00000391745.1_Missense_Mutation_p.P206S	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	189	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGCGACTTGGGCTCACGGGG	0.592																																						.											0													135.0	115.0	122.0					19																	54803112		2195	4164	6359	SO:0001583	missense	11026			U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.565C>T	19.37:g.54803112G>A	ENSP00000251390:p.Pro189Ser	Somatic		WXS	Illumina HiSeq	Phase_I	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	ENST00000251390.3	37	CCDS12887.1	.	.	.	.	.	.	.	.	.	.	G	6.760	0.509147	0.12883	.	.	ENSG00000170866	ENST00000251390;ENST00000391745	T;T	0.02863	4.13;4.13	1.96	-0.554	0.11811	Immunoglobulin-like fold (1);	0.692657	0.13156	N	0.409475	T	0.03651	0.0104	L	0.52573	1.65	0.09310	N	1	B	0.20780	0.048	B	0.30251	0.113	T	0.38373	-0.9664	10	0.52906	T	0.07	.	6.2264	0.20710	0.0:0.0:0.467:0.533	.	189	Q8N6C8	LIRA3_HUMAN	S	189;206	ENSP00000251390:P189S;ENSP00000375625:P206S	ENSP00000251390:P189S	P	-	1	0	LILRA3	59494924	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.571000	0.02138	-0.025000	0.13918	0.485000	0.47835	CCA		0.592	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1		
ARHGAP15	55843	broad.mit.edu	37	2	143959765	143959765	+	Silent	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr2:143959765A>G	ENST00000295095.6	+	3	395	c.228A>G	c.(226-228)gaA>gaG	p.E76E	ARHGAP15_ENST00000409869.1_Silent_p.E76E	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	76					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		CTCCATTGGAACAACTGGTGA	0.313																																						.											0													104.0	104.0	104.0					2																	143959765		2203	4300	6503	SO:0001819	synonymous_variant	55843			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.228A>G	2.37:g.143959765A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	37	CCDS2184.1																																																																																				0.313	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
OR6B3	150681	broad.mit.edu	37	2	240984793	240984793	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr2:240984793C>T	ENST00000319423.4	-	1	696	c.697G>A	c.(697-699)Ggc>Agc	p.G233S	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		CTCCAGCAGCCGGTGGCCGAG	0.577																																						.											0													46.0	53.0	51.0					2																	240984793		2098	4229	6327	SO:0001583	missense	150681				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.697G>A	2.37:g.240984793C>T	ENSP00000322435:p.Gly233Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	c	10.51	1.369882	0.24771	.	.	ENSG00000178586	ENST00000319423	T	0.00293	8.26	4.09	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000223	T	0.00468	0.0015	M	0.65498	2.005	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.48115	-0.9063	10	0.72032	D	0.01	.	6.6505	0.22959	0.0:0.6118:0.0:0.3882	.	233	Q8NGW1	OR6B3_HUMAN	S	233	ENSP00000322435:G233S	ENSP00000322435:G233S	G	-	1	0	OR6B3	240633466	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	0.167000	0.16602	0.284000	0.22305	-0.931000	0.02705	GGC		0.577	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
HPS4	89781	broad.mit.edu	37	22	26860415	26860415	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr22:26860415A>G	ENST00000398145.2	-	11	1797	c.1181T>C	c.(1180-1182)gTt>gCt	p.V394A	HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000336873.5_Missense_Mutation_p.V394A|HPS4_ENST00000398141.1_Missense_Mutation_p.V407A|HPS4_ENST00000402105.3_Missense_Mutation_p.V389A	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	394					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						GCCATCTGGAACAGGCACATG	0.552									Hermansky-Pudlak syndrome																													.											0													73.0	66.0	68.0					22																	26860415		2203	4300	6503	SO:0001583	missense	89781	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1181T>C	22.37:g.26860415A>G	ENSP00000381213:p.Val394Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	ENST00000398145.2	37	CCDS13835.1	.	.	.	.	.	.	.	.	.	.	A	0.060	-1.226539	0.01518	.	.	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873;ENST00000312736;ENST00000422379	T;T;T;T;T	0.52526	1.73;1.69;1.73;1.73;0.66	3.99	0.277	0.15668	.	0.653399	0.13948	N	0.351736	T	0.13243	0.0321	N	0.01410	-0.885	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001;0.001	T	0.25813	-1.0121	10	0.07482	T	0.82	-3.4244	2.9116	0.05739	0.361:0.2352:0.4038:0.0	.	394;394;394;394;407;389	Q6ICH6;Q6P1K3;Q9NQG7;A8K2E6;Q9NQG7-4;Q9NQG7-3	.;.;HPS4_HUMAN;.;.;.	A	394;407;389;394;412;412	ENSP00000381213:V394A;ENSP00000381210:V407A;ENSP00000384185:V389A;ENSP00000338457:V394A;ENSP00000415081:V412A	ENSP00000325840:V412A	V	-	2	0	HPS4	25190415	0.020000	0.18652	0.000000	0.03702	0.022000	0.10575	1.574000	0.36482	-0.090000	0.12462	0.533000	0.62120	GTT		0.552	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320778.1	NM_022081	
LAMB2	3913	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	49162828	49162828	+	Missense_Mutation	SNP	G	G	A	rs563405094		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:49162828G>A	ENST00000418109.1	-	20	2742	c.2578C>T	c.(2578-2580)Cgc>Tgc	p.R860C	LAMB2_ENST00000464891.1_5'UTR|LAMB2_ENST00000305544.4_Missense_Mutation_p.R860C	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	860	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGGTCACAGCGAAGCCCAAAG	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16151	0.0		0.0	False		,,,				2504	0.0					.											0													62.0	59.0	60.0					3																	49162828		2203	4300	6503	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2578C>T	3.37:g.49162828G>A	ENSP00000388325:p.Arg860Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170780	0.78452	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.63417	-0.04;-0.04	6.08	6.08	0.98989	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.166713	0.51477	D	0.000090	D	0.83492	0.5266	M	0.93106	3.38	0.58432	D	0.999999	D	0.89917	1.0	D	0.73380	0.98	D	0.86585	0.1856	10	0.87932	D	0	.	15.3887	0.74726	0.0:0.0:0.8608:0.1392	.	860	P55268	LAMB2_HUMAN	C	860	ENSP00000388325:R860C;ENSP00000307156:R860C	ENSP00000307156:R860C	R	-	1	0	LAMB2	49137832	0.738000	0.28186	1.000000	0.80357	0.991000	0.79684	3.900000	0.56295	2.894000	0.99253	0.655000	0.94253	CGC		0.607	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
CYB561D2	11068	broad.mit.edu;bcgsc.ca	37	3	50391044	50391044	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:50391044T>C	ENST00000418577.1	+	3	1114	c.538T>C	c.(538-540)Tca>Cca	p.S180P	NPRL2_ENST00000232501.3_5'Flank|CYB561D2_ENST00000232508.5_Missense_Mutation_p.S180P|CYB561D2_ENST00000425346.1_Missense_Mutation_p.S180P|CYB561D2_ENST00000424512.1_Missense_Mutation_p.S180P|XXcos-LUCA11.5_ENST00000606589.1_Intron			O14569	C56D2_HUMAN	cytochrome b561 family, member D2	180	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|lung(1)|urinary_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGGCATGTGCTCACTCTGGTT	0.582																																						.											0													143.0	135.0	138.0					3																	50391044		2203	4300	6503	SO:0001583	missense	11068			AF040704	CCDS2827.1	3p21.3	2013-03-14	2013-03-14		ENSG00000114395	ENSG00000114395		"""Cytochrome b genes"""	30253	protein-coding gene	gene with protein product	"""putative tumor suppressor 101F6"""	607068	"""cytochrome b-561 domain containing 2"""			9122200, 11085536, 23249217	Standard	XM_005264832		Approved	101F6, TSP10	uc003dal.3	O14569	OTTHUMG00000156813	ENST00000418577.1:c.538T>C	3.37:g.50391044T>C	ENSP00000391209:p.Ser180Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K552	Missense_Mutation	SNP	ENST00000418577.1	37	CCDS2827.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.691986	0.88735	.	.	ENSG00000114395	ENST00000425346;ENST00000424512;ENST00000232508;ENST00000418577	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.68	5.68	0.88126	Cytochrome b561, eukaryote (1);Cytochrome b561/ferric reductase transmembrane (1);	0.057497	0.64402	D	0.000001	T	0.72301	0.3443	M	0.85041	2.73	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.77117	-0.2706	10	0.66056	D	0.02	.	15.6089	0.76699	0.0:0.0:0.0:1.0	.	180	O14569	C56D2_HUMAN	P	180	ENSP00000400454:S180P;ENSP00000410663:S180P;ENSP00000232508:S180P;ENSP00000391209:S180P	ENSP00000232508:S180P	S	+	1	0	CYB561D2	50366048	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.179000	0.69175	0.459000	0.35465	TCA		0.582	CYB561D2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345973.1	NM_007022	
DNAH12	201625	broad.mit.edu	37	3	57438684	57438684	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:57438684delA	ENST00000351747.2	-	25	3783	c.3603delT	c.(3601-3603)aatfs	p.N1201fs		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1201	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GGGCATTCTCATTTTCCCAAT	0.368																																						.											0													83.0	83.0	83.0					3																	57438684		692	1591	2283	SO:0001589	frameshift_variant	201625			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.3603delT	3.37:g.57438684delA	ENSP00000295937:p.Asn1201fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Frame_Shift_Del	DEL	ENST00000351747.2	37																																																																																					0.368	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
TRPC1	7220	broad.mit.edu	37	3	142525034	142525034	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:142525034G>T	ENST00000476941.1	+	13	2825	c.2339G>T	c.(2338-2340)gGc>gTc	p.G780V	TRPC1_ENST00000273482.6_Missense_Mutation_p.G746V	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	780					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						GATTTACTTGGCTTTCGGACT	0.338																																						.											0													70.0	70.0	70.0					3																	142525034		2203	4300	6503	SO:0001583	missense	7220			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.2339G>T	3.37:g.142525034G>T	ENSP00000419313:p.Gly780Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CE4	Missense_Mutation	SNP	ENST00000476941.1	37	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339985	0.81911	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;T	0.79247	-0.93;-1.25	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.87341	0.6153	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.83275	0.996;0.899	D	0.87462	0.2408	10	0.62326	D	0.03	-19.8713	19.5907	0.95509	0.0:0.0:1.0:0.0	.	780;746	P48995;P48995-2	TRPC1_HUMAN;.	V	780;746	ENSP00000419313:G780V;ENSP00000273482:G746V	ENSP00000273482:G746V	G	+	2	0	TRPC1	144007724	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.455000	0.97625	2.642000	0.89623	0.563000	0.77884	GGC		0.338	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
HMX1	3166	broad.mit.edu	37	4	8869718	8869718	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr4:8869718delA	ENST00000400677.3	-	2	950	c.748delT	c.(748-750)tggfs	p.W250fs	HMX1_ENST00000506970.2_Intron	NM_018942.2	NP_061815.2	Q9NP08	HMX1_HUMAN	H6 family homeobox 1	250					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)										TTCTGGAACCAGATCTTAACC	0.701																																						.											0													6.0	9.0	8.0					4																	8869718		683	1576	2259	SO:0001589	frameshift_variant	3166			M99587	CCDS47018.1	4p16.1	2011-06-20	2007-07-09			ENSG00000215612		"""Homeoboxes / ANTP class : NKL subclass"""	5017	protein-coding gene	gene with protein product		142992	"""homeo box (H6 family) 1"""			1360670	Standard	NM_018942		Approved	H6, NKX5-3	uc003izz.1	Q9NP08		ENST00000400677.3:c.748delT	4.37:g.8869718delA	ENSP00000383516:p.Trp250fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000400677.3	37	CCDS47018.1																																																																																				0.701	HMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359147.14	NM_018942	
FNIP2	57600	broad.mit.edu;mdanderson.org	37	4	159780275	159780275	+	Silent	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr4:159780275G>A	ENST00000264433.6	+	9	999	c.924G>A	c.(922-924)agG>agA	p.R308R	FNIP2_ENST00000379346.3_Silent_p.R331R	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	308					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TGGTTAGGAGGAAGAAAATTG	0.398																																						.											0													79.0	78.0	78.0					4																	159780275		1845	4097	5942	SO:0001819	synonymous_variant	57600			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.924G>A	4.37:g.159780275G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q05DC3|Q96I31|Q9H994	Silent	SNP	ENST00000264433.6	37	CCDS47155.1																																																																																				0.398	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
PRDM9	56979	broad.mit.edu;mdanderson.org	37	5	23527628	23527628	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr5:23527628C>T	ENST00000296682.3	+	11	2613	c.2431C>T	c.(2431-2433)Cgg>Tgg	p.R811W		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	811					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGAGTGTGGGCGGGGCTTTAG	0.572										HNSCC(3;0.000094)																												.											0													40.0	50.0	46.0					5																	23527628		2149	4270	6419	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2431C>T	5.37:g.23527628C>T	ENSP00000296682:p.Arg811Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	3.066	-0.192235	0.06259	.	.	ENSG00000164256	ENST00000296682	T	0.19806	2.12	3.02	1.12	0.20585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20373	0.0490	M	0.72576	2.205	0.20975	N	0.999817	B	0.22800	0.075	B	0.18561	0.022	T	0.26710	-1.0095	9	0.46703	T	0.11	.	3.8662	0.09018	0.4206:0.4551:0.0:0.1244	.	811	Q9NQV7	PRDM9_HUMAN	W	811	ENSP00000296682:R811W	ENSP00000296682:R811W	R	+	1	2	PRDM9	23563385	0.002000	0.14202	0.775000	0.31657	0.007000	0.05969	1.748000	0.38308	0.307000	0.22880	-0.575000	0.04146	CGG		0.572	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
PCDHA8	56140	broad.mit.edu	37	5	140223107	140223107	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr5:140223107C>T	ENST00000531613.1	+	1	2201	c.2201C>T	c.(2200-2202)gCg>gTg	p.A734V	PCDHA8_ENST00000378123.3_Missense_Mutation_p.A734V|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	734					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTGCCGGGCGGGCAAGCCC	0.662																																						.											0													49.0	49.0	49.0					5																	140223107		2196	4266	6462	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2201C>T	5.37:g.140223107C>T	ENSP00000434655:p.Ala734Val	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	5.825	0.336386	0.11013	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.11712	2.75;2.75	3.06	3.06	0.35304	.	0.235442	0.21287	U	0.077055	T	0.08223	0.0205	N	0.22421	0.69	0.23346	N	0.997868	B;B	0.13145	0.002;0.007	B;B	0.08055	0.001;0.003	T	0.25641	-1.0126	10	0.42905	T	0.14	.	13.3249	0.60454	0.0:1.0:0.0:0.0	.	734;734	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	V	734	ENSP00000434655:A734V;ENSP00000367363:A734V	ENSP00000367363:A734V	A	+	2	0	PCDHA8	140203291	0.355000	0.24921	0.151000	0.22473	0.037000	0.13140	2.945000	0.49043	1.692000	0.51112	0.460000	0.39030	GCG		0.662	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
SLC25A2	83884	broad.mit.edu	37	5	140683388	140683388	+	Silent	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr5:140683388C>T	ENST00000239451.4	-	1	224	c.45G>A	c.(43-45)gcG>gcA	p.A15A		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	15					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	CTGCGGCCCCCGCTGTGAGGT	0.607																																						.											0													45.0	47.0	47.0					5																	140683388		2203	4300	6503	SO:0001819	synonymous_variant	83884			AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.45G>A	5.37:g.140683388C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q496C1|Q6XUI0|Q8NFZ2	Silent	SNP	ENST00000239451.4	37	CCDS4258.1																																																																																				0.607	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251799.2	NM_031947	
PCDH12	51294	broad.mit.edu;mdanderson.org	37	5	141335867	141335867	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr5:141335867A>G	ENST00000231484.3	-	1	2760	c.1550T>C	c.(1549-1551)gTc>gCc	p.V517A	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	517	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAGCAGTGACCTCTCCTGT	0.517																																						.											0													90.0	87.0	88.0					5																	141335867		2203	4300	6503	SO:0001583	missense	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1550T>C	5.37:g.141335867A>G	ENSP00000231484:p.Val517Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880823	0.72294	.	.	ENSG00000113555	ENST00000231484	T	0.67171	-0.25	5.16	5.16	0.70880	Cadherin (5);Cadherin-like (1);	0.194189	0.41823	D	0.000817	T	0.65995	0.2745	M	0.79123	2.44	0.45690	D	0.998607	P	0.43938	0.822	B	0.37550	0.253	T	0.73375	-0.4002	10	0.72032	D	0.01	.	12.9983	0.58660	1.0:0.0:0.0:0.0	.	517	Q9NPG4	PCD12_HUMAN	A	517	ENSP00000231484:V517A	ENSP00000231484:V517A	V	-	2	0	PCDH12	141316051	0.984000	0.35163	1.000000	0.80357	0.984000	0.73092	9.139000	0.94554	2.169000	0.68431	0.533000	0.62120	GTC		0.517	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
GRM1	2911	broad.mit.edu;ucsc.edu	37	6	146720023	146720023	+	Silent	SNP	G	G	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr6:146720023G>T	ENST00000282753.1	+	7	2083	c.1848G>T	c.(1846-1848)ctG>ctT	p.L616L	GRM1_ENST00000392299.2_Silent_p.L616L|GRM1_ENST00000355289.4_Silent_p.L616L|GRM1_ENST00000507907.1_Silent_p.L616L|GRM1_ENST00000361719.2_Silent_p.L616L|GRM1_ENST00000492807.2_Silent_p.L616L			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	616					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TCTTTGTACTGTACCGGGACA	0.483																																						.											0													264.0	221.0	236.0					6																	146720023		2203	4300	6503	SO:0001819	synonymous_variant	2911			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1848G>T	6.37:g.146720023G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	CCDS5209.1																																																																																				0.483	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
SFT2D1	113402	broad.mit.edu	37	6	166736357	166736357	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr6:166736357A>G	ENST00000361731.3	-	7	537	c.428T>C	c.(427-429)aTc>aCc	p.I143T	SFT2D1_ENST00000487841.1_5'UTR	NM_145169.1	NP_660152.1			SFT2 domain containing 1											NS(1)|central_nervous_system(1)|large_intestine(3)|upper_aerodigestive_tract(1)	6		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)		TGCATATGGGATGTACGACAG	0.318																																						.											0													130.0	124.0	126.0					6																	166736357		2203	4300	6503	SO:0001583	missense	113402			AF041429	CCDS5292.1	6q27	2008-02-05	2005-07-25	2005-07-25	ENSG00000198818	ENSG00000198818			21102	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 83"""	C6orf83			Standard	NM_145169		Approved	MGC19825, pRGR1	uc003qux.3	Q8WV19	OTTHUMG00000016001	ENST00000361731.3:c.428T>C	6.37:g.166736357A>G	ENSP00000354590:p.Ile143Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000361731.3	37	CCDS5292.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.623451	0.46840	.	.	ENSG00000198818	ENST00000361731	T	0.51071	0.72	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.57475	0.2056	H	0.97682	4.055	0.80722	D	1	B	0.31752	0.338	B	0.37015	0.239	T	0.70378	-0.4888	10	0.87932	D	0	-24.6251	12.8362	0.57775	1.0:0.0:0.0:0.0	.	143	Q8WV19	SFT2A_HUMAN	T	143	ENSP00000354590:I143T	ENSP00000354590:I143T	I	-	2	0	SFT2D1	166656347	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	5.854000	0.69503	1.964000	0.57103	0.443000	0.29094	ATC		0.318	SFT2D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043061.2	NM_145169	
CCT6P3	643180	broad.mit.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																						.											0																																												643180					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000426828.1	37																																																																																					0.388	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000344862.1		
PMPCB	9512	broad.mit.edu	37	7	102944340	102944340	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr7:102944340A>G	ENST00000249269.4	+	5	547	c.509A>G	c.(508-510)gAg>gGg	p.E170G	PMPCB_ENST00000428154.1_Missense_Mutation_p.E170G|PMPCB_ENST00000420236.2_Missense_Mutation_p.E65G	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	170					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGAGAAGCAGAGATTGAACGT	0.348																																						.											0													97.0	93.0	95.0					7																	102944340		2203	4300	6503	SO:0001583	missense	9512			AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.509A>G	7.37:g.102944340A>G	ENSP00000249269:p.Glu170Gly	Somatic		WXS	Illumina HiSeq	Phase_I	O60416|Q96FV4	Missense_Mutation	SNP	ENST00000249269.4	37	CCDS5730.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.571301	0.86542	.	.	ENSG00000105819	ENST00000249269;ENST00000428154;ENST00000420236	T;T;T	0.21191	2.02;2.02;2.02	5.2	5.2	0.72013	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.54415	0.1857	M	0.93328	3.405	0.80722	D	1	P;P;D;D;D;D;D	0.69078	0.613;0.952;0.986;0.986;0.986;0.986;0.997	P;P;P;P;P;P;P	0.62649	0.788;0.842;0.842;0.842;0.842;0.842;0.905	T	0.67669	-0.5611	10	0.59425	D	0.04	.	15.0883	0.72174	1.0:0.0:0.0:0.0	.	65;65;170;170;161;170;170	E7ERZ4;B4DM90;A8K1E9;B3KM34;Q96CP5;O75439;G3V0E4	.;.;.;.;.;MPPB_HUMAN;.	G	170;170;65	ENSP00000249269:E170G;ENSP00000390035:E170G;ENSP00000410393:E65G	ENSP00000249269:E170G	E	+	2	0	PMPCB	102731576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	1.959000	0.56917	0.528000	0.53228	GAG		0.348	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347913.1	NM_004279	
AOC1	26	broad.mit.edu;mdanderson.org	37	7	150555109	150555109	+	Silent	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr7:150555109C>T	ENST00000493429.1	+	4	2135	c.1551C>T	c.(1549-1551)cgC>cgT	p.R517R	AOC1_ENST00000467291.1_Silent_p.R517R|AOC1_ENST00000416793.2_Silent_p.R517R|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000360937.4_Silent_p.R517R			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	517					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	TGCACTACCGCGTAGACCTGG	0.567																																						.											0													53.0	59.0	57.0					7																	150555109		2162	4257	6419	SO:0001819	synonymous_variant	26			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1551C>T	7.37:g.150555109C>T		Somatic		WXS	Illumina HiSeq	Phase_I	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Silent	SNP	ENST00000493429.1	37	CCDS43679.1																																																																																				0.567	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091	
PABPC1	26986	broad.mit.edu	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I|PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																						.											2	Substitution - Missense(2)	kidney(1)|endometrium(1)											154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
ODF2	4957	broad.mit.edu	37	9	131245156	131245156	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr9:131245156A>G	ENST00000434106.3	+	10	1340	c.977A>G	c.(976-978)cAa>cGa	p.Q326R	ODF2_ENST00000535026.1_3'UTR|ODF2_ENST00000393527.3_Missense_Mutation_p.Q302R|ODF2_ENST00000546203.1_Missense_Mutation_p.Q307R|ODF2_ENST00000448249.3_Missense_Mutation_p.Q245R|ODF2_ENST00000372807.5_Missense_Mutation_p.Q321R|ODF2_ENST00000604420.1_Missense_Mutation_p.Q326R|ODF2_ENST00000372791.3_Missense_Mutation_p.Q307R|ODF2_ENST00000351030.3_Missense_Mutation_p.Q321R|ODF2_ENST00000372814.3_Missense_Mutation_p.Q370R|ODF2_ENST00000393533.2_Missense_Mutation_p.Q326R|ODF2_ENST00000444119.2_Missense_Mutation_p.Q302R	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	326					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						CAGGAAATACAATGTGAGAAG	0.522																																						.											0													77.0	80.0	79.0					9																	131245156		2203	4300	6503	SO:0001583	missense	4957			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.977A>G	9.37:g.131245156A>G	ENSP00000403453:p.Gln326Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.043499	0.55003	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.87;1.01;1.01;1.01	5.66	5.66	0.87406	.	0.455332	0.26750	N	0.022693	T	0.39627	0.1085	L	0.46157	1.445	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.19706	0.038;0.003;0.038;0.003;0.035;0.035;0.003;0.038;0.012;0.006	B;B;B;B;B;B;B;B;B;B	0.19391	0.008;0.013;0.014;0.01;0.008;0.013;0.013;0.008;0.025;0.013	T	0.19614	-1.0300	10	0.51188	T	0.08	-16.8018	14.703	0.69168	1.0:0.0:0.0:0.0	.	307;321;245;260;326;370;321;307;326;302	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	R	326;370;321;326;302;245;307;307	ENSP00000377166:Q326R;ENSP00000361901:Q370R;ENSP00000342581:Q321R;ENSP00000361882:Q326R;ENSP00000307781:Q302R;ENSP00000396687:Q245R;ENSP00000437579:Q307R;ENSP00000361877:Q307R	ENSP00000307781:Q302R	Q	+	2	0	ODF2	130284977	0.998000	0.40836	0.964000	0.40570	0.995000	0.86356	6.107000	0.71517	2.153000	0.67306	0.459000	0.35465	CAA		0.522	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
NUP188	23511	broad.mit.edu	37	9	131750367	131750367	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr9:131750367A>G	ENST00000372577.2	+	24	2456	c.2435A>G	c.(2434-2436)aAg>aGg	p.K812R		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	812					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CTGCTGATCAAGACAGTGAAA	0.502																																						.											0													187.0	169.0	175.0					9																	131750367		2203	4300	6503	SO:0001583	missense	23511			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2435A>G	9.37:g.131750367A>G	ENSP00000361658:p.Lys812Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.732046	0.48939	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.64991	-0.13	5.87	5.87	0.94306	.	0.046254	0.85682	D	0.000000	T	0.46229	0.1382	N	0.08118	0	0.42132	D	0.991474	B;B	0.31125	0.02;0.309	B;B	0.35182	0.035;0.197	T	0.48375	-0.9041	10	0.32370	T	0.25	-4.2014	15.7569	0.78037	1.0:0.0:0.0:0.0	.	145;812	E9PET9;Q5SRE5	.;NU188_HUMAN	R	701;812	ENSP00000361658:K812R	ENSP00000349125:K701R	K	+	2	0	NUP188	130790188	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.901000	0.75693	2.371000	0.80710	0.533000	0.62120	AAG		0.502	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
B3GALT5	10317	ucsc.edu	37	21	41033240	41033240	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr21:41033240A>G	ENST00000380620.4	+	5	1346	c.754A>G	c.(754-756)Agg>Ggg	p.R252G	B3GALT5_ENST00000398714.2_Missense_Mutation_p.R252G|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000343118.4_Missense_Mutation_p.R252G|B3GALT5_ENST00000380618.1_Missense_Mutation_p.R252G			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	252					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				CTGCCTCGAAAGGCTGAACAT	0.547																																						.											0													94.0	93.0	94.0					21																	41033240		2203	4300	6503	SO:0001583	missense	10317			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.754A>G	21.37:g.41033240A>G	ENSP00000369994:p.Arg252Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	ENST00000380620.4	37	CCDS13667.1	.	.	.	.	.	.	.	.	.	.	A	9.108	1.005925	0.19199	.	.	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.64	3.23	0.37069	.	0.697068	0.13081	N	0.415340	D	0.82481	0.5046	L	0.57536	1.79	0.09310	N	1	P	0.35124	0.485	B	0.33295	0.161	T	0.74948	-0.3490	10	0.72032	D	0.01	.	5.8292	0.18570	0.6958:0.1628:0.1414:0.0	.	252	Q9Y2C3	B3GT5_HUMAN	G	252	ENSP00000369994:R252G;ENSP00000369992:R252G;ENSP00000343318:R252G;ENSP00000381699:R252G	ENSP00000343318:R252G	R	+	1	2	B3GALT5	39955110	0.997000	0.39634	0.001000	0.08648	0.034000	0.12701	3.644000	0.54381	0.926000	0.37118	0.533000	0.62120	AGG		0.547	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195008.2	NM_033170	
CUL2	8453	ucsc.edu;bcgsc.ca	37	10	35333504	35333504	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr10:35333504T>C	ENST00000374748.1	-	9	1017	c.704A>G	c.(703-705)tAt>tGt	p.Y235C	CUL2_ENST00000602371.1_Missense_Mutation_p.Y178C|CUL2_ENST00000374742.1_Missense_Mutation_p.Y235C|CUL2_ENST00000374751.3_Missense_Mutation_p.Y235C|CUL2_ENST00000374749.3_Missense_Mutation_p.Y235C|CUL2_ENST00000537177.1_Missense_Mutation_p.Y254C|CUL2_ENST00000374746.1_Missense_Mutation_p.Y235C			Q13617	CUL2_HUMAN	cullin 2	235					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						CTTTTCCATATACTGTGAGCA	0.299																																						.											0													61.0	66.0	64.0					10																	35333504		2201	4287	6488	SO:0001583	missense	8453			U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.704A>G	10.37:g.35333504T>C	ENSP00000363880:p.Tyr235Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388686	0.82902	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177	T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1	5.88	5.88	0.94601	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	M	0.88979	2.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84297	0.0503	10	0.87932	D	0	-14.4811	16.2961	0.82769	0.0:0.0:0.0:1.0	.	235;254;235	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	C	235;235;235;235;178;235;254	ENSP00000363883:Y235C;ENSP00000363880:Y235C;ENSP00000363878:Y235C;ENSP00000363881:Y235C;ENSP00000363874:Y235C;ENSP00000444856:Y254C	ENSP00000363874:Y235C	Y	-	2	0	CUL2	35373510	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.250000	0.74265	0.454000	0.30748	TAT		0.299	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
DLX3	1747	ucsc.edu	37	17	48072253	48072253	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:48072253A>G	ENST00000434704.2	-	1	335	c.110T>C	c.(109-111)gTc>gCc	p.V37A	RP11-1094H24.3_ENST00000511867.1_lincRNA|DLX3_ENST00000512495.2_5'Flank	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	37					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CAGGTCAGTGACAGAAGACTC	0.592																																						.											0													95.0	92.0	93.0					17																	48072253		2203	4300	6503	SO:0001583	missense	1747				CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.110T>C	17.37:g.48072253A>G	ENSP00000389870:p.Val37Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQL6	Missense_Mutation	SNP	ENST00000434704.2	37	CCDS11556.1	.	.	.	.	.	.	.	.	.	.	A	4.173	0.030746	0.08101	.	.	ENSG00000064195	ENST00000434704	D	0.89123	-2.47	5.01	5.01	0.66863	.	0.075441	0.53938	D	0.000058	T	0.66257	0.2771	N	0.01522	-0.82	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.64935	-0.6290	10	0.02654	T	1	-31.6637	7.3354	0.26607	0.9044:0.0:0.0956:0.0	.	37	O60479	DLX3_HUMAN	A	37	ENSP00000389870:V37A	ENSP00000389870:V37A	V	-	2	0	DLX3	45427252	0.999000	0.42202	0.995000	0.50966	0.996000	0.88848	1.415000	0.34748	2.115000	0.64714	0.402000	0.26972	GTC		0.592	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366307.1		
HECTD4	283450	ucsc.edu	37	12	112607414	112607414	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:112607414T>C	ENST00000430131.2	-	69	11980	c.10835A>G	c.(10834-10836)cAg>cGg	p.Q3612R	HECTD4_ENST00000550722.1_Missense_Mutation_p.Q3888R|HECTD4_ENST00000377560.5_Missense_Mutation_p.Q3862R			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3612					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGAGGCCAGCTGCCTGGCAGC	0.597																																						.											0													46.0	52.0	50.0					12																	112607414		2047	4188	6235	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10835A>G	12.37:g.112607414T>C	ENSP00000404379:p.Gln3612Arg	Somatic		WXS	Illumina HiSeq	Phase_I	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	T	27.5	4.835640	0.91117	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.50813	0.73;0.73;0.73	5.88	5.88	0.94601	.	.	.	.	.	T	0.52677	0.1749	N	0.19112	0.55	0.53005	D	0.999965	P	0.45126	0.851	P	0.58391	0.838	T	0.57585	-0.7786	9	0.72032	D	0.01	.	16.2794	0.82664	0.0:0.0:0.0:1.0	.	3612	Q9Y4D8	K0614_HUMAN	R	3862;3612;3888;77	ENSP00000366783:Q3862R;ENSP00000404379:Q3612R;ENSP00000449784:Q3888R	ENSP00000366783:Q3862R	Q	-	2	0	C12orf51	111091797	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.509000	0.81698	2.251000	0.74343	0.482000	0.46254	CAG		0.597	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
LRRC37A	9884	ucsc.edu	37	17	44408776	44408776	+	Missense_Mutation	SNP	T	T	C	rs273532		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:44408776T>C	ENST00000320254.5	+	9	4136	c.4133T>C	c.(4132-4134)cTt>cCt	p.L1378P	ARL17B_ENST00000575960.1_Intron|LRRC37A_ENST00000393465.3_Missense_Mutation_p.L1378P|ARL17B_ENST00000570618.1_Intron|LRRC37A_ENST00000496930.1_Missense_Mutation_p.L416P|ARL17B_ENST00000575698.1_Intron|ARL17B_ENST00000434041.2_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1378						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GTATCTGCTCTTTCAGAACAT	0.388																																						.											0													23.0	18.0	20.0					17																	44408776		1771	1871	3642	SO:0001583	missense	9884			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.4133T>C	17.37:g.44408776T>C	ENSP00000326324:p.Leu1378Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DY2|Q8IWC7	Missense_Mutation	SNP	ENST00000320254.5	37	CCDS11504.2	63	0.028846153846153848	2	0.0040650406504065045	19	0.052486187845303865	5	0.008741258741258742	37	0.048812664907651716	c	4.196	0.035078	0.08101	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.56103	1.64;0.5;0.48	2.1	-2.82	0.05787	.	.	.	.	.	T	0.02156	0.0067	N	0.00648	-1.295	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12863	-1.0531	9	0.05721	T	0.95	.	7.6392	0.28284	0.0:0.341:0.0:0.659	.	416;1378	E9PP10;A6NMS7	.;L37A1_HUMAN	P	416;1378;1378;1378	ENSP00000437021:L416P;ENSP00000377108:L1378P;ENSP00000326324:L1378P	ENSP00000326324:L1378P	L	+	2	0	LRRC37A	41764537	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-2.004000	0.01461	-1.201000	0.02659	-0.495000	0.04643	CTT		0.388	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313519.3	NM_014834	
PGR	5241	ucsc.edu	37	11	100999187	100999187	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:100999187C>T	ENST00000325455.5	-	1	2068	c.615G>A	c.(613-615)tgG>tgA	p.W205*	PGR_ENST00000263463.5_Nonsense_Mutation_p.W205*|PGR_ENST00000534013.1_Intron	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	205	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.W205C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	GGGCCCCGGACCAGTGAGGGC	0.687																																					Pancreas(124;2271 2354 21954 22882)	.											1	Substitution - Missense(1)	lung(1)											7.0	9.0	9.0					11																	100999187		2081	4166	6247	SO:0001587	stop_gained	5241			M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.615G>A	11.37:g.100999187C>T	ENSP00000325120:p.Trp205*	Somatic		WXS	Illumina HiSeq	Phase_I	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Nonsense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	c	16.97	3.267528	0.59540	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	.	.	.	4.44	3.53	0.40419	.	0.717914	0.12600	N	0.454809	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4107	0.21690	0.0:0.7115:0.1883:0.1003	.	.	.	.	X	205	.	ENSP00000263463:W205X	W	-	3	0	PGR	100504397	0.714000	0.27936	0.601000	0.28877	0.101000	0.19017	1.009000	0.29886	0.864000	0.35578	-0.217000	0.12591	TGG		0.687	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
PLEKHG5	57449	ucsc.edu	37	1	6531590	6531590	+	Silent	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:6531590T>C	ENST00000400915.3	-	13	1473	c.1407A>G	c.(1405-1407)cgA>cgG	p.R469R	PLEKHG5_ENST00000535355.1_Silent_p.R482R|PLEKHG5_ENST00000544978.1_Silent_p.R413R|PLEKHG5_ENST00000377732.1_Silent_p.R450R|PLEKHG5_ENST00000377725.1_Silent_p.R413R|PLEKHG5_ENST00000377748.1_Silent_p.R490R|PLEKHG5_ENST00000400913.1_Silent_p.R413R|PLEKHG5_ENST00000377728.3_Silent_p.R413R|PLEKHG5_ENST00000340850.5_Silent_p.R413R|PLEKHG5_ENST00000377737.2_Silent_p.R413R|PLEKHG5_ENST00000377740.3_Silent_p.R490R|PLEKHG5_ENST00000537245.1_Silent_p.R492R	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	469	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GTAGCAGCGCTCGCGTGCGCC	0.706																																						.											0													13.0	17.0	15.0					1																	6531590		2198	4283	6481	SO:0001819	synonymous_variant	57449			AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.1407A>G	1.37:g.6531590T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	ENST00000400915.3	37	CCDS41241.1																																																																																				0.706	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
RNF43	54894	ucsc.edu	37	17	56439960	56439960	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:56439960A>G	ENST00000584437.1	-	5	2587	c.632T>C	c.(631-633)gTg>gCg	p.V211A	RNF43_ENST00000407977.2_Missense_Mutation_p.V211A|RNF43_ENST00000500597.2_Missense_Mutation_p.V170A|RNF43_ENST00000577625.1_Missense_Mutation_p.V84A|RNF43_ENST00000577716.1_Missense_Mutation_p.V211A|RNF43_ENST00000581868.1_Missense_Mutation_p.V84A|RNF43_ENST00000583753.1_Missense_Mutation_p.V170A|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	211					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGGATGATCACAAAGATGGT	0.602																																						.											0													105.0	88.0	94.0					17																	56439960		2203	4300	6503	SO:0001583	missense	54894				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.632T>C	17.37:g.56439960A>G	ENSP00000463069:p.Val211Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.643799	0.87859	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.10382	3.01;2.88	5.43	5.43	0.79202	.	0.274603	0.36303	N	0.002671	T	0.15739	0.0379	N	0.24115	0.695	0.36538	D	0.871114	P;D;P	0.58970	0.952;0.984;0.951	P;P;P	0.55871	0.713;0.786;0.622	T	0.13602	-1.0503	10	0.40728	T	0.16	-15.9882	14.6434	0.68742	1.0:0.0:0.0:0.0	.	170;211;211	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	A	211;170	ENSP00000385328:V211A;ENSP00000441969:V170A	ENSP00000385328:V211A	V	-	2	0	RNF43	53794959	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.542000	0.67218	2.058000	0.61347	0.402000	0.26972	GTG		0.602	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
SFPQ	6421	ucsc.edu;bcgsc.ca	37	1	35658491	35658491	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:35658491T>C	ENST00000357214.5	-	1	258	c.160A>G	c.(160-162)Agc>Ggc	p.S54G		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	54	Gln/Glu/Pro-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				TTAGGGCCGCTCTGGCCCGGG	0.731			T	TFE3	papillary renal cell																																	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	0													11.0	13.0	12.0					1																	35658491		1964	3988	5952	SO:0001583	missense	6421			X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.160A>G	1.37:g.35658491T>C	ENSP00000349748:p.Ser54Gly	Somatic		WXS	Illumina HiSeq	Phase_I	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	37	CCDS388.1	.	.	.	.	.	.	.	.	.	.	T	5.418	0.262247	0.10239	.	.	ENSG00000116560	ENST00000357214	T	0.24350	1.86	2.69	0.382	0.16234	.	2.256580	0.01555	N	0.019877	T	0.13628	0.0330	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17745	-1.0359	10	0.22706	T	0.39	.	5.7667	0.18231	0.0:0.6264:0.0:0.3736	.	54	P23246	SFPQ_HUMAN	G	54	ENSP00000349748:S54G	ENSP00000349748:S54G	S	-	1	0	SFPQ	35431078	0.004000	0.15560	0.884000	0.34674	0.067000	0.16453	0.060000	0.14342	0.317000	0.23160	-0.425000	0.05940	AGC		0.731	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
SYNGAP1	8831	ucsc.edu	37	6	33400504	33400504	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr6:33400504A>G	ENST00000418600.2	+	5	531	c.430A>G	c.(430-432)Acg>Gcg	p.T144A	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.T85A|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.T144A|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	144					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CATCAAACGAACGAAGTCACA	0.582																																						.											0													75.0	64.0	67.0					6																	33400504		2203	4300	6503	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.430A>G	6.37:g.33400504A>G	ENSP00000403636:p.Thr144Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	A	12.86	2.065748	0.36470	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.19938	2.11;2.21;2.3	4.36	4.36	0.52297	Pleckstrin homology domain (1);	0.117466	0.64402	N	0.000019	T	0.07324	0.0185	N	0.26130	0.795	0.44976	D	0.997994	B;B;B	0.14438	0.0;0.0;0.01	B;B;B	0.15870	0.001;0.001;0.014	T	0.06899	-1.0801	10	0.51188	T	0.08	.	11.5483	0.50706	1.0:0.0:0.0:0.0	.	144;144;144	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	A	144;144;144;85	ENSP00000293748:T144A;ENSP00000403636:T144A;ENSP00000412475:T85A	ENSP00000293748:T144A	T	+	1	0	SYNGAP1	33508482	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	5.143000	0.64826	1.840000	0.53500	0.383000	0.25322	ACG		0.582	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
TP63	8626	ucsc.edu;mdanderson.org;bcgsc.ca	37	3	189455532	189455532	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:189455532C>A	ENST00000264731.3	+	2	155	c.66C>A	c.(64-66)ttC>ttA	p.F22L	TP63_ENST00000392460.3_Missense_Mutation_p.F22L|TP63_ENST00000382063.4_Missense_Mutation_p.F22L|TP63_ENST00000418709.2_Missense_Mutation_p.F22L|TP63_ENST00000320472.5_Missense_Mutation_p.F22L|TP63_ENST00000440651.2_Missense_Mutation_p.F22L	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	22	Transcription activation.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TTTTAAGTTTCGTAGAAACCC	0.348										HNSCC(45;0.13)																												.											0													70.0	74.0	73.0					3																	189455532		2203	4300	6503	SO:0001583	missense	8626			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.66C>A	3.37:g.189455532C>A	ENSP00000264731:p.Phe22Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.133012	0.56828	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063	D;D;D;D;D;D	0.99557	-5.8;-6.11;-6.04;-6.03;-5.8;-6.16	5.67	-5.27	0.02763	.	0.063913	0.64402	D	0.000005	D	0.96423	0.8833	N	0.08118	0	0.80722	D	1	B;B;B;B	0.21147	0.052;0.018;0.031;0.018	B;B;B;B	0.16722	0.016;0.016;0.005;0.016	T	0.82851	-0.0253	9	.	.	.	-5.9382	16.2055	0.82126	0.0:0.1538:0.0:0.8462	.	22;22;22;22	Q9H3D4-7;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;P63_HUMAN;.	L	22	ENSP00000264731:F22L;ENSP00000407144:F22L;ENSP00000317510:F22L;ENSP00000376253:F22L;ENSP00000394337:F22L;ENSP00000371495:F22L	.	F	+	3	2	TP63	190938226	0.013000	0.17824	0.793000	0.32043	0.991000	0.79684	-1.643000	0.02004	-1.002000	0.03429	0.650000	0.86243	TTC		0.348	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
ULK2	9706	ucsc.edu	37	17	19705212	19705212	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:19705212T>C	ENST00000395544.4	-	16	1818	c.1319A>G	c.(1318-1320)aAc>aGc	p.N440S	ULK2_ENST00000580130.1_5'UTR|ULK2_ENST00000361658.2_Missense_Mutation_p.N440S	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	440					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					GGGGCTGGTGTTGGACCTTCG	0.483																																						.											0													163.0	166.0	165.0					17																	19705212		2203	4300	6503	SO:0001583	missense	9706			AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1319A>G	17.37:g.19705212T>C	ENSP00000378914:p.Asn440Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	T	9.279	1.047567	0.19827	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.44083	0.93;0.93	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.35158	0.0922	N	0.02916	-0.46	0.49915	D	0.999834	D	0.69078	0.997	D	0.70716	0.97	T	0.31888	-0.9927	10	0.02654	T	1	-23.0341	15.7258	0.77756	0.0:0.0:0.0:1.0	.	440	Q8IYT8	ULK2_HUMAN	S	440	ENSP00000354877:N440S;ENSP00000378914:N440S	ENSP00000354877:N440S	N	-	2	0	ULK2	19645804	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.465000	0.80898	2.311000	0.77944	0.533000	0.62120	AAC		0.483	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
AHNAK2	113146	mdanderson.org	37	14	105416223	105416223	+	Silent	SNP	G	G	A	rs141406015	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr14:105416223G>A	ENST00000333244.5	-	7	5684	c.5565C>T	c.(5563-5565)gcC>gcT	p.A1855A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1855						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCTCACTTCGGCCTCCACCT	0.617													.|||	198	0.0395367	0.0983	0.0101	5008	,	,		17388	0.0089		0.003	False		,,,				2504	0.0501					.											0													134.0	170.0	158.0					14																	105416223		1938	4106	6044	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5565C>T	14.37:g.105416223G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
CNTNAP3	79937	mdanderson.org	37	9	39103743	39103743	+	Missense_Mutation	SNP	C	C	T	rs7852039	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr9:39103743C>T	ENST00000297668.6	-	16	2607	c.2534G>A	c.(2533-2535)cGt>cAt	p.R845H	CNTNAP3_ENST00000377656.2_Missense_Mutation_p.R844H|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.R757H	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	845	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.		R -> H (in dbSNP:rs7852039). {ECO:0000269|PubMed:11214970}.		cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GAGCTTACCACGCAGCTCAAT	0.418													C|||	934	0.186502	0.062	0.1354	5008	,	,		15532	0.3036		0.2376	False		,,,				2504	0.2178					.											0								C	HIS/ARG	392,4014	190.5+/-216.4	24,344,1835	39.0	43.0	42.0		2534	-1.3	0.0	9	dbSNP_116	42	1860,6740	331.0+/-319.4	208,1444,2648	yes	missense	CNTNAP3	NM_033655.3	29	232,1788,4483	TT,TC,CC		21.6279,8.897,17.3151	benign	845/1289	39103743	2252,10754	2203	4300	6503	SO:0001583	missense	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2534G>A	9.37:g.39103743C>T	ENSP00000297668:p.Arg845His	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMA0|Q9C0E9	Missense_Mutation	SNP	ENST00000297668.6	37	CCDS6616.1	439	0.20100732600732601	26	0.052845528455284556	58	0.16022099447513813	164	0.2867132867132867	191	0.2519788918205805	C	11.25	1.582659	0.28180	0.08897	0.216279	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144	T;T;T	0.42513	0.97;0.97;0.97	3.23	-1.29	0.09288	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.00012	0.0000	L	0.42487	1.325	0.50813	P	1.0299999999996423E-4	B;B;B	0.27286	0.174;0.076;0.032	B;B;B	0.30179	0.048;0.112;0.032	T	0.37596	-0.9699	8	0.16896	T	0.51	.	3.4899	0.07634	0.195:0.2478:0.0:0.5572	rs7852039;rs7852039	845;844;845	Q9BZ76-2;A6NC89;Q9BZ76	.;.;CNTP3_HUMAN	H	845;844;757	ENSP00000297668:R845H;ENSP00000366884:R844H;ENSP00000350863:R757H	ENSP00000297668:R845H	R	-	2	0	CNTNAP3	39093743	0.000000	0.05858	0.008000	0.14137	0.241000	0.25554	-0.236000	0.09003	-0.130000	0.11599	0.485000	0.47835	CGT		0.418	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
DCBLD2	131566	mdanderson.org	37	3	98620083	98620083	+	Missense_Mutation	SNP	G	G	C	rs190637453	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:98620083G>C	ENST00000326840.6	-	1	450	c.88C>G	c.(88-90)Ctc>Gtc	p.L30V	DCBLD2_ENST00000326857.9_Missense_Mutation_p.L30V|DCBLD2_ENST00000469648.1_5'Flank|CTD-2021J15.1_ENST00000474798.1_RNA	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	30					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						gagagggggagcgcggcccag	0.731													G|||	24	0.00479233	0.0	0.0101	5008	,	,		10431	0.0		0.0139	False		,,,				2504	0.0031					.											0								G	VAL/LEU	8,3348		0,8,1670	8.0	9.0	9.0		88	0.5	1.0	3		9	71,7025		0,71,3477	no	missense	DCBLD2	NM_080927.3	32	0,79,5147	CC,CG,GG		1.0006,0.2384,0.7558	possibly-damaging	30/776	98620083	79,10373	1678	3548	5226	SO:0001583	missense	131566				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.88C>G	3.37:g.98620083G>C	ENSP00000321573:p.Leu30Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	ENST00000326840.6	37	CCDS46878.1	18	0.008241758241758242	0	0.0	6	0.016574585635359115	0	0.0	12	0.0158311345646438	G	10.06	1.247539	0.22880	0.002384	0.010006	ENSG00000057019	ENST00000326840;ENST00000326857	D;D	0.91124	-2.78;-2.79	2.37	0.476	0.16779	.	1.549460	0.04531	N	0.386306	T	0.70413	0.3221	N	0.14661	0.345	0.22280	N	0.999231	B;B	0.17465	0.022;0.013	B;B	0.12837	0.008;0.003	T	0.65459	-0.6163	10	0.44086	T	0.13	-0.8532	4.8872	0.13708	0.3129:0.0:0.6871:0.0	.	30;30	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	V	30	ENSP00000321573:L30V;ENSP00000321646:L30V	ENSP00000321573:L30V	L	-	1	0	DCBLD2	100102773	0.959000	0.32827	0.967000	0.41034	0.231000	0.25187	0.336000	0.19823	0.128000	0.18479	0.121000	0.15741	CTC		0.731	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927	
DDX12P	440081	mdanderson.org	37	12	9583283	9583283	+	IGR	SNP	C	C	T	rs2429896		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:9583283C>T								RP13-735L24.1 (33070 upstream) : SNORA75 (14370 downstream)																							GCCGGATGCCCGCAGCCTGCC	0.672																																						.											0													11.0	13.0	12.0					12																	9583283		679	1582	2261	SO:0001628	intergenic_variant	440081																															12.37:g.9583283C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.672								
DEFA3	1668	mdanderson.org	37	8	6873603	6873603	+	Missense_Mutation	SNP	T	T	G	rs145076681		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr8:6873603T>G	ENST00000327857.2	-	3	285	c.194A>C	c.(193-195)gAc>gCc	p.D65A	DEFA1B_ENST00000535841.1_Intron	NM_005217.3	NP_005208.1	P59666	DEF3_HUMAN	defensin, alpha 3, neutrophil-specific	65					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular estrogen receptor signaling pathway (GO:0030520)|killing of cells of other organism (GO:0031640)	azurophil granule lumen (GO:0035578)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.D65A(1)		endometrium(1)|prostate(2)	3				COAD - Colon adenocarcinoma(149;0.0561)|READ - Rectum adenocarcinoma(644;0.118)		GCAATAGCAGTCCATGTTTTT	0.498																																						.											1	Substitution - Missense(1)	prostate(1)											156.0	118.0	130.0					8																	6873603		1957	4128	6085	SO:0001583	missense	1668			M23281	CCDS5962.1	8p23.1	2009-08-05			ENSG00000239839	ENSG00000239839		"""Defensins, alpha"""	2762	protein-coding gene	gene with protein product		604522		DEF3		8477861, 17214878, 15944200	Standard	NM_005217		Approved	HNP-3		P59666	OTTHUMG00000090381	ENST00000327857.2:c.194A>C	8.37:g.6873603T>G	ENSP00000328359:p.Asp65Ala	Somatic		WXS	Illumina HiSeq	Phase_I	P11479|Q14125	Missense_Mutation	SNP	ENST00000327857.2	37	CCDS5962.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.042516	0.00402	.	.	ENSG00000239839	ENST00000327857	T	0.41400	1.0	1.01	-2.03	0.07365	.	.	.	.	.	T	0.15046	0.0363	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.24154	-1.0168	7	0.08179	T	0.78	.	0.1742	0.00116	0.3008:0.2168:0.2655:0.217	.	65	P59666	DEF3_HUMAN	A	65	ENSP00000328359:D65A	ENSP00000328359:D65A	D	-	2	0	DEFA3	6861013	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	-0.189000	0.09629	-1.937000	0.01047	-0.806000	0.03193	GAC		0.498	DEFA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206753.2	NM_005217	
EXOC3L4	91828	mdanderson.org	37	14	103568981	103568981	+	Silent	SNP	A	A	C	rs77071436	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr14:103568981A>C	ENST00000380069.3	+	2	997	c.921A>C	c.(919-921)ccA>ccC	p.P307P		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	307					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CCGGCTTCCCAGCGTGGGAGG	0.706													A|||	1073	0.214257	0.1006	0.1931	5008	,	,		11366	0.2579		0.2396	False		,,,				2504	0.3119					.											0								A		378,3714		22,334,1690	6.0	9.0	8.0		921	-8.7	0.0	14	dbSNP_131	8	1547,6535		144,1259,2638	no	coding-synonymous	EXOC3L4	NM_001077594.1		166,1593,4328	CC,CA,AA		19.1413,9.2375,15.8124		307/723	103568981	1925,10249	2046	4041	6087	SO:0001819	synonymous_variant	91828			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.921A>C	14.37:g.103568981A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																				0.706	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
FRG1B	284802	mdanderson.org	37	20	29625947	29625947	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr20:29625947T>C	ENST00000278882.3	+	5	571	c.191T>C	c.(190-192)aTt>aCt	p.I64T	FRG1B_ENST00000358464.4_Missense_Mutation_p.I64T|FRG1B_ENST00000439954.2_Missense_Mutation_p.I69T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	64								p.I64T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCAGATGCAATTGGACCAAGA	0.343																																						.											4	Substitution - Missense(4)	urinary_tract(2)|prostate(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.191T>C	20.37:g.29625947T>C	ENSP00000278882:p.Ile64Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	11.16	1.557441	0.27827	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.53640	0.61	1.68	1.68	0.24146	.	0.048324	0.85682	N	0.000000	T	0.39279	0.1072	.	.	.	0.50313	D	0.999869	B	0.11235	0.004	B	0.30943	0.122	T	0.37549	-0.9701	9	0.62326	D	0.03	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	69	F5H5R5	.	T	64;69;64	ENSP00000408863:I69T	ENSP00000278882:I64T	I	+	2	0	FRG1B	28239608	1.000000	0.71417	0.998000	0.56505	0.053000	0.15095	6.623000	0.74238	1.028000	0.39785	0.155000	0.16302	ATT		0.343	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1	2483	mdanderson.org	37	4	190878658	190878658	+	Splice_Site	SNP	G	G	A	rs76810924		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr4:190878658G>A	ENST00000226798.4	+	6	759		c.e6+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AATGATCAAGGTAATGATGAC	0.348																																						.											0													47.0	43.0	44.0					4																	190878658		2169	4247	6416	SO:0001630	splice_region_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.537+1G>A	4.37:g.190878658G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	15.05	2.718286	0.48622	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115652	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	9.554000	0.98121	1.860000	0.53959	0.454000	0.30748	.		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
FRG1	2483	mdanderson.org	37	4	190883004	190883004	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr4:190883004C>A	ENST00000226798.4	+	8	879	c.657C>A	c.(655-657)caC>caA	p.H219Q		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	219					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TCCAAGACCACAAACTTAAAA	0.289																																						.											0													66.0	82.0	77.0					4																	190883004		2129	4195	6324	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.657C>A	4.37:g.190883004C>A	ENSP00000226798:p.His219Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	9.796	1.179300	0.21787	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	T	0.28255	1.62	3.89	2.08	0.27032	.	0.353012	0.32884	N	0.005540	T	0.22781	0.0550	L	0.50333	1.59	0.27511	N	0.951693	B	0.25904	0.137	B	0.22880	0.042	T	0.22034	-1.0228	10	0.15952	T	0.53	-5.3563	8.561	0.33511	0.0:0.8087:0.0:0.1913	.	219	Q14331	FRG1_HUMAN	Q	219;91	ENSP00000226798:H219Q	ENSP00000226798:H219Q	H	+	3	2	FRG1	191119998	0.733000	0.28132	1.000000	0.80357	0.952000	0.60782	-0.200000	0.09478	0.227000	0.20999	0.479000	0.44913	CAC		0.289	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG2B	441581	mdanderson.org	37	10	135439015	135439015	+	Missense_Mutation	SNP	T	T	C	rs75470891		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr10:135439015T>C	ENST00000425520.1	-	4	477	c.425A>G	c.(424-426)gAt>gGt	p.D142G	FRG2B_ENST00000443774.1_Missense_Mutation_p.D143G	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	142						nucleus (GO:0005634)		p.D143G(1)|p.D142G(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ATGGTGGGCATCACAGGTCTC	0.517																																						.											2	Substitution - Missense(2)	prostate(2)											94.0	106.0	102.0					10																	135439015		2200	4298	6498	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.425A>G	10.37:g.135439015T>C	ENSP00000401310:p.Asp142Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	7.820	0.717602	0.15372	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.46063	0.88;0.88	.	.	.	.	2.387620	0.01707	N	0.027493	T	0.45115	0.1326	N	0.19112	0.55	0.80722	P	0.0	D	0.61697	0.99	D	0.66351	0.943	T	0.44967	-0.9293	7	0.25751	T	0.34	-0.0211	.	.	.	.	142	Q96QU4	FRG2B_HUMAN	G	143;142	ENSP00000408343:D143G;ENSP00000401310:D142G	ENSP00000401310:D142G	D	-	2	0	FRG2B	135289005	0.038000	0.19896	0.258000	0.24420	0.260000	0.26232	0.264000	0.18497	0.103000	0.17682	0.102000	0.15555	GAT		0.517	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
HRNR	388697	mdanderson.org	37	1	152187510	152187510	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:152187510C>T	ENST00000368801.2	-	3	6670	c.6595G>A	c.(6595-6597)Ggc>Agc	p.G2199S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2199					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTTGGCCGTGGCTGGAG	0.632																																						.											0													49.0	66.0	61.0					1																	152187510		2172	4285	6457	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6595G>A	1.37:g.152187510C>T	ENSP00000357791:p.Gly2199Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	8.711	0.912060	0.17907	.	.	ENSG00000197915	ENST00000368801	T	0.17370	2.28	3.28	0.982	0.19762	.	.	.	.	.	T	0.01156	0.0038	N	0.04880	-0.145	0.09310	N	1	P	0.48162	0.906	B	0.27380	0.079	T	0.37197	-0.9716	9	0.11794	T	0.64	.	5.1396	0.14952	0.0:0.51:0.0:0.49	rs61814942	2199	Q86YZ3	HORN_HUMAN	S	2199	ENSP00000357791:G2199S	ENSP00000357791:G2199S	G	-	1	0	HRNR	150454134	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.145000	0.03194	0.054000	0.16065	0.558000	0.71614	GGC		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
HSPA8	3312	mdanderson.org	37	11	122931403	122931403	+	Silent	SNP	G	G	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:122931403G>A	ENST00000532636.1	-	3	428	c.309C>T	c.(307-309)gtC>gtT	p.V103V	HSPA8_ENST00000534624.1_Silent_p.V103V|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000534319.1_5'Flank|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000227378.3_Silent_p.V103V|HSPA8_ENST00000526110.1_Silent_p.V103V|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000453788.2_Silent_p.V103V|HSPA8_ENST00000533540.1_Intron|SNORD14E_ENST00000364009.1_RNA			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	103					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ATTCTACTTGGACCTTGGGCC	0.463																																					Colon(21;486 594 5900 6733 14272)	.											0													85.0	84.0	84.0					11																	122931403		2202	4299	6501	SO:0001819	synonymous_variant	3312			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.309C>T	11.37:g.122931403G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H3R6	Silent	SNP	ENST00000532636.1	37	CCDS8440.1																																																																																				0.463	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
ICAM1	3383	mdanderson.org;bcgsc.ca	37	19	10395799	10395799	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr19:10395799T>C	ENST00000264832.3	+	7	1760	c.1435T>C	c.(1435-1437)Tat>Cat	p.Y479H	ICAM1_ENST00000423829.2_Missense_Mutation_p.Y257H|ICAM4_ENST00000393717.2_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|ICAM4_ENST00000340992.4_5'Flank|CTD-2369P2.5_ENST00000592893.1_RNA|ICAM4_ENST00000380770.3_5'Flank	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	479					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	AGCCCCCCGGTATGAGATTGT	0.582																																						.											0													95.0	99.0	98.0					19																	10395799		2203	4300	6503	SO:0001583	missense	3383				CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.1435T>C	19.37:g.10395799T>C	ENSP00000264832:p.Tyr479His	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	37	CCDS12231.1	.	.	.	.	.	.	.	.	.	.	T	6.128	0.391854	0.11581	.	.	ENSG00000090339	ENST00000264832;ENST00000423829	T;T	0.15139	2.45;2.45	5.22	-8.02	0.01118	.	4.968880	0.00728	N	0.000934	T	0.07863	0.0197	N	0.22421	0.69	0.09310	N	1	B;B	0.15473	0.004;0.013	B;B	0.08055	0.003;0.001	T	0.27536	-1.0071	10	0.15499	T	0.54	0.0697	0.8733	0.01219	0.2333:0.1331:0.3035:0.3301	.	257;479	E7ESS4;P05362	.;ICAM1_HUMAN	H	479;257	ENSP00000264832:Y479H;ENSP00000413124:Y257H	ENSP00000264832:Y479H	Y	+	1	0	ICAM1	10256799	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.518000	0.06267	-1.908000	0.01086	-0.337000	0.08149	TAT		0.582	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
INTS4	92105	mdanderson.org	37	11	77614592	77614592	+	Silent	SNP	C	C	T	rs565544206	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:77614592C>T	ENST00000534064.1	-	17	2125	c.2091G>A	c.(2089-2091)gcG>gcA	p.A697A	INTS4_ENST00000535943.1_Silent_p.A72A|AAMDC_ENST00000532481.1_Intron	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	697					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.A697A(1)	INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TTACCTGTTTCGCTGCTGCTG	0.483													C|||	7	0.00139776	0.0045	0.0	5008	,	,		22683	0.001		0.0	False		,,,				2504	0.0					.											1	Substitution - coding silent(1)	prostate(1)											63.0	54.0	57.0					11																	77614592		2200	4292	6492	SO:0001819	synonymous_variant	92105			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.2091G>A	11.37:g.77614592C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	ENST00000534064.1	37	CCDS31644.1																																																																																				0.483	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
MAGEC1	9947	mdanderson.org	37	X	140994352	140994352	+	Missense_Mutation	SNP	C	C	A	rs113701062		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chrX:140994352C>A	ENST00000285879.4	+	4	1448	c.1162C>A	c.(1162-1164)Ctt>Att	p.L388I	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	388										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTTACTGAGTCTTTTCCAGAG	0.493										HNSCC(15;0.026)			-|||	52	0.0137748	0.028	0.0115	3775	,	,		13425	0.0		0.005	False		,,,				2504	0.002					.											0													104.0	111.0	109.0					X																	140994352		2202	4293	6495	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1162C>A	X.37:g.140994352C>A	ENSP00000285879:p.Leu388Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	0.007	-1.943046	0.00479	.	.	ENSG00000155495	ENST00000285879	T	0.02345	4.33	.	.	.	.	.	.	.	.	T	0.01353	0.0044	N	0.08118	0	0.09310	N	1	B	0.32829	0.386	B	0.23150	0.044	T	0.43605	-0.9381	8	0.87932	D	0	.	5.684	0.17792	0.0:0.6646:0.3354:0.0	.	388	O60732	MAGC1_HUMAN	I	388	ENSP00000285879:L388I	ENSP00000285879:L388I	L	+	1	0	MAGEC1	140822018	0.009000	0.17119	0.040000	0.18447	0.040000	0.13550	0.074000	0.14662	-1.619000	0.01566	-1.645000	0.00762	CTT		0.493	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MICALCL	84953	mdanderson.org	37	11	12316389	12316389	+	Missense_Mutation	SNP	A	A	C	rs3812754|rs542581403|rs199786165	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:12316389A>C	ENST00000256186.2	+	3	1702	c.1411A>C	c.(1411-1413)Aca>Cca	p.T471P		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	471			T -> P (in dbSNP:rs3812754).		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.T471delT(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		tcctcctcctACAGCGGGAGG	0.572													A|||	1475	0.294529	0.1331	0.3386	5008	,	,		4509	0.1815		0.5537	False		,,,				2504	0.3313					.											2	Deletion - In frame(2)	upper_aerodigestive_tract(1)|skin(1)						A	PRO/THR	721,2429		137,447,991	4.0	4.0	4.0		1411	-0.8	0.0	11	dbSNP_107	4	3523,3545		1029,1465,1040	yes	missense	MICALCL	NM_032867.2	38	1166,1912,2031	CC,CA,AA		49.8444,22.8889,41.5345	benign	471/696	12316389	4244,5974	1575	3534	5109	SO:0001583	missense	84953			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1411A>C	11.37:g.12316389A>C	ENSP00000256186:p.Thr471Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	766	0.3507326007326007	103	0.20934959349593496	147	0.40607734806629836	106	0.1853146853146853	410	0.5408970976253298	A	0.021	-1.425527	0.01126	0.228889	0.498444	ENSG00000133808	ENST00000256186	T	0.13307	2.6	0.418	-0.835	0.10775	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.38110	0.618	B	0.25759	0.063	T	0.38045	-0.9679	7	0.23302	T	0.38	.	.	.	.	rs3812754	471	Q6ZW33	MICLK_HUMAN	P	471	ENSP00000256186:T471P	ENSP00000256186:T471P	T	+	1	0	MICALCL	12272965	0.001000	0.12720	0.028000	0.17463	0.023000	0.10783	-0.872000	0.04219	-0.631000	0.05560	-0.661000	0.03856	ACA		0.572	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
GPC1	2817	mdanderson.org	37	2	241395500	241395500	+	Intron	SNP	A	A	G	rs71428439	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr2:241395500A>G	ENST00000264039.2	+	2	414				MIR149_ENST00000384879.1_RNA|AC110619.2_ENST00000404327.3_Intron|AC110619.2_ENST00000404891.1_Intron	NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1						axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		GTGCTGGGGCAGCTGGAACAA	0.781													G|||	721	0.14397	0.1112	0.2017	5008	,	,		8497	0.1994		0.1272	False		,,,				2504	0.1074					.											0								G		87,1611		1,85,763	2.0	2.0	2.0			-5.9	0.5	2	dbSNP_130	2	253,3699		4,245,1727	no	intron	GPC1	NM_002081.2		5,330,2490	GG,GA,AA		6.4018,5.1237,6.0177			241395500	340,5310	849	1976	2825	SO:0001627	intron_variant	406941			AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.167-2947A>G	2.37:g.241395500A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KTD1|Q53QM4	RNA	SNP	ENST00000264039.2	37	CCDS2534.1																																																																																				0.781	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257179.3	NM_002081	
MUC17	140453	mdanderson.org	37	7	100680472	100680472	+	Missense_Mutation	SNP	G	G	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr7:100680472G>C	ENST00000306151.4	+	3	5839	c.5775G>C	c.(5773-5775)agG>agC	p.R1925S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1925	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GGGAAGGAAGGCCTCCATTAA	0.502																																						.											0													246.0	243.0	244.0					7																	100680472		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5775G>C	7.37:g.100680472G>C	ENSP00000302716:p.Arg1925Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.005	-2.151273	0.00325	.	.	ENSG00000169876	ENST00000306151	T	0.02787	4.16	0.579	-1.16	0.09678	.	.	.	.	.	T	0.00815	0.0027	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40683	-0.9550	9	0.02654	T	1	.	0.1144	0.00059	0.2275:0.1978:0.2306:0.3441	.	1925	Q685J3	MUC17_HUMAN	S	1925	ENSP00000302716:R1925S	ENSP00000302716:R1925S	R	+	3	2	MUC17	100467192	0.007000	0.16637	0.000000	0.03702	0.002000	0.02628	0.028000	0.13644	-2.485000	0.00520	-3.513000	0.00033	AGG		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC21	394263	mdanderson.org	37	6	30955158	30955158	+	Silent	SNP	C	C	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr6:30955158C>T	ENST00000376296.3	+	2	1447	c.1206C>T	c.(1204-1206)gcC>gcT	p.A402A	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	402	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAGTGGGGCCAGCACAGCCA	0.627																																						.											0													140.0	138.0	138.0					6																	30955158		2203	4300	6503	SO:0001819	synonymous_variant	394263			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1206C>T	6.37:g.30955158C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																				0.627	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MUC2	4583	mdanderson.org	37	11	1093452	1093452	+	Silent	SNP	G	G	A	rs34136803		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:1093452G>A	ENST00000441003.2	+	30	5298	c.5271G>A	c.(5269-5271)ccG>ccA	p.P1757P	MUC2_ENST00000333592.6_Silent_p.P45P|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.P1724P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1724P(1)|p.P1757P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccaccg	0.617																																						.											2	Substitution - coding silent(2)	prostate(2)											107.0	134.0	125.0					11																	1093452		2040	4045	6085	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5271G>A	11.37:g.1093452G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195507155	195507155	+	Missense_Mutation	SNP	C	C	T	rs202193697		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:195507155C>T	ENST00000463781.3	-	2	11755	c.11296G>A	c.(11296-11298)Gct>Act	p.A3766T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3766T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.602																																						.											0													22.0	19.0	20.0					3																	195507155		686	1585	2271	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11296G>A	3.37:g.195507155C>T	ENSP00000417498:p.Ala3766Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	1.427	-0.571349	0.03882	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28895	1.59;1.64	.	.	.	.	0.325811	0.13540	U	0.380241	T	0.10680	0.0261	N	0.08118	0	0.09310	N	1	B	0.28350	0.208	B	0.14578	0.011	T	0.25882	-1.0119	8	.	.	.	.	4.4816	0.11769	0.0:0.6679:0.0:0.3321	.	3638	E7ESK3	.	T	3766	ENSP00000417498:A3766T;ENSP00000420243:A3766T	.	A	-	1	0	MUC4	196991934	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	-0.062000	0.11674	-0.525000	0.06391	0.064000	0.15345	GCT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195512646	195512646	+	Silent	SNP	C	C	G	rs3107750	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:195512646C>G	ENST00000463781.3	-	2	6264	c.5805G>C	c.(5803-5805)acG>acC	p.T1935T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T1935T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGCGTGGTGTCAC	0.592																																						.											0													37.0	34.0	35.0					3																	195512646		690	1589	2279	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5805G>C	3.37:g.195512646C>G		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PRB2	653247	mdanderson.org	37	12	11546262	11546262	+	Silent	SNP	G	G	A	rs199808121	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:11546262G>A	ENST00000389362.4	-	3	785	c.750C>T	c.(748-750)ggC>ggT	p.G250G	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	250	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGCTGGTTGCCTCCTTGTG	0.607																																						.											0													111.0	144.0	133.0					12																	11546262		2188	4276	6464	SO:0001819	synonymous_variant	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.750C>T	12.37:g.11546262G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																				0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
OR6C74	254783	mdanderson.org	37	12	55641157	55641157	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr12:55641157T>C	ENST00000343870.4	+	1	176	c.86T>C	c.(85-87)cTt>cCt	p.L29P		NM_001005490.1	NP_001005490.1	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C, member 74	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	12						TTTCTTCTCCTTTTTTTCACC	0.378																																						.											0													183.0	177.0	179.0					12																	55641157		2203	4300	6503	SO:0001583	missense	254783				CCDS31816.1	12q13.13	2012-08-09			ENSG00000197706	ENSG00000197706		"""GPCR / Class A : Olfactory receptors"""	31303	protein-coding gene	gene with protein product							Standard	NM_001005490		Approved		uc010spg.2	A6NCV1	OTTHUMG00000165162	ENST00000343870.4:c.86T>C	12.37:g.55641157T>C	ENSP00000342836:p.Leu29Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000343870.4	37	CCDS31816.1	.	.	.	.	.	.	.	.	.	.	t	12.35	1.911727	0.33721	.	.	ENSG00000197706	ENST00000343870	T	0.00580	6.43	4.83	4.83	0.62350	.	0.000000	0.43747	D	0.000537	T	0.03739	0.0106	M	0.90759	3.145	0.30755	N	0.744759	D	0.89917	1.0	D	0.79784	0.993	T	0.00763	-1.1576	10	0.72032	D	0.01	.	14.4929	0.67665	0.0:0.0:0.0:1.0	.	29	A6NCV1	O6C74_HUMAN	P	29	ENSP00000342836:L29P	ENSP00000342836:L29P	L	+	2	0	OR6C74	53927424	0.629000	0.27146	0.074000	0.20217	0.175000	0.22909	5.237000	0.65360	2.139000	0.66308	0.450000	0.29827	CTT		0.378	OR6C74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382312.1		
RC3H1	149041	mdanderson.org;bcgsc.ca	37	1	173921192	173921192	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr1:173921192C>A	ENST00000367696.2	-	14	2806	c.2455G>T	c.(2455-2457)Ggc>Tgc	p.G819C	RC3H1_ENST00000367694.2_Missense_Mutation_p.G819C|RC3H1_ENST00000258349.4_Missense_Mutation_p.G819C			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	819					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						ATGTAGGAGCCGATGGTGTCA	0.408																																						.											0													143.0	124.0	131.0					1																	173921192		2203	4300	6503	SO:0001583	missense	149041			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2455G>T	1.37:g.173921192C>A	ENSP00000356669:p.Gly819Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895293	0.91962	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.59638	0.26;0.26;0.25	5.77	5.77	0.91146	.	0.043803	0.85682	N	0.000000	T	0.67915	0.2944	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.67145	0.993;0.993;0.996;0.993	P;P;D;P	0.65874	0.87;0.87;0.939;0.87	T	0.69030	-0.5253	10	0.72032	D	0.01	-12.1335	19.9913	0.97366	0.0:1.0:0.0:0.0	.	819;819;819;819	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	C	819	ENSP00000356669:G819C;ENSP00000258349:G819C;ENSP00000356667:G819C	ENSP00000258349:G819C	G	-	1	0	RC3H1	172187815	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.761000	0.68801	2.734000	0.93682	0.585000	0.79938	GGC		0.408	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
SLC4A7	9497	mdanderson.org	37	3	27444780	27444780	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr3:27444780A>G	ENST00000295736.5	-	15	2214	c.2144T>C	c.(2143-2145)cTt>cCt	p.L715P	SLC4A7_ENST00000454389.1_Missense_Mutation_p.L724P|SLC4A7_ENST00000388777.4_Missense_Mutation_p.L265P|SLC4A7_ENST00000435667.2_Missense_Mutation_p.L600P|SLC4A7_ENST00000445684.1_Missense_Mutation_p.L711P|SLC4A7_ENST00000455077.1_Missense_Mutation_p.L596P|SLC4A7_ENST00000440156.1_Missense_Mutation_p.L711P|SLC4A7_ENST00000437179.1_Missense_Mutation_p.L596P|SLC4A7_ENST00000428386.1_Missense_Mutation_p.L591P|SLC4A7_ENST00000446700.1_Missense_Mutation_p.L707P|SLC4A7_ENST00000425128.2_3'UTR	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	715					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	ATAACACACAAGGCTGCTTGC	0.378																																						.											0													105.0	104.0	104.0					3																	27444780		2203	4300	6503	SO:0001583	missense	9497			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.2144T>C	3.37:g.27444780A>G	ENSP00000295736:p.Leu715Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.665776	0.67700	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	D;D;D;D;D;D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.14	5.14	0.70334	Bicarbonate transporter, C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.94049	0.8093	H	0.96889	3.9	0.80722	D	1	P;P;P;D;P;P;P;P;P	0.89917	0.576;0.606;0.576;1.0;0.576;0.552;0.552;0.576;0.606	P;P;P;D;P;P;P;P;P	0.97110	0.496;0.582;0.496;1.0;0.496;0.447;0.447;0.496;0.582	D	0.95937	0.8943	10	0.87932	D	0	.	14.9553	0.71107	1.0:0.0:0.0:0.0	.	711;596;707;711;724;265;591;715;596	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	P	266;715;591;724;711;596;707;596;711;600;265;611	ENSP00000411031:L266P;ENSP00000295736:L715P;ENSP00000416368:L591P;ENSP00000390394:L724P;ENSP00000414797:L711P;ENSP00000394252:L596P;ENSP00000406605:L707P;ENSP00000407382:L596P;ENSP00000406804:L711P;ENSP00000395336:L600P;ENSP00000373429:L265P;ENSP00000388703:L611P	ENSP00000295736:L715P	L	-	2	0	SLC4A7	27419784	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	1.945000	0.56424	0.459000	0.35465	CTT		0.378	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	
SOX8	30812	mdanderson.org	37	16	1034954	1034954	+	Silent	SNP	T	T	C	rs11542178	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr16:1034954T>C	ENST00000293894.3	+	3	1024	c.909T>C	c.(907-909)taT>taC	p.Y303Y		NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	303					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				GCCAGGCCTATGGGGGCGCCT	0.751													C|||	1718	0.343051	0.5772	0.2867	5008	,	,		9222	0.1052		0.3091	False		,,,				2504	0.3466					.											0								C		2425,1917		709,1007,455	9.0	11.0	11.0		909	-6.6	0.0	16	dbSNP_120	11	2368,6146		350,1668,2239	no	coding-synonymous	SOX8	NM_014587.3		1059,2675,2694	CC,CT,TT		27.813,44.1502,37.2822		303/447	1034954	4793,8063	2171	4257	6428	SO:0001819	synonymous_variant	30812			AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.909T>C	16.37:g.1034954T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZW2	Silent	SNP	ENST00000293894.3	37	CCDS10428.1																																																																																				0.751	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242867.1		
TRIM49	57093	mdanderson.org	37	11	89531533	89531533	+	Missense_Mutation	SNP	G	G	T	rs146898780	byFrequency	TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:89531533G>T	ENST00000329758.1	-	8	1452	c.1124C>A	c.(1123-1125)gCg>gAg	p.A375E	TRIM49_ENST00000532501.2_Missense_Mutation_p.A298E	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	375	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AAAGAGTCCCGCCTTTCCATC	0.448													t|||	168	0.0335463	0.0507	0.0504	5008	,	,		18300	0.0446		0.0109	False		,,,				2504	0.0102					.											0													78.0	85.0	83.0					11																	89531533		2129	4278	6407	SO:0001583	missense	57093			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.1124C>A	11.37:g.89531533G>T	ENSP00000327604:p.Ala375Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	ENST00000329758.1	37	CCDS8287.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.430515	0.00184	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.68331	-0.32	0.812	0.812	0.18744	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.24160	0.0585	N	0.00332	-1.63	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25813	-1.0121	8	.	.	.	.	3.6708	0.08273	0.0:0.0:0.4123:0.5877	.	375	P0CI25	TRI49_HUMAN	E	375;298	ENSP00000327604:A375E	.	A	-	2	0	TRIM49	89171181	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.249000	0.18216	-0.171000	0.10797	-1.228000	0.01579	GCG		0.448	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
ZMYND11	10771	bcgsc.ca	37	10	283550	283550	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr10:283550A>G	ENST00000397962.3	+	6	970	c.542A>G	c.(541-543)aAg>aGg	p.K181R	ZMYND11_ENST00000381591.1_Missense_Mutation_p.K181R|ZMYND11_ENST00000402736.1_Intron|ZMYND11_ENST00000381604.4_Missense_Mutation_p.K141R|ZMYND11_ENST00000381607.4_Missense_Mutation_p.K87R|ZMYND11_ENST00000558098.2_Missense_Mutation_p.K181R|ZMYND11_ENST00000535374.1_Missense_Mutation_p.K24R|ZMYND11_ENST00000381584.1_Missense_Mutation_p.K164R|ZMYND11_ENST00000509513.2_Missense_Mutation_p.K181R|ZMYND11_ENST00000403354.1_Missense_Mutation_p.K127R|ZMYND11_ENST00000309776.4_Missense_Mutation_p.K141R|ZMYND11_ENST00000602682.1_Intron|ZMYND11_ENST00000397959.3_Intron|ZMYND11_ENST00000545619.1_Missense_Mutation_p.K87R|ZMYND11_ENST00000381602.4_Missense_Mutation_p.K141R			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	181	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AAAAAGGGGAAGGACAATAAA	0.408																																						.											0													103.0	99.0	101.0					10																	283550		2203	4300	6503	SO:0001583	missense	10771			X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.542A>G	10.37:g.283550A>G	ENSP00000381053:p.Lys181Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Missense_Mutation	SNP	ENST00000397962.3	37	CCDS7052.2	.	.	.	.	.	.	.	.	.	.	A	31	5.083659	0.94050	.	.	ENSG00000015171	ENST00000439456;ENST00000397962;ENST00000309776;ENST00000381602;ENST00000509513;ENST00000381591;ENST00000403354;ENST00000381607;ENST00000381604;ENST00000397955;ENST00000381584;ENST00000545619;ENST00000535374	T;T;T;T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.4	5.4	0.78164	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.36193	0.0958	L	0.44542	1.39	.	.	.	D;D;P;D;D;P;P	0.63046	0.984;0.992;0.795;0.984;0.979;0.948;0.948	P;P;P;P;D;P;P	0.71414	0.743;0.872;0.636;0.743;0.973;0.584;0.482	T	0.13495	-1.0507	9	0.18710	T	0.47	-29.9056	15.7172	0.77677	1.0:0.0:0.0:0.0	.	141;181;127;181;127;127;127	Q15326;Q2LD45;B7Z2J6;Q2LD48;B0QZE2;Q2LD46;Q2LD47	ZMY11_HUMAN;.;.;.;.;.;.	R	127;181;141;141;181;181;127;87;141;196;164;87;24	ENSP00000381053:K181R;ENSP00000309992:K141R;ENSP00000371015:K141R;ENSP00000424205:K181R;ENSP00000371003:K181R;ENSP00000385484:K127R;ENSP00000371020:K87R;ENSP00000371017:K141R;ENSP00000370996:K164R;ENSP00000438461:K87R	ENSP00000309992:K141R	K	+	2	0	ZMYND11	273550	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.880000	0.92407	2.170000	0.68504	0.460000	0.39030	AAG		0.408	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046382.4	NM_006624	
DNHD1	144132	bcgsc.ca	37	11	6591281	6591281	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr11:6591281G>T	ENST00000527990.2	+	38	12906	c.12906G>T	c.(12904-12906)caG>caT	p.Q4302H	DNHD1_ENST00000254579.6_Missense_Mutation_p.Q4302H			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4302					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CCCAAGACCAGCTGTGGGCAA	0.557																																						.											0													89.0	88.0	88.0					11																	6591281		1964	4165	6129	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.12906G>T	11.37:g.6591281G>T	ENSP00000436180:p.Gln4302His	Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	5.424	0.263402	0.10294	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	T;T	0.08634	3.07;3.07	4.69	3.77	0.43336	Dynein heavy chain (1);	0.425959	0.23362	N	0.049015	T	0.08447	0.0210	L	0.50919	1.6	0.25206	N	0.990016	B;B;B;B	0.14805	0.011;0.005;0.011;0.011	B;B;B;B	0.15052	0.008;0.002;0.008;0.012	T	0.31251	-0.9950	10	0.15952	T	0.53	-4.8843	10.8944	0.47015	0.0:0.1891:0.8109:0.0	.	3390;570;355;4302	B0I1S4;D3DQT9;Q9NSW8;Q96M86	.;.;.;DNHD1_HUMAN	H	4302;4302;570;570	ENSP00000254579:Q4302H;ENSP00000436180:Q4302H	ENSP00000254579:Q4302H	Q	+	3	2	DNHD1	6547857	0.923000	0.31300	0.967000	0.41034	0.346000	0.29079	1.124000	0.31320	1.192000	0.43071	0.655000	0.94253	CAG		0.557	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
C17orf97	400566	bcgsc.ca	37	17	263643	263643	+	Missense_Mutation	SNP	C	C	A	rs71369083|rs71145728		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:263643C>A	ENST00000360127.6	+	2	1025	c.1009C>A	c.(1009-1011)Ccc>Acc	p.P337T	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	367	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GGGCTTCCACCCCGACCCCGA	0.697																																						.											0																																										SO:0001583	missense	400566			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1009C>A	17.37:g.263643C>A	ENSP00000353245:p.Pro337Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.987809	0.00002	.	.	ENSG00000187624	ENST00000360127	T	0.31247	1.5	2.05	-4.1	0.03940	.	.	.	.	.	T	0.13329	0.0323	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35400	-0.9790	9	0.13853	T	0.58	.	10.5042	0.44823	0.1779:0.7067:0.1154:0.0	.	337	Q6ZQX7-4	.	T	337	ENSP00000353245:P337T	ENSP00000353245:P337T	P	+	1	0	C17orf97	263989	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.281000	0.00260	-5.715000	0.00010	-5.246000	0.00001	CCC		0.697	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
LRRC37A3	374819	bcgsc.ca	37	17	62892919	62892919	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr17:62892919C>A	ENST00000584306.1	-	3	987	c.457G>T	c.(457-459)Gat>Tat	p.D153Y	LRRC37A3_ENST00000319651.5_Missense_Mutation_p.D153Y|LRRC37A3_ENST00000339474.5_Intron|RP11-927P21.1_ENST00000577938.1_RNA|LRRC37A3_ENST00000577487.1_5'Flank|RP11-927P21.2_ENST00000581622.1_RNA|RP11-927P21.1_ENST00000584131.1_RNA|RP11-927P21.1_ENST00000584959.1_RNA|LRRC37A3_ENST00000400877.3_Intron	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	153						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TGAGCTGGATCTTTCTTCAGC	0.478																																						.											0													49.0	88.0	75.0					17																	62892919		1639	3463	5102	SO:0001583	missense	374819			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.457G>T	17.37:g.62892919C>A	ENSP00000464535:p.Asp153Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	ENST00000584306.1	37	CCDS32708.1	.	.	.	.	.	.	.	.	.	.	.	8.215	0.801125	0.16397	.	.	ENSG00000176809	ENST00000319651	T	0.70164	-0.46	1.87	0.862	0.19056	.	.	.	.	.	T	0.65312	0.2679	L	0.50333	1.59	0.09310	N	1	D	0.53462	0.96	P	0.52856	0.711	T	0.54925	-0.8220	9	0.66056	D	0.02	.	4.5234	0.11969	0.0:0.7977:0.0:0.2023	.	153	O60309	L37A3_HUMAN	Y	153	ENSP00000325713:D153Y	ENSP00000325713:D153Y	D	-	1	0	LRRC37A3	60323381	0.017000	0.18338	0.000000	0.03702	0.043000	0.13939	0.844000	0.27654	0.349000	0.23975	0.162000	0.16502	GAT		0.478	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445377.1	NM_199340	
ANKRD30BL	554226	bcgsc.ca	37	2	132905706	132905706	+	Nonstop_Mutation	SNP	A	A	G	rs142209162		TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr2:132905706A>G	ENST00000409867.1	-	6	1024	c.775T>C	c.(775-777)Tag>Cag	p.*259Q	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	0										endometrium(1)|kidney(3)	4						ACTGTATCCTATTCATCAGGT	0.438																																						.											0																																										SO:0001578	stop_lost	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.775T>C	2.37:g.132905706A>G	ENSP00000386398:p.*259Gluext*29	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.034	-1.317389	0.01331	.	.	ENSG00000163046	ENST00000409867	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Q	259	.	.	X	-	1	0	ANKRD30BL	132622176	0.072000	0.21174	0.103000	0.21229	0.104000	0.19210	0.225000	0.17757	0.156000	0.19299	0.155000	0.16302	TAG		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
PLG	5340	bcgsc.ca	37	6	161143514	161143514	+	Missense_Mutation	SNP	A	A	T			TCGA-KM-8476-01A-11D-2310-10	TCGA-KM-8476-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5bebc389-de0d-45b8-9d2f-6476988c358a	69f24cd1-4ec4-4ef0-876f-4eda31a72245	g.chr6:161143514A>T	ENST00000308192.9	+	10	1234	c.1171A>T	c.(1171-1173)Acc>Tcc	p.T391S		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	391	Kringle 4. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CACATCCTCCACCACCACCAC	0.483																																						.											0													138.0	124.0	128.0					6																	161143514		2203	4300	6503	SO:0001583	missense	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1171A>T	6.37:g.161143514A>T	ENSP00000308938:p.Thr391Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.999575	0.54147	.	.	ENSG00000122194	ENST00000308192	T	0.63744	-0.06	5.18	5.18	0.71444	Kringle (5);Kringle-like fold (1);	0.641780	0.12774	U	0.440292	T	0.65698	0.2716	M	0.81341	2.54	0.23113	N	0.99828	P	0.37015	0.578	P	0.51297	0.665	T	0.64525	-0.6387	10	0.62326	D	0.03	.	10.6335	0.45551	0.8391:0.1609:0.0:0.0	.	391	P00747	PLMN_HUMAN	S	391	ENSP00000308938:T391S	ENSP00000308938:T391S	T	+	1	0	PLG	161063504	0.981000	0.34729	0.394000	0.26270	0.502000	0.33828	2.748000	0.47483	1.952000	0.56665	0.383000	0.25322	ACC		0.483	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
