#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ASIC1	41	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	50453582	50453582	+	Silent	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr12:50453582C>T	ENST00000447966.2	+	3	632	c.403C>T	c.(403-405)Ctg>Ttg	p.L135L	ASIC1_ENST00000228468.4_Silent_p.L135L	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	135					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	TGAAAAGCAGCTGGAGATACT	0.537																																																	0													130.0	103.0	112.0					12																	50453582		2203	4300	6503	SO:0001819	synonymous_variant	0			U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.403C>T	12.37:g.50453582C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A3KN86|E5KBL7|P78349|Q96CV2	Silent	SNP	ENST00000447966.2	37	CCDS44876.1																																																																																				0.537	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2		NM_020039	
ACCS	84680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	44096169	44096169	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr11:44096169G>A	ENST00000263776.8	+	5	861	c.427G>A	c.(427-429)Gag>Aag	p.E143K	ACCS_ENST00000533208.1_3'UTR|ACCS_ENST00000432284.2_Missense_Mutation_p.G119E|CTD-2609K8.3_ENST00000531268.1_RNA	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	143					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						CAGCCTCCGGGAGGAAGTGGC	0.562																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0													179.0	161.0	167.0					11																	44096169		2203	4300	6503	SO:0001583	missense	84680			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.427G>A	11.37:g.44096169G>A	ENSP00000263776:p.Glu143Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.71|12.71	2.020706|2.020706	0.35606|0.35606	.|.	.|.	ENSG00000110455|ENSG00000110455	ENST00000263776|ENST00000432284	T|T	0.24723|0.38401	1.84|1.14	5.78|5.78	3.88|3.88	0.44766|0.44766	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.101782|.	0.64402|.	D|.	0.000003|.	T|T	0.21674|0.21674	0.0522|0.0522	N|N	0.17248|0.17248	0.465|0.465	0.30778|0.30778	N|N	0.742278|0.742278	B;B|B	0.26935|0.27997	0.164;0.012|0.197	B;B|B	0.26310|0.22386	0.047;0.068|0.039	T|T	0.13683|0.13683	-1.0500|-1.0500	10|9	0.08599|0.24483	T|T	0.76|0.36	-16.1246|-16.1246	11.2621|11.2621	0.49089|0.49089	0.1477:0.0:0.8523:0.0|0.1477:0.0:0.8523:0.0	.|.	70;143|119	B4DYM9;Q96QU6|B4E219	.;1A1L1_HUMAN|.	K|E	143|119	ENSP00000263776:E143K|ENSP00000391775:G119E	ENSP00000263776:E143K|ENSP00000391775:G119E	E|G	+|+	1|2	0|0	ACCS|ACCS	44052745|44052745	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.406000|4.406000	0.59748|0.59748	1.419000|1.419000	0.47118|0.47118	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.562	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1		NM_032592	
AKAP6	9472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	33068660	33068660	+	Silent	SNP	T	T	A	rs144892695		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr14:33068660T>A	ENST00000280979.4	+	6	2684	c.2514T>A	c.(2512-2514)gcT>gcA	p.A838A	AKAP6_ENST00000557272.1_Silent_p.A838A|AKAP6_ENST00000557354.1_Silent_p.A838A	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	838					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TCAAGGAAGCTGTGGAGGAGG	0.398																																					Melanoma(49;821 1200 7288 13647 42351)												0													157.0	145.0	149.0					14																	33068660		2203	4300	6503	SO:0001819	synonymous_variant	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2514T>A	14.37:g.33068660T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	CCDS9644.1																																																																																				0.398	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2		NM_004274	
ANKRD36	375248	broad.mit.edu;hgsc.bcm.edu	37	2	97784175	97784175	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:97784175A>T	ENST00000461153.2	+	3	651	c.407A>T	c.(406-408)cAc>cTc	p.H136L	ANKRD36_ENST00000420699.2_Missense_Mutation_p.H136L			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	136										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						ACTGCTCTGCACTACGCTGTG	0.413																																																	0													74.0	61.0	65.0					2																	97784175		1860	4101	5961	SO:0001583	missense	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.407A>T	2.37:g.97784175A>T	ENSP00000419530:p.His136Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657408	0.47467	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000393513;ENST00000289105;ENST00000455519	T;T	0.69806	-0.43;-0.43	1.4	1.4	0.22301	Ankyrin repeat-containing domain (4);	0.000000	0.49916	D	0.000133	T	0.72550	0.3474	M	0.63843	1.955	0.80722	D	1	D;P;D	0.69078	0.993;0.89;0.997	D;D;D	0.68943	0.961;0.923;0.958	T	0.71454	-0.4588	10	0.87932	D	0	.	4.9561	0.14041	1.0:0.0:0.0:0.0	.	136;136;136	A6QL64;F2Z332;A6QL64-4	AN36A_HUMAN;.;.	L	136	ENSP00000419530:H136L;ENSP00000391950:H136L	ENSP00000289105:H136L	H	+	2	0	ANKRD36	97147902	1.000000	0.71417	0.149000	0.22428	0.090000	0.18270	4.976000	0.63785	0.893000	0.36288	0.155000	0.16302	CAC		0.413	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			
ARSB	411	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	78076227	78076227	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:78076227C>T	ENST00000264914.4	-	8	2131	c.1595G>A	c.(1594-1596)tGg>tAg	p.W532*		NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	532					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		ATCCTACATCCAAGGGCCCCA	0.532																																					Melanoma(169;563 1968 25780 26156 52266)												0													57.0	54.0	55.0					5																	78076227		2203	4298	6501	SO:0001587	stop_gained	411			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1595G>A	5.37:g.78076227C>T	ENSP00000264914:p.Trp532*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC20|Q8N322|Q9UDI9	Nonsense_Mutation	SNP	ENST00000264914.4	37	CCDS4043.1	.	.	.	.	.	.	.	.	.	.	C	43	10.069172	0.99330	.	.	ENSG00000113273	ENST00000264914	.	.	.	5.3	5.3	0.74995	.	0.122412	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.9763	0.89128	0.0:1.0:0.0:0.0	.	.	.	.	X	532	.	ENSP00000264914:W532X	W	-	2	0	ARSB	78111983	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.534000	0.73833	2.476000	0.83614	0.555000	0.69702	TGG		0.532	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226932.2		NM_000046	
ATG2A	23130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	64673943	64673943	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr11:64673943G>A	ENST00000377264.3	-	21	3158	c.3046C>T	c.(3046-3048)Cag>Tag	p.Q1016*	ATG2A_ENST00000421419.2_Nonsense_Mutation_p.Q1016*	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1016					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GGGGCCAGCTGAGCCGGGGGA	0.687																																																	0													33.0	41.0	38.0					11																	64673943		2201	4297	6498	SO:0001587	stop_gained	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.3046C>T	11.37:g.64673943G>A	ENSP00000366475:p.Gln1016*	Somatic		WXS	Illumina HiSeq	Phase_I	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Nonsense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.031055|7.031055	0.98013|0.98013	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000421419;ENST00000377264|ENST00000418259	.|.	.|.	.|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.196963|.	0.43919|.	D|.	0.000516|.	.|T	.|0.56455	.|0.1986	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64622	.|-0.6364	.|3	0.02654|.	T|.	1|.	.|.	11.5776|11.5776	0.50873|0.50873	0.0:0.0:0.8217:0.1783|0.0:0.0:0.8217:0.1783	.|.	.|.	.|.	.|.	X|L	1016|817	.|.	ENSP00000366475:Q1016X|.	Q|S	-|-	1|2	0|0	ATG2A|ATG2A	64430519|64430519	0.976000|0.976000	0.34144|0.34144	0.960000|0.960000	0.40013|0.40013	0.699000|0.699000	0.40488|0.40488	2.337000|2.337000	0.43947|0.43947	2.574000|2.574000	0.86865|0.86865	0.655000|0.655000	0.94253|0.94253	CAG|TCA		0.687	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1		NM_015104	
BAP1	8314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52438515	52438515	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr3:52438515C>A	ENST00000460680.1	-	12	1675	c.1204G>T	c.(1204-1206)Gag>Tag	p.E402*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.E384*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		tcgtcatcctcatagtcatcc	0.577			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0													157.0	116.0	130.0					3																	52438515		2203	4300	6503	SO:0001587	stop_gained	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1204G>T	3.37:g.52438515C>A	ENSP00000417132:p.Glu402*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	38	6.706306	0.97776	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	5.65	5.65	0.86999	.	0.168051	0.52532	D	0.000070	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.7207	0.96142	0.0:1.0:0.0:0.0	.	.	.	.	X	402;384	.	ENSP00000296288:E384X	E	-	1	0	BAP1	52413555	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	6.282000	0.72639	2.661000	0.90470	0.655000	0.94253	GAG		0.577	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
BMX	660	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	15549469	15549469	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chrX:15549469A>G	ENST00000357607.2	+	11	1146	c.958A>G	c.(958-960)Atg>Gtg	p.M320V	BMX_ENST00000348343.6_Missense_Mutation_p.M320V|BMX_ENST00000342014.6_Missense_Mutation_p.M320V			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	320	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					AGGAGCATTTATGGTTAGAAA	0.343																																																	0													153.0	150.0	151.0					X																	15549469		2203	4300	6503	SO:0001583	missense	660			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.958A>G	X.37:g.15549469A>G	ENSP00000350224:p.Met320Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	37	CCDS14168.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.459800	0.26248	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	T;T;T	0.24723	1.84;1.84;1.84	5.56	5.56	0.83823	SH2 motif (5);	0.076868	0.56097	D	0.000026	T	0.16557	0.0398	N	0.20685	0.6	0.36953	D	0.892985	B	0.21821	0.061	B	0.20767	0.031	T	0.17319	-1.0373	10	0.17369	T	0.5	.	12.4963	0.55929	1.0:0.0:0.0:0.0	.	320	P51813	BMX_HUMAN	V	320	ENSP00000350224:M320V;ENSP00000308774:M320V;ENSP00000340082:M320V	ENSP00000340082:M320V	M	+	1	0	BMX	15459390	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	1.798000	0.38814	1.857000	0.53885	0.486000	0.48141	ATG		0.343	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1		NM_001721	
C10orf76	79591	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	103750317	103750317	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr10:103750317T>C	ENST00000370033.4	-	19	1516	c.1397A>G	c.(1396-1398)gAt>gGt	p.D466G		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	466						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		CATATAGAGATCCATAGGAAA	0.348																																																	0													128.0	123.0	124.0					10																	103750317		1817	4092	5909	SO:0001583	missense	79591			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.1397A>G	10.37:g.103750317T>C	ENSP00000359050:p.Asp466Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.220406	0.79464	.	.	ENSG00000120029	ENST00000370033;ENST00000431271;ENST00000263485;ENST00000456149	T	0.68624	-0.34	5.86	5.86	0.93980	Domain of unknown function DUF1741 (1);	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	L	0.35793	1.09	0.80722	D	1	P	0.51057	0.941	P	0.51657	0.676	T	0.71447	-0.4590	10	0.72032	D	0.01	-16.3984	14.819	0.70055	0.0:0.0:0.0:1.0	.	466	Q5T2E6	CJ076_HUMAN	G	466;41;92;92	ENSP00000359050:D466G	ENSP00000263485:D92G	D	-	2	0	C10orf76	103740307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.800000	0.69108	2.241000	0.73720	0.533000	0.62120	GAT		0.348	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1		NM_024541	
C16orf71	146562	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	4794979	4794979	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr16:4794979C>T	ENST00000299320.5	+	6	1488	c.1010C>T	c.(1009-1011)cCc>cTc	p.P337L	RP11-127I20.7_ENST00000588099.1_RNA|C16orf71_ENST00000590191.1_Missense_Mutation_p.P351L	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	337										breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						GCCGACACTCCCCAGGACACC	0.612																																																	0													57.0	53.0	55.0					16																	4794979		2197	4300	6497	SO:0001583	missense	146562			AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.1010C>T	16.37:g.4794979C>T	ENSP00000299320:p.Pro337Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NCV0	Missense_Mutation	SNP	ENST00000299320.5	37	CCDS10521.1	.	.	.	.	.	.	.	.	.	.	C	7.892	0.732628	0.15507	.	.	ENSG00000166246	ENST00000299320;ENST00000411541	T	0.05513	3.43	4.02	-0.237	0.13061	.	1.023020	0.07792	N	0.955085	T	0.03136	0.0092	N	0.24115	0.695	0.09310	N	1	B	0.30851	0.297	B	0.27262	0.078	T	0.38286	-0.9668	10	0.02654	T	1	-3.0288	3.6116	0.08062	0.0:0.4733:0.1908:0.3359	.	337	Q8IYS4	CP071_HUMAN	L	337;92	ENSP00000299320:P337L	ENSP00000299320:P337L	P	+	2	0	C16orf71	4734980	0.000000	0.05858	0.027000	0.17364	0.060000	0.15804	0.042000	0.13949	-0.000000	0.14550	-0.258000	0.10820	CCC		0.612	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251644.1		NM_139170	
CCDC181	57821	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	169391155	169391155	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:169391155A>C	ENST00000367806.3	-	3	666	c.514T>G	c.(514-516)Ttt>Gtt	p.F172V	CCDC181_ENST00000367805.3_Missense_Mutation_p.F172V|CCDC181_ENST00000545005.1_Missense_Mutation_p.F172V|CCDC181_ENST00000491570.1_5'UTR	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	172			F -> S (in dbSNP:rs3820059). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.			nucleus (GO:0005634)											TAATTTTTAAAAGTAGTAGTG	0.353																																																	0													72.0	78.0	76.0					1																	169391155		2203	4298	6501	SO:0001583	missense	57821			AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.514T>G	1.37:g.169391155A>C	ENSP00000356780:p.Phe172Val	Somatic		WXS	Illumina HiSeq	Phase_I	O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	ENST00000367806.3	37		.	.	.	.	.	.	.	.	.	.	A	0.007	-1.960468	0.00465	.	.	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005;ENST00000456107	T;T;T;T	0.21191	2.02;2.02;2.02;2.03	5.24	1.4	0.22301	.	1.102760	0.06633	N	0.759632	T	0.02688	0.0081	N	0.08118	0	0.18873	N	0.999985	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.44205	-0.9343	9	0.15952	T	0.53	0.091	5.9865	0.19436	0.5414:0.2278:0.2308:0.0	.	172;172;172	Q5TID7-2;Q5TID7;Q5TID7-3	.;CA114_HUMAN;.	V	172	ENSP00000356779:F172V;ENSP00000356780:F172V;ENSP00000442297:F172V;ENSP00000411000:F172V	ENSP00000356779:F172V	F	-	1	0	C1orf114	167657779	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	0.226000	0.17776	0.307000	0.22880	0.455000	0.32223	TTT		0.353	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086099.1		NM_021179	
CARS	833	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	3050597	3050597	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr11:3050597G>C	ENST00000397111.5	-	7	874	c.629C>G	c.(628-630)tCc>tGc	p.S210C	CARS_ENST00000397114.3_Missense_Mutation_p.S200C|CARS_ENST00000401769.3_Missense_Mutation_p.S223C|CARS_ENST00000380525.4_Missense_Mutation_p.S293C|CARS-AS1_ENST00000499962.1_RNA|CARS_ENST00000278224.9_Missense_Mutation_p.S210C			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	210					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	GGAGAAGATGGAATTGTCAGT	0.483			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)			Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	0													100.0	99.0	99.0					11																	3050597		2202	4298	6500	SO:0001583	missense	833			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.629C>G	11.37:g.3050597G>C	ENSP00000380300:p.Ser210Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	ENST00000397111.5	37	CCDS7742.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684101	0.68157	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.48522	0.81;0.83;0.83;0.82;0.82	3.9	2.98	0.34508	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.71117	0.3302	M	0.90650	3.135	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;0.998;1.0	D;D;D;D;D;D	0.79108	0.984;0.984;0.992;0.987;0.984;0.992	T	0.75551	-0.3278	10	0.62326	D	0.03	-25.42	11.4874	0.50361	0.0905:0.0:0.9095:0.0	.	223;293;210;210;293;200	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	C	293;210;210;200;223	ENSP00000369897:S293C;ENSP00000380300:S210C;ENSP00000278224:S210C;ENSP00000380303:S200C;ENSP00000384069:S223C	ENSP00000278224:S210C	S	-	2	0	CARS	3007173	1.000000	0.71417	0.934000	0.37439	0.908000	0.53690	8.603000	0.90871	0.829000	0.34733	0.555000	0.69702	TCC		0.483	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4		NM_001751	
CBX8	57332	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	77768913	77768913	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr17:77768913G>C	ENST00000269385.4	-	5	808	c.691C>G	c.(691-693)Ctg>Gtg	p.L231V	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	231					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GTGTCGTCCAGCTTCCTGCCC	0.662																																																	0													29.0	29.0	29.0					17																	77768913		2203	4300	6503	SO:0001583	missense	57332			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.691C>G	17.37:g.77768913G>C	ENSP00000269385:p.Leu231Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q96H39|Q9NR07	Missense_Mutation	SNP	ENST00000269385.4	37	CCDS11765.1	.	.	.	.	.	.	.	.	.	.	g	5.418	0.262251	0.10239	.	.	ENSG00000141570	ENST00000269385;ENST00000427800;ENST00000413392	T	0.42900	0.96	4.87	0.265	0.15612	.	1.161370	0.06380	N	0.715021	T	0.22399	0.0540	N	0.14661	0.345	0.24552	N	0.994014	B	0.02656	0.0	B	0.04013	0.001	T	0.22521	-1.0214	10	0.29301	T	0.29	-6.0904	2.7275	0.05218	0.0861:0.247:0.2964:0.3705	.	231	Q9HC52	CBX8_HUMAN	V	231;206;221	ENSP00000269385:L231V	ENSP00000269385:L231V	L	-	1	2	CBX8	75383508	0.997000	0.39634	1.000000	0.80357	0.982000	0.71751	0.367000	0.20382	0.572000	0.29383	-0.509000	0.04479	CTG		0.662	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318011.1		NM_020649	
CDH8	1006	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	61689382	61689382	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr16:61689382A>C	ENST00000577390.1	-	11	2852	c.1898T>G	c.(1897-1899)tTg>tGg	p.L633W	CDH8_ENST00000299345.6_Missense_Mutation_p.L633W|CDH8_ENST00000577730.1_Missense_Mutation_p.L633W	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	633					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ACCTAACAGCAAAATGATGCA	0.423																																																	0													91.0	76.0	81.0					16																	61689382		2203	4300	6503	SO:0001583	missense	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1898T>G	16.37:g.61689382A>C	ENSP00000462701:p.Leu633Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.733276	0.89482	.	.	ENSG00000150394	ENST00000299345	T	0.61627	0.09	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000002	T	0.69115	0.3075	L	0.43152	1.355	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.72141	-0.4380	10	0.87932	D	0	.	15.0016	0.71476	1.0:0.0:0.0:0.0	.	633	P55286	CADH8_HUMAN	W	633	ENSP00000299345:L633W	ENSP00000299345:L633W	L	-	2	0	CDH8	60246883	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.904000	0.92590	2.146000	0.66826	0.459000	0.35465	TTG		0.423	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3		NM_001796	
CEBPZ	10153	hgsc.bcm.edu	37	2	37428927	37428929	+	In_Frame_Del	DEL	TTT	TTT	-	rs551280049|rs190431091|rs148813970	byFrequency	TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	TTT	TTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:37428927_37428929delTTT	ENST00000234170.5	-	16	3288_3290	c.3143_3145delAAA	c.(3142-3147)aaaact>act	p.K1048del	AC007390.5_ENST00000406711.1_Intron|AC007390.5_ENST00000392061.2_Intron|AC007390.5_ENST00000402297.1_Intron|AC007390.5_ENST00000397226.2_Intron|AC007390.5_ENST00000397064.2_Intron	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	1048					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TGTTTTTTAGTTTTTTGAGTGGT	0.3																																																	0										48,4216		2,44,2086						-0.3	0.1		dbSNP_54	38	454,7798		23,408,3695	no	coding	CEBPZ	NM_005760.2		25,452,5781	A1A1,A1R,RR		5.5017,1.1257,4.0109				502,12014				SO:0001651	inframe_deletion	10153			M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.3143_3145delAAA	2.37:g.37428930_37428932delTTT	ENSP00000234170:p.Lys1048del	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NE75	In_Frame_Del	DEL	ENST00000234170.5	37	CCDS1787.1																																																																																				0.300	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2		NM_005760	
CHIT1	1118	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	203186906	203186906	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:203186906C>T	ENST00000367229.1	-	10	1151	c.1117G>A	c.(1117-1119)Ggc>Agc	p.G373S	CHIT1_ENST00000255427.3_Missense_Mutation_p.G354S|CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Missense_Mutation_p.G364S	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	373					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GGGTATCGGCCCTGGTTGCAG	0.592																																																	0													65.0	59.0	61.0					1																	203186906		2203	4300	6503	SO:0001583	missense	1118			U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1117G>A	1.37:g.203186906C>T	ENSP00000356198:p.Gly373Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Missense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193986	0.58017	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	T;T;T	0.37584	1.19;1.19;1.19	4.84	3.93	0.45458	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.47093	D	0.000252	T	0.63462	0.2513	M	0.88512	2.96	0.47547	D	0.999458	D;D;D	0.89917	1.0;0.994;0.977	D;P;P	0.97110	1.0;0.872;0.809	T	0.69143	-0.5223	10	0.66056	D	0.02	-7.6467	11.2318	0.48916	0.0:0.9098:0.0:0.0902	.	344;364;373	Q13231-3;G5EA51;Q13231	.;.;CHIT1_HUMAN	S	373;354;364	ENSP00000356198:G373S;ENSP00000255427:G354S;ENSP00000438078:G364S	ENSP00000255427:G354S	G	-	1	0	CHIT1	201453529	1.000000	0.71417	0.576000	0.28549	0.200000	0.23975	4.206000	0.58473	1.174000	0.42811	0.655000	0.94253	GGC		0.592	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2		NM_003465	
CHRNA1	1134	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	175612868	175612868	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:175612868A>T	ENST00000261007.5	-	10	1499	c.1433T>A	c.(1432-1434)tTa>tAa	p.L478*	AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Nonsense_Mutation_p.L371*|CHRNA1_ENST00000409219.1_Nonsense_Mutation_p.L373*|CHRNA1_ENST00000348749.5_Nonsense_Mutation_p.L453*	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	478					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TTGCTGATTTAATTCAATGAG	0.488																																																	0													93.0	86.0	88.0					2																	175612868		2203	4300	6503	SO:0001587	stop_gained	1134			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1433T>A	2.37:g.175612868A>T	ENSP00000261007:p.Leu478*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRV6|D3DPE8	Nonsense_Mutation	SNP	ENST00000261007.5	37	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	A	35	5.470363	0.96274	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	.	.	.	5.24	5.24	0.73138	.	0.295099	0.32301	N	0.006292	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4423	0.75195	1.0:0.0:0.0:0.0	.	.	.	.	X	453;478;371;373	.	ENSP00000261007:L478X	L	-	2	0	CHRNA1	175321114	1.000000	0.71417	0.644000	0.29465	0.983000	0.72400	7.096000	0.76960	2.107000	0.64212	0.533000	0.62120	TTA		0.488	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			
CILP2	148113	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19653420	19653420	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:19653420G>A	ENST00000291495.5	+	5	914	c.829G>A	c.(829-831)Gga>Aga	p.G277R	CILP2_ENST00000586018.1_Missense_Mutation_p.G283R|CILP2_ENST00000588333.2_3'UTR	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	277						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CCAGGCCAACGGATCCATCTC	0.597																																																	0													52.0	52.0	52.0					19																	19653420		2203	4300	6503	SO:0001583	missense	148113			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.829G>A	19.37:g.19653420G>A	ENSP00000291495:p.Gly277Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	7.123	0.578383	0.13686	.	.	ENSG00000160161	ENST00000291495	T	0.52983	0.64	5.23	-6.0	0.02206	Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.845223	0.10738	N	0.639848	T	0.37785	0.1016	L	0.47716	1.5	0.09310	N	1	B;B	0.19200	0.034;0.034	B;B	0.19391	0.025;0.025	T	0.23833	-1.0177	10	0.20519	T	0.43	-16.4744	16.5466	0.84448	0.215:0.0:0.785:0.0	.	277;277	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	R	277	ENSP00000291495:G277R	ENSP00000291495:G277R	G	+	1	0	CILP2	19514420	0.000000	0.05858	0.191000	0.23289	0.180000	0.23129	-1.275000	0.02817	-1.346000	0.02211	0.555000	0.69702	GGA		0.597	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3		NM_153221	
DMAP1	55929	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	44684379	44684379	+	Silent	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:44684379A>T	ENST00000372289.2	+	5	935	c.672A>T	c.(670-672)cgA>cgT	p.R224R	DMAP1_ENST00000361745.6_Silent_p.R224R|DMAP1_ENST00000315913.5_Silent_p.R224R|DMAP1_ENST00000488433.1_3'UTR	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	224					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					GGCACGAACGACGGCGGAAGG	0.562											OREG0013437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													117.0	111.0	113.0					1																	44684379		2203	4300	6503	SO:0001819	synonymous_variant	55929			AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.672A>T	1.37:g.44684379A>T		Somatic	925	WXS	Illumina HiSeq	Phase_I	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Silent	SNP	ENST00000372289.2	37	CCDS509.1																																																																																				0.562	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3		NM_019100	
DNAJA3	9093	hgsc.bcm.edu;ucsc.edu	37	16	4504893	4504893	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr16:4504893delT	ENST00000262375.6	+	11	1498	c.1421delT	c.(1420-1422)cttfs	p.L474fs	DNAJA3_ENST00000431375.2_Intron|DNAJA3_ENST00000355296.4_Intron	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	474					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						CTTTCCAAACTTAAGAAAATG	0.498																																																	0													79.0	76.0	77.0					16																	4504893		2197	4300	6497	SO:0001589	frameshift_variant	9093			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1421delT	16.37:g.4504893delT	ENSP00000262375:p.Leu474fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Frame_Shift_Del	DEL	ENST00000262375.6	37	CCDS10515.1																																																																																				0.498	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1			
DNAH3	55567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	21033334	21033334	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr16:21033334T>G	ENST00000261383.3	-	40	5734	c.5735A>C	c.(5734-5736)cAc>cCc	p.H1912P	DNAH3_ENST00000415178.1_Intron	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1912					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GAAGGCAAGGTGGATGGGAGA	0.473																																																	0													130.0	105.0	114.0					16																	21033334		2201	4300	6501	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5735A>C	16.37:g.21033334T>G	ENSP00000261383:p.His1912Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.860085	0.51482	.	.	ENSG00000158486	ENST00000261383	T	0.27890	1.64	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.37265	0.0997	M	0.79258	2.445	0.80722	D	1	B	0.30686	0.29	B	0.28638	0.092	T	0.37596	-0.9699	10	0.66056	D	0.02	.	14.543	0.68008	0.0:0.0:0.0:1.0	.	1912	Q8TD57	DYH3_HUMAN	P	1912	ENSP00000261383:H1912P	ENSP00000261383:H1912P	H	-	2	0	DNAH3	20940835	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.285000	0.78660	1.835000	0.53391	0.379000	0.24179	CAC		0.473	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1		NM_017539	
DOCK7	85440	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	63084419	63084419	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:63084419T>C	ENST00000340370.5	-	14	1657	c.1640A>G	c.(1639-1641)gAg>gGg	p.E547G	DOCK7_ENST00000251157.5_Missense_Mutation_p.E547G|DOCK7_ENST00000404627.2_Missense_Mutation_p.E547G	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	547					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TGCGGGAAACTCTAAGATTTC	0.388																																																	0													92.0	98.0	96.0					1																	63084419		2203	4300	6503	SO:0001583	missense	85440				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.1640A>G	1.37:g.63084419T>C	ENSP00000340742:p.Glu547Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.894305	0.91889	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.39592	1.07;1.07;1.07	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;1.0	T	0.74542	-0.3631	10	0.87932	D	0	.	15.5051	0.75731	0.0:0.0:0.0:1.0	.	547;547;547;547;547	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	G	547	ENSP00000251157:E547G;ENSP00000340742:E547G;ENSP00000384446:E547G	ENSP00000251157:E547G	E	-	2	0	DOCK7	62857007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.825000	0.86693	2.248000	0.74166	0.528000	0.53228	GAG		0.388	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1		NM_033407	
DOK7	285489	hgsc.bcm.edu;ucsc.edu	37	4	3487325	3487325	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr4:3487325delT	ENST00000340083.5	+	5	657	c.592delT	c.(592-594)tgcfs	p.C198fs	DOK7_ENST00000507039.1_Frame_Shift_Del_p.L194fs|DOK7_ENST00000389653.2_Frame_Shift_Del_p.C198fs	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	198	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTGTTCGACTGCATCGTCCG	0.682																																																	0													47.0	43.0	45.0					4																	3487325		2203	4300	6503	SO:0001589	frameshift_variant	285489			AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.592delT	4.37:g.3487325delT	ENSP00000344432:p.Cys198fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Frame_Shift_Del	DEL	ENST00000340083.5	37	CCDS3370.2																																																																																				0.682	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1		NM_173660	
DSC2	1824	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	28651758	28651758	+	Silent	SNP	A	A	G	rs397517395		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr18:28651758A>G	ENST00000280904.6	-	13	2381	c.1938T>C	c.(1936-1938)taT>taC	p.Y646Y	snoU13_ENST00000459603.1_RNA|DSC2_ENST00000251081.6_Silent_p.Y646Y	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	646	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TAGGTACTACATATGAGCCAA	0.368																																																	0													115.0	99.0	104.0					18																	28651758		2203	4300	6503	SO:0001819	synonymous_variant	1824			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1938T>C	18.37:g.28651758A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000280904.6	37	CCDS11892.1																																																																																				0.368	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1		NM_004949	
EIF2AK4	440275	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	40299227	40299227	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr15:40299227C>G	ENST00000263791.5	+	24	3411	c.3368C>G	c.(3367-3369)gCa>gGa	p.A1123G	EIF2AK4_ENST00000559311.1_3'UTR|EIF2AK4_ENST00000382727.2_Missense_Mutation_p.A1095G	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1123	Histidyl-tRNA synthetase-like.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ATCCCTTTTGCAAGATATGTG	0.299																																																	0													72.0	65.0	67.0					15																	40299227		1797	4073	5870	SO:0001583	missense	440275			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.3368C>G	15.37:g.40299227C>G	ENSP00000263791:p.Ala1123Gly	Somatic		WXS	Illumina HiSeq	Phase_I	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.885236	0.91814	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.56444	0.46;0.46	5.93	5.93	0.95920	.	0.053822	0.64402	D	0.000001	T	0.72993	0.3530	M	0.85373	2.75	0.80722	D	1	D;D	0.63046	0.99;0.992	P;P	0.56612	0.762;0.802	T	0.76948	-0.2770	10	0.87932	D	0	-17.0723	19.3318	0.94293	0.0:1.0:0.0:0.0	.	1095;1123	Q9P2K8-2;Q9P2K8	.;E2AK4_HUMAN	G	1123;1095	ENSP00000263791:A1123G;ENSP00000372174:A1095G	ENSP00000263791:A1123G	A	+	2	0	EIF2AK4	38086519	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.673000	0.74482	2.802000	0.96397	0.563000	0.77884	GCA		0.299	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1			
ENPEP	2028	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	111463966	111463966	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr4:111463966C>T	ENST00000265162.5	+	12	2209	c.1867C>T	c.(1867-1869)Cat>Tat	p.H623Y		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	623					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		AAACCCAGATCATATTGGGTT	0.378																																																	0													104.0	109.0	107.0					4																	111463966		2203	4300	6503	SO:0001583	missense	2028			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1867C>T	4.37:g.111463966C>T	ENSP00000265162:p.His623Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739375	0.89573	.	.	ENSG00000138792	ENST00000265162	T	0.05786	3.39	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	M	0.67953	2.075	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.00140	-1.2000	10	0.36615	T	0.2	.	17.6176	0.88072	0.0:1.0:0.0:0.0	.	623	Q07075	AMPE_HUMAN	Y	623	ENSP00000265162:H623Y	ENSP00000265162:H623Y	H	+	1	0	ENPEP	111683415	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.200000	0.58433	2.611000	0.88343	0.655000	0.94253	CAT		0.378	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2			
ERAP1	51752	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	96139528	96139528	+	Silent	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:96139528G>A	ENST00000443439.2	-	2	168	c.102C>T	c.(100-102)agC>agT	p.S34S	CTD-2260A17.3_ENST00000606656.1_RNA|ERAP1_ENST00000296754.3_Silent_p.S34S|CTD-2260A17.3_ENST00000606346.1_RNA	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	34					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		ATGCTTCAGTGCTCTGACACC	0.453																																																	0													116.0	98.0	105.0					5																	96139528		2203	4300	6503	SO:0001819	synonymous_variant	51752			AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.102C>T	5.37:g.96139528G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Silent	SNP	ENST00000443439.2	37	CCDS47250.1																																																																																				0.453	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1		NM_016442	
FARP1	10160	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	99098408	99098408	+	Silent	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr13:99098408G>A	ENST00000319562.6	+	25	3118	c.2853G>A	c.(2851-2853)aaG>aaA	p.K951K	FARP1_ENST00000376586.2_Silent_p.K982K|FARP1_ENST00000595437.1_Silent_p.K982K	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	951	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGTGGCAGAAGCTGTGGGTGG	0.552											OREG0022474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													108.0	106.0	107.0					13																	99098408		2203	4300	6503	SO:0001819	synonymous_variant	10160			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2853G>A	13.37:g.99098408G>A		Somatic	1341	WXS	Illumina HiSeq	Phase_I	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	37	CCDS9487.1																																																																																				0.552	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3		NM_005766	
FASN	2194	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	80041257	80041257	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr17:80041257G>T	ENST00000306749.2	-	32	5604	c.5386C>A	c.(5386-5388)Ctg>Atg	p.L1796M	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1796	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	AACGCATCCAGTAGGACCCCG	0.642																																					Colon(59;314 1043 11189 28578 32273)												0													74.0	73.0	73.0					17																	80041257		2202	4298	6500	SO:0001583	missense	2194			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5386C>A	17.37:g.80041257G>T	ENSP00000304592:p.Leu1796Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735138	0.30774	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.04502	3.61	4.1	0.842	0.18927	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.162426	0.41712	D	0.000823	T	0.16514	0.0397	M	0.83012	2.62	0.51233	D	0.999916	D	0.89917	1.0	D	0.97110	1.0	T	0.00804	-1.1559	10	0.72032	D	0.01	-20.7536	3.8007	0.08757	0.3506:0.0:0.4873:0.1622	.	1796	P49327	FAS_HUMAN	M	1796;761	ENSP00000304592:L1796M	ENSP00000304592:L1796M	L	-	1	2	FASN	77634546	1.000000	0.71417	0.114000	0.21550	0.007000	0.05969	3.094000	0.50227	0.026000	0.15269	0.561000	0.74099	CTG		0.642	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1		NM_004104	
GIF	2694	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	59611470	59611470	+	Silent	SNP	C	C	T	rs200472519		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr11:59611470C>T	ENST00000257248.2	-	2	185	c.138G>A	c.(136-138)tcG>tcA	p.S46S	GIF_ENST00000541311.1_Silent_p.S21S	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	46			S -> L (in IFD). {ECO:0000269|PubMed:15738392}.		cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	ATGAAGTCACCGAGTTCTCCA	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		18373	0.001		0.0	False		,,,				2504	0.0				NSCLC(53;1139 1245 16872 38474 42853)												0													127.0	110.0	116.0					11																	59611470		2201	4295	6496	SO:0001819	synonymous_variant	2694			X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.138G>A	11.37:g.59611470C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RAN8|B4DVZ1	Silent	SNP	ENST00000257248.2	37	CCDS7977.1																																																																																				0.512	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1		NM_005142	
FAT3	120114	hgsc.bcm.edu;ucsc.edu	37	11	92531377	92531377	+	Missense_Mutation	SNP	G	G	A	rs150673105	byFrequency	TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr11:92531377G>A	ENST00000298047.6	+	9	5215	c.5198G>A	c.(5197-5199)cGc>cAc	p.R1733H	FAT3_ENST00000525166.1_Missense_Mutation_p.R1583H|FAT3_ENST00000409404.2_Missense_Mutation_p.R1733H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1733	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GATTATGAGCGCACATCCTCT	0.408										TCGA Ovarian(4;0.039)			g|||	19	0.00379393	0.0144	0.0	5008	,	,		21525	0.0		0.0	False		,,,				2504	0.0																0								A	HIS/ARG	33,3907		0,33,1937	90.0	87.0	88.0		5198	-3.0	0.0	11	dbSNP_134	88	1,8327		0,1,4163	yes	missense	FAT3	NM_001008781.2	29	0,34,6100	AA,AG,GG		0.012,0.8376,0.2771	benign	1733/4558	92531377	34,12234	1970	4164	6134	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5198G>A	11.37:g.92531377G>A	ENSP00000298047:p.Arg1733His	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		11	0.005036630036630037	11	0.022357723577235773	0	0.0	0	0.0	0	0.0	g	10.46	1.355966	0.24598	0.008376	1.2E-4	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.51574	0.7;0.7;0.7	5.93	-2.98	0.05513	.	.	.	.	.	T	0.17916	0.0430	L	0.33710	1.025	0.46279	D	0.998966	B	0.12013	0.005	B	0.04013	0.001	T	0.02352	-1.1172	9	0.39692	T	0.17	.	10.5459	0.45060	0.6862:0.0:0.2094:0.1044	.	1733	Q8TDW7-3	.	H	1733;1733;1583	ENSP00000298047:R1733H;ENSP00000387040:R1733H;ENSP00000432586:R1583H	ENSP00000298047:R1733H	R	+	2	0	FAT3	92171025	0.003000	0.15002	0.005000	0.12908	0.890000	0.51754	0.054000	0.14205	-0.910000	0.03847	-0.930000	0.02707	CGC		0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding			NM_001008781	
HERC2	8924	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	28514431	28514431	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr15:28514431C>A	ENST00000261609.7	-	11	1517	c.1409G>T	c.(1408-1410)gGc>gTc	p.G470V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTACACGCGGCCATTGCGTGA	0.562																																																	0													101.0	77.0	85.0					15																	28514431		2203	4300	6503	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1409G>T	15.37:g.28514431C>A	ENSP00000261609:p.Gly470Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799499	0.70567	.	.	ENSG00000128731	ENST00000261609	D	0.87966	-2.32	5.74	5.74	0.90152	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.94098	0.8108	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94190	0.7440	10	0.87932	D	0	.	19.9883	0.97356	0.0:1.0:0.0:0.0	.	470	O95714	HERC2_HUMAN	V	470	ENSP00000261609:G470V	ENSP00000261609:G470V	G	-	2	0	HERC2	26188026	1.000000	0.71417	0.994000	0.49952	0.198000	0.23893	7.271000	0.78506	2.718000	0.92993	0.650000	0.86243	GGC		0.562	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2		NM_004667	
HIST2H2BE	8349	hgsc.bcm.edu	37	1	149857934	149857936	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:149857934_149857936delTTG	ENST00000369155.2	-	1	296_298	c.255_257delCAA	c.(253-258)aacaag>aag	p.N85del	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	85					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GGTGGAGCGCTTGTTGTAGTGCG	0.655																																																	0																																										SO:0001651	inframe_deletion	8349			AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.255_257delCAA	1.37:g.149857937_149857939delTTG	ENSP00000358151:p.Asn85del	Somatic		WXS	Illumina HiSeq	Phase_I	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	In_Frame_Del	DEL	ENST00000369155.2	37	CCDS936.1																																																																																				0.655	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1		NM_003528	
IPO4	79711	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24657425	24657425	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr14:24657425G>C	ENST00000354464.6	-	4	451	c.275C>G	c.(274-276)aCa>aGa	p.T92R	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	92					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TACTTACTCTGTTTCTCTCTG	0.567																																																	0													81.0	88.0	86.0					14																	24657425		1917	4137	6054	SO:0001583	missense	79711			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.275C>G	14.37:g.24657425G>C	ENSP00000346453:p.Thr92Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	37	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723985	0.30593	.	.	ENSG00000196497	ENST00000354464	T	0.05199	3.48	4.58	2.57	0.30868	Armadillo-like helical (1);Armadillo-type fold (1);	0.191775	0.42821	N	0.000642	T	0.04003	0.0112	N	0.14661	0.345	0.42295	D	0.992156	B	0.12013	0.005	B	0.15484	0.013	T	0.43669	-0.9377	10	0.16896	T	0.51	.	12.6477	0.56744	0.0:0.3166:0.6834:0.0	.	92	Q8TEX9	IPO4_HUMAN	R	92	ENSP00000346453:T92R	ENSP00000346453:T92R	T	-	2	0	IPO4	23727265	0.998000	0.40836	0.974000	0.42286	0.884000	0.51177	2.901000	0.48695	1.260000	0.44134	0.563000	0.77884	ACA		0.567	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4		NM_024658	
KDM4B	23030	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	5137677	5137677	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:5137677A>T	ENST00000159111.4	+	17	2649	c.2431A>T	c.(2431-2433)Acc>Tcc	p.T811S	KDM4B_ENST00000536461.1_Missense_Mutation_p.T845S	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	811					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GCAGATGACCACCGATAGGAG	0.687																																																	0													34.0	36.0	35.0					19																	5137677		2202	4299	6501	SO:0001583	missense	23030			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2431A>T	19.37:g.5137677A>T	ENSP00000159111:p.Thr811Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	37	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083096	0.55861	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.13420	2.59;2.59	3.95	3.95	0.45737	.	0.335986	0.30134	N	0.010325	T	0.15998	0.0385	L	0.31371	0.925	0.35502	D	0.799868	D;P	0.54964	0.969;0.775	P;P	0.53313	0.723;0.526	T	0.19778	-1.0295	10	0.23302	T	0.38	-38.0283	11.6966	0.51546	1.0:0.0:0.0:0.0	.	845;811	F5GX28;O94953	.;KDM4B_HUMAN	S	811;845	ENSP00000159111:T811S;ENSP00000440495:T845S	ENSP00000159111:T811S	T	+	1	0	KDM4B	5088677	0.986000	0.35501	0.972000	0.41901	0.872000	0.50106	4.144000	0.58057	1.576000	0.49790	0.459000	0.35465	ACC		0.687	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1		NM_015015	
KIF1C	10749	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	4926964	4926964	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr17:4926964C>G	ENST00000320785.5	+	23	3187	c.2830C>G	c.(2830-2832)Cag>Gag	p.Q944E		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	944					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						CTGGCTCAAGCAGGAGCAGCT	0.711																																					Melanoma(96;1023 1447 10250 19259 33730)												0													22.0	22.0	22.0					17																	4926964		2197	4289	6486	SO:0001583	missense	10749			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2830C>G	17.37:g.4926964C>G	ENSP00000320821:p.Gln944Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309421	0.60414	.	.	ENSG00000129250	ENST00000320785	T	0.74632	-0.86	4.93	4.93	0.64822	.	.	.	.	.	T	0.80513	0.4637	L	0.46157	1.445	0.45076	D	0.998094	P	0.49447	0.924	P	0.59424	0.857	T	0.82123	-0.0613	9	0.72032	D	0.01	.	15.6642	0.77213	0.0:1.0:0.0:0.0	.	944	O43896	KIF1C_HUMAN	E	944	ENSP00000320821:Q944E	ENSP00000320821:Q944E	Q	+	1	0	KIF1C	4867688	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.672000	0.54583	2.558000	0.86282	0.655000	0.94253	CAG		0.711	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1			
KIFC1	3833	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33374604	33374604	+	Silent	SNP	G	G	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr6:33374604G>T	ENST00000428849.2	+	10	2379	c.1929G>T	c.(1927-1929)ctG>ctT	p.L643L		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	643	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						TTTCTCCACTGGAAGAGAACG	0.547																																																	0													117.0	105.0	109.0					6																	33374604		2203	4300	6503	SO:0001819	synonymous_variant	3833			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1929G>T	6.37:g.33374604G>T		Somatic		WXS	Illumina HiSeq	Phase_I	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	ENST00000428849.2	37	CCDS34430.1																																																																																				0.547	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1		NM_002263	
LAMB3	3914	hgsc.bcm.edu	37	1	209796944	209796950	+	Frame_Shift_Del	DEL	TGCCGCA	TGCCGCA	-	rs202068754|rs62637710	byFrequency	TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	TGCCGCA	TGCCGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:209796944_209796950delTGCCGCA	ENST00000356082.4	-	16	2392_2398	c.2258_2264delTGCGGCA	c.(2257-2265)gtgcggcagfs	p.VRQ753fs	LAMB3_ENST00000367030.3_Frame_Shift_Del_p.VRQ753fs|LAMB3_ENST00000391911.1_Frame_Shift_Del_p.VRQ753fs|MIR4260_ENST00000583107.1_RNA	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	753	Domain II.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCCTCCCGCCTGCCGCACCAGCCTCTC	0.643																																																	0									,,	172,4094		0,172,1961					,,	4.2	0.1			44	197,8057		0,197,3930	no	frameshift,frameshift,frameshift	LAMB3	NM_001127641.1,NM_001017402.1,NM_000228.2	,,	0,369,5891	A1A1,A1R,RR		2.3867,4.0319,2.9473	,,	,,		369,12151				SO:0001589	frameshift_variant	3914			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2258_2264delTGCGGCA	1.37:g.209796944_209796950delTGCCGCA	ENSP00000348384:p.Val753fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Frame_Shift_Del	DEL	ENST00000356082.4	37	CCDS1487.1																																																																																				0.643	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2		NM_000228	
LINGO1	84894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	77906716	77906716	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr15:77906716G>T	ENST00000355300.6	-	2	1707	c.1533C>A	c.(1531-1533)caC>caA	p.H511Q	LINGO1_ENST00000561030.1_Missense_Mutation_p.H505Q	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	511	Ig-like C2-type.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GCACATGCAGGTGGGCGGGCA	0.662																																																	0													51.0	56.0	54.0					15																	77906716		2127	4224	6351	SO:0001583	missense	84894			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1533C>A	15.37:g.77906716G>T	ENSP00000347451:p.His511Gln	Somatic		WXS	Illumina HiSeq	Phase_I	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	37	CCDS45313.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040006	0.35989	.	.	ENSG00000169783	ENST00000355300	T	0.65549	-0.16	5.08	4.17	0.49024	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.43500	0.1250	N	0.16602	0.42	0.80722	D	1	P	0.45428	0.858	B	0.40659	0.336	T	0.28427	-1.0044	10	0.30078	T	0.28	.	9.9124	0.41415	0.1566:0.0:0.8434:0.0	.	511	Q96FE5	LIGO1_HUMAN	Q	511	ENSP00000347451:H511Q	ENSP00000347451:H511Q	H	-	3	2	LINGO1	75693771	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.867000	0.63013	1.132000	0.42129	0.462000	0.41574	CAC		0.662	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419546.1		NM_032808	
LMO4	8543	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	87805242	87805242	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:87805242G>C	ENST00000370544.5	+	3	1040	c.260G>C	c.(259-261)tGc>tCc	p.C87S	LMO4_ENST00000370542.1_Missense_Mutation_p.C87S|LMO4_ENST00000489303.1_3'UTR	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	87	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		AGCGGTGCTTGCAGCGCTTGC	0.423																																																	0													90.0	89.0	89.0					1																	87805242		2203	4300	6503	SO:0001583	missense	8543			U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.260G>C	1.37:g.87805242G>C	ENSP00000359575:p.Cys87Ser	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT23|O00158|O88894	Missense_Mutation	SNP	ENST00000370544.5	37	CCDS713.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933378	0.92458	.	.	ENSG00000143013	ENST00000370544;ENST00000370542	D;D	0.99311	-5.73;-5.73	5.93	5.02	0.67125	Zinc finger, LIM-type (5);	0.040421	0.85682	D	0.000000	D	0.99736	0.9896	H	0.99535	4.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96795	0.9585	10	0.87932	D	0	.	15.2184	0.73288	0.0674:0.0:0.9326:0.0	.	87	P61968	LMO4_HUMAN	S	87	ENSP00000359575:C87S;ENSP00000359573:C87S	ENSP00000359573:C87S	C	+	2	0	LMO4	87577830	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.869000	0.99810	1.506000	0.48736	0.655000	0.94253	TGC		0.423	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028264.2		NM_006769	
LRFN3	79414	broad.mit.edu;hgsc.bcm.edu	37	19	36430547	36430547	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:36430547G>C	ENST00000588831.1	+	3	1274	c.220G>C	c.(220-222)Gtg>Ctg	p.V74L	LRFN3_ENST00000246529.3_Missense_Mutation_p.V74L			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	74					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CATCGCCTCCGTGCGCCGCCG	0.706																																																	0													14.0	15.0	15.0					19																	36430547		2156	4217	6373	SO:0001583	missense	79414			BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.220G>C	19.37:g.36430547G>C	ENSP00000466989:p.Val74Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UY10	Missense_Mutation	SNP	ENST00000588831.1	37	CCDS12483.1	.	.	.	.	.	.	.	.	.	.	G	5.112	0.206225	0.09704	.	.	ENSG00000126243	ENST00000246529	T	0.48836	0.8	4.44	3.31	0.37934	.	0.000000	0.33290	N	0.005076	T	0.21103	0.0508	N	0.04387	-0.21	0.23893	N	0.996549	B	0.18461	0.028	B	0.24006	0.05	T	0.11108	-1.0601	10	0.20519	T	0.43	.	5.7351	0.18061	0.107:0.201:0.6919:0.0	.	74	Q9BTN0	LRFN3_HUMAN	L	74	ENSP00000246529:V74L	ENSP00000246529:V74L	V	+	1	0	LRFN3	41122387	0.001000	0.12720	0.919000	0.36401	0.949000	0.60115	-0.098000	0.11024	2.201000	0.70794	0.557000	0.71058	GTG		0.706	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2		NM_024509	
MBD1	4152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	47799982	47799982	+	Silent	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr18:47799982A>T	ENST00000591416.1	-	12	1829	c.1398T>A	c.(1396-1398)ccT>ccA	p.P466P	MBD1_ENST00000269471.5_Silent_p.P443P|MBD1_ENST00000424334.2_Silent_p.P517P|MBD1_ENST00000382948.5_Silent_p.P466P|MBD1_ENST00000585595.1_Silent_p.P491P|MBD1_ENST00000457839.2_Silent_p.P491P|MBD1_ENST00000398495.2_Silent_p.P435P|MBD1_ENST00000349085.2_Silent_p.P410P|MBD1_ENST00000587605.1_Silent_p.P410P|MBD1_ENST00000436910.1_Silent_p.P443P|MBD1_ENST00000269468.5_Silent_p.P466P|MBD1_ENST00000588937.1_Silent_p.P443P|MBD1_ENST00000398493.1_Silent_p.P410P|MBD1_ENST00000585672.1_Silent_p.P416P|MBD1_ENST00000591535.1_Silent_p.P443P|MBD1_ENST00000339998.6_Silent_p.P466P|MBD1_ENST00000353909.3_Silent_p.P417P|MBD1_ENST00000398488.1_Silent_p.P410P|MBD1_ENST00000590208.1_Silent_p.P466P|MBD1_ENST00000347968.3_Silent_p.P410P			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	466					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						GCACCTGCACAGGACTGCTTG	0.632																																																	0													41.0	41.0	41.0					18																	47799982		2203	4300	6503	SO:0001819	synonymous_variant	4152			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1398T>A	18.37:g.47799982A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Silent	SNP	ENST00000591416.1	37	CCDS11943.1																																																																																				0.632	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3		NM_015846	
MTHFSD	64779	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	86565766	86565766	+	Silent	SNP	G	G	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr16:86565766G>T	ENST00000360900.6	-	8	1028	c.1003C>A	c.(1003-1005)Cgg>Agg	p.R335R	MTHFSD_ENST00000543303.2_Silent_p.R334R|MTHFSD_ENST00000381214.5_Silent_p.R335R|MTHFSD_ENST00000322911.6_Silent_p.R334R|MTHFSD_ENST00000546093.1_Silent_p.R172R	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	335	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						CAGGTGAGCCGCAGGGGCACG	0.701																																																	0													8.0	11.0	10.0					16																	86565766		1878	4092	5970	SO:0001819	synonymous_variant	64779			AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.1003C>A	16.37:g.86565766G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Silent	SNP	ENST00000360900.6	37	CCDS54047.1																																																																																				0.701	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432182.1		NM_022764	
NOTCH1	4851	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	139410507	139410507	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr9:139410507C>T	ENST00000277541.6	-	10	1670	c.1595G>A	c.(1594-1596)tGt>tAt	p.C532Y		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	532	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGTGCTGGCACACTCGTCCAC	0.647			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													51.0	58.0	56.0					9																	139410507		2066	4196	6262	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1595G>A	9.37:g.139410507C>T	ENSP00000277541:p.Cys532Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154164	0.78114	.	.	ENSG00000148400	ENST00000277541	D	0.99992	-12.4	5.02	5.02	0.67125	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99994	0.9999	H	0.99626	4.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99996	1.5492	10	0.87932	D	0	.	17.3208	0.87235	0.0:1.0:0.0:0.0	.	532	P46531	NOTC1_HUMAN	Y	532	ENSP00000277541:C532Y	ENSP00000277541:C532Y	C	-	2	0	NOTCH1	138530328	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	7.252000	0.78309	2.314000	0.78098	0.563000	0.77884	TGT		0.647	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1		NM_017617	
ORC1	4998	hgsc.bcm.edu;ucsc.edu	37	1	52867881	52867881	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:52867881delG	ENST00000371568.3	-	2	233	c.15delC	c.(13-15)cccfs	p.P5fs	PRPF38A_ENST00000257181.9_5'Flank|ORC1_ENST00000371566.1_Frame_Shift_Del_p.P5fs	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	5					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TCAGCCTTGTGGGGTAGTGTG	0.443																																																	0													118.0	102.0	108.0					1																	52867881		2203	4300	6503	SO:0001589	frameshift_variant	4998				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.15delC	1.37:g.52867881delG	ENSP00000360623:p.Pro5fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQ34|Q13471|Q5T0F5	Frame_Shift_Del	DEL	ENST00000371568.3	37	CCDS566.1																																																																																				0.443	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1		NM_004153	
PCCA	5095	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	100925589	100925589	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr13:100925589A>T	ENST00000376285.1	+	12	1092	c.1054A>T	c.(1054-1056)Aca>Tca	p.T352S	PCCA_ENST00000376279.3_Missense_Mutation_p.T352S|PCCA_ENST00000376286.4_Missense_Mutation_p.T326S	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	352	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	GGAAATGAATACAAGACTCCA	0.378																																																	0													64.0	68.0	67.0					13																	100925589		2203	4300	6503	SO:0001583	missense	5095			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1054A>T	13.37:g.100925589A>T	ENSP00000365462:p.Thr352Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	A	24.9	4.585703	0.86748	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97831	-4.56;-4.56;-4.56	5.55	4.34	0.51931	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (2);Biotin carboxylation domain (1);	0.049050	0.85682	N	0.000000	D	0.98798	0.9595	M	0.91972	3.26	0.58432	D	0.999999	D;D;D	0.89917	0.991;1.0;0.991	D;D;D	0.77557	0.961;0.99;0.961	D	0.99211	1.0876	10	0.87932	D	0	.	12.0782	0.53655	0.8709:0.0:0.0:0.1291	.	352;326;352	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	S	326;352;352	ENSP00000365463:T326S;ENSP00000365456:T352S;ENSP00000365462:T352S	ENSP00000365456:T352S	T	+	1	0	PCCA	99723590	1.000000	0.71417	0.986000	0.45419	0.990000	0.78478	9.229000	0.95273	0.997000	0.38969	0.528000	0.53228	ACA		0.378	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2			
PDLIM4	8572	broad.mit.edu;hgsc.bcm.edu	37	5	131607572	131607572	+	Silent	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:131607572C>T	ENST00000253754.3	+	6	823	c.759C>T	c.(757-759)ccC>ccT	p.P253P	PDLIM4_ENST00000379018.3_Intron|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	253	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGGGCTGCCCGAGTGCACGC	0.736																																																	0																																										SO:0001819	synonymous_variant	8572			AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.759C>T	5.37:g.131607572C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Silent	SNP	ENST00000253754.3	37	CCDS4152.1																																																																																				0.736	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2		NM_003687	
PCDHA5	56143	broad.mit.edu;hgsc.bcm.edu	37	5	140202644	140202644	+	Silent	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:140202644C>T	ENST00000529859.1	+	1	1284	c.1284C>T	c.(1282-1284)gaC>gaT	p.D428D	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000378126.3_Silent_p.D428D|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Silent_p.D428D|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGCGGGACGGGGGCTCGC	0.647																																																	0													89.0	94.0	92.0					5																	140202644		2203	4299	6502	SO:0001819	synonymous_variant	56143			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1284C>T	5.37:g.140202644C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O75284|Q8N4R3	Silent	SNP	ENST00000529859.1	37	CCDS54917.1																																																																																				0.647	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2		NM_018908	
PECR	55825	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	216908708	216908708	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:216908708G>A	ENST00000265322.7	-	7	819	c.745C>T	c.(745-747)Cct>Tct	p.P249S		NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	249					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	GAAGCTGCAGGAGACAGTAGG	0.512																																																	0													75.0	67.0	70.0					2																	216908708		2203	4300	6503	SO:0001583	missense	55825			AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.745C>T	2.37:g.216908708G>A	ENSP00000265322:p.Pro249Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Missense_Mutation	SNP	ENST00000265322.7	37	CCDS33375.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577121	0.86645	.	.	ENSG00000115425	ENST00000265322	T	0.52983	0.64	5.55	5.55	0.83447	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.986;0.976	T	0.62282	-0.6887	10	0.48119	T	0.1	.	17.001	0.86381	0.0:0.0:1.0:0.0	.	249;103	Q9BY49;Q9BY49-2	PECR_HUMAN;.	S	249	ENSP00000265322:P249S	ENSP00000265322:P249S	P	-	1	0	PECR	216616953	1.000000	0.71417	0.969000	0.41365	0.977000	0.68977	4.776000	0.62354	2.607000	0.88179	0.591000	0.81541	CCT		0.512	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1		NM_018441	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000541194.1_Missense_Mutation_p.S22P|PODXL_ENST00000537928.1_Missense_Mutation_p.S22P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000322985.9_Missense_Mutation_p.S22P			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																																	0													5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420				CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	7.37:g.131241055A>G	ENSP00000367817:p.Ser22Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	37	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2		NM_001018111	
PPP5C	5536	hgsc.bcm.edu;ucsc.edu	37	19	46888136	46888136	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:46888136C>G	ENST00000012443.4	+	7	977	c.874C>G	c.(874-876)Ctg>Gtg	p.L292V	PPP5C_ENST00000391919.1_Missense_Mutation_p.L164V|AC007193.9_ENST00000599645.1_RNA	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	292	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CTTCAAGCTCCTGTACCCAGA	0.507																																																	0													116.0	98.0	104.0					19																	46888136		2203	4300	6503	SO:0001583	missense	5536				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.874C>G	19.37:g.46888136C>G	ENSP00000012443:p.Leu292Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	37	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949227	0.53186	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	D;D	0.85773	-2.03;-2.03	4.59	3.56	0.40772	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.073752	0.56097	D	0.000034	D	0.87269	0.6135	L	0.58428	1.81	0.80722	D	1	B;P;B	0.50819	0.168;0.939;0.088	B;P;B	0.55785	0.183;0.784;0.255	D	0.86787	0.1983	10	0.62326	D	0.03	-9.2087	10.4644	0.44598	0.0:0.9034:0.0:0.0966	.	150;292;292	B7Z1I1;B2R6R6;P53041	.;.;PPP5_HUMAN	V	292;279;164	ENSP00000012443:L292V;ENSP00000375786:L164V	ENSP00000012443:L292V	L	+	1	2	PPP5C	51579976	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.583000	0.67484	0.928000	0.37168	0.491000	0.48974	CTG		0.507	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2		NM_006247	
PREPL	9581	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	44554022	44554022	+	Silent	SNP	T	T	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:44554022T>A	ENST00000409936.1	-	11	2012	c.1575A>T	c.(1573-1575)ctA>ctT	p.L525L	PREPL_ENST00000378511.3_Silent_p.L463L|PREPL_ENST00000409957.1_Silent_p.L436L|PREPL_ENST00000541738.1_Silent_p.L436L|PREPL_ENST00000410081.1_Silent_p.L525L|PREPL_ENST00000409411.1_Silent_p.L436L|PREPL_ENST00000409272.1_Silent_p.L525L|PREPL_ENST00000260648.6_Silent_p.L525L|PREPL_ENST00000378520.3_Silent_p.L459L	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	525						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GTTTTTTAGTTAGGCGGCCAT	0.448																																																	0													51.0	48.0	49.0					2																	44554022		2203	4300	6503	SO:0001819	synonymous_variant	9581			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1575A>T	2.37:g.44554022T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	ENST00000409936.1	37	CCDS33190.1																																																																																				0.448	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1		NM_006036	
PROP1	5626	broad.mit.edu;hgsc.bcm.edu	37	5	177421243	177421243	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:177421243C>T	ENST00000308304.2	-	2	514	c.206G>A	c.(205-207)cGg>cAg	p.R69Q		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	69					blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGGCGGCGCCGGGAGTGCGG	0.652																																																	0													36.0	39.0	38.0					5																	177421243		2203	4300	6503	SO:0001583	missense	5626			AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.206G>A	5.37:g.177421243C>T	ENSP00000311290:p.Arg69Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000308304.2	37	CCDS4430.1	.	.	.	.	.	.	.	.	.	.	.	15.81	2.942452	0.53079	.	.	ENSG00000175325	ENST00000308304	D	0.95447	-3.71	3.33	3.33	0.38152	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.37483	N	0.002063	D	0.94489	0.8226	L	0.36672	1.1	0.48040	D	0.999577	D	0.69078	0.997	D	0.70227	0.968	D	0.91423	0.5160	10	0.24483	T	0.36	-15.7293	6.665	0.23035	0.0:0.8647:0.0:0.1353	.	69	O75360	PROP1_HUMAN	Q	69	ENSP00000311290:R69Q	ENSP00000311290:R69Q	R	-	2	0	PROP1	177353849	0.980000	0.34600	0.996000	0.52242	0.283000	0.27025	0.784000	0.26816	1.902000	0.55061	0.485000	0.47835	CGG		0.652	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253472.1		NM_006261	
PRPSAP1	5635	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	74324943	74324943	+	Splice_Site	SNP	C	C	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr17:74324943C>G	ENST00000446526.3	-	7	1081	c.636G>C	c.(634-636)agG>agC	p.R212S	PRPSAP1_ENST00000324684.4_Splice_Site_p.R109S	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	183					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						AGGACTGGGCCCTAGAAGGAC	0.493																																																	0													80.0	59.0	66.0					17																	74324943		2203	4300	6503	SO:0001630	splice_region_variant	5635			D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.636-1G>C	17.37:g.74324943C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6M4|Q96H06	Missense_Mutation	SNP	ENST00000446526.3	37	CCDS11743.2	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383817	0.61845	.	.	ENSG00000161542	ENST00000446526;ENST00000324684;ENST00000435555;ENST00000436498	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.73	2.69	0.31865	.	0.000000	0.85682	D	0.000000	D	0.84915	0.5578	H	0.95611	3.695	0.80722	D	1	B;P	0.43094	0.021;0.799	B;P	0.49561	0.033;0.615	D	0.86263	0.1656	10	0.87932	D	0	.	10.8723	0.46891	0.0:0.7977:0.0:0.2023	.	183;212	Q14558;Q14558-2	KPRA_HUMAN;.	S	212;109;109;109	ENSP00000414624:R212S;ENSP00000314973:R109S;ENSP00000392838:R109S;ENSP00000387494:R109S	ENSP00000314973:R109S	R	-	3	2	PRPSAP1	71836538	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.302000	0.33459	0.447000	0.26695	0.655000	0.94253	AGG		0.493	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342480.2		NM_002766	Missense_Mutation
RGR	5995	hgsc.bcm.edu	37	10	86008696	86008698	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	GGA	GGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr10:86008696_86008698delGGA	ENST00000359452.4	+	3	305_307	c.267_269delGGA	c.(265-270)tcggac>tcc	p.D90del	RGR_ENST00000372092.3_In_Frame_Del_p.G73del|RGR_ENST00000358110.5_In_Frame_Del_p.D86del	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	86					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.S89S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						CCTACGGCTCGGACGGCTGCCAG	0.626																																					NSCLC(15;204 545 5889 6385 32445)												1	Substitution - coding silent(1)	large_intestine(1)																																								SO:0001651	inframe_deletion	5995			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.267_269delGGA	10.37:g.86008696_86008698delGGA	ENSP00000352427:p.Asp90del	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKK7|Q96FC5	In_Frame_Del	DEL	ENST00000359452.4	37	CCDS7374.1																																																																																				0.626	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049116.1		NM_002921	
RIF1	55183	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	152320194	152320194	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:152320194A>C	ENST00000243326.5	+	29	4643	c.4160A>C	c.(4159-4161)aAt>aCt	p.N1387T	RIF1_ENST00000428287.2_Missense_Mutation_p.N1387T|RIF1_ENST00000444746.2_Missense_Mutation_p.N1387T|RIF1_ENST00000430328.2_Missense_Mutation_p.N1387T|RIF1_ENST00000453091.2_Missense_Mutation_p.N1387T			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TCCAAAGAGAATACACCCCCA	0.363																																																	0													90.0	96.0	94.0					2																	152320194		2203	4300	6503	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4160A>C	2.37:g.152320194A>C	ENSP00000243326:p.Asn1387Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.606601	0.46527	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	5.45	4.3	0.51218	.	0.388373	0.30168	N	0.010251	T	0.47525	0.1450	M	0.66939	2.045	0.80722	D	1	P;P	0.52842	0.926;0.956	P;P	0.53266	0.554;0.722	T	0.47446	-0.9117	10	0.66056	D	0.02	-11.5968	10.2329	0.43266	0.9201:0.0:0.0799:0.0	.	1387;1387	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	T	1387	ENSP00000390181:N1387T;ENSP00000414615:N1387T;ENSP00000415691:N1387T;ENSP00000243326:N1387T;ENSP00000416123:N1387T	ENSP00000243326:N1387T	N	+	2	0	RIF1	152028440	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	4.178000	0.58284	0.924000	0.37069	0.455000	0.32223	AAT		0.363	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3			
SAMD7	344658	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	169644942	169644942	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr3:169644942C>A	ENST00000428432.2	+	6	1281	c.892C>A	c.(892-894)Cct>Act	p.P298T	SAMD7_ENST00000335556.3_Missense_Mutation_p.P298T	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	298										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TGGGGTTTGCCCTCCAGTTCC	0.512																																																	0													49.0	49.0	49.0					3																	169644942		2201	4300	6501	SO:0001583	missense	344658			BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.892C>A	3.37:g.169644942C>A	ENSP00000391299:p.Pro298Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000428432.2	37	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	C	7.277	0.608366	0.14002	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.47177	0.85;0.85	5.61	1.12	0.20585	.	0.364534	0.31290	N	0.007919	T	0.23688	0.0573	N	0.24115	0.695	0.09310	N	1	B	0.21381	0.055	B	0.15870	0.014	T	0.05852	-1.0860	10	0.23302	T	0.38	-0.1087	1.3297	0.02132	0.1695:0.4136:0.1678:0.249	.	298	Q7Z3H4	SAMD7_HUMAN	T	298	ENSP00000391299:P298T;ENSP00000334668:P298T	ENSP00000334668:P298T	P	+	1	0	SAMD7	171127636	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.367000	0.20382	0.303000	0.22785	-0.188000	0.12872	CCT		0.512	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1		NM_182610	
SELENBP1	8991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151337664	151337664	+	Splice_Site	SNP	C	C	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr1:151337664C>G	ENST00000368868.5	-	10	1229		c.e10+1		SELENBP1_ENST00000473693.1_5'Flank|SELENBP1_ENST00000447402.3_Splice_Site|SELENBP1_ENST00000426705.2_Splice_Site|SELENBP1_ENST00000435071.1_Splice_Site	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1						protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GAGGCTCTTACCTTGACCACT	0.577																																																	0													54.0	53.0	53.0					1																	151337664		2203	4300	6503	SO:0001630	splice_region_variant	8991			U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.1137+1G>C	1.37:g.151337664C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Splice_Site	SNP	ENST00000368868.5	37	CCDS995.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644886	0.67358	.	.	ENSG00000143416	ENST00000368868;ENST00000447402;ENST00000435071	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1102	0.53836	0.1721:0.8279:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SELENBP1	149604288	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	6.888000	0.75622	2.384000	0.81235	0.655000	0.94253	.		0.577	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034904.4			Intron
SLC6A5	9152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	20676346	20676347	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr11:20676346_20676347CC>TT	ENST00000525748.1	+	16	2599_2600	c.2326_2327CC>TT	c.(2326-2328)CCc>TTc	p.P776F	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	776					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CATGATCGACCCCTTGGGAACC	0.559																																																	0																																										SO:0001583	missense	9152			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	Exception_encountered	11.37:g.20676346_20676347delinsTT	ENSP00000434364:p.Pro776Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	CCDS7854.1																																																																																				0.559	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2		NM_004211	
SLC8A3	6547	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	70633975	70633975	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr14:70633975C>T	ENST00000381269.2	-	2	1918	c.1165G>A	c.(1165-1167)Gat>Aat	p.D389N	SLC8A3_ENST00000528359.1_Missense_Mutation_p.D389N|SLC8A3_ENST00000356921.2_Missense_Mutation_p.D389N|SLC8A3_ENST00000534137.1_Missense_Mutation_p.D389N|SLC8A3_ENST00000357887.3_Missense_Mutation_p.D389N	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	389	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TCAGGCTCATCGGTGTGCACC	0.512																																																	0													124.0	114.0	117.0					14																	70633975		2203	4300	6503	SO:0001583	missense	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1165G>A	14.37:g.70633975C>T	ENSP00000370669:p.Asp389Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	C	4.874	0.162377	0.09287	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.36520	1.3;1.25;1.39;1.32;1.39	5.83	3.97	0.46021	Na-Ca exchanger/integrin-beta4 (2);	0.415939	0.27976	N	0.017099	T	0.34424	0.0897	M	0.64170	1.965	0.50632	D	0.999881	B;B;B;B	0.09022	0.001;0.002;0.002;0.002	B;B;B;B	0.12837	0.005;0.005;0.008;0.008	T	0.09228	-1.0684	10	0.22706	T	0.39	.	11.8253	0.52263	0.0:0.8545:0.0:0.1455	.	389;389;389;389	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	N	389	ENSP00000349392:D389N;ENSP00000370669:D389N;ENSP00000350560:D389N;ENSP00000436688:D389N;ENSP00000433531:D389N	ENSP00000349392:D389N	D	-	1	0	SLC8A3	69703728	1.000000	0.71417	0.019000	0.16419	0.146000	0.21551	4.976000	0.63785	0.757000	0.33036	-0.148000	0.13756	GAT		0.512	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			
SMEK2	57223	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	55813757	55813757	+	Silent	SNP	T	T	A	rs199689343		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:55813757T>A	ENST00000345102.5	-	6	1414	c.1113A>T	c.(1111-1113)gtA>gtT	p.V371V	SMEK2_ENST00000272313.5_Silent_p.V371V|SMEK2_ENST00000407823.3_Silent_p.V371V	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	371					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TAATTACCATTACAATTTCAA	0.294																																																	0								T	,	0,4404		0,0,2202	102.0	104.0	103.0		1113,1113	4.6	1.0	2		103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SMEK2	NM_001122964.1,NM_020463.2	,	0,1,6501	AA,AT,TT		0.0116,0.0,0.0077	,	371/850,371/765	55813757	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	57223			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1113A>T	2.37:g.55813757T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Silent	SNP	ENST00000345102.5	37	CCDS46289.1																																																																																				0.294	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1		NM_020463	
ST6GAL2	84620	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	107460218	107460218	+	Silent	SNP	C	C	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:107460218C>G	ENST00000409382.3	-	2	826	c.216G>C	c.(214-216)ggG>ggC	p.G72G	AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Silent_p.G72G|ST6GAL2_ENST00000409087.3_Silent_p.G72G	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	72					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CGTCCAGGCCCCCAGGCGGGG	0.701																																																	0													15.0	19.0	18.0					2																	107460218		2156	4224	6380	SO:0001819	synonymous_variant	84620			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.216G>C	2.37:g.107460218C>G		Somatic		WXS	Illumina HiSeq	Phase_I	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	37	CCDS2073.1																																																																																				0.701	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1		NM_032528	
SUGP2	10147	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19136452	19136452	+	Silent	SNP	G	G	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:19136452G>A	ENST00000601879.1	-	3	1002	c.705C>T	c.(703-705)ctC>ctT	p.L235L	SUGP2_ENST00000600377.1_Silent_p.L249L|SUGP2_ENST00000452918.2_Silent_p.L235L|SUGP2_ENST00000598202.1_5'UTR|SUGP2_ENST00000456085.2_Intron|SUGP2_ENST00000337018.6_Silent_p.L235L			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	235					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CCTTAGCTGTGAGCAGGCCCT	0.517																																																	0													109.0	104.0	106.0					19																	19136452		2203	4300	6503	SO:0001819	synonymous_variant	10147			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.705C>T	19.37:g.19136452G>A		Somatic		WXS	Illumina HiSeq	Phase_I	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Silent	SNP	ENST00000601879.1	37	CCDS12392.1																																																																																				0.517	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1		NM_001017392	
TBC1D15	64786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	72278663	72278663	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr12:72278663A>G	ENST00000550746.1	+	5	480	c.416A>G	c.(415-417)aAg>aGg	p.K139R	TBC1D15_ENST00000485960.2_Missense_Mutation_p.K139R|TBC1D15_ENST00000393309.3_Intron|TBC1D15_ENST00000319106.8_Missense_Mutation_p.K147R	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	139					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAATCAATCAAGCAAAACAAA	0.403																																																	0													197.0	193.0	194.0					12																	72278663		2203	4300	6503	SO:0001583	missense	64786			AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.416A>G	12.37:g.72278663A>G	ENSP00000448182:p.Lys139Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	ENST00000550746.1	37	CCDS31858.1	.	.	.	.	.	.	.	.	.	.	A	5.312	0.242949	0.10077	.	.	ENSG00000121749	ENST00000482439;ENST00000550746;ENST00000491063;ENST00000319106;ENST00000485960	T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64	5.76	5.76	0.90799	Domain of unknown function DUF3548 (1);	0.098913	0.64402	D	0.000002	T	0.36936	0.0985	N	0.20986	0.625	0.80722	D	1	D;D;D	0.76494	0.967;0.96;0.999	P;P;D	0.81914	0.782;0.695;0.995	T	0.08932	-1.0698	10	0.02654	T	1	-12.3433	16.0665	0.80887	1.0:0.0:0.0:0.0	.	147;139;139	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	R	40;139;40;147;139	ENSP00000449643:K40R;ENSP00000448182:K139R;ENSP00000418091:K40R;ENSP00000318262:K147R;ENSP00000420678:K139R	ENSP00000318262:K147R	K	+	2	0	TBC1D15	70564930	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.939000	0.56591	2.185000	0.69588	0.482000	0.46254	AAG		0.403	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2		NM_022771	
TINF2	26277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24710922	24710922	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr14:24710922G>T	ENST00000267415.7	-	3	699	c.358C>A	c.(358-360)Cag>Aag	p.Q120K	TINF2_ENST00000540705.1_Missense_Mutation_p.Q85K|TINF2_ENST00000538777.1_5'UTR|TINF2_ENST00000399423.4_Missense_Mutation_p.Q120K|TINF2_ENST00000559019.1_Intron|TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000558566.1_Missense_Mutation_p.Q120K	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	120					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		TCTGACAGCTGCTTCACCTGC	0.438									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																																								0													53.0	50.0	51.0					14																	24710922		1867	4111	5978	SO:0001583	missense	26277	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.358C>A	14.37:g.24710922G>T	ENSP00000267415:p.Gln120Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B3W5Q7|Q9H904|Q9UHC2	Missense_Mutation	SNP	ENST00000267415.7	37	CCDS41936.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517720	0.27123	.	.	ENSG00000092330	ENST00000267415;ENST00000540705;ENST00000399423	T;T;T	0.40756	1.02;1.02;1.02	5.09	2.2	0.27929	.	0.974936	0.08451	N	0.943893	T	0.33876	0.0878	L	0.60455	1.87	0.80722	D	1	P;B;B	0.36249	0.545;0.372;0.372	B;B;B	0.35770	0.21;0.15;0.15	T	0.17077	-1.0381	10	0.14656	T	0.56	-7.7219	3.6647	0.08252	0.0903:0.166:0.5718:0.1719	.	85;120;120	B4DFJ1;Q9BSI4-2;Q9BSI4	.;.;TINF2_HUMAN	K	120;85;120	ENSP00000267415:Q120K;ENSP00000442154:Q85K;ENSP00000382350:Q120K	ENSP00000267415:Q120K	Q	-	1	0	TINF2	23780762	0.974000	0.33945	0.890000	0.34922	0.404000	0.30871	0.754000	0.26390	0.291000	0.22468	-0.521000	0.04368	CAG		0.438	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2			
TNPO2	30000	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	12813644	12813644	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:12813644T>A	ENST00000592287.1	-	20	2406	c.2298A>T	c.(2296-2298)gaA>gaT	p.E766D	TNPO2_ENST00000450764.2_Missense_Mutation_p.E766D|TNPO2_ENST00000425528.1_Missense_Mutation_p.E766D|TNPO2_ENST00000441499.1_Missense_Mutation_p.E766D|TNPO2_ENST00000588216.1_Missense_Mutation_p.E766D|TNPO2_ENST00000356861.5_Missense_Mutation_p.E766D	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	766					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CACCTGTGTTTTCCAGCAGTG	0.592																																																	0													216.0	231.0	226.0					19																	12813644		2027	4187	6214	SO:0001583	missense	30000			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.2298A>T	19.37:g.12813644T>A	ENSP00000468434:p.Glu766Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O14655|Q6IN77	Missense_Mutation	SNP	ENST00000592287.1	37	CCDS45991.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.607142	0.87157	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.91	0.797	0.18654	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.91459	3.21	0.58432	D	0.999998	D;P	0.65815	0.995;0.763	P;B	0.60236	0.871;0.228	T	0.69826	-0.5040	10	0.87932	D	0	-10.7686	10.0451	0.42182	0.0:0.5782:0.0:0.4218	.	930;766	Q4LE60;O14787	.;TNPO2_HUMAN	D	930;766;766;766;766	ENSP00000407182:E766D;ENSP00000389648:E766D;ENSP00000397379:E766D;ENSP00000349321:E766D	ENSP00000349321:E766D	E	-	3	2	TNPO2	12674644	0.984000	0.35163	0.997000	0.53966	0.998000	0.95712	0.191000	0.17076	-0.192000	0.10432	0.533000	0.62120	GAA		0.592	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1		NM_013433	
TRAPPC10	7109	broad.mit.edu;ucsc.edu	37	21	45522670	45522670	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr21:45522670A>T	ENST00000291574.4	+	22	3533	c.3358A>T	c.(3358-3360)Agt>Tgt	p.S1120C		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1120					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						TGTCGACAACAGTAGCAACTG	0.577																																																	0													176.0	168.0	170.0					21																	45522670		2203	4300	6503	SO:0001583	missense	7109			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.3358A>T	21.37:g.45522670A>T	ENSP00000291574:p.Ser1120Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	37	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184388	0.78677	.	.	ENSG00000160218	ENST00000291574;ENST00000542855	T	0.25749	1.78	5.49	5.49	0.81192	.	0.138589	0.64402	D	0.000004	T	0.39937	0.1097	L	0.48642	1.525	0.43408	D	0.995544	D;D	0.71674	0.992;0.998	P;D	0.65323	0.823;0.934	T	0.22661	-1.0210	10	0.72032	D	0.01	.	10.27	0.43477	0.926:0.0:0.074:0.0	.	379;1120	B4DI17;P48553	.;TPC10_HUMAN	C	1120;251	ENSP00000291574:S1120C	ENSP00000291574:S1120C	S	+	1	0	TRAPPC10	44347098	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.848000	0.69458	2.202000	0.70862	0.533000	0.62120	AGT		0.577	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1		NM_003274	
TTC33	23548	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	40716581	40716581	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:40716581A>C	ENST00000337702.4	-	5	607	c.455T>G	c.(454-456)gTa>gGa	p.V152G	TTC33_ENST00000503936.2_5'UTR	NM_012382.2	NP_036514.1	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	152										NS(1)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GTGAAGGGCTACTTGAAAACT	0.373																																																	0													106.0	110.0	108.0					5																	40716581		2203	4300	6503	SO:0001583	missense	23548			BC015701	CCDS3931.1	5p13.1	2013-01-11			ENSG00000113638	ENSG00000113638		"""Tetratricopeptide (TTC) repeat domain containing"""	29959	protein-coding gene	gene with protein product	"""osmosis responsive factor"""					12477932	Standard	NM_012382		Approved	OSRF	uc003jma.3	Q6PID6	OTTHUMG00000131142	ENST00000337702.4:c.455T>G	5.37:g.40716581A>C	ENSP00000338533:p.Val152Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6G0|O95105	Missense_Mutation	SNP	ENST00000337702.4	37	CCDS3931.1	.	.	.	.	.	.	.	.	.	.	A	13.97	2.395648	0.42512	.	.	ENSG00000113638	ENST00000337702	T	0.73897	-0.79	5.8	5.8	0.92144	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.159286	0.56097	D	0.000031	T	0.70979	0.3286	L	0.56769	1.78	0.80722	D	1	B	0.32128	0.357	B	0.31191	0.125	T	0.68663	-0.5349	10	0.30078	T	0.28	-16.2897	16.1418	0.81533	1.0:0.0:0.0:0.0	.	152	Q6PID6	TTC33_HUMAN	G	152	ENSP00000338533:V152G	ENSP00000338533:V152G	V	-	2	0	TTC33	40752338	0.997000	0.39634	0.999000	0.59377	0.974000	0.67602	7.498000	0.81546	2.203000	0.70933	0.528000	0.53228	GTA		0.373	TTC33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253831.1		NM_012382	
TUSC3	7991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	15531300	15531300	+	Silent	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr8:15531300C>T	ENST00000503731.1	+	6	901	c.753C>T	c.(751-753)atC>atT	p.I251I	TUSC3_ENST00000506802.1_Silent_p.I251I|TUSC3_ENST00000382020.4_Silent_p.I251I|TUSC3_ENST00000509380.1_Silent_p.I251I|TUSC3_ENST00000503191.1_3'UTR	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	251					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		GGAACCATATCCGTGGACCTC	0.383																																																	0													165.0	139.0	148.0					8																	15531300		2203	4300	6503	SO:0001819	synonymous_variant	7991			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.753C>T	8.37:g.15531300C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Silent	SNP	ENST00000503731.1	37	CCDS5994.1																																																																																				0.383	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1		NM_006765	
VENTX	27287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	135053527	135053527	+	Missense_Mutation	SNP	C	C	A	rs150065198	byFrequency	TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr10:135053527C>A	ENST00000325980.9	+	3	1005	c.494C>A	c.(493-495)gCg>gAg	p.A165E		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	165					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		TCTCTCCATGCGCCCCCAGCT	0.597																																																	0													47.0	52.0	50.0					10																	135053527		2203	4300	6503	SO:0001583	missense	27287			AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.494C>A	10.37:g.135053527C>A	ENSP00000357556:p.Ala165Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MZ3	Missense_Mutation	SNP	ENST00000325980.9	37	CCDS7675.1	.	.	.	.	.	.	.	.	.	.	C	4.298	0.054491	0.08291	.	.	ENSG00000151650	ENST00000325980	D	0.91180	-2.8	2.68	-0.57	0.11753	.	1.766420	0.03653	N	0.241412	T	0.79499	0.4456	N	0.08118	0	0.09310	N	1	B	0.28055	0.199	B	0.25614	0.062	T	0.68224	-0.5465	10	0.30854	T	0.27	.	6.0163	0.19605	0.0:0.6695:0.1938:0.1367	.	165	O95231	VENTX_HUMAN	E	165	ENSP00000357556:A165E	ENSP00000357556:A165E	A	+	2	0	VENTX	134903517	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.976000	0.03786	-0.269000	0.09298	-1.426000	0.01102	GCG		0.597	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4		NM_014468	
WDR46	9277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33248690	33248691	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr6:33248690_33248691GT>AA	ENST00000374617.4	-	11	1545_1546	c.1189_1190AC>TT	c.(1189-1191)ACt>TTt	p.T397F	B3GALT4_ENST00000606990.1_Intron	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	397							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						CAGGGTCCGAGTGCTCAGAGGC	0.599																																																	0																																										SO:0001583	missense	9277			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.1189_1190delinsAA	6.37:g.33248690_33248691delinsAA	ENSP00000363746:p.Thr397Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	ENST00000374617.4	37	CCDS4772.1																																																																																				0.599	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076382.2		NM_005452	
ZFAND2B	130617	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	220072989	220072989	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr2:220072989T>C	ENST00000289528.5	+	5	641	c.446T>C	c.(445-447)aTc>aCc	p.I149T	ZFAND2B_ENST00000409217.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409594.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409206.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409336.1_Missense_Mutation_p.I149T|ZFAND2B_ENST00000444522.2_Missense_Mutation_p.I149T|ZFAND2B_ENST00000409097.1_Missense_Mutation_p.I149T	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	149						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)	p.I149T(1)		endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGCTGCCATCTCCAGAGCA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											75.0	62.0	66.0					2																	220072989		2203	4300	6503	SO:0001583	missense	130617			AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.446T>C	2.37:g.220072989T>C	ENSP00000289528:p.Ile149Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB98	Missense_Mutation	SNP	ENST00000289528.5	37	CCDS2435.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.286451	0.40494	.	.	ENSG00000158552	ENST00000409206;ENST00000409594;ENST00000289528;ENST00000422255;ENST00000409097;ENST00000409336;ENST00000409217;ENST00000444522	T;T;T;T;T;T;T;T	0.44881	0.95;0.95;0.91;0.92;0.91;0.91;0.92;0.91	5.32	5.32	0.75619	Zinc finger, AN1-type (1);	0.400654	0.26646	N	0.023223	T	0.38480	0.1042	L	0.54323	1.7	0.38030	D	0.93514	P;B;B	0.36438	0.553;0.019;0.149	B;B;B	0.35470	0.203;0.022;0.053	T	0.44283	-0.9338	10	0.48119	T	0.1	-15.7601	11.5973	0.50981	0.0:0.0:0.0:1.0	.	40;149;149	B3KQB0;Q8WV99;B4DEN4	.;ZFN2B_HUMAN;.	T	149	ENSP00000386824:I149T;ENSP00000386399:I149T;ENSP00000289528:I149T;ENSP00000409931:I149T;ENSP00000387179:I149T;ENSP00000386898:I149T;ENSP00000386370:I149T;ENSP00000411334:I149T	ENSP00000289528:I149T	I	+	2	0	ZFAND2B	219781233	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	3.720000	0.54933	2.233000	0.73108	0.533000	0.62120	ATC		0.532	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256824.2		NM_138802	
ZNF12	7559	broad.mit.edu;hgsc.bcm.edu	37	7	6731607	6731607	+	Silent	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr7:6731607C>T	ENST00000405858.1	-	5	1507	c.966G>A	c.(964-966)gaG>gaA	p.E322E	ZNF12_ENST00000404360.1_Silent_p.E248E|ZNF12_ENST00000342651.5_Silent_p.E284E|AC073343.2_ENST00000577401.1_RNA|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	322					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		CATAGGGCTTCTCCCCTGTGT	0.453																																																	0													67.0	73.0	71.0					7																	6731607		2202	4300	6502	SO:0001819	synonymous_variant	7559			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.966G>A	7.37:g.6731607C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Silent	SNP	ENST00000405858.1	37	CCDS47538.1																																																																																				0.453	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2		NM_016265	
ZNF304	57343	hgsc.bcm.edu;ucsc.edu	37	19	57863052	57863052	+	Frame_Shift_Del	DEL	T	T	-	rs117111481	byFrequency	TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:57863052delT	ENST00000282286.5	+	1	193	c.20delT	c.(19-21)atgfs	p.M7fs	CTC-444N24.13_ENST00000597973.1_RNA|ZNF304_ENST00000598744.1_De_novo_Start_InFrame|ZNF304_ENST00000391705.3_Frame_Shift_Del_p.M7fs|ZNF304_ENST00000443917.2_Frame_Shift_Del_p.M7fs			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	7					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GCGGTGCTGATGGACCGGGTT	0.662																																																	0													98.0	76.0	83.0					19																	57863052		2203	4300	6503	SO:0001589	frameshift_variant	57343			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.20delT	19.37:g.57863052delT	ENSP00000282286:p.Met7fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000282286.5	37	CCDS12950.1																																																																																				0.662	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			
AMN	81693	broad.mit.edu	37	14	103389067	103389067	+	Splice_Site	SNP	C	C	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr14:103389067C>T	ENST00000299155.5	+	1	75	c.42C>T	c.(40-42)tgC>tgT	p.C14C		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	14					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.C14C(1)		kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGCAGCTCTGCGGTGAGCCGG	0.692																																																	1	Substitution - coding silent(1)	large_intestine(1)											27.0	21.0	23.0					14																	103389067		2182	4280	6462	SO:0001630	splice_region_variant	81693			AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.43+1C>T	14.37:g.103389067C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6UX83	Silent	SNP	ENST00000299155.5	37	CCDS9977.1																																																																																				0.692	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415704.1			Silent
CDC14C	168448	broad.mit.edu	37	7	48965048	48965048	+	IGR	SNP	C	C	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr7:48965048C>A								AC004899.1 (73827 upstream) : AC010971.1 (304684 downstream)																							ATGGCAGCACCCCTACTGATG	0.453																																																	0																																										SO:0001628	intergenic_variant	168448																															7.37:g.48965048C>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.453									
CNTNAP4	85445	broad.mit.edu	37	16	76486631	76486631	+	Missense_Mutation	SNP	A	A	C	rs150449060		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr16:76486631A>C	ENST00000476707.1	+	7	1446	c.1307A>C	c.(1306-1308)tAc>tCc	p.Y436S	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.Y384S|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.Y432S|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.Y360S			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	433	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.Y408S(1)|p.Y360S(1)|p.Y432S(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TCGAATCTCTACCAGCCAGGA	0.433																																																	3	Substitution - Missense(3)	kidney(3)											42.0	43.0	43.0					16																	76486631		2198	4300	6498	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1307A>C	16.37:g.76486631A>C	ENSP00000417628:p.Tyr436Ser	Somatic		WXS	Illumina GAIIx	Phase_I	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	A	9.057	0.993638	0.19043	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	5.43	-5.64	0.02466	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.414840	0.05049	N	0.477704	T	0.53367	0.1792	.	.	.	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.0;0.004;0.0;0.001	T	0.36335	-0.9752	9	0.19590	T	0.45	.	8.5598	0.33503	0.2896:0.1725:0.0:0.538	.	360;436;408;433	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	S	432;384;360;436	ENSP00000306893:Y432S;ENSP00000439733:Y384S;ENSP00000418741:Y360S;ENSP00000417628:Y436S	ENSP00000306893:Y432S	Y	+	2	0	CNTNAP4	75044132	0.050000	0.20438	0.706000	0.30403	0.985000	0.73830	0.076000	0.14712	-0.785000	0.04522	-0.291000	0.09656	TAC		0.433	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1		NM_033401	
ITGA1	3672	broad.mit.edu	37	5	52221113	52221113	+	Silent	SNP	C	C	G	rs201717960		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr5:52221113C>G	ENST00000282588.6	+	19	2867	c.2409C>G	c.(2407-2409)ccC>ccG	p.P803P		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	803					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTCAGATTCCCTTTGCCAAAG	0.393																																																	0													69.0	69.0	69.0					5																	52221113		2203	4300	6503	SO:0001819	synonymous_variant	3672			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2409C>G	5.37:g.52221113C>G		Somatic		WXS	Illumina GAIIx	Phase_I	B2RNU0	Silent	SNP	ENST00000282588.6	37	CCDS3955.1																																																																																				0.393	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3		NM_181501	
Unknown	0	broad.mit.edu	37	9	66499680	66499680	+	IGR	SNP	C	C	A	rs370931238		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr9:66499680C>A								RP11-262H14.1 (30370 upstream) : RP11-262H14.7 (17525 downstream)																							TCATGTTAACCCCTTCCCAGG	0.582																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.66499680C>A		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.582									
LPA	4018	broad.mit.edu	37	6	161032706	161032706	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr6:161032706C>A	ENST00000316300.5	-	16	2535	c.2491G>T	c.(2491-2493)Gga>Tga	p.G831*	LPA_ENST00000447678.1_Nonsense_Mutation_p.G831*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3339	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TAACTCTGTCCATTACCGTGG	0.478																																																	0													89.0	95.0	93.0					6																	161032706		1157	2473	3630	SO:0001587	stop_gained	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2491G>T	6.37:g.161032706C>A	ENSP00000321334:p.Gly831*	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	23.4	4.408217	0.83340	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.17	2.17	0.27698	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.8282	0.29328	0.0:1.0:0.0:0.0	.	.	.	.	X	831	.	ENSP00000321334:G831X	G	-	1	0	LPA	160952696	0.659000	0.27411	0.008000	0.14137	0.070000	0.16714	3.656000	0.54467	1.217000	0.43442	0.194000	0.17425	GGA		0.478	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1		NM_005577	
LYPD5	284348	broad.mit.edu	37	19	44303017	44303017	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:44303017T>A	ENST00000377950.3	-	3	397	c.317A>T	c.(316-318)gAc>gTc	p.D106V	LYPD5_ENST00000414615.2_Missense_Mutation_p.D63V|LYPD5_ENST00000594013.1_Missense_Mutation_p.D63V	NM_001031749.2	NP_001026919.2	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5	106						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	8		Prostate(69;0.0352)				GTTGCATTTGTCAGTTGTGCA	0.687																																																	0													33.0	29.0	31.0					19																	44303017		2203	4300	6503	SO:0001583	missense	284348			AK055031	CCDS12631.1, CCDS46096.1	19q13.31	2008-02-05				ENSG00000159871			26397	protein-coding gene	gene with protein product						12477932	Standard	NM_182573		Approved	FLJ30469	uc002oxm.4	Q6UWN5		ENST00000377950.3:c.317A>T	19.37:g.44303017T>A	ENSP00000367185:p.Asp106Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q6PEX9|Q96DR2	Missense_Mutation	SNP	ENST00000377950.3	37	CCDS46096.1	.	.	.	.	.	.	.	.	.	.	t	15.10	2.731644	0.48939	.	.	ENSG00000159871	ENST00000377950;ENST00000414615	T;D	0.99264	1.46;-5.65	3.3	2.26	0.28386	.	0.381500	0.19096	U	0.122828	D	0.98033	0.9352	L	0.34521	1.04	0.09310	N	0.999994	D	0.64830	0.994	P	0.56865	0.808	D	0.94690	0.7873	10	0.87932	D	0	-22.7539	5.3118	0.15835	0.0:0.1382:0.0:0.8618	.	106	Q6UWN5	LYPD5_HUMAN	V	106;63	ENSP00000367185:D106V;ENSP00000408433:D63V	ENSP00000367185:D106V	D	-	2	0	LYPD5	48994857	0.264000	0.24093	0.011000	0.14972	0.055000	0.15305	3.503000	0.53340	0.469000	0.27268	0.439000	0.28862	GAC		0.687	LYPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463611.1		NM_182573	
BACE2	25825	broad.mit.edu	37	21	42551343	42551343	+	Intron	SNP	G	G	C			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr21:42551343G>C	ENST00000330333.6	+	1	775				PLAC4_ENST00000414699.1_RNA|PLAC4_ENST00000440221.2_RNA|PLAC4_ENST00000536486.1_RNA|BACE2_ENST00000347667.5_Intron|BACE2-IT1_ENST00000433378.1_RNA|BACE2_ENST00000328735.6_Intron|PLAC4_ENST00000430327.2_RNA	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				cagggtgagtgagggtgtcag	0.607																																																	0													158.0	137.0	144.0					21																	42551343		2196	4273	6469	SO:0001627	intron_variant	191585			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+10841G>C	21.37:g.42551343G>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	37	CCDS13668.1																																																																																				0.607	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1			
RAC1	5879	broad.mit.edu	37	7	6442071	6442071	+	Silent	SNP	G	G	C	rs538973654		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr7:6442071G>C	ENST00000348035.4	+	6	786	c.573G>C	c.(571-573)ctG>ctC	p.L191L	RAC1_ENST00000356142.4_Silent_p.L210L|RAC1_ENST00000488373.1_3'UTR	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	191					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	AATGCCTGCTGTTGTAAATGT	0.468																																																	0													39.0	42.0	41.0					7																	6442071		2202	4288	6490	SO:0001819	synonymous_variant	5879			AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.573G>C	7.37:g.6442071G>C		Somatic		WXS	Illumina GAIIx	Phase_I	O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Silent	SNP	ENST00000348035.4	37	CCDS5348.1																																																																																				0.468	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242868.2		NM_018890	
SPCS3	60559	broad.mit.edu	37	4	177248330	177248330	+	Silent	SNP	C	C	T	rs569036179		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr4:177248330C>T	ENST00000503362.1	+	4	425	c.312C>T	c.(310-312)gtC>gtT	p.V104V	SPCS3_ENST00000507001.1_3'UTR	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)	104					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		ACCAAGTTGTCCTATGGGACA	0.308													C|||	1	0.000199681	0.0	0.0	5008	,	,		16582	0.001		0.0	False		,,,				2504	0.0																0													39.0	37.0	38.0					4																	177248330		1805	4062	5867	SO:0001819	synonymous_variant	60559			AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.312C>T	4.37:g.177248330C>T		Somatic		WXS	Illumina GAIIx	Phase_I	P12280|Q9H0S7	Silent	SNP	ENST00000503362.1	37	CCDS54823.1																																																																																				0.308	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362329.1		NM_021928	
RP11-24M17.5	0	broad.mit.edu	37	15	76074431	76074431	+	RNA	SNP	C	C	T	rs371238897		TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr15:76074431C>T	ENST00000395215.3	+	0	610																		p.S190L(2)									CTCCAGTCCTCGAGCTGCAGA	0.547																																																	2	Substitution - Missense(2)	endometrium(2)																																										0																															15.37:g.76074431C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000395215.3	37		.	.	.	.	.	.	.	.	.	.	.	3.205	-0.162863	0.06502	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.789	0.789	0.18607	.	.	.	.	.	T	0.29850	0.0746	.	.	.	.	.	.	B	0.20550	0.046	B	0.15870	0.014	T	0.30208	-0.9986	6	0.27082	T	0.32	.	7.4893	0.27452	0.0:0.9999:0.0:1.0E-4	.	190	B4DZE6	.	L	190	.	ENSP00000378641:S190L	S	+	2	0	AC019294.2	73861486	0.987000	0.35691	0.013000	0.15412	0.024000	0.10985	3.310000	0.51911	0.745000	0.32763	0.274000	0.19336	TCG		0.547	RP11-24M17.5-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000420501.1			
RP11-24M17.5	0	broad.mit.edu	37	15	76074441	76074441	+	RNA	SNP	A	A	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr15:76074441A>T	ENST00000395215.3	+	0	620																											CGAGCTGCAGAGAAGCGGTCC	0.557																																																	0																																												0																															15.37:g.76074441A>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000395215.3	37		.	.	.	.	.	.	.	.	.	.	.	3.651	-0.071454	0.07228	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.437	0.437	0.16555	.	.	.	.	.	T	0.15478	0.0373	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.38001	-0.9681	6	0.02654	T	1	.	3.7635	0.08613	0.6336:0.0:0.0:0.3664	.	193	B4DZE6	.	S	193	.	ENSP00000378641:R193S	R	+	3	2	AC019294.2	73861496	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.070000	0.14573	-0.824000	0.04295	-1.485000	0.00982	AGA		0.557	RP11-24M17.5-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000420501.1			
DNAH17-AS1	100996295	broad.mit.edu	37	17	76497744	76497744	+	3'UTR	SNP	T	T	G			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr17:76497744T>G	ENST00000598378.1	+	0	2834				DNAH17_ENST00000389840.5_Intron|RP11-559N14.5_ENST00000591373.1_RNA|DNAH17_ENST00000585328.1_Intron					DNAH17 antisense RNA 1																		AGTGGCAGGGTCTGAAGTCCC	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0					17q25.3	2014-02-12	2013-05-21		ENSG00000268470	ENSG00000267432		"""Long non-coding RNAs"""	48594	non-coding RNA	RNA, long non-coding							Standard	NR_102401		Approved				OTTHUMG00000177588	ENST00000598378.1:c.*1181T>G	17.37:g.76497744T>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000598378.1	37																																																																																					0.627	DNAH17-AS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				
RPS4XP21	126235	broad.mit.edu	37	19	34584130	34584130	+	IGR	SNP	G	G	T			TCGA-A3-3317-01A-01D-0966-08	TCGA-A3-3317-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cd12847f-695b-4b97-9a56-a4a1ddc58ec4	02b0790a-61a7-4917-be68-533c397b2e6b	g.chr19:34584130G>T								RN7SL150P (165600 upstream) : LSM14A (79299 downstream)																							GGATGGACGAGCAGCAAACAC	0.502																																																	0																																										SO:0001628	intergenic_variant	0																															19.37:g.34584130G>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	G	13.85	2.360707	0.41801	.	.	ENSG00000186008	ENST00000469064	.	.	.	0.505	0.505	0.16953	.	0.088513	0.45126	U	0.000384	T	0.30166	0.0756	.	.	.	0.26469	N	0.975304	P	0.42584	0.784	B	0.43225	0.412	T	0.16630	-1.0396	8	0.87932	D	0	.	6.7661	0.23568	1.0E-4:0.0:0.9999:0.0	.	40	C9JQ55	.	D	40	.	ENSP00000420227:A40D	A	-	2	0	RPS4XP21	39275970	1.000000	0.71417	0.347000	0.25668	0.021000	0.10359	4.863000	0.62983	0.508000	0.28173	0.313000	0.20887	GCT	0	0.502									
