#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	1268041	1268041	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:1268041C>T	ENST00000339381.5	+	3	1162	c.1130C>T	c.(1129-1131)aCg>aTg	p.T377M		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	377					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GACTGCATCACGCTGCAGAAC	0.642																																						.											0													24.0	22.0	23.0					1																	1268041		2193	4292	6485	SO:0001583	missense	83756			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1130C>T	1.37:g.1268041C>T	ENSP00000344411:p.Thr377Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	37	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	C	5.099	0.203895	0.09704	.	.	ENSG00000169962	ENST00000339381	D	0.81996	-1.56	4.71	2.73	0.32206	Extracellular ligand-binding receptor (1);	3.801630	0.00520	N	0.000181	T	0.74520	0.3727	L	0.34521	1.04	0.09310	N	1	P	0.45212	0.853	B	0.37198	0.243	T	0.64433	-0.6409	10	0.30854	T	0.27	.	7.1638	0.25679	0.0:0.6293:0.1846:0.1861	.	377	Q7RTX0	TS1R3_HUMAN	M	377	ENSP00000344411:T377M	ENSP00000344411:T377M	T	+	2	0	TAS1R3	1257904	0.004000	0.15560	0.002000	0.10522	0.005000	0.04900	0.968000	0.29357	0.948000	0.37687	0.561000	0.74099	ACG		0.642	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
QSER1	79832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	32954825	32954825	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:32954825A>T	ENST00000399302.2	+	4	1969	c.1634A>T	c.(1633-1635)tAt>tTt	p.Y545F	QSER1_ENST00000527788.1_Missense_Mutation_p.Y306F	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	545										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CCAAAGTCTTATGCTGAAAGA	0.413																																						.											0													108.0	102.0	104.0					11																	32954825		1889	4123	6012	SO:0001583	missense	79832			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.1634A>T	11.37:g.32954825A>T	ENSP00000382241:p.Tyr545Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.851349	0.32699	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.24908	2.16;1.83	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000014	T	0.44932	0.1317	M	0.64997	1.995	0.42017	D	0.990965	D;D;D	0.67145	0.995;0.996;0.993	P;P;P	0.60609	0.852;0.877;0.757	T	0.44967	-0.9293	10	0.59425	D	0.04	.	15.0045	0.71501	1.0:0.0:0.0:0.0	.	306;306;545	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	F	545;306;306	ENSP00000382241:Y545F;ENSP00000432766:Y306F	ENSP00000078652:Y306F	Y	+	2	0	QSER1	32911401	1.000000	0.71417	0.958000	0.39756	0.017000	0.09413	5.277000	0.65586	2.019000	0.59389	0.482000	0.46254	TAT		0.413	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
DENND4B	9909	hgsc.bcm.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001					.											0													28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	1.37:g.153907297C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																				0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
BCAN	63827	hgsc.bcm.edu	37	1	156616757	156616758	+	In_Frame_Ins	INS	-	-	GGGAGG	rs376527030		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:156616757_156616758insGGGAGG	ENST00000329117.5	+	3	592_593	c.256_257insGGGAGG	c.(256-258)cgg>cGGGAGGgg	p.86_87insEG	RP11-284F21.10_ENST00000605886.1_RNA|RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_In_Frame_Ins_p.86_87insEG	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	86	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTCCCGGGGCCGGGAGGCAGAG	0.708																																						.											0																																										SO:0001652	inframe_insertion	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.257_262dupGGGAGG	1.37:g.156616758_156616763dupGGGAGG	ENSP00000331210:p.Arg86_Glu87insGluGly	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	In_Frame_Ins	INS	ENST00000329117.5	37	CCDS1149.1																																																																																				0.708	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
ATP13A2	23400	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	17331882	17331882	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:17331882A>G	ENST00000326735.8	-	3	308	c.275T>C	c.(274-276)aTa>aCa	p.I92T	RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.I92T|ATP13A2_ENST00000452699.1_Missense_Mutation_p.I92T			Q9NQ11	AT132_HUMAN	ATPase type 13A2	92					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TTTGTCTCTTATTTCGATAAC	0.637																																						.											0													28.0	31.0	30.0					1																	17331882		2202	4299	6501	SO:0001583	missense	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.275T>C	1.37:g.17331882A>G	ENSP00000327214:p.Ile92Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	A	6.938	0.542775	0.13250	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699	D;D;D	0.92545	-2.8;-3.06;-2.79	3.85	-1.4	0.08968	.	0.722701	0.12684	N	0.447692	T	0.79269	0.4417	N	0.16098	0.37	0.25600	N	0.986609	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.14023	0.01;0.001;0.001	T	0.64368	-0.6424	10	0.02654	T	1	-3.0825	8.3771	0.32449	0.654:0.0:0.346:0.0	.	92;92;92	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	T	92	ENSP00000327214:I92T;ENSP00000341115:I92T;ENSP00000413307:I92T	ENSP00000327214:I92T	I	-	2	0	ATP13A2	17204469	0.994000	0.37717	0.993000	0.49108	0.990000	0.78478	0.255000	0.18333	-0.382000	0.07870	0.402000	0.26972	ATA		0.637	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
SPG11	80208	hgsc.bcm.edu;ucsc.edu	37	15	44881589	44881589	+	Silent	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr15:44881589G>A	ENST00000261866.7	-	28	4783	c.4767C>T	c.(4765-4767)gtC>gtT	p.V1589V	SPG11_ENST00000558253.1_5'UTR|SPG11_ENST00000427534.2_Silent_p.V1589V|SPG11_ENST00000535302.2_Silent_p.V1589V|SPG11_ENST00000558319.1_Silent_p.V1589V	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1589					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TGACAGGGTGGACCTTTGTGG	0.458																																						.											0													94.0	94.0	94.0					15																	44881589		2198	4298	6496	SO:0001819	synonymous_variant	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.4767C>T	15.37:g.44881589G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	CCDS10112.1																																																																																				0.458	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
LILRA1	11024	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	19	55107718	55107718	+	Silent	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr19:55107718C>T	ENST00000251372.3	+	7	1205	c.1023C>T	c.(1021-1023)aaC>aaT	p.N341N	LILRA1_ENST00000453777.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	341	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CAGGAGAGAACGTGACCCTGC	0.607																																						.											0													81.0	78.0	79.0					19																	55107718		2203	4300	6503	SO:0001819	synonymous_variant	11024			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1023C>T	19.37:g.55107718C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	CCDS12901.1																																																																																				0.607	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
C2orf49	79074	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	105956200	105956200	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:105956200C>A	ENST00000258457.2	+	2	489	c.260C>A	c.(259-261)aCt>aAt	p.T87N	RP11-332H14.2_ENST00000610036.1_lincRNA|C2orf49_ENST00000410049.1_Missense_Mutation_p.T87N|C2orf49_ENST00000437250.2_Missense_Mutation_p.T125N			Q9BVC5	ASHWN_HUMAN	chromosome 2 open reading frame 49	87					embryonic morphogenesis (GO:0048598)	tRNA-splicing ligase complex (GO:0072669)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6						AAAAATGAGACTAAAAGGTAC	0.308																																						.											0													63.0	66.0	65.0					2																	105956200		2203	4300	6503	SO:0001583	missense	79074			BC001310	CCDS2068.1, CCDS74550.1	2q12.2	2009-04-22			ENSG00000135974	ENSG00000135974			28772	protein-coding gene	gene with protein product	"""ashwin"""					12477932	Standard	NM_001286537		Approved	MGC5509, asw	uc002tcs.1	Q9BVC5	OTTHUMG00000130808	ENST00000258457.2:c.260C>A	2.37:g.105956200C>A	ENSP00000258457:p.Thr87Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXN3|B4E2G9	Missense_Mutation	SNP	ENST00000258457.2	37	CCDS2068.1	.	.	.	.	.	.	.	.	.	.	C	9.774	1.173471	0.21704	.	.	ENSG00000135974	ENST00000258457;ENST00000437250;ENST00000410049	T;T;T	0.47177	0.85;0.85;0.85	5.57	2.6	0.31112	.	0.638126	0.16883	N	0.195629	T	0.24812	0.0602	N	0.22421	0.69	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.07751	-1.0756	10	0.16896	T	0.51	-2.0156	1.54	0.02553	0.2836:0.4246:0.1153:0.1765	.	125;87	B4E2G9;Q9BVC5	.;ASHWN_HUMAN	N	87;125;87	ENSP00000258457:T87N;ENSP00000400208:T125N;ENSP00000386361:T87N	ENSP00000258457:T87N	T	+	2	0	C2orf49	105322632	0.001000	0.12720	0.948000	0.38648	0.996000	0.88848	0.345000	0.19979	1.366000	0.46076	0.585000	0.79938	ACT		0.308	C2orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253353.2	NM_024093	
RBX1	9978	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	22	41368482	41368482	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr22:41368482A>G	ENST00000216225.8	+	5	357	c.317A>G	c.(316-318)tAt>tGt	p.Y106C		NM_014248.3	NP_055063.1	P62877	RBX1_HUMAN	ring-box 1, E3 ubiquitin protein ligase	106					cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|Notch signaling pathway (GO:0007219)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|Cul5-RING ubiquitin ligase complex (GO:0031466)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)|VCB complex (GO:0030891)	NEDD8 ligase activity (GO:0019788)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(3)|skin(1)	5						TCTTTCAGGTATGGGCACTAG	0.328																																						.											0													208.0	194.0	199.0					22																	41368482		2202	4300	6502	SO:0001583	missense	9978			AF140598	CCDS14009.1	22q13.2	2010-09-17	2010-09-17		ENSG00000100387	ENSG00000100387		"""RING-type (C3HC4) zinc fingers"""	9928	protein-coding gene	gene with protein product	"""regulator of cullins 1"""	603814	"""ring-box 1"""			10213691, 10230407	Standard	NM_014248		Approved	ROC1, RNF75, BA554C12.1	uc003azk.3	P62877	OTTHUMG00000151298	ENST00000216225.8:c.317A>G	22.37:g.41368482A>G	ENSP00000216225:p.Tyr106Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDY1|Q8N6Z8|Q9D1S2|Q9WUK9|Q9Y254	Missense_Mutation	SNP	ENST00000216225.8	37	CCDS14009.1	.	.	.	.	.	.	.	.	.	.	A	13.89	2.373090	0.42105	.	.	ENSG00000100387	ENST00000216225	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.47563	0.1452	L	0.28115	0.83	0.80722	D	1	B	0.25235	0.121	B	0.29785	0.107	T	0.44967	-0.9293	9	0.48119	T	0.1	.	13.0206	0.58784	1.0:0.0:0.0:0.0	.	106	P62877	RBX1_HUMAN	C	106	.	ENSP00000216225:Y106C	Y	+	2	0	RBX1	39698428	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.464000	0.60134	2.326000	0.78906	0.533000	0.62120	TAT		0.328	RBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322149.1	NM_014248	
VILL	50853	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	38040486	38040486	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:38040486G>T	ENST00000283713.6	+	10	1292	c.1026G>T	c.(1024-1026)caG>caT	p.Q342H	VILL_ENST00000383759.2_Missense_Mutation_p.Q342H|VILL_ENST00000465644.1_Missense_Mutation_p.Q60H			O15195	VILL_HUMAN	villin-like	342					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CGTTCAAGCAGCTCTTCCGGA	0.706																																						.											0													21.0	21.0	21.0					3																	38040486		2197	4293	6490	SO:0001583	missense	50853				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1026G>T	3.37:g.38040486G>T	ENSP00000283713:p.Gln342His	Somatic		WXS	Illumina HiSeq	Phase_I	A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	ENST00000283713.6	37	CCDS2670.2	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756925	0.49362	.	.	ENSG00000136059	ENST00000283713;ENST00000383759;ENST00000356246;ENST00000465644	T;T;T	0.31769	1.48;1.48;1.48	3.97	2.07	0.26955	.	0.331612	0.34133	N	0.004226	T	0.45256	0.1333	M	0.82716	2.605	0.32969	D	0.522115	D;P	0.52996	0.957;0.937	P;P	0.55667	0.781;0.533	T	0.56950	-0.7894	10	0.59425	D	0.04	-9.0365	5.5574	0.17123	0.1793:0.0:0.6603:0.1604	.	328;342	O15195-2;O15195	.;VILL_HUMAN	H	342;342;328;60	ENSP00000283713:Q342H;ENSP00000373266:Q342H;ENSP00000422096:Q60H	ENSP00000283713:Q342H	Q	+	3	2	VILL	38015490	1.000000	0.71417	0.997000	0.53966	0.292000	0.27327	0.696000	0.25541	0.407000	0.25591	-0.350000	0.07774	CAG		0.706	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
MYRIP	25924	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	40211564	40211564	+	Missense_Mutation	SNP	C	C	T	rs142520074		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:40211564C>T	ENST00000302541.6	+	8	1195	c.853C>T	c.(853-855)Cgt>Tgt	p.R285C	MYRIP_ENST00000425621.1_Missense_Mutation_p.R285C|MYRIP_ENST00000444716.1_Missense_Mutation_p.R285C|MYRIP_ENST00000396217.3_Missense_Mutation_p.R196C|MYRIP_ENST00000539167.1_Missense_Mutation_p.R98C|MYRIP_ENST00000459828.1_3'UTR	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	285	Myosin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TGGAGGCTACCGTGCTCCCGC	0.587																																						.											0								C	CYS/ARG	0,4406		0,0,2203	82.0	73.0	76.0		853	2.7	0.0	3	dbSNP_134	76	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYRIP	NM_015460.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	285/860	40211564	1,13005	2203	4300	6503	SO:0001583	missense	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.853C>T	3.37:g.40211564C>T	ENSP00000301972:p.Arg285Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	37	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416632	0.42918	0.0	1.16E-4	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.56	2.65	0.31530	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	2.435180	0.01566	N	0.020350	T	0.38612	0.1047	N	0.24115	0.695	0.09310	N	1	D;P;P	0.71674	0.998;0.876;0.938	P;B;P	0.57244	0.816;0.311;0.448	T	0.33854	-0.9852	9	.	.	.	.	9.6442	0.39857	0.3937:0.6063:0.0:0.0	.	196;285;285	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	C	285;285;285;196;98	ENSP00000398665:R285C;ENSP00000301972:R285C;ENSP00000389323:R285C;ENSP00000379519:R196C;ENSP00000438297:R98C	.	R	+	1	0	MYRIP	40186568	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.057000	0.14279	0.407000	0.25591	-0.314000	0.08810	CGT		0.587	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
CCNL1	57018	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	156866283	156866283	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:156866283T>C	ENST00000295926.3	-	11	1446	c.1328A>G	c.(1327-1329)cAt>cGt	p.H443R	CCNL1_ENST00000479052.1_5'Flank|CCNL1_ENST00000461804.1_Intron	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	443					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			AGGAGAACCATGATTATGATG	0.433																																						.											0													191.0	192.0	192.0					3																	156866283		2203	4300	6503	SO:0001583	missense	57018			AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.1328A>G	3.37:g.156866283T>C	ENSP00000295926:p.His443Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Missense_Mutation	SNP	ENST00000295926.3	37	CCDS3178.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.260717	0.39995	.	.	ENSG00000163660	ENST00000295926	T	0.17854	2.25	5.0	5.0	0.66597	.	0.048329	0.85682	D	0.000000	T	0.13243	0.0321	N	0.21373	0.66	0.80722	D	1	P	0.37466	0.596	B	0.37888	0.26	T	0.13980	-1.0489	10	0.23891	T	0.37	-14.4614	15.0209	0.71630	0.0:0.0:0.0:1.0	.	443	Q9UK58	CCNL1_HUMAN	R	443	ENSP00000295926:H443R	ENSP00000295926:H443R	H	-	2	0	CCNL1	158348977	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.079000	0.64431	1.993000	0.58246	0.455000	0.32223	CAT		0.433	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	NM_020307	
SYTL3	94120	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	159173001	159173001	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr6:159173001G>A	ENST00000297239.9	+	12	1270	c.1076G>A	c.(1075-1077)gGa>gAa	p.G359E	SYTL3_ENST00000360448.3_Missense_Mutation_p.G291E|SYTL3_ENST00000367081.3_Missense_Mutation_p.G85E			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	359	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		TCCTCCCAGGGAAAGCGCAAG	0.552																																						.											0													80.0	68.0	72.0					6																	159173001		2203	4300	6503	SO:0001583	missense	94120			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1076G>A	6.37:g.159173001G>A	ENSP00000297239:p.Gly359Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	ENST00000297239.9	37	CCDS56458.1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487983	0.64074	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.68331	-0.32;-0.32;-0.32	5.75	4.85	0.62838	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.261183	0.37012	N	0.002293	T	0.71728	0.3374	L	0.55481	1.735	0.21841	N	0.999516	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.85130	0.993;0.997;0.994	T	0.65429	-0.6170	10	0.87932	D	0	.	15.2148	0.73258	0.0:0.2629:0.7371:0.0	.	85;359;291	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	E	291;359;359;85	ENSP00000353631:G291E;ENSP00000297239:G359E;ENSP00000356048:G85E	ENSP00000297239:G359E	G	+	2	0	SYTL3	159092989	1.000000	0.71417	0.170000	0.22879	0.398000	0.30690	4.854000	0.62918	2.716000	0.92895	0.655000	0.94253	GGA		0.552	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		
SYTL3	94120	hgsc.bcm.edu;ucsc.edu	37	6	159173011	159173011	+	Silent	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr6:159173011G>A	ENST00000297239.9	+	12	1280	c.1086G>A	c.(1084-1086)aaG>aaA	p.K362K	SYTL3_ENST00000360448.3_Silent_p.K294K|SYTL3_ENST00000367081.3_Silent_p.K88K			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	362	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		GAAAGCGCAAGACTGGAGTCC	0.572																																						.											0													81.0	68.0	72.0					6																	159173011		2203	4300	6503	SO:0001819	synonymous_variant	94120			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1086G>A	6.37:g.159173011G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q496J4|Q496J6|Q5U3B9	Silent	SNP	ENST00000297239.9	37	CCDS56458.1																																																																																				0.572	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		
TMEM31	203562	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	102967204	102967204	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chrX:102967204G>C	ENST00000319560.6	+	2	209	c.18G>C	c.(16-18)aaG>aaC	p.K6N	GLRA4_ENST00000372617.4_Intron	NM_182541.2	NP_872347.2	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	6						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						TAACAGAAAAGAGTGAGGGAG	0.413																																						.											0													137.0	107.0	117.0					X																	102967204		2203	4300	6503	SO:0001583	missense	203562			BC029575	CCDS35359.1	Xq22.2	2008-02-05			ENSG00000179363	ENSG00000179363			28601	protein-coding gene	gene with protein product						12477932	Standard	NM_182541		Approved	MGC39655	uc004elh.3	Q5JXX7	OTTHUMG00000022109	ENST00000319560.6:c.18G>C	X.37:g.102967204G>C	ENSP00000316940:p.Lys6Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHR4	Missense_Mutation	SNP	ENST00000319560.6	37	CCDS35359.1	.	.	.	.	.	.	.	.	.	.	g	6.426	0.446660	0.12223	.	.	ENSG00000179363	ENST00000319560	.	.	.	4.13	1.22	0.21188	.	0.454099	0.16291	N	0.220916	T	0.18341	0.0440	N	0.08118	0	0.09310	N	1	B	0.23735	0.09	B	0.27262	0.078	T	0.20840	-1.0263	9	0.87932	D	0	0.0061	6.6205	0.22800	0.0:0.3729:0.4321:0.195	.	6	Q5JXX7	TMM31_HUMAN	N	6	.	ENSP00000316940:K6N	K	+	3	2	TMEM31	102853860	0.013000	0.17824	0.065000	0.19835	0.467000	0.32768	0.461000	0.21940	0.128000	0.18479	0.525000	0.51046	AAG		0.413	TMEM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057741.1	NM_182541	
BPTF	2186	broad.mit.edu;hgsc.bcm.edu	37	17	65909291	65909291	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:65909291G>A	ENST00000321892.4	+	13	5730	c.5669G>A	c.(5668-5670)gGc>gAc	p.G1890D	BPTF_ENST00000335221.5_Missense_Mutation_p.G1890D|BPTF_ENST00000424123.3_Missense_Mutation_p.G1751D|BPTF_ENST00000306378.6_Missense_Mutation_p.G1764D			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1890					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCGACCTTTGGCATCACTTGG	0.363																																						.											0													101.0	112.0	108.0					17																	65909291		2115	4264	6379	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5669G>A	17.37:g.65909291G>A	ENSP00000315454:p.Gly1890Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	G	14.70	2.613083	0.46631	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.61627	0.09;0.09;0.09	5.77	5.77	0.91146	.	.	.	.	.	T	0.63236	0.2494	N	0.12182	0.205	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.83275	0.996;0.993	T	0.66460	-0.5918	9	0.46703	T	0.11	-12.7977	20.3626	0.98863	0.0:0.0:1.0:0.0	.	1764;1890	Q12830-2;Q12830-4	.;.	D	1764;1890;1890	ENSP00000307208:G1764D;ENSP00000334351:G1890D;ENSP00000315454:G1890D	ENSP00000307208:G1764D	G	+	2	0	BPTF	63339753	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.823000	0.86660	2.885000	0.99019	0.655000	0.94253	GGC		0.363	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
DCUN1D4	23142	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	4	52779712	52779712	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr4:52779712G>A	ENST00000334635.5	+	11	1021	c.841G>A	c.(841-843)Gag>Aag	p.E281K	DCUN1D4_ENST00000381441.3_Missense_Mutation_p.E246K|DCUN1D4_ENST00000381437.4_Missense_Mutation_p.E221K|DCUN1D4_ENST00000451288.2_Missense_Mutation_p.E325K	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	281	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			TTTGTTGGACGAGTTTGTGGA	0.373																																						.											0													101.0	99.0	100.0					4																	52779712		2203	4300	6503	SO:0001583	missense	23142			D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.841G>A	4.37:g.52779712G>A	ENSP00000334625:p.Glu281Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	ENST00000334635.5	37	CCDS33982.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992205	0.93167	.	.	ENSG00000109184	ENST00000334635;ENST00000381441;ENST00000381437;ENST00000451288;ENST00000510808	.	.	.	6.02	6.02	0.97574	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	D	0.87597	0.6217	H	0.94423	3.535	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.99;0.995;0.993	D	0.89852	0.4010	9	0.72032	D	0.01	-18.733	19.5352	0.95251	0.0:0.0:1.0:0.0	.	325;246;281	B4DH25;Q92564-2;Q92564	.;.;DCNL4_HUMAN	K	281;246;221;325;91	.	ENSP00000334625:E281K	E	+	1	0	DCUN1D4	52474469	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.850000	0.98022	0.650000	0.86243	GAG		0.373	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
PCDHA8	56140	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	5	140222358	140222358	+	Silent	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr5:140222358G>A	ENST00000531613.1	+	1	1452	c.1452G>A	c.(1450-1452)gcG>gcA	p.A484A	PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.A484A|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCGGACGCGCAGGAGAACG	0.657																																						.											0													49.0	55.0	53.0					5																	140222358		2195	4261	6456	SO:0001819	synonymous_variant	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1452G>A	5.37:g.140222358G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																				0.657	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
SPAM1	6677	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	123594255	123594255	+	Missense_Mutation	SNP	C	C	T	rs377689190		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr7:123594255C>T	ENST00000439500.1	+	4	1244	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W	SPAM1_ENST00000460182.1_Missense_Mutation_p.R211W|SPAM1_ENST00000223028.7_Missense_Mutation_p.R211W|SPAM1_ENST00000402183.2_Missense_Mutation_p.R211W|SPAM1_ENST00000340011.5_Missense_Mutation_p.R211W	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	211					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.R211W(2)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AAAATTACTTCGGCCAAATCA	0.378																																						.											2	Substitution - Missense(2)	lung(2)						C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	77.0	83.0	81.0		631,631,631,631,631	-1.0	0.0	7		81	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense,missense,missense	SPAM1	NM_001174044.1,NM_001174045.1,NM_001174046.1,NM_003117.4,NM_153189.2	101,101,101,101,101	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	211/510,211/510,211/510,211/512,211/510	123594255	1,13003	2203	4299	6502	SO:0001583	missense	6677			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.631C>T	7.37:g.123594255C>T	ENSP00000402123:p.Arg211Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605065	0.66445	0.0	1.16E-4	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	6.17	-0.96	0.10340	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.204215	0.42548	D	0.000688	T	0.74861	0.3772	H	0.96547	3.84	0.21290	N	0.999731	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77038	-0.2736	9	.	.	.	-26.04	20.5191	0.99215	0.8136:0.1864:0.0:0.0	.	211;211	Q8TC30;P38567	.;HYALP_HUMAN	W	211	ENSP00000386028:R211W;ENSP00000417934:R211W;ENSP00000345849:R211W;ENSP00000402123:R211W;ENSP00000223028:R211W	.	R	+	1	2	SPAM1	123381491	0.007000	0.16637	0.022000	0.16811	0.934000	0.57294	0.147000	0.16202	-0.161000	0.10983	0.655000	0.94253	CGG		0.378	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
LRRC6	23639	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	8	133673863	133673863	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr8:133673863A>T	ENST00000519595.1	-	2	119	c.21T>A	c.(19-21)gaT>gaA	p.D7E	LRRC6_ENST00000520446.1_5'UTR|LRRC6_ENST00000250173.1_Missense_Mutation_p.D7E|LRRC6_ENST00000518642.1_Missense_Mutation_p.D7E			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	7					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GTCTAATAAGATCTTCTGTGA	0.348																																						.											0													60.0	59.0	59.0					8																	133673863		2203	4300	6503	SO:0001583	missense	23639			U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.21T>A	8.37:g.133673863A>T	ENSP00000429791:p.Asp7Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q13648|Q4G183	Missense_Mutation	SNP	ENST00000519595.1	37		.	.	.	.	.	.	.	.	.	.	A	11.10	1.539703	0.27563	.	.	ENSG00000129295	ENST00000519595;ENST00000518642;ENST00000250173;ENST00000395414	T;T;T	0.49720	0.77;0.77;0.77	5.91	-2.39	0.06602	.	0.044642	0.85682	D	0.000000	T	0.15998	0.0385	N	0.04043	-0.29	0.42148	D	0.991545	B	0.15719	0.014	B	0.18561	0.022	T	0.04915	-1.0918	10	0.16896	T	0.51	-25.756	2.1324	0.03754	0.5007:0.1192:0.2651:0.1149	.	7	Q86X45	LRRC6_HUMAN	E	7	ENSP00000429791:D7E;ENSP00000428610:D7E;ENSP00000250173:D7E	ENSP00000250173:D7E	D	-	3	2	LRRC6	133743045	0.048000	0.20356	0.995000	0.50966	0.958000	0.62258	-0.513000	0.06305	-0.077000	0.12752	0.533000	0.62120	GAT		0.348	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	
HIPK1	204851	broad.mit.edu	37	1	114483676	114483676	+	Missense_Mutation	SNP	A	A	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:114483676A>C	ENST00000369558.1	+	2	903	c.671A>C	c.(670-672)cAc>cCc	p.H224P	HIPK1_ENST00000426820.2_Missense_Mutation_p.H224P|HIPK1_ENST00000369561.4_Missense_Mutation_p.H224P|HIPK1_ENST00000369559.4_Missense_Mutation_p.H224P|HIPK1_ENST00000369555.2_Missense_Mutation_p.H224P|HIPK1_ENST00000369554.2_Missense_Mutation_p.H224P			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	224	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTGAAGAACCACCCCTCCTAT	0.478																																						.											0													83.0	85.0	85.0					1																	114483676		2203	4300	6503	SO:0001583	missense	204851			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.671A>C	1.37:g.114483676A>C	ENSP00000358571:p.His224Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.984379	0.74474	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561	T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.61602	0.2360	N	0.21448	0.665	0.80722	D	1	D;D	0.69078	0.997;0.988	D;D	0.81914	0.995;0.977	T	0.69756	-0.5059	10	0.87932	D	0	.	16.1738	0.81836	1.0:0.0:0.0:0.0	.	224;224	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	P	295;224;224;224;224;224;224	ENSP00000407442:H295P;ENSP00000358572:H224P;ENSP00000409673:H224P;ENSP00000358567:H224P;ENSP00000358568:H224P;ENSP00000358571:H224P;ENSP00000358574:H224P	ENSP00000358567:H224P	H	+	2	0	HIPK1	114285199	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.249000	0.95470	2.221000	0.72209	0.455000	0.32223	CAC		0.478	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
SYT9	143425	broad.mit.edu	37	11	7439309	7439309	+	Silent	SNP	C	C	T	rs375976845		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:7439309C>T	ENST00000318881.6	+	5	1524	c.1287C>T	c.(1285-1287)ccC>ccT	p.P429P		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	429	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.P429P(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ATGTCCCTCCCGAGAACATTG	0.473													C|||	1	0.000199681	0.0	0.0014	5008	,	,		23605	0.0		0.0	False		,,,				2504	0.0					.											1	Substitution - coding silent(1)	lung(1)						C		1,4401	2.1+/-5.4	0,1,2200	175.0	147.0	157.0		1287	-11.7	0.7	11		157	0,8592		0,0,4296	no	coding-synonymous	SYT9	NM_175733.3		0,1,6496	TT,TC,CC		0.0,0.0227,0.0077		429/492	7439309	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	143425			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1287C>T	11.37:g.7439309C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000318881.6	37	CCDS7778.1																																																																																				0.473	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
CAPRIN1	4076	broad.mit.edu	37	11	34118204	34118204	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:34118204delT	ENST00000341394.4	+	16	2073	c.1884delT	c.(1882-1884)cctfs	p.P628fs	CAPRIN1_ENST00000530820.1_Frame_Shift_Del_p.P628fs|CAPRIN1_ENST00000389645.3_Frame_Shift_Del_p.P628fs|CAPRIN1_ENST00000533657.1_3'UTR|CAPRIN1_ENST00000529307.1_Frame_Shift_Del_p.P547fs|CAPRIN1_ENST00000532820.1_Frame_Shift_Del_p.P628fs	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	628					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				ACCGGGGCCCTGCCAATGGAT	0.403																																						.											0													57.0	63.0	61.0					11																	34118204		2202	4298	6500	SO:0001589	frameshift_variant	4076			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1884delT	11.37:g.34118204delT	ENSP00000340329:p.Pro628fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Frame_Shift_Del	DEL	ENST00000341394.4	37	CCDS31453.1																																																																																				0.403	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
CEP290	80184	broad.mit.edu	37	12	88443060	88443060	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:88443060delT	ENST00000552810.1	-	54	7684	c.7341delA	c.(7339-7341)aaafs	p.K2447fs	CEP290_ENST00000547691.2_Frame_Shift_Del_p.K1507fs|RNA5SP364_ENST00000516938.1_RNA|CEP290_ENST00000309041.7_Frame_Shift_Del_p.K2449fs|C12orf29_ENST00000356891.3_3'UTR|CEP290_ENST00000397838.3_Frame_Shift_Del_p.K1507fs	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	2447					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GTTCTGAAAGTTTTTTTACCT	0.308																																						.											0													80.0	79.0	80.0					12																	88443060		1796	4061	5857	SO:0001589	frameshift_variant	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.7341delA	12.37:g.88443060delT	ENSP00000448012:p.Lys2447fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Del	DEL	ENST00000552810.1	37	CCDS55858.1																																																																																				0.308	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
BRAP	8315	broad.mit.edu;mdanderson.org;bcgsc.ca	37	12	112082340	112082340	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:112082340G>A	ENST00000327551.6	-	12	1492	c.1352C>T	c.(1351-1353)gCc>gTc	p.A451V	BRAP_ENST00000419234.4_Missense_Mutation_p.A481V|BRAP_ENST00000539060.1_Missense_Mutation_p.A302V			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						GGTGAGTTTGGCCACTTTTGT	0.458																																					Pancreas(146;846 1904 7830 25130 26065)	.											0													106.0	99.0	102.0					12																	112082340		2203	4300	6503	SO:0001583	missense	8315			AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1352C>T	12.37:g.112082340G>A	ENSP00000330813:p.Ala451Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000327551.6	37		.	.	.	.	.	.	.	.	.	.	G	14.69	2.610943	0.46631	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	T;T;T	0.46819	0.86;0.89;0.88	5.8	5.8	0.92144	.	0.105878	0.64402	D	0.000003	T	0.41604	0.1166	L	0.39397	1.21	0.58432	D	0.999994	B;B	0.06786	0.0;0.001	B;B	0.10450	0.0;0.005	T	0.13442	-1.0509	10	0.30078	T	0.28	-14.4681	16.3021	0.82825	0.0:0.1322:0.8678:0.0	.	302;481	B4DRM1;Q7Z569	.;BRAP_HUMAN	V	481;302;451;263	ENSP00000403524:A481V;ENSP00000441659:A302V;ENSP00000330813:A451V	ENSP00000330813:A451V	A	-	2	0	BRAP	110566723	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.532000	0.67154	2.737000	0.93849	0.557000	0.71058	GCC		0.458	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
WDR66	144406	broad.mit.edu	37	12	122361543	122361543	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:122361543A>G	ENST00000288912.4	+	3	1248	c.394A>G	c.(394-396)Agc>Ggc	p.S132G	WDR66_ENST00000397454.2_Missense_Mutation_p.S132G	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	132							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CCAAAGAGGTAGCAAGTCAAA	0.363																																					Esophageal Squamous(85;849 1794 49757 52143)	.											0													72.0	66.0	68.0					12																	122361543		1831	4084	5915	SO:0001583	missense	144406			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.394A>G	12.37:g.122361543A>G	ENSP00000288912:p.Ser132Gly	Somatic		WXS	Illumina HiSeq	Phase_I	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	ENST00000288912.4	37	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	A	6.574	0.474291	0.12521	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.18338	2.22;2.22	3.04	0.672	0.17935	.	1.271310	0.05890	N	0.628150	T	0.09818	0.0241	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35822	-0.9773	10	0.32370	T	0.25	.	4.7844	0.13219	0.7199:0.0:0.2801:0.0	.	132	Q8TBY9	WDR66_HUMAN	G	132	ENSP00000288912:S132G;ENSP00000380595:S132G	ENSP00000288912:S132G	S	+	1	0	WDR66	120845926	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.276000	0.18716	0.130000	0.18549	0.377000	0.23210	AGC		0.363	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668	
ASB7	140460	broad.mit.edu	37	15	101170058	101170058	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr15:101170058C>T	ENST00000332783.7	+	5	1413	c.628C>T	c.(628-630)Cgc>Tgc	p.R210C	ASB7_ENST00000558747.1_Intron|ASB7_ENST00000343276.4_Missense_Mutation_p.R210C	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	210					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.R210C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			AAACTTGGGTCGCTTAGAAGA	0.473																																						.											1	Substitution - Missense(1)	lung(1)											123.0	103.0	109.0					15																	101170058		2203	4300	6503	SO:0001583	missense	140460				CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.628C>T	15.37:g.101170058C>T	ENSP00000328327:p.Arg210Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1E5|Q6GSJ6|Q7Z4S3	Missense_Mutation	SNP	ENST00000332783.7	37	CCDS10387.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548738	0.86127	.	.	ENSG00000183475	ENST00000332783;ENST00000343276	T;T	0.53206	0.63;0.63	5.53	5.53	0.82687	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.64011	0.2560	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.69654	0.965;0.932	T	0.65508	-0.6151	10	0.87932	D	0	-1.3671	14.655	0.68825	0.1454:0.8546:0.0:0.0	.	210;210	Q9H672;Q9H672-2	ASB7_HUMAN;.	C	210	ENSP00000328327:R210C;ENSP00000339819:R210C	ENSP00000328327:R210C	R	+	1	0	ASB7	98987581	0.996000	0.38824	0.999000	0.59377	0.994000	0.84299	3.434000	0.52841	2.755000	0.94549	0.650000	0.86243	CGC		0.473	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313617.1	NM_024708	
PRSS36	146547	broad.mit.edu	37	16	31154780	31154780	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr16:31154780G>T	ENST00000268281.4	-	8	1041	c.983C>A	c.(982-984)gCc>gAc	p.A328D	PRSS36_ENST00000569305.1_Missense_Mutation_p.A328D|PRSS36_ENST00000418068.2_Missense_Mutation_p.A328D	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	328	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						TGGCCGCGGGGCCTTCCCGCA	0.667																																						.											0													27.0	33.0	31.0					16																	31154780		2197	4300	6497	SO:0001583	missense	146547			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.983C>A	16.37:g.31154780G>T	ENSP00000268281:p.Ala328Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	G	8.398	0.841279	0.16891	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.88509	-2.39;-2.39	4.11	3.12	0.35913	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.85318	0.5669	N	0.13327	0.33	0.09310	N	0.999997	D;D;D	0.71674	0.986;0.998;0.998	P;D;D	0.69824	0.823;0.966;0.966	T	0.73145	-0.4075	9	0.02654	T	1	.	9.4339	0.38626	0.0:0.2171:0.7829:0.0	.	328;328;328	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	D	328	ENSP00000268281:A328D;ENSP00000407160:A328D	ENSP00000268281:A328D	A	-	2	0	PRSS36	31062281	0.181000	0.23161	0.573000	0.28510	0.893000	0.52053	1.534000	0.36051	0.901000	0.36495	0.491000	0.48974	GCC		0.667	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502	
KAT7	11143	broad.mit.edu;ucsc.edu	37	17	47893250	47893250	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:47893250C>A	ENST00000259021.4	+	8	1218	c.938C>A	c.(937-939)gCa>gAa	p.A313E	KAT7_ENST00000454930.2_Missense_Mutation_p.A174E|KAT7_ENST00000424009.2_Missense_Mutation_p.A283E|KAT7_ENST00000435742.2_Missense_Mutation_p.A127E|KAT7_ENST00000503935.2_Missense_Mutation_p.A157E|KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000509773.1_Missense_Mutation_p.A203E|KAT7_ENST00000510819.1_Missense_Mutation_p.A144E	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	313					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TTCCGAAGAGCACAAGCCCGG	0.448																																						.											0													75.0	75.0	75.0					17																	47893250		2203	4300	6503	SO:0001583	missense	11143			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.938C>A	17.37:g.47893250C>A	ENSP00000259021:p.Ala313Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	37	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	C	34	5.317390	0.95682	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.84795	0.5551	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.997;0.991;0.997;0.998;0.999;0.998	D	0.86860	0.2029	9	0.87932	D	0	-13.841	18.8697	0.92308	0.0:1.0:0.0:0.0	.	276;144;203;174;313;283	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;.;KAT7_HUMAN;.	E	313;174;203;144;283;157;127	.	ENSP00000259021:A313E	A	+	2	0	KAT7	45248249	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.926000	0.75835	2.788000	0.95919	0.650000	0.86243	GCA		0.448	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
GPS1	2873	broad.mit.edu	37	17	80010268	80010268	+	Intron	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:80010268T>C	ENST00000306823.6	+	1	56				RFNG_ENST00000584838.1_5'Flank|GPS1_ENST00000355130.2_Missense_Mutation_p.V29A|GPS1_ENST00000578552.1_Intron|GPS1_ENST00000392358.2_Missense_Mutation_p.V29A|GPS1_ENST00000320548.4_5'UTR|RFNG_ENST00000429557.3_5'Flank|RFNG_ENST00000310496.4_5'Flank			Q13098	CSN1_HUMAN	G protein pathway suppressor 1						cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TCAGACCTCGTCCTGCCCGGC	0.647																																						.											0													43.0	39.0	40.0					17																	80010268		2196	4298	6494	SO:0001627	intron_variant	2873				CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.33+428T>C	17.37:g.80010268T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NA10|Q9BWL1	Missense_Mutation	SNP	ENST00000306823.6	37	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	T	8.338	0.828139	0.16749	.	.	ENSG00000169727	ENST00000392358;ENST00000320548;ENST00000355130	.	.	.	3.33	2.24	0.28232	.	.	.	.	.	T	0.15219	0.0367	N	0.08118	0	0.20764	N	0.99986	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28427	-1.0044	8	0.07175	T	0.84	-9.2856	7.3296	0.26575	0.0:0.1963:0.0:0.8037	.	29;29	A8K070;Q13098-7	.;.	A	29;57;29	.	ENSP00000313569:V57A	V	+	2	0	GPS1	77603557	0.113000	0.22115	0.585000	0.28666	0.356000	0.29392	0.467000	0.22035	1.141000	0.42275	0.240000	0.17902	GTC		0.647	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492	
ASXL3	80816	broad.mit.edu	37	18	31325884	31325884	+	Silent	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr18:31325884T>C	ENST00000269197.5	+	12	6072	c.6072T>C	c.(6070-6072)ccT>ccC	p.P2024P		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2024	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						cgcctccccctccccctccac	0.602																																						.											0													10.0	13.0	12.0					18																	31325884		1819	4049	5868	SO:0001819	synonymous_variant	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6072T>C	18.37:g.31325884T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	CCDS45847.1																																																																																				0.602	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
EPG5	57724	broad.mit.edu	37	18	43534970	43534970	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr18:43534970T>C	ENST00000282041.5	-	2	432	c.398A>G	c.(397-399)gAa>gGa	p.E133G		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	133					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CTTGGGGGTTTCTACTTTAGT	0.498																																						.											0													105.0	100.0	101.0					18																	43534970		1883	4105	5988	SO:0001583	missense	57724			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.398A>G	18.37:g.43534970T>C	ENSP00000282041:p.Glu133Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	12.22	1.873783	0.33069	.	.	ENSG00000152223	ENST00000282041	T	0.13307	2.6	5.76	1.96	0.26148	.	1.429990	0.03915	N	0.282546	T	0.10423	0.0255	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.33929	-0.9849	10	0.62326	D	0.03	-0.0288	5.1599	0.15056	0.1319:0.1426:0.0:0.7255	.	133;133	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	G	133	ENSP00000282041:E133G	ENSP00000282041:E133G	E	-	2	0	EPG5	41788968	0.478000	0.25917	0.000000	0.03702	0.044000	0.14063	1.758000	0.38410	0.089000	0.17243	0.460000	0.39030	GAA		0.498	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
NDUFS1	4719	broad.mit.edu	37	2	206988916	206988916	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:206988916A>G	ENST00000233190.6	-	19	2443	c.2177T>C	c.(2176-2178)aTa>aCa	p.I726T	AC007383.4_ENST00000453039.1_RNA|NDUFS1_ENST00000455934.2_Missense_Mutation_p.I740T|NDUFS1_ENST00000457011.1_Missense_Mutation_p.I610T|NDUFS1_ENST00000440274.1_Missense_Mutation_p.I690T|NDUFS1_ENST00000449699.1_Missense_Mutation_p.I726T|NDUFS1_ENST00000423725.1_Missense_Mutation_p.I669T|NDUFS1_ENST00000432169.1_Missense_Mutation_p.I615T	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	726					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTTCAGCATATGGATGGTTC	0.408																																						.											0													116.0	97.0	104.0					2																	206988916		2203	4300	6503	SO:0001583	missense	4719				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.2177T>C	2.37:g.206988916A>G	ENSP00000233190:p.Ile726Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	37	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.608040	0.46527	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.88431	-2.35;-2.33;-2.23;-2.24;-2.38;-2.35;-2.23	5.26	5.26	0.73747	.	0.137318	0.64402	D	0.000007	D	0.83510	0.5270	L	0.36672	1.1	0.47407	D	0.99941	B;B;B;B	0.25955	0.138;0.049;0.025;0.007	B;B;B;B	0.19666	0.022;0.026;0.013;0.013	T	0.81996	-0.0676	10	0.72032	D	0.01	-10.7223	12.3475	0.55130	0.8595:0.1405:0.0:0.0	.	615;690;740;726	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	T	726;669;610;690;740;726;615	ENSP00000233190:I726T;ENSP00000397760:I669T;ENSP00000400976:I610T;ENSP00000409766:I690T;ENSP00000392709:I740T;ENSP00000399912:I726T;ENSP00000409689:I615T	ENSP00000233190:I726T	I	-	2	0	NDUFS1	206697161	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	5.774000	0.68906	1.988000	0.58038	0.460000	0.39030	ATA		0.408	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
SLC32A1	140679	broad.mit.edu	37	20	37356927	37356927	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr20:37356927C>T	ENST00000217420.1	+	2	1486	c.1223C>T	c.(1222-1224)tCg>tTg	p.S408L		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	408					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CTGGAGAAGTCGCTCTTCCAG	0.657																																						.											0													56.0	57.0	56.0					20																	37356927		2203	4300	6503	SO:0001583	missense	140679			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1223C>T	20.37:g.37356927C>T	ENSP00000217420:p.Ser408Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013250	0.35511	.	.	ENSG00000101438	ENST00000217420	T	0.02121	4.44	4.45	4.45	0.53987	.	0.125962	0.56097	D	0.000035	T	0.01800	0.0057	N	0.16743	0.435	0.58432	D	0.999998	B	0.20459	0.045	B	0.12837	0.008	T	0.51988	-0.8635	10	0.08381	T	0.77	-9.6575	14.9208	0.70835	0.0:1.0:0.0:0.0	.	408	Q9H598	VIAAT_HUMAN	L	408	ENSP00000217420:S408L	ENSP00000217420:S408L	S	+	2	0	SLC32A1	36790341	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.968000	0.70413	2.202000	0.70862	0.563000	0.77884	TCG		0.657	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
USP16	10600	broad.mit.edu	37	21	30409627	30409627	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr21:30409627A>G	ENST00000334352.4	+	7	710	c.479A>G	c.(478-480)gAa>gGa	p.E160G	USP16_ENST00000399976.2_Missense_Mutation_p.E160G|USP16_ENST00000399975.3_Missense_Mutation_p.E159G|USP16_ENST00000535828.1_Intron	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16											breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						ATTGAACTTGAAAATAAAAAA	0.303																																					Melanoma(92;625 1444 27493 34101 44971)	.											0													46.0	53.0	51.0					21																	30409627		2201	4299	6500	SO:0001583	missense	10600			AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.479A>G	21.37:g.30409627A>G	ENSP00000334808:p.Glu160Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000334352.4	37	CCDS13583.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587621	0.46110	.	.	ENSG00000156256	ENST00000399975;ENST00000399976;ENST00000334352	T;T;T	0.07021	3.23;3.24;3.24	5.9	5.9	0.94986	.	0.275088	0.41097	D	0.000948	T	0.05868	0.0153	N	0.14661	0.345	0.80722	D	1	B;B;B	0.12013	0.003;0.002;0.005	B;B;B	0.09377	0.003;0.004;0.002	T	0.42068	-0.9473	10	0.32370	T	0.25	.	12.1736	0.54173	0.9318:0.0:0.0682:0.0	.	145;159;160	Q9Y5T5-3;Q9Y5T5-2;Q9Y5T5	.;.;UBP16_HUMAN	G	159;160;160	ENSP00000382857:E159G;ENSP00000382858:E160G;ENSP00000334808:E160G	ENSP00000334808:E160G	E	+	2	0	USP16	29331498	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.616000	0.46376	2.251000	0.74343	0.528000	0.53228	GAA		0.303	USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171847.1		
SCN5A	6331	broad.mit.edu	37	3	38592026	38592026	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:38592026C>A	ENST00000333535.4	-	28	5986	c.5837G>T	c.(5836-5838)gGc>gTc	p.G1946V	SCN5A_ENST00000425664.1_Missense_Mutation_p.G1928V|SCN5A_ENST00000449557.2_Missense_Mutation_p.G1892V|SCN5A_ENST00000423572.2_Missense_Mutation_p.G1945V|SCN5A_ENST00000414099.2_Missense_Mutation_p.G1928V|SCN5A_ENST00000455624.2_Missense_Mutation_p.G1913V|SCN5A_ENST00000443581.1_Missense_Mutation_p.G1945V|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000450102.2_Missense_Mutation_p.G1892V|SCN5A_ENST00000451551.2_Missense_Mutation_p.G1892V|SCN5A_ENST00000413689.1_Missense_Mutation_p.G1946V			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1946					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GGCGATGAGGCCCTCTCGCTC	0.622																																						.											0													38.0	46.0	44.0					3																	38592026		2070	4192	6262	SO:0001583	missense	6331			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5837G>T	3.37:g.38592026C>A	ENSP00000328968:p.Gly1946Val	Somatic		WXS	Illumina HiSeq	Phase_I	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639836	0.67244	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96073	-3.84;-3.87;-3.87;-3.85;-3.87;-3.84;-3.87;-3.9;-3.85;-3.85	4.95	4.95	0.65309	.	0.108732	0.64402	D	0.000007	D	0.97763	0.9266	M	0.82193	2.58	0.80722	D	1	P;D;D;B;D;B	0.89917	0.784;1.0;0.996;0.404;0.998;0.336	P;D;D;B;D;B	0.91635	0.596;0.999;0.969;0.253;0.979;0.34	D	0.97752	1.0215	10	0.48119	T	0.1	.	18.3714	0.90408	0.0:1.0:0.0:0.0	.	1892;1913;1928;1946;1945;1946	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	V	1928;1945;1946;1892;1945;1928;1946;1913;1892;1892	ENSP00000398962:G1928V;ENSP00000398266:G1945V;ENSP00000410257:G1946V;ENSP00000388797:G1892V;ENSP00000397915:G1945V;ENSP00000416634:G1928V;ENSP00000328968:G1946V;ENSP00000399524:G1913V;ENSP00000403355:G1892V;ENSP00000413996:G1892V	ENSP00000328968:G1946V	G	-	2	0	SCN5A	38567030	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.624000	0.61254	2.573000	0.86826	0.655000	0.94253	GGC		0.622	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
CRIPAK	285464	broad.mit.edu	37	4	1388673	1388673	+	Frame_Shift_Del	DEL	C	C	-	rs532285367|rs541930803	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr4:1388673delC	ENST00000324803.4	+	1	3334	c.374delC	c.(373-375)gccfs	p.A125fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	125					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			ATGCGGAGTGCCCGCCTGCTC	0.697													|||unknown(ALL_OTHER_Ns)	102	0.0203674	0.0121	0.0274	5008	,	,		14414	0.0149		0.0417	False		,,,				2504	0.0102					.											0													116.0	111.0	113.0					4																	1388673		2203	4300	6503	SO:0001589	frameshift_variant	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.374delC	4.37:g.1388673delC	ENSP00000323978:p.Ala125fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB03	Frame_Shift_Del	DEL	ENST00000324803.4	37	CCDS3349.1																																																																																				0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
DNAH5	1767	broad.mit.edu;mdanderson.org;bcgsc.ca	37	5	13708238	13708238	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr5:13708238C>T	ENST00000265104.4	-	76	13436	c.13332G>A	c.(13330-13332)tgG>tgA	p.W4444*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4444					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTACTTTTTTCCACCAAGCAG	0.403									Kartagener syndrome																													.											0													175.0	162.0	166.0					5																	13708238		2203	4300	6503	SO:0001587	stop_gained	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13332G>A	5.37:g.13708238C>T	ENSP00000265104:p.Trp4444*	Somatic		WXS	Illumina HiSeq	Phase_I	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	55	24.226362	0.99959	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.8429	0.92192	0.0:1.0:0.0:0.0	.	.	.	.	X	4444	.	ENSP00000265104:W4444X	W	-	3	0	DNAH5	13761238	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.642000	0.83385	2.521000	0.84997	0.655000	0.94253	TGG		0.403	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
RANBP9	10048	broad.mit.edu	37	6	13638047	13638047	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr6:13638047A>G	ENST00000011619.3	-	10	1724	c.1666T>C	c.(1666-1668)Ttc>Ctc	p.F556L	RANBP9_ENST00000539980.1_Missense_Mutation_p.F327L	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	556					axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			TACCTGGTGAAGTTATTAACT	0.313																																						.											0													192.0	187.0	188.0					6																	13638047		2202	4300	6502	SO:0001583	missense	10048			AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.1666T>C	6.37:g.13638047A>G	ENSP00000011619:p.Phe556Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.013244	0.35511	.	.	ENSG00000010017	ENST00000011619;ENST00000539980	T	0.76448	-1.02	5.96	5.96	0.96718	.	0.306271	0.39909	N	0.001223	T	0.58595	0.2133	L	0.33485	1.01	0.46222	D	0.99893	B	0.31125	0.309	B	0.37550	0.253	T	0.60490	-0.7253	10	0.11794	T	0.64	-11.6893	16.4221	0.83766	1.0:0.0:0.0:0.0	.	556	Q96S59	RANB9_HUMAN	L	556;327	ENSP00000011619:F556L	ENSP00000011619:F556L	F	-	1	0	RANBP9	13746026	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.283000	0.76528	0.477000	0.44152	TTC		0.313	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
COL12A1	1303	broad.mit.edu;mdanderson.org	37	6	75843574	75843574	+	Splice_Site	SNP	C	C	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr6:75843574C>A	ENST00000322507.8	-	33	5973	c.5664G>T	c.(5662-5664)ctG>ctT	p.L1888L	COL12A1_ENST00000416123.2_Splice_Site_p.L1888L|COL12A1_ENST00000345356.6_Splice_Site_p.L724L|COL12A1_ENST00000483888.2_Splice_Site_p.L1888L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1888	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AAATAATTACCAGTTCCTCTG	0.433																																						.											0													85.0	82.0	83.0					6																	75843574		1872	4110	5982	SO:0001630	splice_region_variant	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5664+1G>T	6.37:g.75843574C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545989	0.45383	.	.	ENSG00000111799	ENST00000419671	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	T	0.71970	0.3403	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68762	-0.5323	4	.	.	.	.	20.1772	0.98182	0.0:1.0:0.0:0.0	.	.	.	.	C	623	.	.	G	-	1	0	COL12A1	75900294	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.629000	0.61290	2.778000	0.95560	0.655000	0.94253	GGT		0.433	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	Silent
ISPD	729920	broad.mit.edu	37	7	16341081	16341081	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr7:16341081T>C	ENST00000407010.2	-	5	799	c.800A>G	c.(799-801)aAa>aGa	p.K267R	ISPD_ENST00000399310.3_Missense_Mutation_p.K217R|ISPD_ENST00000479493.1_5'UTR	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	267					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						GAGATCTCGTTTGTAGGTCAC	0.388										Multiple Myeloma(15;0.18)																												.											0													88.0	80.0	82.0					7																	16341081		1856	4101	5957	SO:0001583	missense	729920			AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.800A>G	7.37:g.16341081T>C	ENSP00000385478:p.Lys267Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		.	.	.	.	.	.	.	.	.	.	T	13.82	2.350427	0.41599	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.85484	-1.99;-1.99	5.15	3.97	0.46021	4-diphosphocytidyl-2C-methyl-D-erythritol synthase (1);	0.199344	0.40554	U	0.001079	T	0.72078	0.3416	N	0.12471	0.22	0.40186	D	0.977343	B	0.24618	0.107	B	0.32762	0.152	T	0.66044	-0.6021	10	0.12766	T	0.61	0.0762	11.4619	0.50215	0.0:0.0746:0.0:0.9254	.	267	A4D126	ISPD_HUMAN	R	267;217	ENSP00000385478:K267R;ENSP00000382249:K217R	ENSP00000382249:K217R	K	-	2	0	ISPD	16307606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.956000	0.49129	2.064000	0.61679	0.533000	0.62120	AAA		0.388	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
GTF2IRD1	9569	broad.mit.edu	37	7	74016919	74016919	+	IGR	DEL	A	A	-	rs375971244|rs201863282		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr7:74016919delA	ENST00000265755.3	+	0	3430				GTF2IRD1_ENST00000455841.2_3'UTR|GTF2IRD1_ENST00000424337.2_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1						multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GTAAAAAAAGAAAAAAAAAAA	0.373																																						.											0																																										SO:0001628	intergenic_variant	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782		7.37:g.74016919delA		Somatic		WXS	Illumina HiSeq	Phase_I	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Splice_Site	DEL	ENST00000265755.3	37	CCDS5571.1																																																																																				0.373	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
ZAN	7455	broad.mit.edu;mdanderson.org;bcgsc.ca	37	7	100390083	100390083	+	RNA	SNP	G	G	A	rs376796357		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr7:100390083G>A	ENST00000348028.3	+	0	7933				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GAGGAGCTGCGTTGCCAGGTC	0.667																																						.											0								G	HIS/ARG,HIS/ARG	1,4205		0,1,2102	43.0	45.0	44.0		7768,7768	3.4	1.0	7		44	0,8440		0,0,4220	no	missense,missense	ZAN	NM_003386.1,NM_173059.1	29,29	0,1,6322	AA,AG,GG		0.0,0.0238,0.0079	probably-damaging,probably-damaging	2590/2813,2590/2722	100390083	1,12645	2103	4220	6323			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100390083G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.156|8.156	0.788519|0.788519	0.16258|0.16258	2.38E-4|2.38E-4	0.0|0.0	ENSG00000146839|ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585|ENST00000546213	T;T;T|T	0.76968|0.24350	-1.06;-1.06;-1.06|1.86	3.39|3.39	3.39|3.39	0.38822|0.38822	Uncharacterised domain, cysteine-rich (2);|.	0.253625|.	0.20874|.	N|.	0.084101|.	T|T	0.13200|0.13200	0.0320|0.0320	N|N	0.08118|0.08118	0|0	0.20873|0.20873	N|N	0.999835|0.999835	D;D|B	0.89917|0.30482	1.0;1.0|0.281	D;D|B	0.81914|0.21917	0.992;0.995|0.037	T|T	0.12319|0.12319	-1.0552|-1.0552	10|9	0.62326|0.87932	D|D	0.03|0	.|.	10.585|10.585	0.45278|0.45278	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2589;2590|1006	F5H0T8;Q9Y493|F5GX59	.;ZAN_HUMAN|.	H|I	2589|1006	ENSP00000445943:R2589H;ENSP00000445091:R2589H;ENSP00000444427:R2589H|ENSP00000441117:V1006I	ENSP00000445091:R2589H|ENSP00000423579:V2590I	R|V	+|+	2|1	0|0	ZAN|ZAN	100228019|100228019	0.670000|0.670000	0.27512|0.27512	0.971000|0.971000	0.41717|0.41717	0.431000|0.431000	0.31685|0.31685	2.708000|2.708000	0.47152|0.47152	2.206000|2.206000	0.71126|0.71126	0.561000|0.561000	0.74099|0.74099	CGT|GTT		0.667	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
NCAPG2	54892	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	158485614	158485614	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr7:158485614G>A	ENST00000409423.1	-	5	474	c.302C>T	c.(301-303)tCt>tTt	p.S101F	NCAPG2_ENST00000479022.1_5'Flank|NCAPG2_ENST00000409339.3_Missense_Mutation_p.S101F|NCAPG2_ENST00000449727.2_Missense_Mutation_p.S101F|NCAPG2_ENST00000356309.3_Missense_Mutation_p.S101F	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	101					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		AAGAATCACAGATGTAATTGC	0.279																																						.											0													117.0	113.0	114.0					7																	158485614		1813	4066	5879	SO:0001583	missense	54892			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.302C>T	7.37:g.158485614G>A	ENSP00000386569:p.Ser101Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	ENST00000409423.1	37	CCDS43686.1	.	.	.	.	.	.	.	.	.	.	G	4.849	0.157781	0.09236	.	.	ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000409339;ENST00000449727	T;T;T;T	0.32515	1.46;1.46;1.45;1.45	5.41	3.47	0.39725	Armadillo-type fold (1);	0.551643	0.21031	N	0.081352	T	0.22781	0.0550	L	0.44542	1.39	0.25303	N	0.989266	B;B	0.28584	0.216;0.138	B;B	0.26969	0.075;0.012	T	0.14980	-1.0453	10	0.10377	T	0.69	-15.4578	11.8548	0.52431	0.0:0.1316:0.7322:0.1361	.	101;101	Q86XI2-2;Q86XI2	.;CNDG2_HUMAN	F	101	ENSP00000348657:S101F;ENSP00000386569:S101F;ENSP00000387007:S101F;ENSP00000388326:S101F	ENSP00000348657:S101F	S	-	2	0	NCAPG2	158178375	0.998000	0.40836	0.980000	0.43619	0.637000	0.38172	2.751000	0.47508	1.400000	0.46741	0.484000	0.47621	TCT		0.279	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760	
WWP1	11059	broad.mit.edu	37	8	87414376	87414376	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr8:87414376delG	ENST00000517970.1	+	8	975	c.668delG	c.(667-669)agafs	p.R223fs	WWP1_ENST00000265428.4_Frame_Shift_Del_p.R223fs|WWP1_ENST00000341922.2_Intron|WWP1_ENST00000349423.2_Intron	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	223					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GTTGCTGCCAGACCCAAAAAT	0.443																																						.											0													105.0	89.0	94.0					8																	87414376		2203	4300	6503	SO:0001589	frameshift_variant	11059			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.668delG	8.37:g.87414376delG	ENSP00000427793:p.Arg223fs	Somatic		WXS	Illumina HiSeq	Phase_I	O00307|Q5YLC1|Q96BP4	Frame_Shift_Del	DEL	ENST00000517970.1	37	CCDS6242.1																																																																																				0.443	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
AGO2	27161	broad.mit.edu	37	8	141551316	141551316	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr8:141551316G>T	ENST00000220592.5	-	15	2093	c.1981C>A	c.(1981-1983)Ccc>Acc	p.P661T	AGO2_ENST00000519980.1_Missense_Mutation_p.P661T	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	661	Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										ATGCGGGTGGGCTTGAAGCGC	0.612																																						.											0													110.0	86.0	94.0					8																	141551316		2200	4300	6500	SO:0001583	missense	27161			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1981C>A	8.37:g.141551316G>T	ENSP00000220592:p.Pro661Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988289	0.93106	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.49432	0.78;0.78	5.36	5.36	0.76844	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.84079	0.5393	H	0.99675	4.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91325	0.5085	10	0.72032	D	0.01	-18.2573	19.4371	0.94799	0.0:0.0:1.0:0.0	.	661;661	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	T	661	ENSP00000220592:P661T;ENSP00000430176:P661T	ENSP00000220592:P661T	P	-	1	0	EIF2C2	141620498	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.774000	0.98992	2.642000	0.89623	0.650000	0.86243	CCC		0.612	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4		
FAM154A	158297	broad.mit.edu;mdanderson.org;bcgsc.ca	37	9	18941779	18941779	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr9:18941779C>T	ENST00000380534.4	-	3	556	c.277G>A	c.(277-279)Gtc>Atc	p.V93I	FAM154A_ENST00000542071.1_Intron|FAM154A_ENST00000380530.1_Intron	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A	93										breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		TCACTCGGGACGAACTGGTCA	0.502																																						.											0													180.0	155.0	164.0					9																	18941779		2203	4300	6503	SO:0001583	missense	158297			BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.277G>A	9.37:g.18941779C>T	ENSP00000369907:p.Val93Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VY58	Missense_Mutation	SNP	ENST00000380534.4	37	CCDS6487.1	.	.	.	.	.	.	.	.	.	.	c	3.915	-0.019391	0.07634	.	.	ENSG00000155875	ENST00000380534	T	0.16897	2.31	5.83	-7.19	0.01500	.	0.944627	0.08746	N	0.899840	T	0.09423	0.0232	L	0.33245	0.995	0.32505	N	0.538404	B	0.24043	0.096	B	0.21151	0.033	T	0.31696	-0.9934	10	0.37606	T	0.19	-2.363	5.6389	0.17552	0.1061:0.1619:0.1047:0.6273	.	93	Q8IYX7	F154A_HUMAN	I	93	ENSP00000369907:V93I	ENSP00000369907:V93I	V	-	1	0	FAM154A	18931779	0.000000	0.05858	0.004000	0.12327	0.047000	0.14425	-2.446000	0.01010	-0.728000	0.04882	0.550000	0.68814	GTC		0.502	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051811.1	NM_153707	
ENTPD2	954	broad.mit.edu	37	9	139946006	139946006	+	Silent	SNP	G	G	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr9:139946006G>T	ENST00000355097.2	-	3	389	c.342C>A	c.(340-342)ggC>ggA	p.G114G	ENTPD2_ENST00000312665.5_Silent_p.G114G|RP11-229P13.15_ENST00000439076.1_RNA|ENTPD2_ENST00000460614.1_5'Flank	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	114					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGAGGGGTGTGCCCGCGTGTC	0.617																																						.											0													67.0	64.0	65.0					9																	139946006		2202	4299	6501	SO:0001819	synonymous_variant	954			U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.342C>A	9.37:g.139946006G>T		Somatic		WXS	Illumina HiSeq	Phase_I	O15464|Q5SPY6|Q5SPY7	Silent	SNP	ENST00000355097.2	37	CCDS7026.1																																																																																				0.617	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055169.1	NM_203468	
NHSL2	340527	broad.mit.edu	37	X	71360546	71360546	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chrX:71360546G>A	ENST00000373677.1	+	2	3312	c.2050G>A	c.(2050-2052)Gat>Aat	p.D684N	NHSL2_ENST00000510661.1_Missense_Mutation_p.D819N|NHSL2_ENST00000540800.1_Missense_Mutation_p.D1050N|NHSL2_ENST00000535692.1_Missense_Mutation_p.D684N			Q5HYW2	NHSL2_HUMAN	NHS-like 2	684										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CGCCACCGGCGATGACCTGCA	0.552																																						.											0													54.0	49.0	51.0					X																	71360546		2203	4300	6503	SO:0001583	missense	340527					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.2050G>A	X.37:g.71360546G>A	ENSP00000362781:p.Asp684Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN94	Missense_Mutation	SNP	ENST00000373677.1	37		.	.	.	.	.	.	.	.	.	.	G	13.38	2.218648	0.39201	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.50548	1.51;0.79;0.74;0.79	6.08	2.02	0.26589	.	0.624103	0.15395	N	0.264638	T	0.37705	0.1013	L	0.51422	1.61	0.09310	N	1	B;B;B	0.18741	0.017;0.03;0.007	B;B;B	0.09377	0.004;0.004;0.003	T	0.22906	-1.0203	10	0.30078	T	0.28	0.5596	7.9991	0.30286	0.4905:0.0:0.5095:0.0	.	1050;819;684	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	N	1050;684;819;684	ENSP00000444617:D1050N;ENSP00000362781:D684N;ENSP00000424079:D819N;ENSP00000444914:D684N	ENSP00000362781:D684N	D	+	1	0	NHSL2	71277271	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.211000	0.17474	-0.054000	0.13266	0.600000	0.82982	GAT		0.552	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
ATP2B4	493	broad.mit.edu	37	1	203693038	203693039	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:203693038_203693039insT	ENST00000357681.5	+	19	4177_4178	c.3054_3055insT	c.(3055-3057)ttcfs	p.F1019fs	ATP2B4_ENST00000391954.2_Intron|ATP2B4_ENST00000341360.2_Frame_Shift_Ins_p.F1019fs|ATP2B4_ENST00000367218.3_Frame_Shift_Ins_p.F1019fs|ATP2B4_ENST00000367219.3_Frame_Shift_Ins_p.F1007fs	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1019					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGGGTAAACCCTTCAGTTGTAC	0.545																																						.											0																																										SO:0001589	frameshift_variant	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3056dupT	1.37:g.203693040_203693040dupT	ENSP00000350310:p.Phe1019fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Frame_Shift_Ins	INS	ENST00000357681.5	37	CCDS1440.1																																																																																				0.545	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	
MYRF	745	broad.mit.edu	37	11	61537812	61537813	+	Frame_Shift_Ins	INS	-	-	C	rs531308836	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:61537812_61537813insC	ENST00000278836.5	+	5	651_652	c.555_556insC	c.(556-558)ccafs	p.P186fs	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000265460.5_Frame_Shift_Ins_p.P177fs	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	186	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CAGCCCACTTGCCAGGCCCCCC	0.688																																						.											0																																										SO:0001589	frameshift_variant	745				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.557dupC	11.37:g.61537814_61537814dupC	ENSP00000278836:p.Pro186fs	Somatic		WXS	Illumina HiSeq	Phase_I	O43582|Q9P1Q6	Frame_Shift_Ins	INS	ENST00000278836.5	37	CCDS44622.1																																																																																				0.688	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279	
FRMD8	83786	broad.mit.edu	37	11	65172422	65172423	+	Frame_Shift_Ins	INS	-	-	C	rs139552682		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:65172422_65172423insC	ENST00000317568.5	+	10	1322_1323	c.1159_1160insC	c.(1159-1161)tcgfs	p.S387fs	FRMD8_ENST00000416776.2_Frame_Shift_Ins_p.S353fs|FRMD8_ENST00000355991.5_Frame_Shift_Ins_p.S331fs	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	387						cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						TGCGACTGGCTCGCCCTCGGAC	0.663																																						.											0																																										SO:0001589	frameshift_variant	83786			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.1160dupC	11.37:g.65172423_65172423dupC	ENSP00000319726:p.Ser387fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4E2P1|Q86V56|Q8NCB5	Frame_Shift_Ins	INS	ENST00000317568.5	37	CCDS8102.1																																																																																				0.663	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
KMT2D	8085	broad.mit.edu	37	12	49415604	49415605	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:49415604_49415605insG	ENST00000301067.7	-	54	16571_16572	c.16572_16573insC	c.(16570-16575)ccctgcfs	p.C5525fs	RP11-386G11.5_ENST00000547866.1_RNA|PRKAG1_ENST00000548065.1_5'Flank|RP11-386G11.5_ENST00000552933.1_RNA	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5525	Post-SET. {ECO:0000255|PROSITE- ProRule:PRU00155}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCACAGTGGCAGGGGATCTTGT	0.51																																						.											0																																										SO:0001589	frameshift_variant	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.16573dupC	12.37:g.49415608_49415608dupG	ENSP00000301067:p.Cys5525fs	Somatic		WXS	Illumina HiSeq	Phase_I	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																				0.510	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CALML4	91860	broad.mit.edu	37	15	68489865	68489866	+	In_Frame_Ins	INS	-	-	CAT			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr15:68489865_68489866insCAT	ENST00000467889.1	-	4	589_590	c.405_406insATG	c.(403-408)atggtg>atgATGgtg	p.135_136insM	CALML4_ENST00000395465.3_Intron|RP11-315D16.2_ENST00000562767.1_In_Frame_Ins_p.61_62insD|CALML4_ENST00000448060.2_In_Frame_Ins_p.88_89insM|CALML4_ENST00000540479.1_In_Frame_Ins_p.59_60insM	NM_033429.2	NP_219501.2	Q96GE6	CALL4_HUMAN	calmodulin-like 4	135	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						TCCTTGTCCACCATCAACATGG	0.475																																						.											0																																										SO:0001652	inframe_insertion	91860			AF308287	CCDS10226.2, CCDS42052.1, CCDS66808.1	15q22.31	2013-01-10			ENSG00000129007	ENSG00000129007		"""EF-hand domain containing"""	18445	protein-coding gene	gene with protein product							Standard	NM_033429		Approved	MGC4809, NY-BR-20	uc002arb.3	Q96GE6	OTTHUMG00000133287	ENST00000467889.1:c.403_405dupATG	15.37:g.68489866_68489868dupCAT	ENSP00000419081:p.Met135_Met135dup	Somatic		WXS	Illumina HiSeq	Phase_I	B4DL15|F8W6Y4|Q6MZY3|Q6N048|Q9H286	In_Frame_Ins	INS	ENST00000467889.1	37	CCDS10226.2																																																																																				0.475	CALML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257067.3	NM_033429	
SEPT9	10801	broad.mit.edu	37	17	75398360	75398361	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:75398360_75398361insG	ENST00000427177.1	+	3	422_423	c.296_297insG	c.(295-300)aaggcgfs	p.A100fs	SEPT9_ENST00000585930.1_5'Flank|SEPT9_ENST00000423034.2_Frame_Shift_Ins_p.A93fs|SEPT9_ENST00000329047.8_Frame_Shift_Ins_p.A82fs|SEPT9_ENST00000591198.1_Frame_Shift_Ins_p.A81fs|SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000588690.1_5'UTR|SEPT9_ENST00000427674.2_5'UTR|SEPT9_ENST00000431235.2_5'UTR|SEPT9_ENST00000590294.1_Frame_Shift_Ins_p.A82fs|SEPT9_ENST00000592420.1_5'UTR	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	100					cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			TCGGGCCCCAAGGCGGCCGAGC	0.688																																						.											0																																										SO:0001589	frameshift_variant	10801			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.298dupG	17.37:g.75398362_75398362dupG	ENSP00000391249:p.Ala100fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Frame_Shift_Ins	INS	ENST00000427177.1	37	CCDS45790.1																																																																																				0.688	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640	
APP	351	broad.mit.edu	37	21	27372385	27372386	+	Frame_Shift_Ins	INS	-	-	C	rs141526793		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr21:27372385_27372386insC	ENST00000346798.3	-	7	1010_1011	c.977_978insG	c.(976-978)ggcfs	p.G326fs	APP_ENST00000440126.3_Frame_Shift_Ins_p.G321fs|APP_ENST00000439274.2_Frame_Shift_Ins_p.G270fs|APP_ENST00000348990.5_Intron|APP_ENST00000358918.3_Frame_Shift_Ins_p.G326fs|APP_ENST00000448388.2_Intron|APP_ENST00000354192.3_Intron|APP_ENST00000359726.3_Intron|APP_ENST00000357903.3_Frame_Shift_Ins_p.G326fs	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	326	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				TGTTCCGGTTGCCGCCACATCC	0.574																																						.											0																																										SO:0001589	frameshift_variant	351			M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.978dupG	21.37:g.27372387_27372387dupC	ENSP00000284981:p.Gly326fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Frame_Shift_Ins	INS	ENST00000346798.3	37	CCDS13576.1																																																																																				0.574	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
SEC14L3	266629	broad.mit.edu	37	22	30857663	30857664	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr22:30857663_30857664insC	ENST00000215812.4	-	10	879_880	c.789_790insG	c.(787-792)gagatcfs	p.I264fs	SEC14L3_ENST00000402286.1_Frame_Shift_Ins_p.I187fs|SEC14L3_ENST00000415957.2_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000403066.1_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000539629.1_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000401751.1_Frame_Shift_Ins_p.I205fs|SEC14L3_ENST00000540910.1_Frame_Shift_Ins_p.I187fs	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	264						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GACTTGGGGATCTCCCCGCCAT	0.54																																					Esophageal Squamous(108;290 1516 3584 23771 37333)	.											0																																										SO:0001589	frameshift_variant	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.790dupG	22.37:g.30857664_30857664dupC	ENSP00000215812:p.Ile264fs	Somatic		WXS	Illumina HiSeq	Phase_I	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Frame_Shift_Ins	INS	ENST00000215812.4	37	CCDS13877.1																																																																																				0.540	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
THBS4	7060	broad.mit.edu	37	5	79331430	79331431	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr5:79331430_79331431insC	ENST00000350881.2	+	1	260_261	c.70_71insC	c.(70-72)gccfs	p.A24fs	THBS4_ENST00000511733.1_5'Flank	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	24					behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		AGCGGCAGGCGCCCAGGCCACC	0.738																																						.											0																																										SO:0001589	frameshift_variant	7060				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.73dupC	5.37:g.79331433_79331433dupC	ENSP00000339730:p.Ala24fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R909|Q86TG2	Frame_Shift_Ins	INS	ENST00000350881.2	37	CCDS4049.1																																																																																				0.738	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1		
KIF1A	547	ucsc.edu	37	2	241697840	241697840	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:241697840T>C	ENST00000320389.7	-	25	2650	c.2492A>G	c.(2491-2493)gAc>gGc	p.D831G	KIF1A_ENST00000498729.2_Missense_Mutation_p.D840G	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	831					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CACCACGTTGTCACAGTCCTC	0.642																																						.											0													63.0	73.0	70.0					2																	241697840		2166	4261	6427	SO:0001583	missense	547			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2492A>G	2.37:g.241697840T>C	ENSP00000322791:p.Asp831Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.166941	0.78339	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.78707	-1.2;-1.2;-1.2	5.28	5.28	0.74379	.	0.060427	0.64402	U	0.000005	T	0.71400	0.3335	L	0.36672	1.1	0.80722	D	1	B;P;B	0.40875	0.125;0.731;0.033	B;B;B	0.41946	0.173;0.371;0.077	T	0.70026	-0.4985	10	0.28530	T	0.3	.	14.8408	0.70223	0.0:0.0:0.0:1.0	.	840;840;831	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	G	831;840;840;840	ENSP00000322791:D831G;ENSP00000438388:D840G;ENSP00000384231:D840G	ENSP00000322791:D831G	D	-	2	0	KIF1A	241346513	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.043000	0.71004	1.999000	0.58509	0.482000	0.46254	GAC		0.642	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
LECT1	11061	ucsc.edu	37	13	53313218	53313218	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr13:53313218A>G	ENST00000377962.3	-	2	239	c.161T>C	c.(160-162)cTg>cCg	p.L54P	LECT1_ENST00000448904.2_Missense_Mutation_p.L54P			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	54					cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		CCCAAAGAGCAGCAGCACAGC	0.692																																						.											0													28.0	38.0	35.0					13																	53313218		2203	4298	6501	SO:0001583	missense	11061			AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.161T>C	13.37:g.53313218A>G	ENSP00000367198:p.Leu54Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TAM4|Q8TAY6|Q9UM18	Missense_Mutation	SNP	ENST00000377962.3	37	CCDS9437.1	.	.	.	.	.	.	.	.	.	.	A	18.37	3.609899	0.66558	.	.	ENSG00000136110	ENST00000448904;ENST00000377962	T;T	0.48836	0.81;0.8	4.55	4.55	0.56014	.	0.000000	0.64402	D	0.000002	T	0.56426	0.1984	L	0.34521	1.04	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.994	D;D;P	0.68192	0.956;0.939;0.87	T	0.61163	-0.7118	10	0.87932	D	0	.	13.8929	0.63750	1.0:0.0:0.0:0.0	.	90;54;54	Q5TAN5;O75829-2;O75829	.;.;LECT1_HUMAN	P	54	ENSP00000388576:L54P;ENSP00000367198:L54P	ENSP00000367198:L54P	L	-	2	0	LECT1	52211219	1.000000	0.71417	1.000000	0.80357	0.444000	0.32077	8.309000	0.89969	1.670000	0.50864	0.379000	0.24179	CTG		0.692	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045110.3		
METTL13	51603	ucsc.edu	37	1	171753605	171753605	+	Silent	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:171753605A>G	ENST00000361735.3	+	2	1145	c.879A>G	c.(877-879)aaA>aaG	p.K293K	METTL13_ENST00000458517.1_Silent_p.K292K|METTL13_ENST00000362019.3_Silent_p.K207K|METTL13_ENST00000367737.5_Intron	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	293							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						CCACTGTGAAACCATCGCGGG	0.617																																						.											0													14.0	15.0	15.0					1																	171753605		2191	4267	6458	SO:0001819	synonymous_variant	51603			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.879A>G	1.37:g.171753605A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Silent	SNP	ENST00000361735.3	37	CCDS1299.1																																																																																				0.617	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084528.5	NM_014955	
TMX3	54495	ucsc.edu	37	18	66365223	66365223	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr18:66365223C>T	ENST00000299608.2	-	7	754	c.438G>A	c.(436-438)atG>atA	p.M146I	TMX3_ENST00000443099.2_Missense_Mutation_p.M119I|TMX3_ENST00000562706.1_Missense_Mutation_p.M146I	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	146					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						GTCTCTTCTGCATATGTTCAA	0.313																																						.											0													100.0	91.0	94.0					18																	66365223		2203	4300	6503	SO:0001583	missense	54495			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.438G>A	18.37:g.66365223C>T	ENSP00000299608:p.Met146Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Missense_Mutation	SNP	ENST00000299608.2	37	CCDS32840.1	.	.	.	.	.	.	.	.	.	.	C	9.922	1.212389	0.22289	.	.	ENSG00000166479	ENST00000299608;ENST00000544714;ENST00000443099	T;T	0.10668	3.13;2.85	5.33	-0.718	0.11205	.	0.159551	0.56097	D	0.000032	T	0.03739	0.0106	N	0.12746	0.255	0.32577	N	0.529024	B;B;B	0.12013	0.005;0.004;0.001	B;B;B	0.13407	0.009;0.007;0.001	T	0.37150	-0.9718	10	0.14656	T	0.56	.	1.661	0.02792	0.1319:0.3586:0.1288:0.3806	.	119;146;146	B4DIE3;Q96JJ7-2;Q96JJ7	.;.;TMX3_HUMAN	I	146;146;119	ENSP00000299608:M146I;ENSP00000402605:M119I	ENSP00000299608:M146I	M	-	3	0	TMX3	64516203	0.247000	0.23920	0.758000	0.31321	0.957000	0.61999	0.199000	0.17237	-0.385000	0.07833	-0.140000	0.14226	ATG		0.313	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420155.1	NM_019022	
ADAM21	8747	mdanderson.org	37	14	70924335	70924335	+	Missense_Mutation	SNP	C	C	T	rs199920662	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr14:70924335C>T	ENST00000603540.1	+	2	377	c.119C>T	c.(118-120)cCg>cTg	p.P40L	ADAM21_ENST00000267499.3_Missense_Mutation_p.P40L|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	40					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TTCACTTCCCCGGAAGTGGTG	0.547																																						.											0													97.0	102.0	100.0					14																	70924335		2203	4300	6503	SO:0001583	missense	8747			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.119C>T	14.37:g.70924335C>T	ENSP00000474385:p.Pro40Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	C	7.541	0.660648	0.14645	.	.	ENSG00000139985	ENST00000267499	T	0.01051	5.4	3.77	2.87	0.33458	.	0.239499	0.21690	U	0.070593	T	0.01870	0.0059	M	0.79343	2.45	0.29294	N	0.869135	P	0.36412	0.552	B	0.34652	0.187	T	0.20706	-1.0267	10	0.32370	T	0.25	.	7.3425	0.26646	0.0:0.8757:0.0:0.1243	.	40	Q9UKJ8	ADA21_HUMAN	L	40	ENSP00000267499:P40L	ENSP00000267499:P40L	P	+	2	0	ADAM21	69994088	0.007000	0.16637	0.766000	0.31476	0.269000	0.26545	0.312000	0.19397	0.924000	0.37069	0.563000	0.77884	CCG		0.547	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
ANKRD30B	374860	mdanderson.org	37	18	14780019	14780019	+	Splice_Site	SNP	G	G	T	rs72873710		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr18:14780019G>T	ENST00000358984.4	+	11	1661	c.1481G>T	c.(1480-1482)gGg>gTg	p.G494V	ANKRD30B_ENST00000447268.2_Splice_Site_p.G494V|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	494										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TGGGATTCTGGGGTATTGTGT	0.343																																						.											0													193.0	177.0	182.0					18																	14780019		692	1591	2283	SO:0001630	splice_region_variant	374860			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1482+1G>T	18.37:g.14780019G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	3.547	-0.092527	0.07053	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.32988	1.43;1.48	1.69	0.336	0.15958	.	.	.	.	.	T	0.12050	0.0293	N	0.14661	0.345	0.23487	N	0.997578	P	0.50710	0.938	B	0.34931	0.192	T	0.15037	-1.0451	9	0.41790	T	0.15	.	3.5662	0.07900	0.7813:0.0:0.2187:0.0	.	494	F8WAG3	.	V	494	ENSP00000351875:G494V;ENSP00000399031:G494V	ENSP00000351875:G494V	G	+	2	0	ANKRD30B	14770019	1.000000	0.71417	0.341000	0.25589	0.044000	0.14063	0.507000	0.22675	0.156000	0.19299	-0.734000	0.03567	GGG		0.343	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	Missense_Mutation
ANKRD30BL	554226	mdanderson.org	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ASTE1	28990	mdanderson.org;bcgsc.ca	37	3	130743262	130743262	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:130743262C>T	ENST00000264992.3	-	3	1330	c.889G>A	c.(889-891)Gaa>Aaa	p.E297K	ASTE1_ENST00000514044.1_Missense_Mutation_p.E297K|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000356918.4_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000412440.2_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	297					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TGGTATTCTTCCATGGAACAG	0.428																																						.											0													143.0	139.0	140.0					3																	130743262		2203	4300	6503	SO:0001583	missense	28990			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.889G>A	3.37:g.130743262C>T	ENSP00000264992:p.Glu297Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	37	CCDS3068.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.02|15.02	2.709772|2.709772	0.48517|0.48517	.|.	.|.	ENSG00000034533|ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270|ENST00000505290	.|.	.|.	.|.	5.64|5.64	3.82|3.82	0.43975|0.43975	.|.	0.242923|.	0.48286|.	N|.	0.000197|.	T|.	0.60170|.	0.2248|.	L|L	0.53249|0.53249	1.67|1.67	0.40900|0.40900	D|D	0.984147|0.984147	P;B|.	0.37061|.	0.58;0.426|.	B;B|.	0.37550|.	0.253;0.187|.	T|.	0.57142|.	-0.7862|.	9|.	0.22109|.	T|.	0.4|.	-7.5697|-7.5697	10.9797|10.9797	0.47486|0.47486	0.0:0.7994:0.1301:0.0705|0.0:0.7994:0.1301:0.0705	.|.	297;297|.	D6RG30;Q2TB18|.	.;ASTE1_HUMAN|.	K|X	297|11	.|.	ENSP00000264992:E297K|.	E|W	-|-	1|3	0|0	ASTE1|ASTE1	132225952|132225952	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.964000|0.964000	0.63967|0.63967	1.683000|1.683000	0.37638|0.37638	0.718000|0.718000	0.32166|0.32166	-0.258000|-0.258000	0.10820|0.10820	GAA|TGG		0.428	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
CDC27	996	mdanderson.org	37	17	45214690	45214690	+	Missense_Mutation	SNP	G	G	A	rs74390782		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:45214690G>A	ENST00000066544.3	-	14	1834	c.1741C>T	c.(1741-1743)Cgg>Tgg	p.R581W	CDC27_ENST00000446365.2_Missense_Mutation_p.R520W|CDC27_ENST00000527547.1_Missense_Mutation_p.R580W|CDC27_ENST00000531206.1_Missense_Mutation_p.R587W	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	581					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TCATGTTCCCGTTGCAGACTG	0.358																																						.											0																																										SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1741C>T	17.37:g.45214690G>A	ENSP00000066544:p.Arg581Trp	Somatic		WXS	Illumina HiSeq	Phase_I	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187140	0.78789	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.63744	1.11;1.11;-0.06;1.11	5.81	4.76	0.60689	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77870	0.4195	M	0.79614	2.46	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.991;0.985;0.985;0.981	T	0.79999	-0.1566	10	0.87932	D	0	-6.0806	12.8812	0.58017	0.0:0.0:0.7678:0.2322	.	520;580;587;581	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	W	581;587;520;580	ENSP00000066544:R581W;ENSP00000434614:R587W;ENSP00000392802:R520W;ENSP00000437339:R580W	ENSP00000066544:R581W	R	-	1	2	CDC27	42569689	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.401000	0.52601	2.761000	0.94854	0.585000	0.79938	CGG		0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
COL5A3	50509	mdanderson.org;bcgsc.ca	37	19	10078060	10078060	+	Missense_Mutation	SNP	C	C	T	rs370182126		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr19:10078060C>T	ENST00000264828.3	-	62	4506	c.4421G>A	c.(4420-4422)cGt>cAt	p.R1474H		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1474	Collagen-like 6.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.R1474H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			AGTGTCTCCACGGGGGCCCAT	0.607																																						.											1	Substitution - Missense(1)	endometrium(1)						C	HIS/ARG	1,4355		0,1,2177	18.0	17.0	17.0		4421	1.8	1.0	19		17	0,8546		0,0,4273	no	missense	COL5A3	NM_015719.3	29	0,1,6450	TT,TC,CC		0.0,0.023,0.0078	probably-damaging	1474/1746	10078060	1,12901	2178	4273	6451	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4421G>A	19.37:g.10078060C>T	ENSP00000264828:p.Arg1474His	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	9.557	1.117512	0.20877	2.3E-4	0.0	ENSG00000080573	ENST00000264828	D	0.94280	-3.39	4.06	1.79	0.24919	.	0.246732	0.29814	N	0.011122	D	0.93530	0.7935	M	0.81341	2.54	0.28887	N	0.894099	D	0.58970	0.984	P	0.52710	0.707	D	0.88317	0.2960	10	0.62326	D	0.03	.	5.0036	0.14277	0.0:0.7142:0.0:0.2858	.	1474	P25940	CO5A3_HUMAN	H	1474	ENSP00000264828:R1474H	ENSP00000264828:R1474H	R	-	2	0	COL5A3	9939060	0.000000	0.05858	0.957000	0.39632	0.065000	0.16274	-0.496000	0.06436	0.929000	0.37192	0.508000	0.49915	CGT		0.607	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
DDX11	1663	mdanderson.org	37	12	31242999	31242999	+	Missense_Mutation	SNP	G	G	A	rs553935649	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:31242999G>A	ENST00000407793.2	+	9	1311	c.1060G>A	c.(1060-1062)Ggg>Agg	p.G354R	DDX11_ENST00000542838.1_Missense_Mutation_p.G354R|DDX11_ENST00000228264.6_Missense_Mutation_p.G328R|DDX11_ENST00000350437.4_Missense_Mutation_p.G354R|DDX11_ENST00000545668.1_Missense_Mutation_p.G354R|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	354	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TCCCTATTACGGGAGCCGCCT	0.657										Multiple Myeloma(12;0.14)			G|||	521	0.104034	0.0446	0.1412	5008	,	,		17385	0.131		0.1501	False		,,,				2504	0.0828					.											0													2.0	2.0	2.0					12																	31242999		1402	2986	4388	SO:0001583	missense	1663			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1060G>A	12.37:g.31242999G>A	ENSP00000384703:p.Gly354Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205774	0.58234	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.70749	-0.49;-0.51;-0.49;-0.51;-0.51	3.98	3.98	0.46160	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.224870	0.45126	D	0.000399	T	0.80879	0.4708	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.77557	0.981;0.957;0.99;0.959;0.973	T	0.81669	-0.0828	10	0.59425	D	0.04	.	8.967	0.35883	0.0:0.0:0.7785:0.2215	.	79;328;354;354;354	Q93000;Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;.;DDX11_HUMAN;.;.	R	354;354;79;328;354;354	ENSP00000443426:G354R;ENSP00000384703:G354R;ENSP00000228264:G328R;ENSP00000440402:G354R;ENSP00000309965:G354R	ENSP00000228264:G328R	G	+	1	0	DDX11	31134266	1.000000	0.71417	0.962000	0.40283	0.851000	0.48451	4.533000	0.60615	2.038000	0.60285	0.505000	0.49811	GGG		0.657	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
FADS6	283985	mdanderson.org	37	17	72889685	72889685	+	Silent	SNP	G	G	A	rs2683274	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:72889685G>A	ENST00000310226.6	-	1	23	c.9C>T	c.(7-9)ccC>ccT	p.P3P		NM_178128.3	NP_835229.2	Q8N9I5	FADS6_HUMAN	fatty acid desaturase 6	9	3 X 6 AA tandem repeat of M-E-P-T-E-P.				fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|lung(4)	8	all_lung(278;0.172)|Lung NSC(278;0.207)					TGGGCTCCGTGGGTTCCATGG	0.746																																						.											0																																										SO:0001819	synonymous_variant	283985			AK094411	CCDS54163.1	17q25.1	2014-07-17	2013-01-25			ENSG00000172782		"""Fatty acid desaturases"""	30459	protein-coding gene	gene with protein product			"""fatty acid desaturase domain family, member 6"""				Standard	XM_005257224		Approved		uc002jmd.1	Q8N9I5		ENST00000310226.6:c.9C>T	17.37:g.72889685G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RQ7|Q6XYE1	Silent	SNP	ENST00000310226.6	37	CCDS54163.1																																																																																				0.746	FADS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445219.1		
FRG1B	284802	mdanderson.org	37	20	29625877	29625877	+	Missense_Mutation	SNP	G	G	A	rs7266938	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr20:29625877G>A	ENST00000278882.3	+	5	501	c.121G>A	c.(121-123)Gcc>Acc	p.A41T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A41T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A46T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	41								p.A41T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GTACAGAATCGCCCTGAAATC	0.358																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.121G>A	20.37:g.29625877G>A	ENSP00000278882:p.Ala41Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	8.740	0.918766	0.17982	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62498	0.02	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	.	.	.	0.52099	D	0.999942	B	0.24186	0.099	B	0.27715	0.082	T	0.43956	-0.9359	9	0.33940	T	0.23	.	9.3557	0.38164	0.0:0.0:1.0:0.0	rs7266938;rs7266938	46	F5H5R5	.	T	41;46;41	ENSP00000408863:A46T	ENSP00000278882:A41T	A	+	1	0	FRG1B	28239538	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	5.232000	0.65332	1.250000	0.43966	0.184000	0.17185	GCC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
GGH	8836	mdanderson.org	37	8	63951312	63951312	+	Missense_Mutation	SNP	A	A	G	rs1800909	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr8:63951312A>G	ENST00000260118.6	-	1	418	c.16T>C	c.(16-18)Tgc>Cgc	p.C6R		NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	6			C -> R (in dbSNP:rs1800909).		glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)			breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	CACAGCAGGCAGCCCGGACTG	0.716													G|||	1161	0.231829	0.1672	0.2277	5008	,	,		10294	0.2192		0.2793	False		,,,				2504	0.2863					.											0								G	ARG/CYS	752,3574		76,600,1487	10.0	10.0	10.0		16	1.1	0.0	8	dbSNP_89	10	2198,6302		290,1618,2342	no	missense	GGH	NM_003878.2	180	366,2218,3829	GG,GA,AA		25.8588,17.3833,23.0002	benign	6/319	63951312	2950,9876	2163	4250	6413	SO:0001583	missense	8836			U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.16T>C	8.37:g.63951312A>G	ENSP00000260118:p.Cys6Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000260118.6	37	CCDS6177.1	512	0.23443223443223443	88	0.17886178861788618	83	0.2292817679558011	127	0.22202797202797203	214	0.28232189973614774	G	6.061	0.379536	0.11466	0.173833	0.258588	ENSG00000137563	ENST00000260118	T	0.21191	2.02	4.12	1.06	0.20224	.	1.412970	0.04201	N	0.329979	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42258	-0.9462	9	0.24483	T	0.36	-3.9473	1.5309	0.02535	0.1969:0.1633:0.4721:0.1677	rs1800909	6	Q92820	GGH_HUMAN	R	6	ENSP00000260118:C6R	ENSP00000260118:C6R	C	-	1	0	GGH	64113866	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.797000	0.26999	-0.133000	0.11537	-0.684000	0.03749	TGC		0.716	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378453.1		
HLA-C	3107	mdanderson.org	37	6	31238866	31238866	+	Missense_Mutation	SNP	C	C	G	rs17413678	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr6:31238866C>G	ENST00000376228.5	-	3	617	c.603G>C	c.(601-603)gaG>gaC	p.E201D	HLA-C_ENST00000383329.3_Missense_Mutation_p.E201D	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	201	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GCTGCAGCGTCTCCTTCCCGT	0.657																																						.											0													53.0	45.0	48.0					6																	31238866		2203	4299	6502	SO:0001583	missense	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.603G>C	6.37:g.31238866C>G	ENSP00000365402:p.Glu201Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.944|8.944	0.966650|0.966650	0.18659|0.18659	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00824	.|5.65;5.65	2.55|2.55	0.453|0.453	0.16639|0.16639	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|1.613380	.|0.04968	.|N	.|0.463348	T|T	0.00109|0.00109	0.0003|0.0003	N|N	0.00058|0.00058	-2.35|-2.35	0.22226|0.22226	N|N	0.999278|0.999278	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.06405	.|0.001;0.001;0.002;0.001	T|T	0.48163|0.48163	-0.9059|-0.9059	5|10	.|0.72032	.|D	.|0.01	.|.	10.0479|10.0479	0.42197|0.42197	0.0:0.3625:0.6374:0.0|0.0:0.3625:0.6374:0.0	rs41549320|rs41549320	.|201;201;201;201	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	H|D	201|201;201;201;238	.|ENSP00000365402:E201D;ENSP00000372819:E201D	.|ENSP00000365402:E201D	D|E	-|-	1|3	0|2	HLA-C|HLA-C	31346845|31346845	0.000000|0.000000	0.05858|0.05858	0.895000|0.895000	0.35142|0.35142	0.078000|0.078000	0.17371|0.17371	-3.936000|-3.936000	0.00330|0.00330	0.101000|0.101000	0.17610|0.17610	0.305000|0.305000	0.20034|0.20034	GAC|GAG		0.657	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
IQSEC3	440073	mdanderson.org	37	12	248071	248071	+	Missense_Mutation	SNP	G	G	C	rs77474006	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:248071G>C	ENST00000538872.1	+	4	1660	c.1542G>C	c.(1540-1542)caG>caC	p.Q514H	RP11-598F7.4_ENST00000508953.2_RNA|IQSEC3_ENST00000382841.2_Missense_Mutation_p.Q211H|IQSEC3_ENST00000326261.4_Missense_Mutation_p.Q514H|RP11-598F7.4_ENST00000505893.2_RNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	514				Q -> H (in Ref. 1; AK091953). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TGGGCGCTCAGACGGTCCAGG	0.711													G|||	285	0.0569089	0.0106	0.1023	5008	,	,		11482	0.0923		0.0487	False		,,,				2504	0.0593					.											0								G	HIS/GLN,HIS/GLN	89,4315		2,85,2115	28.0	24.0	26.0		633,1542	1.8	0.0	12	dbSNP_131	26	516,8078		20,476,3801	yes	missense,missense	IQSEC3	NM_015232.1,NM_001170738.1	24,24	22,561,5916	CC,CG,GG		6.0042,2.0209,4.6546	benign,benign	211/760,514/1183	248071	605,12393	2202	4297	6499	SO:0001583	missense	440073			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.1542G>C	12.37:g.248071G>C	ENSP00000437554:p.Gln514His	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	ENST00000538872.1	37	CCDS53728.1	114	0.0521978021978022	3	0.006097560975609756	28	0.07734806629834254	46	0.08041958041958042	37	0.048812664907651716	G	16.49	3.137794	0.56936	0.020209	0.060042	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.10288	2.89;2.89;2.9	5.14	1.79	0.24919	.	2.881560	0.00496	N	0.000144	T	0.00815	0.0027	M	0.68952	2.095	0.80722	P	0.0	B;B	0.14805	0.011;0.004	B;B	0.12156	0.005;0.007	T	0.27468	-1.0073	9	0.54805	T	0.06	.	7.7839	0.29080	0.1955:0.1367:0.6678:0.0	.	514;211	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	H	514;514;211	ENSP00000437554:Q514H;ENSP00000315662:Q514H;ENSP00000372292:Q211H	ENSP00000315662:Q514H	Q	+	3	2	IQSEC3	118332	0.024000	0.19004	0.018000	0.16275	0.006000	0.05464	0.502000	0.22594	0.543000	0.28864	0.561000	0.74099	CAG		0.711	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
KRT6B	3854	mdanderson.org	37	12	52843581	52843581	+	Silent	SNP	A	A	G	rs382894		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:52843581A>G	ENST00000252252.3	-	4	920	c.873T>C	c.(871-873)ctT>ctC	p.L291L		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	291	Coil 1B.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.L291L(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCTCATCTGTAAGAGTGTCTG	0.488																																						.											1	Substitution - coding silent(1)	prostate(1)											186.0	173.0	177.0					12																	52843581		2203	4300	6503	SO:0001819	synonymous_variant	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.873T>C	12.37:g.52843581A>G		Somatic		WXS	Illumina HiSeq	Phase_I	P48669	Silent	SNP	ENST00000252252.3	37	CCDS8828.1																																																																																				0.488	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
KRTAP10-6	386674	mdanderson.org	37	21	46011987	46011987	+	Missense_Mutation	SNP	A	A	G	rs201334923	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr21:46011987A>G	ENST00000400368.1	-	1	399	c.379T>C	c.(379-381)Tcc>Ccc	p.S127P	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	127	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CAGCAGACGGACACACAGCAC	0.642													.|||	980	0.195687	0.3873	0.1282	5008	,	,		18410	0.2401		0.0855	False		,,,				2504	0.0521					.											0								G	,PRO/SER	346,3600		9,328,1636	65.0	101.0	89.0		,379	-1.7	0.0	21	dbSNP_132	89	122,8214		6,110,4052	no	intron,missense	TSPEAR,KRTAP10-6	NM_144991.2,NM_198688.2	,74	15,438,5688	GG,GA,AA		1.4635,8.7684,3.8105	,benign	,127/366	46011987	468,11814	1973	4168	6141	SO:0001583	missense	386674			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.379T>C	21.37:g.46011987A>G	ENSP00000383219:p.Ser127Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	g	0.017	-1.506709	0.00992	0.087684	0.014635	ENSG00000188155	ENST00000400368	T	0.01397	4.94	2.44	-1.71	0.08133	.	.	.	.	.	T	0.00039	0.0001	N	0.00793	-1.18	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.39522	-0.9610	8	0.02654	T	1	.	2.6267	0.04931	0.3892:0.0:0.2528:0.358	.	127	P60371	KR106_HUMAN	P	127	ENSP00000383219:S127P	ENSP00000383219:S127P	S	-	1	0	KRTAP10-6	44836415	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.886000	0.04157	-0.713000	0.04981	-1.032000	0.02404	TCC		0.642	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
L3HYPDH	112849	mdanderson.org	37	14	59950690	59950690	+	Silent	SNP	A	A	C	rs2296842	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr14:59950690A>C	ENST00000247194.4	-	1	458	c.345T>G	c.(343-345)gcT>gcG	p.A115A	RP11-701B16.2_ENST00000554253.1_RNA|L3HYPDH_ENST00000487285.1_5'Flank|JKAMP_ENST00000425728.2_5'Flank|JKAMP_ENST00000554271.1_5'Flank|JKAMP_ENST00000356057.5_5'Flank|JKAMP_ENST00000261247.9_5'Flank|JKAMP_ENST00000556985.1_5'Flank	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	115					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	CGAAGTCCAAAGCGAAGCGGC	0.706											OREG0022712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	A|||	1328	0.265176	0.1861	0.3833	5008	,	,		16051	0.1825		0.2376	False		,,,				2504	0.4018					.											0								A		853,3413		111,631,1391	10.0	10.0	10.0		345	-9.7	0.0	14	dbSNP_100	10	1857,6475		235,1387,2544	no	coding-synonymous	C14orf149	NM_144581.1		346,2018,3935	CC,CA,AA		22.2876,19.9953,21.5114		115/355	59950690	2710,9888	2133	4166	6299	SO:0001819	synonymous_variant	112849			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.345T>G	14.37:g.59950690A>C		Somatic	1042	WXS	Illumina HiSeq	Phase_I	Q96LJ5	Silent	SNP	ENST00000247194.4	37	CCDS9739.1																																																																																				0.706	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581	
MAMDC4	158056	mdanderson.org	37	9	139752899	139752899	+	Missense_Mutation	SNP	T	T	G	rs2275156	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr9:139752899T>G	ENST00000317446.2	+	22	2772	c.2722T>G	c.(2722-2724)Tgg>Ggg	p.W908G	MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Missense_Mutation_p.W987G	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CCACCTGGCCTGGCCCGGCCT	0.692																																						.											0								T	GLY/TRP	3660,734		1569,522,106	27.0	35.0	32.0		2722	1.3	0.2	9	dbSNP_100	32	6268,2320		2351,1566,377	yes	missense	MAMDC4	NM_206920.2	184	3920,2088,483	GG,GT,TT		27.0144,16.7046,23.5249	possibly-damaging	908/1138	139752899	9928,3054	2197	4294	6491	SO:0001583	missense	158056			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.2722T>G	9.37:g.139752899T>G	ENSP00000319388:p.Trp908Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000317446.2	37	CCDS7010.1	1541|1541	0.7055860805860806|0.7055860805860806	359|359	0.7296747967479674|0.7296747967479674	199|199	0.5497237569060773|0.5497237569060773	471|471	0.8234265734265734|0.8234265734265734	512|512	0.6754617414248021|0.6754617414248021	.|.	4.918|4.918	0.170594|0.170594	0.09391|0.09391	0.832954|0.832954	0.729856|0.729856	ENSG00000177943|ENSG00000177943	ENST00000413647|ENST00000317446;ENST00000445819	.|T;T	.|0.01725	.|4.67;4.67	5.05|5.05	1.29|1.29	0.21616|0.21616	.|Concanavalin A-like lectin/glucanase (1);MAM domain (3);	.|0.463995	.|0.19512	.|N	.|0.112484	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.63428|0.63428	1.95|1.95	0.46437|0.46437	P|P	9.510000000000352E-4|9.510000000000352E-4	.|B;P	.|0.40970	.|0.181;0.734	.|B;P	.|0.44696	.|0.287;0.458	T|T	0.23404|0.23404	-1.0189|-1.0189	4|9	.|0.10636	.|T	.|0.68	-9.2031|-9.2031	3.7674|3.7674	0.08627|0.08627	0.1504:0.2498:0.0:0.5998|0.1504:0.2498:0.0:0.5998	rs2275156;rs57694508|rs2275156;rs57694508	.|987;908	.|Q6UXC1;Q6UXC1-2	.|AEGP_HUMAN;.	R|G	972|908;987	.|ENSP00000319388:W908G;ENSP00000411339:W987G	.|ENSP00000319388:W908G	L|W	+|+	2|1	0|0	MAMDC4|MAMDC4	138872720|138872720	0.007000|0.007000	0.16637|0.16637	0.232000|0.232000	0.24009|0.24009	0.941000|0.941000	0.58515|0.58515	0.076000|0.076000	0.14712|0.14712	-0.021000|-0.021000	0.14009|0.14009	0.459000|0.459000	0.35465|0.35465	CTG|TGG		0.692	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254642.3	NM_206920	
ANKRD30BL	554226	mdanderson.org	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																						.											0													27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																					0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
ANKRD30BL	554226	mdanderson.org	37	2	133014612	133014612	+	Intron	SNP	A	A	C	rs199913868|rs74853538	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:133014612A>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGAGGGAGGTACCGCAGCGAC	0.716																																						.											0													27.0	46.0	40.0					2																	133014612		1553	3577	5130	SO:0001627	intron_variant	100313824					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+489T>G	2.37:g.133014612A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																					0.716	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
MTMR3	8897	mdanderson.org	37	22	30419455	30419455	+	Intron	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr22:30419455C>T	ENST00000401950.2	+	19	3767				CTA-85E5.10_ENST00000453743.2_RNA|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Silent_p.D1108D|MTMR3_ENST00000406629.1_Silent_p.D1108D|MTMR3_ENST00000351488.3_Intron|MTMR3_ENST00000323630.5_Intron	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3						peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			GGGACACTGACCGTGTTGATC	0.498																																						.											0													217.0	179.0	192.0					22																	30419455		2203	4300	6503	SO:0001627	intron_variant	8897			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.3425+769C>T	22.37:g.30419455C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	37	CCDS13870.1																																																																																				0.498	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
MUC4	4585	mdanderson.org	37	3	195505801	195505801	+	Missense_Mutation	SNP	G	G	A	rs200432267		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:195505801G>A	ENST00000463781.3	-	2	13109	c.12650C>T	c.(12649-12651)gCa>gTa	p.A4217V	MUC4_ENST00000475231.1_Missense_Mutation_p.A4217V|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A4217E(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.592																																						.											1	Substitution - Missense(1)	kidney(1)											35.0	29.0	31.0					3																	195505801		692	1582	2274	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12650C>T	3.37:g.195505801G>A	ENSP00000417498:p.Ala4217Val	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	1.430	-0.570605	0.03910	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.45;1.52	0.93	-1.86	0.07760	.	.	.	.	.	T	0.15609	0.0376	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.26155	-1.0111	8	.	.	.	.	6.1781	0.20455	0.43:0.0:0.57:0.0	.	4089	E7ESK3	.	V	4217	ENSP00000417498:A4217V;ENSP00000420243:A4217V	.	A	-	2	0	MUC4	196990580	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-1.621000	0.01562	-1.862000	0.00560	GCA		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507399	195507399	+	Silent	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr3:195507399C>T	ENST00000463781.3	-	2	11511	c.11052G>A	c.(11050-11052)acG>acA	p.T3684T	MUC4_ENST00000475231.1_Silent_p.T3684T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCCGTGACAGGAA	0.587																																						.											0													12.0	12.0	12.0					3																	195507399		559	1412	1971	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11052G>A	3.37:g.195507399C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
OR5A1	219982	mdanderson.org	37	11	59211421	59211421	+	Silent	SNP	C	C	T	rs17591107	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:59211421C>T	ENST00000302030.2	+	1	805	c.780C>T	c.(778-780)ttC>ttT	p.F260F		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						CAGCCCTTTTCGTGTACTTGC	0.537													C|||	630	0.125799	0.0242	0.1326	5008	,	,		21088	0.1111		0.2525	False		,,,				2504	0.1431					.											0								C		251,4151	146.9+/-181.5	10,231,1960	265.0	215.0	232.0		780	6.0	1.0	11	dbSNP_123	232	2264,6326	383.3+/-340.7	283,1698,2314	no	coding-synonymous	OR5A1	NM_001004728.1		293,1929,4274	TT,TC,CC		26.3562,5.702,19.3581		260/316	59211421	2515,10477	2201	4295	6496	SO:0001819	synonymous_variant	219982			AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.780C>T	11.37:g.59211421C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B9EH58|Q6IFF2|Q96RB1	Silent	SNP	ENST00000302030.2	37	CCDS31561.1																																																																																				0.537	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728	
PABPC3	5042	mdanderson.org	37	13	25671742	25671742	+	Missense_Mutation	SNP	G	G	A	rs140135080	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr13:25671742G>A	ENST00000281589.3	+	1	1443	c.1406G>A	c.(1405-1407)cGa>cAa	p.R469Q		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	469					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CAGGTTCCACGAGTCATGTCA	0.547																																						.											0													104.0	96.0	98.0					13																	25671742		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1406G>A	13.37:g.25671742G>A	ENSP00000281589:p.Arg469Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	6.381	0.438497	0.12104	.	.	ENSG00000151846	ENST00000281589	T	0.26223	1.75	0.875	-0.195	0.13236	.	0.000000	0.40064	U	0.001189	T	0.13114	0.0318	L	0.35288	1.05	0.42075	D	0.991227	B	0.06786	0.001	B	0.06405	0.002	T	0.20638	-1.0269	10	0.10902	T	0.67	.	5.1429	0.14969	0.252:0.0:0.748:0.0	.	469	Q9H361	PABP3_HUMAN	Q	469	ENSP00000281589:R469Q	ENSP00000281589:R469Q	R	+	2	0	PABPC3	24569742	1.000000	0.71417	0.977000	0.42913	0.138000	0.21146	3.032000	0.49736	-0.094000	0.12374	0.313000	0.20887	CGA		0.547	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PABPC3	5042	mdanderson.org	37	13	25671759	25671759	+	Missense_Mutation	SNP	C	C	T	rs115121649	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr13:25671759C>T	ENST00000281589.3	+	1	1460	c.1423C>T	c.(1423-1425)Cgt>Tgt	p.R475C		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	475					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GTCAACGCAGCGTGTTGCTAA	0.532																																						.											0													93.0	84.0	87.0					13																	25671759		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1423C>T	13.37:g.25671759C>T	ENSP00000281589:p.Arg475Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	7.042	0.562727	0.13498	.	.	ENSG00000151846	ENST00000281589	T	0.29142	1.58	0.875	-1.75	0.08031	.	0.000000	0.48767	U	0.000176	T	0.32346	0.0826	M	0.86740	2.835	0.52501	D	0.999952	B	0.11235	0.004	B	0.06405	0.002	T	0.03750	-1.1007	10	0.48119	T	0.1	.	6.6426	0.22917	0.0:0.732:0.0:0.268	.	475	Q9H361	PABP3_HUMAN	C	475	ENSP00000281589:R475C	ENSP00000281589:R475C	R	+	1	0	PABPC3	24569759	1.000000	0.71417	0.869000	0.34112	0.045000	0.14185	1.663000	0.37429	-0.898000	0.03906	-1.305000	0.01319	CGT		0.532	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PI4KAP2	375133	mdanderson.org	37	22	21829555	21829555	+	RNA	SNP	T	T	G	rs377578228		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr22:21829555T>G	ENST00000450651.1	-	0	1783							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.I530L(4)		endometrium(3)|urinary_tract(1)	4						TCCAACATGATAGTGACCAGG	0.607																																						.											4	Substitution - Missense(4)	endometrium(3)|urinary_tract(1)											26.0	21.0	23.0					22																	21829555		692	1582	2274			375133					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21829555T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	ENST00000450651.1	37																																																																																					0.607	PI4KAP2-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000334908.1		
POTEC	388468	mdanderson.org	37	18	14542888	14542888	+	Silent	SNP	A	A	G	rs543140115	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr18:14542888A>G	ENST00000358970.5	-	1	257	c.258T>C	c.(256-258)caT>caC	p.H86H	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	86			H -> D (in dbSNP:rs45469098). {ECO:0000269|PubMed:15489334}.							NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AGGAGTTGTCATGGTCTCCAG	0.587													.|||	10	0.00199681	0.0076	0.0	5008	,	,		28860	0.0		0.0	False		,,,				2504	0.0					.											0													51.0	57.0	55.0					18																	14542888		692	1591	2283	SO:0001819	synonymous_variant	388468			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.258T>C	18.37:g.14542888A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																				0.587	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
PRB4	5545	mdanderson.org	37	12	11461742	11461742	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr12:11461742C>T	ENST00000535904.1	-	3	208	c.175G>A	c.(175-177)Gga>Aga	p.G59R	PRB4_ENST00000279575.1_Missense_Mutation_p.G59R|PRB4_ENST00000445719.2_Missense_Mutation_p.G59R			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	80	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGGGGTGGTCCTTGTGGCTTT	0.627										HNSCC(22;0.051)																												.											0													205.0	222.0	216.0					12																	11461742		2201	4293	6494	SO:0001583	missense	5545				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.175G>A	12.37:g.11461742C>T	ENSP00000442834:p.Gly59Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	1.855	-0.464114	0.04476	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.04862	3.54;3.54;3.54	0.956	-1.91	0.07641	.	.	.	.	.	T	0.06554	0.0168	M	0.66297	2.02	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.40079	-0.9582	9	0.31617	T	0.26	.	2.5673	0.04786	0.0:0.3453:0.2742:0.3805	.	59	E9PAL0	.	R	59	ENSP00000279575:G59R;ENSP00000442834:G59R;ENSP00000412740:G59R	ENSP00000279575:G59R	G	-	1	0	PRB4	11353009	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.693000	0.00829	-1.187000	0.02709	0.196000	0.17591	GGA		0.627	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
PRIMA1	145270	mdanderson.org	37	14	94245649	94245649	+	Silent	SNP	A	A	G	rs4905087	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr14:94245649A>G	ENST00000393140.1	-	3	204	c.102T>C	c.(100-102)caT>caC	p.H34H	PRIMA1_ENST00000393143.1_Silent_p.H34H|PRIMA1_ENST00000316227.3_Silent_p.H34H	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	34					establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		GGGGCTCACCATGCGTCACCT	0.652													G|||	2933	0.585663	0.6271	0.6239	5008	,	,		9302	0.3155		0.7873	False		,,,				2504	0.5736					.											0								G		2825,1579		907,1011,284	40.0	34.0	36.0		102	-2.0	0.3	14	dbSNP_111	36	6650,1944		2582,1486,229	no	coding-synonymous	PRIMA1	NM_178013.3		3489,2497,513	GG,GA,AA		22.6204,35.8538,27.1042		34/154	94245649	9475,3523	2202	4297	6499	SO:0001819	synonymous_variant	145270				CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.102T>C	14.37:g.94245649A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q86XR6	Silent	SNP	ENST00000393140.1	37	CCDS9912.1																																																																																				0.652	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280658.1	NM_178013	
PRIMA1	145270	mdanderson.org	37	14	94245652	94245652	+	Silent	SNP	C	C	T	rs4900195	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr14:94245652C>T	ENST00000393140.1	-	3	201	c.99G>A	c.(97-99)acG>acA	p.T33T	PRIMA1_ENST00000393143.1_Silent_p.T33T|PRIMA1_ENST00000316227.3_Silent_p.T33T	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	33					establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		GCTCACCATGCGTCACCTGTA	0.647													C|||	1818	0.363019	0.3949	0.3573	5008	,	,		9432	0.2302		0.4692	False		,,,				2504	0.3517					.											0								C		1764,2638		367,1030,804	40.0	34.0	36.0		99	-8.8	0.2	14	dbSNP_111	36	4098,4500		978,2142,1179	no	coding-synonymous	PRIMA1	NM_178013.3		1345,3172,1983	TT,TC,CC		47.6622,40.0727,45.0923		33/154	94245652	5862,7138	2201	4299	6500	SO:0001819	synonymous_variant	145270				CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.99G>A	14.37:g.94245652C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q86XR6	Silent	SNP	ENST00000393140.1	37	CCDS9912.1																																																																																				0.647	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280658.1	NM_178013	
SYCE1L	100130958	mdanderson.org	37	16	77246517	77246517	+	Missense_Mutation	SNP	C	C	A	rs62049594	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr16:77246517C>A	ENST00000378644.4	+	10	683	c.628C>A	c.(628-630)Ccc>Acc	p.P210T	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	210					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						CCGGAGCGCCCCCGAGGTCGG	0.721													C|||	1026	0.204872	0.0318	0.2435	5008	,	,		12471	0.1339		0.4175	False		,,,				2504	0.2658					.											0								C	THR/PRO	129,1243		10,109,567	7.0	11.0	10.0		628	-0.7	0.0	16	dbSNP_129	10	1202,1964		244,714,625	yes	missense	SYCE1L	NM_001129979.1	38	254,823,1192	AA,AC,CC		37.9659,9.4023,29.3301	benign	210/243	77246517	1331,3207	686	1583	2269	SO:0001583	missense	100130958				CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.628C>A	16.37:g.77246517C>A	ENSP00000367911:p.Pro210Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NF23	Missense_Mutation	SNP	ENST00000378644.4	37	CCDS45533.1	527	0.2413003663003663	24	0.04878048780487805	96	0.26519337016574585	90	0.15734265734265734	317	0.4182058047493404	C	11.59	1.685129	0.29872	0.094023	0.379659	ENSG00000205078	ENST00000378644	T	0.44083	0.93	3.12	-0.663	0.11410	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.25235	0.121	B	0.30646	0.118	T	0.47497	-0.9113	8	0.25751	T	0.34	-2.1026	1.3164	0.02108	0.2227:0.42:0.2185:0.1389	rs62049594	210	A8MT33	SYC1L_HUMAN	T	210	ENSP00000367911:P210T	ENSP00000367911:P210T	P	+	1	0	SYCE1L	75804018	0.000000	0.05858	0.002000	0.10522	0.082000	0.17680	-0.852000	0.04308	0.118000	0.18165	0.305000	0.20034	CCC		0.721	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433889.1	NM_001129979	
SYT8	90019	mdanderson.org	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381906.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481					.											0								T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
TPSAB1	7177	mdanderson.org	37	16	1291160	1291160	+	Missense_Mutation	SNP	G	G	T	rs141519544		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr16:1291160G>T	ENST00000338844.3	+	3	101	c.68G>T	c.(67-69)gGc>gTc	p.G23V	TPSAB1_ENST00000461509.2_Missense_Mutation_p.G30V	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	23			G -> V (in allele alpha; dbSNP:rs1141965). {ECO:0000269|PubMed:10898108}.		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G23V(1)		NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CCAGCCCCAGGCCAGGCCCTG	0.711																																						.											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											21.0	23.0	22.0					16																	1291160		2193	4291	6484	SO:0001583	missense	7177			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.68G>T	16.37:g.1291160G>T	ENSP00000343577:p.Gly23Val	Somatic		WXS	Illumina HiSeq	Phase_I	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	CCDS10431.1	745	0.3411172161172161	111	0.22560975609756098	106	0.292817679558011	262	0.458041958041958	266	0.35092348284960423	G	9.934	1.215703	0.22373	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.86497	-2.13;-2.13	2.84	0.752	0.18398	.	0.709020	0.11654	N	0.542536	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	D	0.56287	0.975	P	0.45660	0.489	T	0.17868	-1.0355	9	0.39692	T	0.17	.	4.3463	0.11134	0.1498:0.3033:0.5468:0.0	.	23	Q15661	TRYB1_HUMAN	V	23;30	ENSP00000343577:G23V;ENSP00000418247:G30V	ENSP00000343577:G23V	G	+	2	0	TPSAB1	1231161	0.001000	0.12720	0.035000	0.18076	0.629000	0.37895	0.668000	0.25127	0.237000	0.21200	0.479000	0.44913	GGC		0.711	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
TPSAB1	7177	mdanderson.org	37	16	1291175	1291175	+	Missense_Mutation	SNP	G	G	A	rs146223687		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr16:1291175G>A	ENST00000338844.3	+	3	116	c.83G>A	c.(82-84)cGa>cAa	p.R28Q	TPSAB1_ENST00000461509.2_Missense_Mutation_p.R35Q	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	28			R -> Q (in allele alpha; dbSNP:rs1064770).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GCCCTGCAGCGAGTGGGCATC	0.716																																						.											0													29.0	30.0	30.0					16																	1291175		2195	4294	6489	SO:0001583	missense	7177			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.83G>A	16.37:g.1291175G>A	ENSP00000343577:p.Arg28Gln	Somatic		WXS	Illumina HiSeq	Phase_I	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	CCDS10431.1	735	0.33653846153846156	108	0.21951219512195122	103	0.2845303867403315	275	0.4807692307692308	249	0.32849604221635886	G	7.760	0.705114	0.15172	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	T;T	0.81078	-1.45;-1.45	3.38	1.37	0.22104	.	0.365821	0.20030	N	0.100730	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.25351	0.124	B	0.17722	0.019	T	0.39354	-0.9618	9	0.12430	T	0.62	.	4.9221	0.13874	0.2867:0.0:0.7133:0.0	rs17134743	28	Q15661	TRYB1_HUMAN	Q	28;35	ENSP00000343577:R28Q;ENSP00000418247:R35Q	ENSP00000343577:R28Q	R	+	2	0	TPSAB1	1231176	0.908000	0.30866	0.007000	0.13788	0.007000	0.05969	1.186000	0.32078	0.765000	0.33221	0.479000	0.44913	CGA		0.716	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
TPSAB1	7177	mdanderson.org	37	16	1291178	1291178	+	Missense_Mutation	SNP	T	T	C	rs112944038		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr16:1291178T>C	ENST00000338844.3	+	3	119	c.86T>C	c.(85-87)gTg>gCg	p.V29A	TPSAB1_ENST00000461509.2_Missense_Mutation_p.V36A	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	29			V -> A (in allele alpha; dbSNP:rs1064771).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CTGCAGCGAGTGGGCATCGTC	0.716																																						.											0													32.0	32.0	32.0					16																	1291178		2196	4296	6492	SO:0001583	missense	7177			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.86T>C	16.37:g.1291178T>C	ENSP00000343577:p.Val29Ala	Somatic		WXS	Illumina HiSeq	Phase_I	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	CCDS10431.1	734	0.3360805860805861	109	0.22154471544715448	102	0.281767955801105	276	0.4825174825174825	247	0.3258575197889182	C	3.007	-0.204833	0.06180	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	T;T	0.81078	-1.45;-1.45	3.38	-6.75	0.01738	.	1.382050	0.04868	N	0.445430	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.07849	-1.0751	9	0.07325	T	0.83	.	7.137	0.25533	0.1118:0.6191:0.113:0.156	.	29	Q15661	TRYB1_HUMAN	A	29;36	ENSP00000343577:V29A;ENSP00000418247:V36A	ENSP00000343577:V29A	V	+	2	0	TPSAB1	1231179	0.934000	0.31675	0.000000	0.03702	0.001000	0.01503	-0.611000	0.05622	-3.400000	0.00171	-1.842000	0.00583	GTG		0.716	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
TPSAB1	7177	mdanderson.org	37	16	1291182	1291182	+	Silent	SNP	C	C	T	rs112531166		TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr16:1291182C>T	ENST00000338844.3	+	3	123	c.90C>T	c.(88-90)ggC>ggT	p.G30G	TPSAB1_ENST00000461509.2_Silent_p.G37G	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	30					defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				AGCGAGTGGGCATCGTCGGGG	0.711																																						.											0													34.0	35.0	35.0					16																	1291182		2198	4299	6497	SO:0001819	synonymous_variant	7177			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.90C>T	16.37:g.1291182C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Silent	SNP	ENST00000338844.3	37	CCDS10431.1																																																																																				0.711	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
WDR18	57418	mdanderson.org	37	19	984554	984554	+	Silent	SNP	C	C	G	rs4806884	byFrequency	TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr19:984554C>G	ENST00000251289.5	+	1	224	c.201C>G	c.(199-201)ctC>ctG	p.L67L	WDR18_ENST00000587001.2_Silent_p.L67L|WDR18_ENST00000591997.1_Intron	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	67					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGGAGCTCCAGCGGAAGG	0.711													.|||	1837	0.366813	0.3283	0.4092	5008	,	,		11315	0.2768		0.5567	False		,,,				2504	0.2863					.											0								G		1233,2751		232,769,991	5.0	7.0	7.0		201	-1.1	1.0	19	dbSNP_111	7	3627,4195		956,1715,1240	no	coding-synonymous	WDR18	NM_024100.3		1188,2484,2231	GG,GC,CC		46.3692,30.9488,41.1655		67/433	984554	4860,6946	1992	3911	5903	SO:0001819	synonymous_variant	57418				CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.201C>G	19.37:g.984554C>G		Somatic		WXS	Illumina HiSeq	Phase_I	O60390|Q9BWR2	Silent	SNP	ENST00000251289.5	37	CCDS12051.1																																																																																				0.711	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
SYT11	23208	bcgsc.ca	37	1	155837927	155837927	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr1:155837927T>C	ENST00000368324.4	+	2	459	c.206T>C	c.(205-207)cTc>cCc	p.L69P	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	69					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CCAGAGACCCTCAGCAACAAG	0.517																																						.											0													154.0	140.0	145.0					1																	155837927		2203	4300	6503	SO:0001583	missense	23208			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.206T>C	1.37:g.155837927T>C	ENSP00000357307:p.Leu69Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	ENST00000368324.4	37	CCDS1122.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.015340	0.75161	.	.	ENSG00000132718	ENST00000368324	T	0.59083	0.29	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67352	-0.5692	10	0.52906	T	0.07	.	15.7349	0.77834	0.0:0.0:0.0:1.0	.	69	Q9BT88	SYT11_HUMAN	P	69	ENSP00000357307:L69P	ENSP00000357307:L69P	L	+	2	0	SYT11	154104551	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.013000	0.88655	2.195000	0.70347	0.533000	0.62120	CTC		0.517	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1	NM_152280	
ADD3	120	bcgsc.ca	37	10	111890182	111890182	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr10:111890182T>C	ENST00000356080.4	+	13	2037	c.1670T>C	c.(1669-1671)cTc>cCc	p.L557P	ADD3_ENST00000360162.3_Missense_Mutation_p.L557P|ADD3_ENST00000277900.8_Missense_Mutation_p.L557P	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	557						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		TTTAGTCATCTCACAGAAGGA	0.383																																						.											0													156.0	142.0	147.0					10																	111890182		2203	4300	6503	SO:0001583	missense	120			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1670T>C	10.37:g.111890182T>C	ENSP00000348381:p.Leu557Pro	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.117345	0.77323	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.20738	2.05;2.05;2.05	5.9	5.9	0.94986	.	0.121775	0.56097	D	0.000032	T	0.48390	0.1497	M	0.73430	2.235	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.79108	0.949;0.992	T	0.50372	-0.8836	10	0.87932	D	0	-4.0791	16.3291	0.83001	0.0:0.0:0.0:1.0	.	557;557	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	P	557	ENSP00000353286:L557P;ENSP00000348381:L557P;ENSP00000277900:L557P	ENSP00000277900:L557P	L	+	2	0	ADD3	111880172	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.989000	0.63870	2.257000	0.74773	0.528000	0.53228	CTC		0.383	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
PIGS	94005	bcgsc.ca	37	17	26882056	26882056	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:26882056G>A	ENST00000308360.7	-	11	1580	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	UNC119_ENST00000335765.4_5'Flank|UNC119_ENST00000301032.4_5'Flank|PIGS_ENST00000395346.2_Missense_Mutation_p.P394L|PIGS_ENST00000543734.1_Missense_Mutation_p.P341L	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	402					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					AGGCAGCTGGGGCTGAGCAAT	0.542																																						.											0													53.0	48.0	50.0					17																	26882056		2203	4300	6503	SO:0001583	missense	94005				CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1205C>T	17.37:g.26882056G>A	ENSP00000309430:p.Pro402Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UVX6	Missense_Mutation	SNP	ENST00000308360.7	37	CCDS11235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.80|13.80	2.346509|2.346509	0.41599|0.41599	.|.	.|.	ENSG00000087111|ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734|ENST00000268758	T;T;T|.	0.40756|.	1.02;1.02;1.02|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.247996|0.247996	0.40302|0.40302	N|N	0.001139|0.001139	T|T	0.57344|0.57344	0.2047|0.2047	N|N	0.26042|0.26042	0.785|0.785	0.52099|0.52099	D|D	0.999945|0.999945	B;B|.	0.15930|.	0.015;0.012|.	B;B|.	0.18561|.	0.022;0.013|.	T|T	0.61806|0.61806	-0.6987|-0.6987	10|7	0.21540|0.87932	T|D	0.41|0	-24.0459|-24.0459	14.9809|14.9809	0.71311|0.71311	0.0:0.0:0.8485:0.1515|0.0:0.0:0.8485:0.1515	.|.	402;394|.	Q96S52;Q96S52-2|.	PIGS_HUMAN;.|.	L|S	394;402;341|144	ENSP00000378755:P394L;ENSP00000309430:P402L;ENSP00000438447:P341L|.	ENSP00000309430:P402L|ENSP00000268758:P144S	P|P	-|-	2|1	0|0	PIGS|PIGS	23906183|23906183	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.871000|0.871000	0.50021|0.50021	2.584000|2.584000	0.46102|0.46102	2.538000|2.538000	0.85594|0.85594	0.462000|0.462000	0.41574|0.41574	CCC|CCC		0.542	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255833.3	NM_033198	
LRRC37B	114659	bcgsc.ca	37	17	30348140	30348140	+	5'Flank	SNP	C	C	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr17:30348140C>G	ENST00000341671.7	+	0	0				LRRC37B_ENST00000394713.3_5'UTR|LRRC37B_ENST00000584368.1_Missense_Mutation_p.A4G|LRRC37B_ENST00000327564.7_Missense_Mutation_p.A19G|LRRC37B_ENST00000543378.2_Intron	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				ATGGCTTTTGCTGAGTGCATA	0.502																																						.											0													52.0	54.0	53.0					17																	30348140		2195	4283	6478	SO:0001631	upstream_gene_variant	114659			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785		17.37:g.30348140C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	37	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	5.469	0.271573	0.10349	.	.	ENSG00000185158	ENST00000327564	T	0.74002	-0.8	1.45	-0.74	0.11115	.	.	.	.	.	T	0.67515	0.2901	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.60949	-0.7161	6	0.87932	D	0	.	4.0966	0.09993	0.0:0.5706:0.0:0.4294	.	.	.	.	G	19	ENSP00000332536:A19G	ENSP00000332536:A19G	A	+	2	0	LRRC37B	27372253	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.113000	0.03296	-0.156000	0.11079	-0.723000	0.03601	GCT		0.502	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888	
EIF5B	9669	bcgsc.ca	37	2	99995848	99995848	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr2:99995848T>C	ENST00000289371.6	+	12	2220	c.2018T>C	c.(2017-2019)gTt>gCt	p.V673A		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	673	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCCACCAATGTTCCTCTTGAA	0.343																																					Colon(162;2388 2567 2705 3444)	.											0													104.0	94.0	97.0					2																	99995848		1868	4103	5971	SO:0001583	missense	9669			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.2018T>C	2.37:g.99995848T>C	ENSP00000289371:p.Val673Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	37	CCDS42721.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.942866	0.92526	.	.	ENSG00000158417	ENST00000289371	T	0.76839	-1.05	5.78	5.78	0.91487	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	.	.	.	.	D	0.89125	0.6626	M	0.86651	2.83	0.80722	D	1	D	0.64830	0.994	D	0.69479	0.964	D	0.90314	0.4339	8	.	.	.	-24.6168	16.1127	0.81273	0.0:0.0:0.0:1.0	.	673	O60841	IF2P_HUMAN	A	673	ENSP00000289371:V673A	.	V	+	2	0	EIF5B	99362280	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.717000	0.84732	2.212000	0.71576	0.260000	0.18958	GTT		0.343	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
PEX1	5189	bcgsc.ca	37	7	92116845	92116845	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chr7:92116845A>G	ENST00000248633.4	-	24	3873	c.3778T>C	c.(3778-3780)Ttt>Ctt	p.F1260L	AC007566.10_ENST00000441539.1_RNA|AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000438045.1_Missense_Mutation_p.F938L|PEX1_ENST00000428214.1_Missense_Mutation_p.F1203L	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1260					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GGATTTTGAAAGCTTTCATAT	0.269																																						.											0													64.0	68.0	66.0					7																	92116845		2201	4287	6488	SO:0001583	missense	5189			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3778T>C	7.37:g.92116845A>G	ENSP00000248633:p.Phe1260Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	37	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.770896	0.90108	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.98120	-4.38;-4.73;-4.32	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.98277	0.9429	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.997	D;D;D	0.83275	0.996;0.985;0.985	D	0.99198	1.0872	10	0.87932	D	0	-21.3596	13.566	0.61819	1.0:0.0:0.0:0.0	.	938;1052;1260	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	L	938;1260;1203	ENSP00000410438:F938L;ENSP00000248633:F1260L;ENSP00000394413:F1203L	ENSP00000248633:F1260L	F	-	1	0	PEX1	91954781	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.853000	0.75435	2.216000	0.71823	0.528000	0.53228	TTT		0.269	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
CLCN5	1184	bcgsc.ca	37	X	49834549	49834549	+	5'UTR	SNP	A	A	G			TCGA-KO-8407-01A-11D-2310-10	TCGA-KO-8407-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	64f696a6-58b2-40a8-b848-fd775cd52529	60f94151-bbc5-4bea-a081-b0247bdbabb3	g.chrX:49834549A>G	ENST00000307367.2	+	0	260				CLCN5_ENST00000376088.3_Missense_Mutation_p.N60S|CLCN5_ENST00000376091.3_Missense_Mutation_p.N60S|CLCN5_ENST00000376108.3_5'UTR			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5						chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					AAGTCGTACAATGGTGGAGGA	0.393																																						.											0													88.0	69.0	76.0					X																	49834549		2203	4300	6503	SO:0001623	5_prime_UTR_variant	1184			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.-32A>G	X.37:g.49834549A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	A	14.51	2.556264	0.45487	.	.	ENSG00000171365	ENST00000376088;ENST00000376091	D;D	0.89617	-2.54;-2.54	5.7	5.7	0.88788	.	.	.	.	.	D	0.82416	0.5032	.	.	.	0.80722	D	1	B	0.28291	0.206	B	0.25291	0.059	T	0.78507	-0.2177	8	0.19590	T	0.45	-23.9209	13.8096	0.63253	1.0:0.0:0.0:0.0	.	60	P51795-2	.	S	60	ENSP00000365256:N60S;ENSP00000365259:N60S	ENSP00000365256:N60S	N	+	2	0	CLCN5	49721289	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.184000	0.72008	1.906000	0.55180	0.412000	0.27726	AAT		0.393	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
