#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADCY8	114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	131896886	131896886	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr8:131896886C>T	ENST00000286355.5	-	8	4125	c.2033G>A	c.(2032-2034)cGg>cAg	p.R678Q	ADCY8_ENST00000377928.3_Missense_Mutation_p.R678Q	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	678					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATCGCCACTCCGCAAGTCGAT	0.458										HNSCC(32;0.087)																																							0													140.0	133.0	135.0					8																	131896886		2203	4300	6503	SO:0001583	missense	114			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2033G>A	8.37:g.131896886C>T	ENSP00000286355:p.Arg678Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793944	0.90453	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.78707	-1.2;-1.2	5.98	5.98	0.97165	.	0.054567	0.85682	D	0.000000	D	0.87301	0.6143	M	0.68952	2.095	0.54753	D	0.999983	D;P	0.71674	0.998;0.836	D;B	0.79108	0.992;0.106	D	0.84783	0.0774	10	0.37606	T	0.19	.	19.5094	0.95135	0.0:1.0:0.0:0.0	.	678;678	E7EVL1;P40145	.;ADCY8_HUMAN	Q	678	ENSP00000286355:R678Q;ENSP00000367161:R678Q	ENSP00000286355:R678Q	R	-	2	0	ADCY8	131966068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.319000	0.79040	2.861000	0.98227	0.650000	0.86243	CGG		0.458	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1			
C17orf75	64149	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	30665271	30665271	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr17:30665271T>G	ENST00000577809.1	-	4	496	c.447A>C	c.(445-447)gaA>gaC	p.E149D	RP11-227G15.3_ENST00000581915.1_RNA|C17orf75_ENST00000225805.4_Missense_Mutation_p.E149D	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	149										ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			AGACCACATATTCTGAAGGGT	0.403																																																	0													152.0	146.0	148.0					17																	30665271		1841	4099	5940	SO:0001583	missense	64149			AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.447A>C	17.37:g.30665271T>G	ENSP00000464275:p.Glu149Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z2H4	Missense_Mutation	SNP	ENST00000577809.1	37	CCDS58537.1	.	.	.	.	.	.	.	.	.	.	T	12.65	2.002085	0.35320	.	.	ENSG00000108666	ENST00000225805	.	.	.	5.68	-0.0434	0.13859	.	0.095110	0.64402	N	0.000001	T	0.38480	0.1042	L	0.45581	1.43	0.34092	D	0.660861	B	0.14805	0.011	B	0.16722	0.016	T	0.26916	-1.0089	9	0.41790	T	0.15	-9.5076	5.2391	0.15462	0.0:0.2974:0.2648:0.4378	.	149	Q9HAS0	NJMU_HUMAN	D	149	.	ENSP00000225805:E149D	E	-	3	2	C17orf75	27689384	0.613000	0.27009	0.999000	0.59377	0.966000	0.64601	-0.311000	0.08124	0.127000	0.18452	-0.366000	0.07423	GAA		0.403	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447204.1		NM_022344	
CDH19	28513	hgsc.bcm.edu;ucsc.edu	37	18	64235860	64235860	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr18:64235860delT	ENST00000540086.1	-	3	529	c.283delA	c.(283-285)agafs	p.R95fs	CDH19_ENST00000262150.2_Frame_Shift_Del_p.R95fs	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	196	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TCACCTGTTCTTTCATCAATG	0.418																																																	0													113.0	110.0	111.0					18																	64235860		2203	4299	6502	SO:0001589	frameshift_variant	28513			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.283delA	18.37:g.64235860delT	ENSP00000439593:p.Arg95fs	Somatic		WXS	Illumina HiSeq	Phase_I	O15098	Frame_Shift_Del	DEL	ENST00000540086.1	37	CCDS59325.1																																																																																				0.418	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1		NM_021153	
CDK12	51755	broad.mit.edu;ucsc.edu	37	17	37650846	37650846	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr17:37650846G>A	ENST00000447079.4	+	5	2351	c.2318G>A	c.(2317-2319)cGt>cAt	p.R773H	CDK12_ENST00000430627.2_Missense_Mutation_p.R773H	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	773	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						ACAGCCATTCGTGAAATCAAA	0.393			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																														Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													82.0	73.0	76.0					17																	37650846		2203	4300	6503	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2318G>A	17.37:g.37650846G>A	ENSP00000398880:p.Arg773His	Somatic		WXS	Illumina GAIIx	Phase_I	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765796	0.90020	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.53640	0.61;0.61	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49305	D	0.000149	T	0.75917	0.3915	M	0.89534	3.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.81346	-0.0974	10	0.87932	D	0	-8.3609	19.1644	0.93548	0.0:0.0:1.0:0.0	.	772;773;773	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	H	773	ENSP00000407720:R773H;ENSP00000398880:R773H	ENSP00000407720:R773H	R	+	2	0	CDK12	34904372	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.601000	0.87937	0.561000	0.74099	CGT		0.393	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4		NM_016507	
CERK	64781	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	47116101	47116101	+	Silent	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr22:47116101G>A	ENST00000216264.8	-	3	373	c.261C>T	c.(259-261)caC>caT	p.H87H	CERK_ENST00000541677.1_5'UTR	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	87	Required for binding to sulfatide and phosphoinositides.				ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)			cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TCTTTACACAGTGAACTGCAC	0.522																																																	0													70.0	61.0	64.0					22																	47116101		2203	4300	6503	SO:0001819	synonymous_variant	64781			AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.261C>T	22.37:g.47116101G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Silent	SNP	ENST00000216264.8	37	CCDS14077.1																																																																																				0.522	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317924.2		NM_022766	
CNTNAP1	8506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	40844591	40844591	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr17:40844591G>C	ENST00000264638.4	+	17	2822	c.2605G>C	c.(2605-2607)Gag>Cag	p.E869Q	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	869	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		AGACGACTTTGAGTTCAATGA	0.587																																																	0													158.0	139.0	146.0					17																	40844591		2203	4300	6503	SO:0001583	missense	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2605G>C	17.37:g.40844591G>C	ENSP00000264638:p.Glu869Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711232	0.48517	.	.	ENSG00000108797	ENST00000264638	T	0.77358	-1.09	5.14	5.14	0.70334	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.267147	0.32258	N	0.006356	T	0.53254	0.1785	N	0.03608	-0.345	0.31858	N	0.621331	P	0.41450	0.75	B	0.37387	0.248	T	0.62905	-0.6755	10	0.40728	T	0.16	.	9.5053	0.39042	0.0933:0.0:0.9067:0.0	.	869	P78357	CNTP1_HUMAN	Q	869	ENSP00000264638:E869Q	ENSP00000264638:E869Q	E	+	1	0	CNTNAP1	38098117	0.999000	0.42202	0.997000	0.53966	0.965000	0.64279	3.483000	0.53194	2.686000	0.91538	0.561000	0.74099	GAG		0.587	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1		NM_003632	
COLEC11	78989	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	3691555	3691555	+	Silent	SNP	C	C	T	rs199962584		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:3691555C>T	ENST00000349077.4	+	7	766	c.663C>T	c.(661-663)ccC>ccT	p.P221P	COLEC11_ENST00000403096.3_Silent_p.P195P|COLEC11_ENST00000418971.2_Silent_p.P235P|COLEC11_ENST00000382062.2_Silent_p.P197P|COLEC11_ENST00000402922.1_Silent_p.P171P|COLEC11_ENST00000402794.1_Silent_p.P171P|COLEC11_ENST00000236693.7_Silent_p.P218P|COLEC11_ENST00000404205.1_Silent_p.P147P|COLEC11_ENST00000487365.1_3'UTR	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	221	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		ACCACTCCCCCATGCGGACCT	0.642																																																	0													65.0	76.0	72.0					2																	3691555		2203	4300	6503	SO:0001819	synonymous_variant	78989			BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.663C>T	2.37:g.3691555C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Silent	SNP	ENST00000349077.4	37	CCDS1649.1																																																																																				0.642	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1		NM_024027	
DLGAP1	9229	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	3502638	3502638	+	Silent	SNP	A	A	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr18:3502638A>G	ENST00000315677.3	-	12	3172	c.2577T>C	c.(2575-2577)ccT>ccC	p.P859P	DLGAP1_ENST00000400147.2_Silent_p.P557P|DLGAP1_ENST00000400155.1_Silent_p.P565P|DLGAP1_ENST00000400149.3_Silent_p.P549P|DLGAP1_ENST00000400145.2_Silent_p.P557P|DLGAP1_ENST00000581527.1_Silent_p.P859P|DLGAP1_ENST00000581699.1_Silent_p.P565P|DLGAP1_ENST00000515196.2_Silent_p.P859P|DLGAP1_ENST00000584874.1_Silent_p.P859P|DLGAP1_ENST00000534970.1_Silent_p.P543P|DLGAP1_ENST00000539435.1_Silent_p.P567P|DLGAP1_ENST00000400150.3_Silent_p.P575P	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	859					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GATGAGCATTAGGATTCTGCA	0.388																																																	0													67.0	74.0	71.0					18																	3502638		2203	4300	6503	SO:0001819	synonymous_variant	9229			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2577T>C	18.37:g.3502638A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Silent	SNP	ENST00000315677.3	37	CCDS11836.1																																																																																				0.388	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4			
ENPEP	2028	broad.mit.edu;ucsc.edu	37	4	111409738	111409745	+	Frame_Shift_Del	DEL	AATCTTTT	AATCTTTT	-			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	AATCTTTT	AATCTTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr4:111409738_111409745delAATCTTTT	ENST00000265162.5	+	2	1028_1035	c.686_693delAATCTTTT	c.(685-693)aaatcttttfs	p.KSF229fs		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	229					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S230Y(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GATGCCAGGAAATCTTTTCCTTGTTTTG	0.423																																																	1	Substitution - Missense(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	2028			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.686_693delAATCTTTT	4.37:g.111409738_111409745delAATCTTTT	ENSP00000265162:p.Lys229fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q504U2	Frame_Shift_Del	DEL	ENST00000265162.5	37	CCDS3691.1																																																																																				0.423	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2			
ENPP2	5168	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	120569905	120569905	+	Silent	SNP	T	T	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr8:120569905T>C	ENST00000075322.6	-	25	2506	c.2448A>G	c.(2446-2448)gtA>gtG	p.V816V	ENPP2_ENST00000522167.1_Silent_p.V451V|ENPP2_ENST00000522826.1_Silent_p.V841V|ENPP2_ENST00000427067.2_Silent_p.V837V|ENPP2_ENST00000259486.6_Silent_p.V868V	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	816					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGAGTTCTTCTACCCATTTTG	0.458																																					Melanoma(20;305 879 2501 4818 31020)												0													187.0	168.0	175.0					8																	120569905		2203	4300	6503	SO:0001819	synonymous_variant	5168			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.2448A>G	8.37:g.120569905T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Silent	SNP	ENST00000075322.6	37	CCDS34936.1																																																																																				0.458	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			
NXPE4	54827	broad.mit.edu;hgsc.bcm.edu	37	11	114451052	114451052	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr11:114451052C>T	ENST00000375478.3	-	5	1081	c.901G>A	c.(901-903)Gtt>Att	p.V301I	NXPE4_ENST00000424261.2_Missense_Mutation_p.V17I	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	301						extracellular vesicular exosome (GO:0070062)											TTCATTGCAACTGTTTCTTCT	0.408																																																	0													121.0	110.0	113.0					11																	114451052		1864	4107	5971	SO:0001583	missense	0			AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.901G>A	11.37:g.114451052C>T	ENSP00000364627:p.Val301Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	C	8.038	0.763327	0.15914	.	.	ENSG00000137634	ENST00000424261;ENST00000375478	T;T	0.13538	2.58;2.74	4.69	3.78	0.43462	.	1.115920	0.06903	N	0.806357	T	0.12433	0.0302	L	0.33485	1.01	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.08889	-1.0700	10	0.27082	T	0.32	.	10.6727	0.45768	0.0:0.9035:0.0:0.0965	.	301	Q6UWF7	FA55D_HUMAN	I	17;301	ENSP00000401503:V17I;ENSP00000364627:V301I	ENSP00000364627:V301I	V	-	1	0	FAM55D	113956262	0.000000	0.05858	0.011000	0.14972	0.312000	0.27988	0.842000	0.27627	2.588000	0.87417	0.655000	0.94253	GTT		0.408	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1		NM_017678	
HELZ	9931	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	65184580	65184580	+	Silent	SNP	T	T	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr17:65184580T>C	ENST00000358691.5	-	12	1183	c.1017A>G	c.(1015-1017)caA>caG	p.Q339Q	HELZ_ENST00000580662.1_5'Flank|HELZ_ENST00000580168.1_Silent_p.Q339Q	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	339						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CTAATCCATTTTGGGCCATCT	0.383																																																	0													280.0	265.0	270.0					17																	65184580		1886	4109	5995	SO:0001819	synonymous_variant	9931			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1017A>G	17.37:g.65184580T>C		Somatic		WXS	Illumina HiSeq	Phase_I	I6L9H4	Silent	SNP	ENST00000358691.5	37	CCDS42374.1																																																																																				0.383	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1		NM_014877	
HHIPL1	84439	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	100129224	100129224	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr14:100129224C>G	ENST00000330710.5	+	6	1612	c.1514C>G	c.(1513-1515)tCc>tGc	p.S505C	HHIPL1_ENST00000357223.2_Missense_Mutation_p.S505C	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	505					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				CGTCTGATGTCCCTCCAAGAG	0.572																																																	0													84.0	76.0	79.0					14																	100129224		2203	4300	6503	SO:0001583	missense	84439			AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.1514C>G	14.37:g.100129224C>G	ENSP00000330601:p.Ser505Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473248	0.63737	.	.	ENSG00000182218	ENST00000330710;ENST00000357223	T;T	0.11385	2.78;2.78	4.84	4.84	0.62591	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Glucose/Sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.280386	0.34628	N	0.003801	T	0.37865	0.1019	M	0.84219	2.685	0.38266	D	0.94202	D;D	0.89917	1.0;0.998	D;D	0.79108	0.992;0.917	T	0.47058	-0.9146	10	0.59425	D	0.04	.	17.978	0.89132	0.0:1.0:0.0:0.0	.	505;505	Q96JK4;Q96JK4-2	HIPL1_HUMAN;.	C	505	ENSP00000330601:S505C;ENSP00000349757:S505C	ENSP00000330601:S505C	S	+	2	0	HHIPL1	99198977	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.159000	0.58157	2.255000	0.74692	0.561000	0.74099	TCC		0.572	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1		XM_041566	
HLA-F	3134	broad.mit.edu;hgsc.bcm.edu	37	6	29694668	29694668	+	IGR	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr6:29694668G>A	ENST00000376861.1	+	0	1544				HLA-F_ENST00000475996.1_Intron|HLA-F_ENST00000440587.2_Missense_Mutation_p.V220M|HLA-F_ENST00000259951.7_Missense_Mutation_p.V349M			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						AGCCTACTCAGTGGTCAGCGG	0.463																																																	0													104.0	119.0	114.0					6																	29694668		1491	2694	4185	SO:0001628	intergenic_variant	3134			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156		6.37:g.29694668G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Missense_Mutation	SNP	ENST00000376861.1	37	CCDS43438.1	.	.	.	.	.	.	.	.	.	.	.	10.08	1.252302	0.22880	.	.	ENSG00000204642	ENST00000449921;ENST00000259951;ENST00000399258;ENST00000440587	T;T	0.00745	5.75;5.8	0.62	0.62	0.17637	.	.	.	.	.	T	0.00552	0.0018	N	0.14661	0.345	0.27138	N	0.961736	B;D	0.58970	0.318;0.984	B;D	0.65323	0.012;0.934	T	0.57871	-0.7736	9	0.87932	D	0	.	7.0003	0.24805	1.0E-4:0.0:0.9999:0.0	.	349;349	A8MVU7;P30511-3	.;.	M	326;349;263;220	ENSP00000259951:V349M;ENSP00000404130:V220M	ENSP00000259951:V349M	V	+	1	0	HLA-F	29802647	1.000000	0.71417	0.109000	0.21407	0.027000	0.11550	6.536000	0.73842	0.580000	0.29522	0.436000	0.28706	GTG		0.463	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195083.1		NM_018950	
IL12RB2	3595	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	67861487	67861487	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:67861487G>C	ENST00000262345.1	+	16	2944	c.2304G>C	c.(2302-2304)aaG>aaC	p.K768N	IL12RB2_ENST00000371000.1_3'UTR|IL12RB2_ENST00000541374.1_3'UTR|IL12RB2_ENST00000544434.1_Missense_Mutation_p.K682N	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	768					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ATCTGTACAAGGTGCTGGAGA	0.582																																																	0													98.0	95.0	96.0					1																	67861487		2203	4300	6503	SO:0001583	missense	3595			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.2304G>C	1.37:g.67861487G>C	ENSP00000262345:p.Lys768Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458732	0.43634	.	.	ENSG00000081985	ENST00000262345;ENST00000544434	T;T	0.52295	0.67;1.42	5.39	4.48	0.54585	.	0.482935	0.23461	N	0.047927	T	0.48241	0.1489	M	0.65975	2.015	0.80722	D	1	D;D	0.69078	0.988;0.997	P;P	0.60789	0.844;0.879	T	0.47573	-0.9107	10	0.31617	T	0.26	-15.141	10.3657	0.44021	0.0911:0.0:0.9089:0.0	.	682;768	F5H7L6;Q99665	.;I12R2_HUMAN	N	768;682	ENSP00000262345:K768N;ENSP00000442443:K682N	ENSP00000262345:K768N	K	+	3	2	IL12RB2	67634075	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	2.940000	0.49003	1.421000	0.47157	0.561000	0.74099	AAG		0.582	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2		NM_001559	
KIAA1024	23251	hgsc.bcm.edu;ucsc.edu	37	15	79749416	79749416	+	Silent	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr15:79749416C>T	ENST00000305428.3	+	2	1002	c.927C>T	c.(925-927)aaC>aaT	p.N309N		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	309						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						TGCCCTATAACAGCCAGTACC	0.507																																																	0													132.0	141.0	138.0					15																	79749416		2196	4293	6489	SO:0001819	synonymous_variant	23251			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.927C>T	15.37:g.79749416C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7MD43	Silent	SNP	ENST00000305428.3	37	CCDS32306.1																																																																																				0.507	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1		NM_015206	
LAD1	3898	broad.mit.edu;ucsc.edu|broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	201354880	201354881	+	Missense_Mutation	DNP	TC	TC	GA	rs143101113		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:201354880_201354881TC>GA	ENST00000391967.2	-	4	1380_1381	c.1079_1080GA>TC	c.(1078-1080)cGA>cTC	p.R360L	LAD1_ENST00000367313.3_Missense_Mutation_p.R374L|LAD1_ENST00000488842.1_5'Flank	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	360						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						TGCTGTAGGTTCGCTGTGTGGG	0.594											OREG0014078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001583	missense	3898			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.1079_1080delinsGA	1.37:g.201354880_201354881delinsGA	ENSP00000375829:p.Arg360Leu	Somatic	2121	WXS	Illumina GAIIx|Illumina HiSeq	Phase_I	O95614|Q96GD8	Silent|Missense_Mutation	SNP	ENST00000391967.2	37	CCDS1410.1																																																																																				0.594	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1		NM_005558	
LYST	1130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	235922372	235922372	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:235922372G>A	ENST00000389794.3	-	23	6955	c.6781C>T	c.(6781-6783)Cgt>Tgt	p.R2261C	LYST_ENST00000389793.2_Missense_Mutation_p.R2261C			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2261					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTTGGCCAACGGCCAACAGCT	0.473																																																	0													73.0	69.0	71.0					1																	235922372		2203	4300	6503	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6781C>T	1.37:g.235922372G>A	ENSP00000374444:p.Arg2261Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621863	0.66787	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.67865	-0.29;-0.29	4.93	2.99	0.34606	.	0.597834	0.18240	N	0.147275	T	0.73674	0.3617	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.66602	0.945	T	0.71632	-0.4534	10	0.87932	D	0	.	5.2737	0.15638	0.0775:0.1389:0.6304:0.1532	.	2261	Q99698	LYST_HUMAN	C	2261	ENSP00000374444:R2261C;ENSP00000374443:R2261C	ENSP00000374443:R2261C	R	-	1	0	LYST	233988995	0.988000	0.35896	0.056000	0.19401	0.908000	0.53690	3.932000	0.56537	0.565000	0.29255	0.558000	0.71614	CGT		0.473	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			
MTA3	57504	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	42909669	42909669	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:42909669C>G	ENST00000405094.1	+	9	831	c.831C>G	c.(829-831)agC>agG	p.S277R	MTA3_ENST00000406911.1_Missense_Mutation_p.S277R|MTA3_ENST00000405592.1_Missense_Mutation_p.S221R|MTA3_ENST00000407270.3_Missense_Mutation_p.S277R|MTA3_ENST00000406652.1_Missense_Mutation_p.S221R			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	277	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						CTGAAGCTAGCTTATTTGAAG	0.388																																																	0													76.0	70.0	72.0					2																	42909669		1876	4110	5986	SO:0001583	missense	57504			AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.831C>G	2.37:g.42909669C>G	ENSP00000385823:p.Ser277Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NSP2|Q9ULF4	Missense_Mutation	SNP	ENST00000405094.1	37		.	.	.	.	.	.	.	.	.	.	C	12.67	2.006513	0.35415	.	.	ENSG00000057935	ENST00000405592;ENST00000406652;ENST00000407270;ENST00000282366;ENST00000406911;ENST00000405094	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.66	0.139	0.14798	.	0.357629	0.35970	N	0.002873	T	0.15305	0.0369	N	0.02842	-0.48	0.32351	N	0.558449	B;B;B	0.30793	0.295;0.027;0.161	B;B;B	0.30943	0.045;0.026;0.122	T	0.16600	-1.0397	10	0.72032	D	0.01	-15.6184	10.4673	0.44616	0.0:0.4879:0.0:0.5121	.	277;277;221	E7EQY4;Q9BTC8-2;D6W5A2	.;.;.	R	221;221;277;277;277;277	ENSP00000383973:S221R;ENSP00000384249:S221R;ENSP00000385045:S277R;ENSP00000385241:S277R;ENSP00000385823:S277R	ENSP00000282366:S277R	S	+	3	2	MTA3	42763173	0.998000	0.40836	0.994000	0.49952	0.994000	0.84299	1.355000	0.34068	-0.003000	0.14444	-0.218000	0.12543	AGC		0.388	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1		NM_020744	
MSH6	2956	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	48032817	48032817	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:48032817C>A	ENST00000234420.5	+	7	3769	c.3617C>A	c.(3616-3618)gCa>gAa	p.A1206E	MSH6_ENST00000538136.1_Missense_Mutation_p.A904E|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.A1076E	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1206					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CATGCAACAGCACATTCTCTG	0.294			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)											93.0	96.0	95.0					2																	48032817		2203	4300	6503	SO:0001583	missense	2956	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3617C>A	2.37:g.48032817C>A	ENSP00000234420:p.Ala1206Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	6.048	0.377163	0.11466	.	.	ENSG00000116062	ENST00000234420;ENST00000543270;ENST00000540021;ENST00000538136	D;D;D	0.84516	-1.86;-1.86;-1.86	4.81	3.86	0.44501	DNA mismatch repair protein MutS, C-terminal (2);	0.265617	0.42548	D	0.000682	T	0.62454	0.2429	N	0.03177	-0.4	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.60332	-0.7284	10	0.05436	T	0.98	-12.0813	10.4484	0.44507	0.3885:0.6115:0.0:0.0	.	1076;1206	B4DF41;P52701	.;MSH6_HUMAN	E	1206;172;1076;904	ENSP00000234420:A1206E;ENSP00000446475:A1076E;ENSP00000438580:A904E	ENSP00000234420:A1206E	A	+	2	0	MSH6	47886321	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.539000	0.45718	2.506000	0.84524	0.462000	0.41574	GCA		0.294	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4		NM_000179	
MPHOSPH10	10199	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	71368393	71368393	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:71368393C>G	ENST00000244230.2	+	7	1692	c.1340C>G	c.(1339-1341)cCt>cGt	p.P447R		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	447					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						AAAGAAAAACCTAAAGAGGAT	0.338																																																	0													145.0	156.0	152.0					2																	71368393		2203	4300	6503	SO:0001583	missense	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1340C>G	2.37:g.71368393C>G	ENSP00000244230:p.Pro447Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415852	0.83449	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.10573	2.86;2.86	5.52	5.52	0.82312	.	0.106900	0.64402	D	0.000004	T	0.40839	0.1133	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.38520	-0.9657	10	0.20046	T	0.44	.	17.3088	0.87202	0.0:1.0:0.0:0.0	.	447	O00566	MPP10_HUMAN	R	447;307	ENSP00000244230:P447R;ENSP00000393034:P307R	ENSP00000244230:P447R	P	+	2	0	MPHOSPH10	71221901	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.021000	0.76425	2.769000	0.95229	0.491000	0.48974	CCT		0.338	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2		NM_005791	
MUC2	4583	hgsc.bcm.edu	37	11	1093286	1093286	+	Missense_Mutation	SNP	C	C	G	rs201333212		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr11:1093286C>G	ENST00000441003.2	+	30	5132	c.5105C>G	c.(5104-5106)aCc>aGc	p.T1702S	MUC2_ENST00000359061.5_Missense_Mutation_p.T1669S|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1669S(1)|p.T1702S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acacccatcaccaccaccact	0.632																																																	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)											116.0	161.0	145.0					11																	1093286		1870	3438	5308	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5105C>G	11.37:g.1093286C>G	ENSP00000415183:p.Thr1702Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	1.291	-0.607547	0.03717	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.12361	2.84;2.69	1.6	-3.2	0.05156	.	194.215000	0.04190	U	0.328173	T	0.04998	0.0134	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28202	-1.0051	9	0.10111	T	0.7	.	0.5419	0.00647	0.3852:0.249:0.1961:0.1696	.	1702	E7EUV1	.	S	1702;1669	ENSP00000415183:T1702S;ENSP00000351956:T1669S	ENSP00000351956:T1669S	T	+	2	0	MUC2	1083286	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.007000	0.03667	-1.356000	0.02183	0.184000	0.17185	ACC		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
NIT2	56954	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	100058770	100058770	+	Missense_Mutation	SNP	C	C	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr3:100058770C>G	ENST00000394140.4	+	3	329	c.238C>G	c.(238-240)Ctc>Gtc	p.L80V		NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	80	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						CAGCATATATCTCATTGGAGG	0.418																																																	0													76.0	73.0	74.0					3																	100058770		2203	4300	6503	SO:0001583	missense	56954			AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.238C>G	3.37:g.100058770C>G	ENSP00000377696:p.Leu80Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9A3|D3DN47|Q8WUF0	Missense_Mutation	SNP	ENST00000394140.4	37	CCDS33806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.90|13.90	2.374934|2.374934	0.42105|0.42105	.|.	.|.	ENSG00000114021|ENSG00000114021	ENST00000394140|ENST00000497785	D|.	0.86030|.	-2.06|.	5.24|5.24	4.36|4.36	0.52297|0.52297	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);|.	0.197014|.	0.43747|.	N|.	0.000525|.	T|T	0.61974|0.61974	0.2390|0.2390	L|L	0.46670|0.46670	1.46|1.46	0.48901|0.48901	D|D	0.999727|0.999727	P;B|.	0.39717|.	0.684;0.003|.	B;B|.	0.35550|.	0.205;0.019|.	T|T	0.59700|0.59700	-0.7405|-0.7405	10|5	0.45353|.	T|.	0.12|.	-14.0103|-14.0103	15.8251|15.8251	0.78698|0.78698	0.0:0.8547:0.1453:0.0|0.0:0.8547:0.1453:0.0	.|.	80;80|.	B7Z3F9;Q9NQR4|.	.;NIT2_HUMAN|.	V|C	80|173	ENSP00000377696:L80V|.	ENSP00000377696:L80V|.	L|S	+|+	1|2	0|0	NIT2|NIT2	101541460|101541460	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.622000|3.622000	0.54217|0.54217	1.337000|1.337000	0.45525|0.45525	0.655000|0.655000	0.94253|0.94253	CTC|TCT		0.418	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353142.2		NM_020202	
NRBP1	29959	broad.mit.edu;ucsc.edu	37	2	27663340	27663340	+	Silent	SNP	C	C	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:27663340C>A	ENST00000233557.3	+	13	1939	c.1107C>A	c.(1105-1107)atC>atA	p.I369I	NRBP1_ENST00000379852.3_Silent_p.I369I|KRTCAP3_ENST00000288873.3_5'Flank|KRTCAP3_ENST00000407293.1_5'Flank|NRBP1_ENST00000379863.3_Silent_p.I377I|KRTCAP3_ENST00000543753.1_5'Flank			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	369					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					TGGCTGAAATCCCTGCAGGAC	0.493																																																	0													101.0	98.0	99.0					2																	27663340		2203	4300	6503	SO:0001819	synonymous_variant	29959			AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1107C>A	2.37:g.27663340C>A		Somatic		WXS	Illumina GAIIx	Phase_I	B3KV40|D6W558|Q53FZ5|Q96SU3	Silent	SNP	ENST00000233557.3	37	CCDS1753.1																																																																																				0.493	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1		NM_013392	
NUMA1	4926	hgsc.bcm.edu	37	11	71746964	71746965	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr11:71746964_71746965insC	ENST00000393695.3	-	3	356_357	c.25_26insG	c.(25-27)gctfs	p.A9fs	NUMA1_ENST00000358965.6_Frame_Shift_Ins_p.A9fs|NUMA1_ENST00000351960.6_Frame_Shift_Ins_p.A9fs	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						GAGGAGTGCAGCCCCCCGGGTG	0.505			T	RARA	APL																																			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0																																										SO:0001589	frameshift_variant	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.26dupG	11.37:g.71746970_71746970dupC	ENSP00000377298:p.Ala9fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000393695.3	37	CCDS31633.1																																																																																				0.505	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			
NUP210L	91181	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	154027277	154027278	+	Missense_Mutation	DNP	TT	TT	GA			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:154027277_154027278TT>GA	ENST00000368559.3	-	24	3342_3343	c.3271_3272AA>TC	c.(3271-3273)AAa>TCa	p.K1091S	NUP210L_ENST00000271854.3_Missense_Mutation_p.K1091S|NUP210L_ENST00000368553.1_Missense_Mutation_p.K24S	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1091					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.K1091R(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CAGTGTCATTTTCTCTGGAAGA	0.366																																																	1	Substitution - Missense(1)	lung(1)																																								SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3271_3272delinsGA	1.37:g.154027277_154027278delinsGA	ENSP00000357547:p.Lys1091Ser	Somatic		WXS	Illumina HiSeq	Phase_I	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1																																																																																				0.366	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3		NM_207308	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52610585	52610585	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr3:52610585delT	ENST00000296302.7	-	22	3664	c.3663delA	c.(3661-3663)gaafs	p.E1222fs	PBRM1_ENST00000394830.3_Frame_Shift_Del_p.E1197fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.E1222fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.E1190fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.E1222fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.E1197fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.E1237fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.E1237fs|SMIM4_ENST00000476842.1_Intron			Q86U86	PB1_HUMAN	polybromo 1	1222	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGCAGGTTTCTTCCAGATTAC	0.378			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													136.0	131.0	133.0					3																	52610585		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3663delA	3.37:g.52610585delT	ENSP00000296302:p.Glu1222fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.378	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PCNT	5116	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	47769001	47769001	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr21:47769001C>A	ENST00000359568.5	+	7	1215	c.1108C>A	c.(1108-1110)Caa>Aaa	p.Q370K	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	370	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGCAAAGCATCAATCAGAAAT	0.343																																																	0													111.0	122.0	118.0					21																	47769001		2203	4300	6503	SO:0001583	missense	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1108C>A	21.37:g.47769001C>A	ENSP00000352572:p.Gln370Lys	Somatic		WXS	Illumina HiSeq	Phase_I	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	3.970	-0.008617	0.07727	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.27256	1.68	5.79	5.79	0.91817	.	0.293184	0.18621	N	0.135848	T	0.15305	0.0369	N	0.17082	0.46	0.22156	N	0.999321	P;P	0.41673	0.759;0.647	B;B	0.38755	0.281;0.146	T	0.13548	-1.0505	10	0.08837	T	0.75	.	13.8757	0.63651	0.1517:0.8483:0.0:0.0	.	252;370	O95613-2;O95613	.;PCNT_HUMAN	K	370;357	ENSP00000352572:Q370K	ENSP00000338675:Q357K	Q	+	1	0	PCNT	46593429	0.854000	0.29725	0.493000	0.27502	0.129000	0.20672	1.638000	0.37165	2.746000	0.94184	0.638000	0.83543	CAA		0.343	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1		NM_006031	
PPAPDC2	403313	hgsc.bcm.edu	37	9	4662602	4662603	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr9:4662602_4662603insG	ENST00000381883.2	+	1	305_306	c.227_228insG	c.(226-231)gcgggcfs	p.AG76fs	SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000475086.1_Intron|SPATA6L_ENST00000454239.2_Intron|SPATA6L_ENST00000223517.5_Intron|SPATA6L_ENST00000381895.5_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	76						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		CTGGCCGCGGCGGGCCCCTCGC	0.752											OREG0019084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(187;1057 3809 8526)												0																																										SO:0001589	frameshift_variant	403313			AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.230dupG	9.37:g.4662605_4662605dupG	ENSP00000371307:p.Ala76fs	Somatic	620	WXS	Illumina HiSeq	Phase_I	B3KY05|Q5JVJ6|Q8NCK9	Frame_Shift_Ins	INS	ENST00000381883.2	37	CCDS34981.1																																																																																				0.752	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051567.1		NM_203453	
PPP1R13B	23368	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	104208221	104208222	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr14:104208221_104208222insG	ENST00000202556.9	-	11	2009_2010	c.1727_1728insC	c.(1726-1728)tcafs	p.S576fs	PPP1R13B_ENST00000423488.2_5'UTR|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	576	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				ATATGGAACTTGAATTCACTGT	0.51																																																	0																																										SO:0001589	frameshift_variant	23368			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.1728dupC	14.37:g.104208222_104208222dupG	ENSP00000202556:p.Ser576fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMX5|O94870	Frame_Shift_Ins	INS	ENST00000202556.9	37	CCDS41997.1																																																																																				0.510	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1		NM_015316	
PRIM2	5558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	57185310	57185310	+	Silent	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr6:57185310C>T	ENST00000607273.1	+	3	297	c.210C>T	c.(208-210)taC>taT	p.Y70Y	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	70					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTGAACAATACCAGAGTAAGT	0.308																																																	0													58.0	58.0	58.0					6																	57185310		1815	4076	5891	SO:0001819	synonymous_variant	5558				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.210C>T	6.37:g.57185310C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Silent	SNP	ENST00000607273.1	37																																																																																					0.308	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_000947	
RAPH1	65059	broad.mit.edu;hgsc.bcm.edu	37	2	204356027	204356027	+	Missense_Mutation	SNP	T	T	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:204356027T>G	ENST00000319170.5	-	3	435	c.136A>C	c.(136-138)Aag>Cag	p.K46Q	RAPH1_ENST00000374493.3_Missense_Mutation_p.K46Q|RAPH1_ENST00000419464.1_Missense_Mutation_p.K46Q|RAPH1_ENST00000418114.1_Missense_Mutation_p.K46Q|RAPH1_ENST00000457812.1_Missense_Mutation_p.K46Q|RAPH1_ENST00000453034.1_Missense_Mutation_p.K46Q|RAPH1_ENST00000423104.1_Missense_Mutation_p.K46Q|RAPH1_ENST00000374488.2_Missense_Mutation_p.K46Q|RAPH1_ENST00000374489.2_Missense_Mutation_p.K46Q|RAPH1_ENST00000308091.4_Missense_Mutation_p.K46Q|RAPH1_ENST00000439222.1_Missense_Mutation_p.K46Q	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	46					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCCATGGGCTTGTCAGAATCC	0.318																																																	0													105.0	106.0	105.0					2																	204356027		2203	4300	6503	SO:0001583	missense	65059			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.136A>C	2.37:g.204356027T>G	ENSP00000316543:p.Lys46Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.084160	0.36758	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201;ENST00000428637;ENST00000420371	T;T;T;T;T;T;T;T;T;T;T	0.47528	0.87;0.87;0.84;0.85;0.85;0.84;0.85;0.87;0.85;0.85;0.87	5.69	5.69	0.88448	.	0.115312	0.39210	N	0.001430	T	0.47097	0.1427	L	0.44542	1.39	0.39798	D	0.972534	P;P;D	0.56521	0.9;0.608;0.976	B;B;P	0.47015	0.39;0.205;0.534	T	0.44298	-0.9337	10	0.31617	T	0.26	-13.4892	15.9414	0.79756	0.0:0.0:0.0:1.0	.	46;46;46	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	Q	46	ENSP00000392854:K46Q;ENSP00000316543:K46Q;ENSP00000363617:K46Q;ENSP00000363613:K46Q;ENSP00000363612:K46Q;ENSP00000311293:K46Q;ENSP00000411138:K46Q;ENSP00000390578:K46Q;ENSP00000397751:K46Q;ENSP00000406662:K46Q;ENSP00000396711:K46Q	ENSP00000311293:K46Q	K	-	1	0	RAPH1	204064272	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	5.585000	0.67497	2.171000	0.68590	0.528000	0.53228	AAG		0.318	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2		NM_025252	
RPS3A	6189	broad.mit.edu;hgsc.bcm.edu	37	4	152022142	152022142	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr4:152022142G>A	ENST00000274065.4	+	3	262	c.182G>A	c.(181-183)gGt>gAt	p.G61D	RPS3A_ENST00000506126.1_Missense_Mutation_p.G24D|RPS3A_ENST00000509736.1_Intron|SNORD73A_ENST00000386062.1_RNA|RPS3A_ENST00000514682.1_Missense_Mutation_p.G24D|RPS3A_ENST00000512690.1_Missense_Mutation_p.G61D|SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000322686.6_Missense_Mutation_p.G48D	NM_001006.4	NP_000997.1			ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					GCATCTGATGGTCTCAAGGGT	0.348																																																	0													43.0	43.0	43.0					4																	152022142		2100	4251	6351	SO:0001583	missense	6189			X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000274065.4:c.182G>A	4.37:g.152022142G>A	ENSP00000346050:p.Gly61Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000274065.4	37	CCDS3775.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999515	0.74818	.	.	ENSG00000145425	ENST00000274065;ENST00000505243;ENST00000514682;ENST00000322686;ENST00000503002;ENST00000508783;ENST00000507327;ENST00000515792;ENST00000506126;ENST00000510993	.	.	.	5.54	5.54	0.83059	.	0.000000	0.34067	N	0.004285	D	0.85583	0.5730	H	0.94582	3.555	0.80722	D	1	P	0.36712	0.566	P	0.46850	0.529	D	0.88096	0.2816	9	0.72032	D	0.01	.	19.538	0.95262	0.0:0.0:1.0:0.0	.	61	P61247	RS3A_HUMAN	D	61;24;24;48;24;24;24;55;24;41	.	ENSP00000346050:G61D	G	+	2	0	RPS3A	152241592	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.811000	0.99226	2.614000	0.88457	0.555000	0.69702	GGT		0.348	RPS3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364957.1			
SDR16C5	195814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	57219234	57219234	+	Splice_Site	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr8:57219234C>T	ENST00000303749.3	-	5	1348		c.e5+1		SDR16C5_ENST00000522671.1_Splice_Site|SDR16C5_ENST00000396721.2_Splice_Site	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5						detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						GACATACTTACCCTGTAGTAC	0.289																																																	0													65.0	66.0	65.0					8																	57219234		2203	4300	6503	SO:0001630	splice_region_variant	195814				CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.710+1G>A	8.37:g.57219234C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DGK2|Q330K3|Q8TDV9|Q96LX1	Splice_Site	SNP	ENST00000303749.3	37	CCDS6167.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432018	0.62844	.	.	ENSG00000170786	ENST00000396721;ENST00000303749;ENST00000522671	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.492	0.95054	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SDR16C5	57381788	1.000000	0.71417	0.952000	0.39060	0.530000	0.34684	7.671000	0.83941	2.614000	0.88457	0.650000	0.86243	.		0.289	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378235.1		NM_138969	Intron
SFXN5	94097	hgsc.bcm.edu	37	2	73188297	73188298	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr2:73188297_73188298insG	ENST00000272433.2	-	13	1037_1038	c.907_908insC	c.(907-909)ctgfs	p.L303fs	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Frame_Shift_Ins_p.C236fs	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	303					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						GGCCAGCGGCAGGGCCAGGCCG	0.658																																																	0																																										SO:0001589	frameshift_variant	94097			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.908dupC	2.37:g.73188300_73188300dupG	ENSP00000272433:p.Leu303fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K116|Q494Y3|Q53T29	Frame_Shift_Ins	INS	ENST00000272433.2	37	CCDS1922.1																																																																																				0.658	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1		NM_144579	
SGCE	8910	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	94257637	94257637	+	Silent	SNP	T	T	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr7:94257637T>A	ENST00000265735.7	-	3	377	c.267A>T	c.(265-267)acA>acT	p.T89T	SGCE_ENST00000447873.1_Silent_p.T89T|SGCE_ENST00000445866.2_Silent_p.T89T|SGCE_ENST00000428696.2_Silent_p.T89T|SGCE_ENST00000415788.2_Silent_p.T125T|SGCE_ENST00000437425.2_Silent_p.T48T	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	89					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CCATTAAATTTGTATTAAATG	0.383																																																	0													73.0	69.0	70.0					7																	94257637		2203	4299	6502	SO:0001819	synonymous_variant	8910			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.267A>T	7.37:g.94257637T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Silent	SNP	ENST00000265735.7	37	CCDS5637.1																																																																																				0.383	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2			
SGIP1	84251	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	67101650	67101650	+	Silent	SNP	C	C	T	rs534433911		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:67101650C>T	ENST00000371037.4	+	4	200	c.123C>T	c.(121-123)ccC>ccT	p.P41P	SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000468286.1_Intron|SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000237247.6_Intron|SGIP1_ENST00000371039.1_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	41					endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						ACGAACCACCCTACAATAGCA	0.373																																																	0													99.0	100.0	99.0					1																	67101650		2203	4300	6503	SO:0001819	synonymous_variant	84251			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.123C>T	1.37:g.67101650C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Silent	SNP	ENST00000371037.4	37	CCDS30744.1																																																																																				0.373	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4		NM_032291	
SMARCA4	6597	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	11098575	11098575	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr19:11098575G>C	ENST00000429416.3	+	7	1374	c.1093G>C	c.(1093-1095)Gag>Cag	p.E365Q	SMARCA4_ENST00000413806.3_Missense_Mutation_p.E365Q|SMARCA4_ENST00000444061.3_Missense_Mutation_p.E365Q|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E365Q|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E365Q|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E365Q|SMARCA4_ENST00000344626.4_Missense_Mutation_p.E365Q|SMARCA4_ENST00000590574.1_Missense_Mutation_p.E365Q|SMARCA4_ENST00000541122.2_Missense_Mutation_p.E365Q	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	365					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CGACCCTGTGGAGATCCTGCA	0.692			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											21.0	27.0	25.0					19																	11098575		2164	4179	6343	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1093G>C	19.37:g.11098575G>C	ENSP00000395654:p.Glu365Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517790	0.44763	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.16;-2.17;-2.17	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.81758	0.4890	N	0.26092	0.79	0.51233	D	0.999913	P;P;P;P;P;P;P	0.42827	0.791;0.791;0.791;0.683;0.791;0.791;0.791	B;B;B;B;B;B;B	0.42916	0.373;0.373;0.373;0.402;0.299;0.373;0.373	T	0.81353	-0.0971	10	0.31617	T	0.26	-42.9749	16.1384	0.81506	0.0:0.0:1.0:0.0	.	365;365;365;365;365;365;365	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	Q	365	ENSP00000395654:E365Q;ENSP00000350720:E365Q;ENSP00000343896:E365Q;ENSP00000445036:E365Q;ENSP00000392837:E365Q;ENSP00000397783:E365Q;ENSP00000414727:E365Q	ENSP00000343896:E365Q	E	+	1	0	SMARCA4	10959575	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.417000	0.97391	2.335000	0.79485	0.655000	0.94253	GAG		0.692	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2		NM_003072	
TACC2	10579	hgsc.bcm.edu;ucsc.edu	37	10	123844479	123844479	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr10:123844479delC	ENST00000369005.1	+	4	2804	c.2464delC	c.(2464-2466)cccfs	p.P822fs	TACC2_ENST00000334433.3_Frame_Shift_Del_p.P822fs|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Frame_Shift_Del_p.P822fs|TACC2_ENST00000515603.1_Frame_Shift_Del_p.P822fs|TACC2_ENST00000515273.1_Frame_Shift_Del_p.P822fs	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	822					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ATCCGAGTGGCCCCTACTATC	0.577																																																	0													103.0	103.0	103.0					10																	123844479		2203	4300	6503	SO:0001589	frameshift_variant	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2464delC	10.37:g.123844479delC	ENSP00000358001:p.Pro822fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Frame_Shift_Del	DEL	ENST00000369005.1	37	CCDS7626.1																																																																																				0.577	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			
TMEM187	8269	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	153247610	153247610	+	Missense_Mutation	SNP	G	G	T	rs139864308	byFrequency	TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chrX:153247610G>T	ENST00000369982.4	+	2	844	c.97G>T	c.(97-99)Gtg>Ttg	p.V33L	MIR3202-1_ENST00000580198.1_RNA	NM_003492.2	NP_003483.1	Q14656	TM187_HUMAN	transmembrane protein 187	33						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|large_intestine(1)|lung(1)|prostate(2)	5	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGTGTTTCCGTGCAAGTGGG	0.637													G||||G|||	1|1	0.000264901|0.000264901	0.0|0.0	0.0014|0.0014	3775|3775	,|,	,|,		13383|13383	0.0|0.0		0.0|0.0	False|False		,,,|,,,				2504|2504	0.0|0.0																0													60.0	61.0	61.0					X																	153247610		2203	4300	6503	SO:0001583	missense	8269			X92475	CCDS14739.1	Xq28	2007-03-14	2007-03-14	2007-03-14	ENSG00000177854	ENSG00000177854			13705	protein-coding gene	gene with protein product		300059	"""chromosome X open reading frame 12"""	CXorf12		8661027	Standard	NM_003492		Approved	ITBA1, DXS9878E	uc004fjq.2	Q14656	OTTHUMG00000024220	ENST00000369982.4:c.97G>T	X.37:g.153247610G>T	ENSP00000358999:p.Val33Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC47|Q6IAV7	Missense_Mutation	SNP	ENST00000369982.4	37	CCDS14739.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	13.80	2.346349	0.41599	.	.	ENSG00000177854	ENST00000369982;ENST00000425274;ENST00000431598	T;T	0.32272	1.46;1.46	4.27	-0.957	0.10350	.	0.962934	0.08356	U	0.958427	T	0.32041	0.0816	M	0.76002	2.32	0.09310	N	1	P	0.37141	0.584	B	0.34180	0.177	T	0.31558	-0.9939	10	0.56958	D	0.05	.	9.3406	0.38079	0.7024:0.0:0.2976:0.0	.	33	Q14656	TM187_HUMAN	L	33	ENSP00000358999:V33L;ENSP00000390108:V33L	ENSP00000358999:V33L	V	+	1	0	TMEM187	152900804	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.290000	0.18975	-0.129000	0.11620	0.436000	0.28706	GTG		0.637	TMEM187-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061093.1		NM_003492	
TSC2	7249	broad.mit.edu;hgsc.bcm.edu	37	16	2132493	2132493	+	Missense_Mutation	SNP	G	G	A	rs201135184		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr16:2132493G>A	ENST00000219476.3	+	32	4501	c.3871G>A	c.(3871-3873)Gtt>Att	p.V1291I	TSC2_ENST00000568454.1_Intron|TSC2_ENST00000401874.2_Intron|TSC2_ENST00000350773.4_Intron|TSC2_ENST00000382538.6_Intron|TSC2_ENST00000439673.2_Intron|TSC2_ENST00000353929.4_Missense_Mutation_p.V1248I	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1291					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GCACAGGAGCGTTTCCTGGGC	0.647			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		19886	0.0		0.001	False		,,,				2504	0.0						yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													99.0	88.0	92.0					16																	2132493		2198	4298	6496	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.3871G>A	16.37:g.2132493G>A	ENSP00000219476:p.Val1291Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	1.861	-0.462674	0.04508	.	.	ENSG00000103197	ENST00000219476;ENST00000353929	D;D	0.87571	-2.27;-2.18	4.25	-1.49	0.08718	.	0.582077	0.16292	N	0.220854	T	0.63379	0.2506	N	0.01576	-0.805	0.23628	N	0.997252	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.54761	-0.8245	10	0.18710	T	0.47	-1.518	10.0827	0.42399	0.524:0.0:0.476:0.0	.	1247;1291	P49815-3;P49815	.;TSC2_HUMAN	I	1291;1248	ENSP00000219476:V1291I;ENSP00000248099:V1248I	ENSP00000219476:V1291I	V	+	1	0	TSC2	2072494	1.000000	0.71417	0.997000	0.53966	0.878000	0.50629	0.977000	0.29475	-0.241000	0.09681	-0.459000	0.05422	GTT		0.647	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2		NM_000548	
TTC12	54970	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	113194723	113194723	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr11:113194723A>C	ENST00000529221.1	+	4	335	c.230A>C	c.(229-231)gAa>gCa	p.E77A	TTC12_ENST00000483239.2_Missense_Mutation_p.E77A|TTC12_ENST00000314756.3_Missense_Mutation_p.E77A|TTC12_ENST00000393020.1_Missense_Mutation_p.E77A	NM_017868.3	NP_060338.3	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	77										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		CAGAGTGCAGAAGAAATAAAC	0.323																																																	0													147.0	138.0	141.0					11																	113194723		2201	4296	6497	SO:0001583	missense	54970			AK000542	CCDS8360.2	11q23.2	2013-01-10			ENSG00000149292	ENSG00000149292		"""Tetratricopeptide (TTC) repeat domain containing"""	23700	protein-coding gene	gene with protein product		610732				12964006	Standard	XM_005271607		Approved	FLJ13859, FLJ20535, TPARM	uc001pnu.3	Q9H892	OTTHUMG00000142832	ENST00000529221.1:c.230A>C	11.37:g.113194723A>C	ENSP00000433757:p.Glu77Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N5H9|Q9NWY3	Missense_Mutation	SNP	ENST00000529221.1	37	CCDS8360.2	.	.	.	.	.	.	.	.	.	.	A	1.152	-0.646492	0.03531	.	.	ENSG00000149292	ENST00000529221;ENST00000429951;ENST00000442859;ENST00000531164;ENST00000529850;ENST00000314756;ENST00000525965;ENST00000393020;ENST00000455306;ENST00000483239	T;T;T;T;T;T;T;T;T;T	0.46063	2.45;0.88;1.46;1.44;0.91;2.43;0.88;2.43;1.48;2.47	5.35	3.05	0.35203	Armadillo-type fold (1);	43.508400	0.00166	N	0.000000	T	0.27205	0.0667	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.013;0.013	B;B	0.14023	0.01;0.01	T	0.18871	-1.0323	10	0.37606	T	0.19	-1.6057	6.8622	0.24074	0.8207:0.0:0.1793:0.0	.	77;77	A8K8G6;Q9H892	.;TTC12_HUMAN	A	77;77;77;52;77;77;77;77;77;77	ENSP00000433757:E77A;ENSP00000413335:E77A;ENSP00000400039:E77A;ENSP00000433916:E52A;ENSP00000431806:E77A;ENSP00000315160:E77A;ENSP00000435308:E77A;ENSP00000376743:E77A;ENSP00000402004:E77A;ENSP00000419652:E77A	ENSP00000315160:E77A	E	+	2	0	TTC12	112699933	0.964000	0.33143	0.004000	0.12327	0.066000	0.16364	2.004000	0.40854	0.577000	0.29470	0.533000	0.62120	GAA		0.323	TTC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286455.2		NM_017868	
VPS41	27072	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	38816289	38816289	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr7:38816289G>A	ENST00000310301.4	-	11	926	c.872C>T	c.(871-873)tCa>tTa	p.S291L	VPS41_ENST00000466017.1_5'UTR|VPS41_ENST00000395969.2_Missense_Mutation_p.S266L	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	291					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CGTTTTTTCTGAAATCTCCTT	0.403																																																	0													84.0	75.0	78.0					7																	38816289		2203	4300	6503	SO:0001583	missense	27072			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.872C>T	7.37:g.38816289G>A	ENSP00000309457:p.Ser291Leu	Somatic		WXS	Illumina HiSeq	Phase_I	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.350936	0.61183	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.52526	0.66;0.66	6.06	5.17	0.71159	.	0.371341	0.31415	N	0.007690	T	0.38852	0.1056	L	0.42529	1.33	0.45979	D	0.998791	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.14392	-1.0474	10	0.37606	T	0.19	-5.7921	10.9195	0.47156	0.1387:0.0:0.8613:0.0	.	291;266;291	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	L	291;266	ENSP00000309457:S291L;ENSP00000379297:S266L	ENSP00000309457:S291L	S	-	2	0	VPS41	38782814	1.000000	0.71417	0.986000	0.45419	0.988000	0.76386	4.508000	0.60441	2.882000	0.98803	0.655000	0.94253	TCA		0.403	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3			
YME1L1	10730	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	27431334	27431334	+	Missense_Mutation	SNP	C	C	G	rs143591480		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr10:27431334C>G	ENST00000326799.3	-	5	731	c.583G>C	c.(583-585)Gat>Cat	p.D195H	YME1L1_ENST00000376016.3_Missense_Mutation_p.D138H|YME1L1_ENST00000375972.3_Intron	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	195					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TACTGAAGATCTGAACAAATG	0.318																																																	0								C	HIS/ASP,HIS/ASP	1,4405	2.1+/-5.4	0,1,2202	152.0	165.0	161.0		412,583	2.3	1.0	10	dbSNP_134	161	0,8600		0,0,4300	no	missense,missense	YME1L1	NM_014263.2,NM_139312.1	81,81	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	138/717,195/774	27431334	1,13005	2203	4300	6503	SO:0001583	missense	10730			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.583G>C	10.37:g.27431334C>G	ENSP00000318480:p.Asp195His	Somatic		WXS	Illumina HiSeq	Phase_I	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.570893	0.65765	2.27E-4	0.0	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000396296	D;D	0.92699	-3.08;-3.09	5.39	2.31	0.28768	Peptidase M41, FtsH (1);	0.338410	0.34200	N	0.004161	D	0.89420	0.6710	L	0.27053	0.805	0.80722	D	1	P;B	0.44946	0.846;0.023	P;B	0.48141	0.568;0.013	D	0.89418	0.3708	10	0.72032	D	0.01	-9.791	15.5069	0.75748	0.0:0.6089:0.3911:0.0	.	138;195	Q96TA2-2;Q96TA2	.;YMEL1_HUMAN	H	138;195;195;130	ENSP00000365184:D138H;ENSP00000318480:D195H	ENSP00000318480:D195H	D	-	1	0	YME1L1	27471340	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.556000	0.45862	0.599000	0.29845	0.591000	0.81541	GAT		0.318	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1		NM_139312	
ZBTB26	57684	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	125681478	125681478	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr9:125681478C>A	ENST00000373656.3	-	2	809	c.736G>T	c.(736-738)Ggc>Tgc	p.G246C	ZBTB26_ENST00000373654.1_Missense_Mutation_p.G246C	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						TTATCACTGCCTGTATAAGAA	0.433																																																	0													168.0	142.0	150.0					9																	125681478		2203	4300	6503	SO:0001583	missense	57684			AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.736G>T	9.37:g.125681478C>A	ENSP00000362760:p.Gly246Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQ53|Q8WTR1	Missense_Mutation	SNP	ENST00000373656.3	37	CCDS6847.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752078	0.31046	.	.	ENSG00000171448	ENST00000373656;ENST00000373654	T;T	0.11169	2.8;2.8	5.52	5.52	0.82312	.	0.197468	0.43416	D	0.000574	T	0.11750	0.0286	L	0.42245	1.32	0.48696	D	0.999695	D	0.65815	0.995	B	0.43103	0.408	T	0.02138	-1.1207	10	0.41790	T	0.15	.	12.7596	0.57356	0.0:0.9255:0.0:0.0744	.	246	Q9HCK0	ZBT26_HUMAN	C	246	ENSP00000362760:G246C;ENSP00000362758:G246C	ENSP00000362758:G246C	G	-	1	0	ZBTB26	124721299	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.150000	0.42254	2.595000	0.87683	0.655000	0.94253	GGC		0.433	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053960.1		NM_020924	
ZCCHC2	54877	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	60241796	60241796	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr18:60241796A>G	ENST00000269499.5	+	13	2900	c.2482A>G	c.(2482-2484)Aca>Gca	p.T828A	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.T507A	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	828						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TGAGAGCTGCACAGTTAACAT	0.498																																																	0													121.0	124.0	123.0					18																	60241796		2107	4236	6343	SO:0001583	missense	54877			AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2482A>G	18.37:g.60241796A>G	ENSP00000269499:p.Thr828Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.325639	0.24080	.	.	ENSG00000141664	ENST00000269499	T	0.25414	1.8	5.69	-4.88	0.03113	.	0.677026	0.14950	N	0.288970	T	0.09949	0.0244	N	0.14661	0.345	0.22541	N	0.999008	B	0.06786	0.001	B	0.04013	0.001	T	0.36866	-0.9730	10	0.13108	T	0.6	-0.944	7.7811	0.29066	0.334:0.4214:0.2445:0.0	.	828	Q9C0B9	ZCHC2_HUMAN	A	828	ENSP00000269499:T828A	ENSP00000269499:T828A	T	+	1	0	ZCCHC2	58392776	0.289000	0.24334	0.222000	0.23844	0.984000	0.73092	0.186000	0.16978	-0.420000	0.07427	0.533000	0.62120	ACA		0.498	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1		NM_017742	
ZNF467	168544	hgsc.bcm.edu	37	7	149462196	149462196	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr7:149462196G>C	ENST00000302017.3	-	5	1808	c.1395C>G	c.(1393-1395)gaC>gaG	p.D465E	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGAAGCGGCGGTCACACTGCG	0.741																																																	0													2.0	3.0	3.0					7																	149462196		1523	3227	4750	SO:0001583	missense	168544			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1395C>G	7.37:g.149462196G>C	ENSP00000304769:p.Asp465Glu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000302017.3	37	CCDS5899.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.641050	0.47153	.	.	ENSG00000181444	ENST00000302017	T	0.60797	0.16	3.9	1.95	0.26073	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.243106	0.21090	U	0.080331	T	0.37320	0.0999	N	0.17838	0.53	0.23496	N	0.997553	B	0.02656	0.0	B	0.11329	0.006	T	0.23084	-1.0198	10	0.45353	T	0.12	-15.1087	6.7112	0.23278	0.0971:0.0:0.7302:0.1727	.	465	Q7Z7K2	ZN467_HUMAN	E	465	ENSP00000304769:D465E	ENSP00000304769:D465E	D	-	3	2	ZNF467	149093129	0.000000	0.05858	1.000000	0.80357	0.918000	0.54935	-1.014000	0.03641	0.831000	0.34780	0.462000	0.41574	GAC		0.741	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1		NM_207336	
ZNF615	284370	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52496685	52496685	+	Silent	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr19:52496685G>A	ENST00000602063.1	-	6	1993	c.1644C>T	c.(1642-1644)ggC>ggT	p.G548G	ZNF615_ENST00000391795.3_Silent_p.G553G|ZNF615_ENST00000594083.1_Silent_p.G559G|ZNF615_ENST00000598071.1_Silent_p.G559G|ZNF615_ENST00000376716.5_Silent_p.G548G			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	548					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TCTCAGTGAAGCCTTTTCCAC	0.448																																																	0													118.0	103.0	108.0					19																	52496685		2203	4300	6503	SO:0001819	synonymous_variant	284370			AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1644C>T	19.37:g.52496685G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	37	CCDS12846.1																																																																																				0.448	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1		NM_198480	
ZNF616	90317	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52618981	52618981	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr19:52618981C>T	ENST00000600228.1	-	4	1697	c.1436G>A	c.(1435-1437)cGa>cAa	p.R479Q	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		AGCTGCAAGTCGTGAATGTAT	0.418																																																	0													112.0	102.0	106.0					19																	52618981		2203	4300	6503	SO:0001583	missense	90317			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1436G>A	19.37:g.52618981C>T	ENSP00000471000:p.Arg479Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	37	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	C	7.547	0.661978	0.14645	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.08	-2.15	0.07102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08891	0.0220	N	0.02357	-0.585	0.09310	N	1	B	0.17667	0.023	B	0.08055	0.003	T	0.19516	-1.0303	8	0.15066	T	0.55	.	2.6705	0.05066	0.3388:0.2533:0.0:0.4078	.	479	Q08AN1	ZN616_HUMAN	Q	479	.	ENSP00000328722:R479Q	R	-	2	0	ZNF616	57310793	0.000000	0.05858	0.000000	0.03702	0.225000	0.24961	-3.457000	0.00464	-2.120000	0.00826	0.305000	0.20034	CGA		0.418	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1		XM_030892	
ZNF551	90233	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	58198816	58198816	+	Silent	SNP	T	T	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr19:58198816T>C	ENST00000282296.5	+	3	1358	c.1173T>C	c.(1171-1173)taT>taC	p.Y391Y	AC003006.7_ENST00000599221.1_Intron|ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000356715.4_Silent_p.Y375Y			Q7Z340	ZN551_HUMAN	zinc finger protein 551	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AAAGGCCTTATCAGTGCTGTG	0.448																																																	0													86.0	89.0	88.0					19																	58198816		2203	4300	6503	SO:0001819	synonymous_variant	90233			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1173T>C	19.37:g.58198816T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DU22|P17034|Q8N246|Q9BRY1	Silent	SNP	ENST00000282296.5	37	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	T	14.25	2.478146	0.44044	.	.	ENSG00000228006	ENST00000541705	.	.	.	2.75	2.75	0.32379	.	0.309864	0.20416	U	0.092765	T	0.16727	0.0402	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.20009	-1.0288	6	0.10636	T	0.68	.	5.6207	0.17455	0.0:0.1346:0.0:0.8653	.	.	.	.	V	197	.	ENSP00000437781:I197V	I	-	1	0	AC004017.1	62890628	0.000000	0.05858	0.028000	0.17463	0.201000	0.24016	-0.911000	0.04050	1.262000	0.44165	0.459000	0.35465	ATA		0.448	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2		NM_138347	
ZNF654	55279	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	88189697	88189697	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr3:88189697A>G	ENST00000309495.5	+	1	1444	c.1237A>G	c.(1237-1239)Atg>Gtg	p.M413V	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		AGACCAAAAGATGCCTGACAT	0.343																																																	0													70.0	72.0	71.0					3																	88189697		1858	4095	5953	SO:0001583	missense	55279			AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.1237A>G	3.37:g.88189697A>G	ENSP00000312141:p.Met413Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H791|Q9NV14	Missense_Mutation	SNP	ENST00000309495.5	37	CCDS46874.1	.	.	.	.	.	.	.	.	.	.	A	3.262	-0.150941	0.06585	.	.	ENSG00000175105	ENST00000309495	T	0.09073	3.02	5.44	2.91	0.33838	.	.	.	.	.	T	0.07863	0.0197	L	0.44542	1.39	0.26244	N	0.978827	B	0.20887	0.049	B	0.22386	0.039	T	0.42085	-0.9472	9	0.13108	T	0.6	.	9.8667	0.41148	0.7271:0.0:0.0:0.2729	.	413	Q8IZM8	ZN654_HUMAN	V	413	ENSP00000312141:M413V	ENSP00000312141:M413V	M	+	1	0	ZNF654	88272387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.734000	0.47368	0.294000	0.22547	0.482000	0.46254	ATG		0.343	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2		NM_018293	
AKT3	10000	broad.mit.edu	37	1	243859018	243859018	+	Splice_Site	SNP	C	C	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:243859018C>A	ENST00000366539.1	-	3	247	c.47G>T	c.(46-48)gGa>gTa	p.G16V	AKT3_ENST00000263826.5_Splice_Site_p.G16V|AKT3_ENST00000336199.5_Splice_Site_p.G16V|AKT3_ENST00000366540.1_Splice_Site_p.G16V			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	16	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			TATATATTCTCCTACATGAGG	0.348																																																	0													63.0	64.0	64.0					1																	243859018		2202	4298	6500	SO:0001630	splice_region_variant	10000			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.47-1G>T	1.37:g.243859018C>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	ENST00000366539.1	37	CCDS31077.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.731535	0.89390	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826;ENST00000552631	T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03	5.66	5.66	0.87406	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.90875	0.7133	M	0.90019	3.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.91841	0.5483	10	0.87932	D	0	.	20.1041	0.97884	0.0:1.0:0.0:0.0	.	16;16	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	V	16	ENSP00000336943:G16V;ENSP00000355498:G16V;ENSP00000355497:G16V;ENSP00000263826:G16V;ENSP00000447820:G16V	ENSP00000263826:G16V	G	-	2	0	AKT3	241925641	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GGA		0.348	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1		NM_181690	Missense_Mutation
PRRC2A	7916	broad.mit.edu	37	6	31599818	31599818	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr6:31599818A>C	ENST00000376033.2	+	16	3602	c.3368A>C	c.(3367-3369)gAg>gCg	p.E1123A	PRRC2A_ENST00000376007.4_Missense_Mutation_p.E1123A	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1123	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TCAGACAAGGAGGCTCCCACA	0.647																																																	0													44.0	57.0	52.0					6																	31599818		1509	2709	4218	SO:0001583	missense	0			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3368A>C	6.37:g.31599818A>C	ENSP00000365201:p.Glu1123Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845335	0.32606	.	.	ENSG00000204469	ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01998	4.51;4.51	5.29	5.29	0.74685	.	0.000000	0.56097	D	0.000022	T	0.04137	0.0115	L	0.42245	1.32	0.58432	D	0.99999	D	0.76494	0.999	D	0.63793	0.918	T	0.45293	-0.9271	10	0.87932	D	0	-18.0605	14.3437	0.66646	1.0:0.0:0.0:0.0	.	1123	P48634	PRC2A_HUMAN	A	1123;1123;348	ENSP00000365175:E1123A;ENSP00000365201:E1123A	ENSP00000365175:E1123A	E	+	2	0	PRRC2A	31707797	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.582000	0.60957	2.228000	0.72767	0.533000	0.62120	GAG		0.647	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1		NM_080686	
CROCCP2	84809	broad.mit.edu	37	1	16945236	16945239	+	lincRNA	DEL	TTAT	TTAT	-	rs554386388	byFrequency	TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	TTAT	TTAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:16945236_16945239delTTAT	ENST00000412962.1	-	0	2280_2283				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGGCATTACCTTATTTAAAGTTCA	0.377														107	0.0213658	0.0083	0.0346	5008	,	,		85238	0.0		0.0507	False		,,,				2504	0.0215																0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945236_16945239delTTAT		Somatic		WXS	Illumina GAIIx	Phase_I	Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	ENST00000412962.1	37																																																																																					0.377	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000092784.1		NR_026752.1	
GAS8	2622	broad.mit.edu	37	16	90099333	90099333	+	Splice_Site	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr16:90099333G>A	ENST00000268699.4	+	4	617		c.e4+1		GAS8_ENST00000540721.1_Splice_Site|GAS8_ENST00000536122.1_Splice_Site	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		CCTGCGGCTGGTAGGTGTGGC	0.572																																																	0													54.0	48.0	50.0					16																	90099333		2198	4300	6498	SO:0001630	splice_region_variant	2622			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.495+1G>A	16.37:g.90099333G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Splice_Site	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860193	0.71834	.	.	ENSG00000141013	ENST00000536122;ENST00000268699;ENST00000540721;ENST00000537797	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.38	0.94529	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GAS8	88626834	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	7.206000	0.77891	2.689000	0.91719	0.555000	0.69702	.		0.572	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2			Intron
HIST1H2AJ	8331	broad.mit.edu	37	6	27782408	27782408	+	Missense_Mutation	SNP	T	T	G	rs199735306		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr6:27782408T>G	ENST00000333151.3	-	1	199	c.111A>C	c.(109-111)aaA>aaC	p.K37N	HIST1H2BM_ENST00000359465.4_5'Flank	NM_021066.2	NP_066544.1	Q99878	H2A1J_HUMAN	histone cluster 1, H2aj	37						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	11						CATAGTTGCCTTTGCGGAGCA	0.672																																																	0													14.0	18.0	17.0					6																	27782408		2101	4194	6295	SO:0001583	missense	8331			Z83736	CCDS4628.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000182611	ENSG00000276368		"""Histones / Replication-dependent"""	4727	protein-coding gene	gene with protein product		602791	"""H2A histone family, member E"", ""histone 1, H2aj"""	H2AFE		9439656, 12408966	Standard	NM_021066		Approved	H2A/E	uc003njn.1	Q99878	OTTHUMG00000014486	ENST00000333151.3:c.111A>C	6.37:g.27782408T>G	ENSP00000328484:p.Lys37Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A2RUU6|Q5JXQ5	Missense_Mutation	SNP	ENST00000333151.3	37	CCDS4628.1	.	.	.	.	.	.	.	.	.	.	.	5.856	0.342084	0.11069	.	.	ENSG00000182611	ENST00000333151	D	0.85773	-2.03	4.06	0.209	0.15226	Histone-fold (2);Histone core (1);Histone H2A (1);	0.000000	0.33813	U	0.004525	T	0.69869	0.3159	M	0.67625	2.065	0.30247	N	0.79447	B	0.13594	0.008	B	0.17098	0.017	T	0.65067	-0.6258	10	0.66056	D	0.02	.	8.6261	0.33890	0.0:0.5728:0.0:0.4272	.	37	Q99878	H2A1J_HUMAN	N	37	ENSP00000328484:K37N	ENSP00000328484:K37N	K	-	3	2	HIST1H2AJ	27890387	0.000000	0.05858	1.000000	0.80357	0.204000	0.24138	-2.471000	0.00990	0.221000	0.20879	-1.099000	0.02127	AAA		0.672	HIST1H2AJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040154.1		NM_021066	
HMGN2	3151	broad.mit.edu	37	1	26801118	26801118	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:26801118G>A	ENST00000361427.5	+	5	291	c.197G>A	c.(196-198)gGg>gAg	p.G66E	HMGN2_ENST00000493418.1_3'UTR	NM_005517.3	NP_005508.1	P05204	HMGN2_HUMAN	high mobility group nucleosomal binding domain 2	66						chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|lung(2)	3		all_cancers(24;1.9e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.38e-49)|OV - Ovarian serous cystadenocarcinoma(117;5.38e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.026)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		GGCAAGGAGGGGAATAACCCT	0.413																																																	0													32.0	35.0	34.0					1																	26801118		2195	4296	6491	SO:0001583	missense	3151			BC081567	CCDS283.1	1p36.1	2011-07-01	2011-04-05	2002-08-16	ENSG00000198830	ENSG00000198830		"""High-mobility group / Canonical"""	4986	protein-coding gene	gene with protein product		163910	"""high-mobility group (nonhistone chromosomal) protein 17"", ""high-mobility group nucleosomal binding domain 2"""	HMG17		2037294	Standard	NM_005517		Approved		uc001bmp.4	P05204	OTTHUMG00000003555	ENST00000361427.5:c.197G>A	1.37:g.26801118G>A	ENSP00000355228:p.Gly66Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q0VGD5|Q6FGI5|Q96C64	Missense_Mutation	SNP	ENST00000361427.5	37	CCDS283.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191839	0.58017	.	.	ENSG00000198830	ENST00000361427	.	.	.	5.65	4.72	0.59763	.	0.591244	0.13227	U	0.403970	T	0.59459	0.2195	.	.	.	0.31110	N	0.710101	D	0.58620	0.983	P	0.52646	0.705	T	0.65030	-0.6267	8	0.66056	D	0.02	.	15.667	0.77238	0.0:0.1421:0.8579:0.0	.	66	P05204	HMGN2_HUMAN	E	66	.	ENSP00000355228:G66E	G	+	2	0	HMGN2	26673705	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.106000	0.64597	1.485000	0.48380	0.655000	0.94253	GGG		0.413	HMGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009901.1		NM_005517	
HIST2H3PS2	440686	broad.mit.edu	37	1	149398908	149398908	+	IGR	SNP	G	G	C			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr1:149398908G>C	ENST00000392948.2	-	0	412				RP5-998N21.7_ENST00000444624.1_RNA|HIST2H2BB_ENST00000609585.1_RNA|RP5-998N21.10_ENST00000609879.1_RNA					histone cluster 2, H3, pseudogene 2											lung(1)|ovary(1)	2						CTCGCGGGACGTGATGGTGGA	0.652																																																	0													124.0	88.0	99.0					1																	149398908		688	1558	2246	SO:0001628	intergenic_variant	440689			AL109948		1q21.1	2012-04-11	2006-10-11		ENSG00000203818	ENSG00000203818		"""Histones / Replication-dependent"""	32060	pseudogene	pseudogene			"""histone 2, H3, pseudogene 2"""				Standard	NG_012783		Approved	p06			OTTHUMG00000041033		1.37:g.149398908G>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000392948.2	37																																																																																					0.652	HIST2H3PS2-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000098436.3		NG_012783	
HSP90B1	7184	broad.mit.edu	37	12	104332226	104332226	+	Missense_Mutation	SNP	A	A	G			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr12:104332226A>G	ENST00000299767.5	+	7	1146	c.964A>G	c.(964-966)Aag>Gag	p.K322E		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	322					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	aaagaaACCAAAGACTAAAAA	0.388																																																	0													45.0	49.0	47.0					12																	104332226		2203	4300	6503	SO:0001583	missense	7184			AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.964A>G	12.37:g.104332226A>G	ENSP00000299767:p.Lys322Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	37	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763352	0.49574	.	.	ENSG00000166598	ENST00000299767;ENST00000421266	T	0.17370	2.28	5.78	5.78	0.91487	ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.34745	0.0908	L	0.52364	1.645	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.03695	-1.1012	10	0.59425	D	0.04	.	12.4981	0.55940	1.0:0.0:0.0:0.0	.	322	P14625	ENPL_HUMAN	E	322;72	ENSP00000299767:K322E	ENSP00000299767:K322E	K	+	1	0	HSP90B1	102856356	1.000000	0.71417	0.940000	0.37924	0.022000	0.10575	6.690000	0.74567	2.197000	0.70478	0.533000	0.62120	AAG		0.388	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1		NM_003299	
Unknown	0	broad.mit.edu	37	13	19414102	19414102	+	IGR	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr13:19414102C>T								LINC00418 (120233 upstream) : RP11-38M15.11 (19864 downstream)																							GAATTTTTACCAAAGATTGAT	0.274																																																	0																																										SO:0001628	intergenic_variant	0																															13.37:g.19414102C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.274									
Unknown	0	broad.mit.edu	37	13	19414287	19414287	+	IGR	SNP	G	G	T	rs4037774	byFrequency	TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr13:19414287G>T								LINC00418 (120418 upstream) : RP11-38M15.11 (19679 downstream)																							TTTTCTTGTTGTAAGGTGCAT	0.274													.|||	2025	0.404353	0.6392	0.3689	5008	,	,		14061	0.2272		0.3668	False		,,,				2504	0.3333																0																																										SO:0001628	intergenic_variant	0																															13.37:g.19414287G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.274									
MICALL2	79778	broad.mit.edu	37	7	1487214	1487214	+	Silent	SNP	C	C	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr7:1487214C>T	ENST00000297508.7	-	4	697	c.522G>A	c.(520-522)aaG>aaA	p.K174K	MICALL2_ENST00000405088.4_Intron	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	174	Forms an intramolecular interaction with the C-terminal coiled coil domain keeping the protein in a closed conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		AGCTTACAGTCTTGGGGGGCG	0.677																																																	0													13.0	15.0	14.0					7																	1487214		2152	4241	6393	SO:0001819	synonymous_variant	79778			BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.522G>A	7.37:g.1487214C>T		Somatic		WXS	Illumina GAIIx	Phase_I	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																				0.677	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2		NM_182924	
SLC23A1	9963	broad.mit.edu	37	5	138715429	138715429	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr5:138715429G>T	ENST00000348729.3	-	8	909	c.863C>A	c.(862-864)gCa>gAa	p.A288E	SLC23A1_ENST00000503919.1_5'Flank|SLC23A1_ENST00000353963.3_Missense_Mutation_p.A292E	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	288					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	ATCGGTTCGTGCCTGGAAGCC	0.592																																																	0													120.0	86.0	97.0					5																	138715429		2203	4300	6503	SO:0001583	missense	9963			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.863C>A	5.37:g.138715429G>T	ENSP00000302701:p.Ala288Glu	Somatic		WXS	Illumina GAIIx	Phase_I	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862506	0.91511	.	.	ENSG00000170482	ENST00000353963;ENST00000348729	T;T	0.20332	2.09;2.08	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.50411	0.1614	M	0.84082	2.675	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.991	T	0.57573	-0.7788	10	0.72032	D	0.01	-10.4162	16.5892	0.84760	0.0:0.0:1.0:0.0	.	288;292	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	E	292;288	ENSP00000302851:A292E;ENSP00000302701:A288E	ENSP00000302701:A288E	A	-	2	0	SLC23A1	138743328	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.406000	0.73276	2.449000	0.82847	0.561000	0.74099	GCA		0.592	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1		NM_152685	
HERC2P4	100289574	broad.mit.edu	37	16	32191961	32191961	+	IGR	SNP	G	G	A	rs574818712		TCGA-A3-3322-01A-01D-0966-08	TCGA-A3-3322-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6f82a369-12e0-4c62-9319-35856c2ef8d5	6a5969e6-52fc-42b9-8b42-41b9da41f6b3	g.chr16:32191961G>A								HERC2P4 (9073 upstream) : RP11-17M15.1 (7692 downstream)																							GCTCTGGAACGTTTGCAGCAA	0.532													g|||	1	0.000199681	0.0008	0.0	5008	,	,		31599	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	0																															16.37:g.32191961G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37		.	.	.	.	.	.	.	.	.	.	.	8.151	0.787460	0.16258	.	.	ENSG00000230267	ENST00000433784	.	.	.	2.51	2.51	0.30379	.	.	.	.	.	T	0.57989	0.2091	.	.	.	.	.	.	.	.	.	.	.	.	T	0.67635	-0.5620	4	0.87932	D	0	.	9.1025	0.36678	0.0:0.7717:0.2283:0.0	.	.	.	.	M	82	.	ENSP00000402538:T82M	T	-	2	0	AC133485.1	32099462	1.000000	0.71417	0.648000	0.29521	0.005000	0.04900	5.078000	0.64425	0.393000	0.25203	-1.041000	0.02371	ACG	0	0.532									
