#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797315	128797316	+	In_Frame_Ins	INS	-	-	CCCGGC	rs3980042|rs373500239|rs142924298	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr5:128797315_128797316insCCCGGC	ENST00000274487.4	+	2	739_740	c.594_595insCCCGGC	c.(595-597)ccc>CCCGGCccc	p.199_199P>PGP	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	199	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N198_P199insPG(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGCGGCCAAATCCCGGCCCCGG	0.713														951	0.189896	0.1815	0.1254	5008	,	,		13147	0.3294		0.1083	False		,,,				2504	0.1871																1	Insertion - In frame(1)	breast(1)								443,3611		48,347,1632						-6.8	0.0		dbSNP_134	11	670,7398		63,544,3427	no	coding	ADAMTS19	NM_133638.3		111,891,5059	A1A1,A1R,RR		8.3044,10.9275,9.1817				1113,11009				SO:0001652	inframe_insertion	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.601_606dupCCCGGC	5.37:g.128797316_128797321dupCCCGGC	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Ins	INS	ENST00000274487.4	37	CCDS4146.1																																																																																				0.713	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2		NM_133638	
ANKH	56172	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	14751238	14751238	+	Silent	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr5:14751238G>A	ENST00000284268.6	-	5	957	c.627C>T	c.(625-627)tgC>tgT	p.C209C	ANKH_ENST00000503939.1_5'UTR|ANKH_ENST00000535119.1_Silent_p.C11C	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	209					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						AGTAGCCCAGGCACAGGGTGG	0.572																																																	0													88.0	81.0	83.0					5																	14751238		2203	4300	6503	SO:0001819	synonymous_variant	56172			AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.627C>T	5.37:g.14751238G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Silent	SNP	ENST00000284268.6	37	CCDS3885.1																																																																																				0.572	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207063.1		NM_054027	
ASTN1	460	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	176993851	176993851	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:176993851G>A	ENST00000367654.3	-	6	1349	c.1138C>T	c.(1138-1140)Cct>Tct	p.P380S	ASTN1_ENST00000367657.3_Missense_Mutation_p.P380S|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.P380S|ASTN1_ENST00000361833.2_Missense_Mutation_p.P380S	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	380					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TTATTCACAGGACTTCGGGGA	0.493																																																	0													130.0	105.0	114.0					1																	176993851		2203	4300	6503	SO:0001583	missense	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1138C>T	1.37:g.176993851G>A	ENSP00000356626:p.Pro380Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	G	22.2	4.254275	0.80135	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.20463	2.07;2.48;2.46;2.08	5.27	4.36	0.52297	.	0.052212	0.85682	N	0.000000	T	0.19967	0.0480	L	0.34521	1.04	0.80722	D	1	B;B;B	0.26602	0.154;0.035;0.035	B;B;B	0.31751	0.135;0.019;0.034	T	0.04930	-1.0917	10	0.87932	D	0	-15.1469	13.2884	0.60255	0.077:0.0:0.923:0.0	.	380;380;380	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	S	380	ENSP00000356629:P380S;ENSP00000354536:P380S;ENSP00000356626:P380S;ENSP00000395041:P380S	ENSP00000354536:P380S	P	-	1	0	ASTN1	175260474	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.291000	0.96070	1.217000	0.43442	0.655000	0.94253	CCT		0.493	ASTN1-201	KNOWN	basic	protein_coding	protein_coding			NM_004319	
ASTN2	23245	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	119204736	119204736	+	Silent	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr9:119204736T>C	ENST00000313400.4	-	21	3694	c.3594A>G	c.(3592-3594)gcA>gcG	p.A1198A	ASTN2_ENST00000288520.5_Silent_p.A299A|ASTN2_ENST00000361477.3_Silent_p.A250A|ASTN2_ENST00000341734.4_Silent_p.A250A|ASTN2_ENST00000373996.3_Silent_p.A1194A|ASTN2_ENST00000361209.2_Silent_p.A1147A			O75129	ASTN2_HUMAN	astrotactin 2	1198					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACCTACCTTCTGCCTTGTTGT	0.498																																																	0													198.0	169.0	179.0					9																	119204736		2203	4300	6503	SO:0001819	synonymous_variant	23245			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3594A>G	9.37:g.119204736T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37																																																																																					0.498	ASTN2-201	KNOWN	basic	protein_coding	protein_coding			NM_014010	
BCKDHA	593	hgsc.bcm.edu	37	19	41931983	41931984	+	IGR	INS	-	-	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr19:41931983_41931984insG	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000601379.1_5'UTR|B3GNT8_ENST00000321702.2_Frame_Shift_Ins_p.R234fs|CTC-435M10.6_ENST00000598887.1_RNA	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						GGGGCAGTGGCGGCCCAGCCAG	0.644																																																	0										83,4175		1,81,2047						-4.9	0.1			48	119,8113		0,119,3997	no	frameshift	B3GNT8	NM_198540.2		1,200,6044	A1A1,A1R,RR		1.4456,1.9493,1.6173				202,12288				SO:0001628	intergenic_variant	374907			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41931985_41931985dupG		Somatic		WXS	Illumina HiSeq	Phase_I	B4DP47|E7EW46|Q16034|Q16472	Frame_Shift_Ins	INS	ENST00000269980.2	37	CCDS12581.1																																																																																				0.644	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3		NM_000709	
BDH1	622	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	197238941	197238941	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr3:197238941G>A	ENST00000392378.2	-	7	1167	c.857C>T	c.(856-858)aCc>aTc	p.T286I	BDH1_ENST00000392379.1_Missense_Mutation_p.T286I|BDH1_ENST00000358186.2_Missense_Mutation_p.T286I|BDH1_ENST00000441275.1_Missense_Mutation_p.T199I	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	286					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		GCTGCAGTAGGTCTCCATCTT	0.582																																																	0													196.0	165.0	175.0					3																	197238941		2203	4300	6503	SO:0001583	missense	622			M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.857C>T	3.37:g.197238941G>A	ENSP00000376183:p.Thr286Ile	Somatic		WXS	Illumina HiSeq	Phase_I	D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	ENST00000392378.2	37	CCDS3328.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215545	0.39102	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000441275	D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14	5.85	-1.21	0.09524	NAD(P)-binding domain (1);	0.551411	0.21865	N	0.067969	D	0.84933	0.5582	L	0.38175	1.15	0.37796	D	0.927537	B	0.12013	0.005	B	0.12156	0.007	T	0.71384	-0.4609	10	0.29301	T	0.29	.	10.2852	0.43562	0.0:0.284:0.3221:0.3939	.	286	Q02338	BDH_HUMAN	I	286;286;286;199	ENSP00000376183:T286I;ENSP00000350914:T286I;ENSP00000376184:T286I;ENSP00000411014:T199I	ENSP00000350914:T286I	T	-	2	0	BDH1	198723338	1.000000	0.71417	0.888000	0.34837	0.855000	0.48748	1.741000	0.38238	-0.360000	0.08138	-0.169000	0.13324	ACC		0.582	BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340267.1		NM_004051	
BMP3	651	broad.mit.edu;hgsc.bcm.edu	37	4	81952663	81952663	+	Silent	SNP	A	A	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr4:81952663A>T	ENST00000282701.2	+	1	545	c.225A>T	c.(223-225)acA>acT	p.T75T		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	75					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						CGGCCCGGACACCGGGCTCCC	0.687																																																	0													17.0	20.0	19.0					4																	81952663		2200	4298	6498	SO:0001819	synonymous_variant	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.225A>T	4.37:g.81952663A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q4VAS5	Silent	SNP	ENST00000282701.2	37	CCDS3588.1																																																																																				0.687	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			
C10orf35	219738	broad.mit.edu;hgsc.bcm.edu	37	10	71392632	71392632	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr10:71392632G>T	ENST00000373279.4	+	4	342	c.183G>T	c.(181-183)caG>caT	p.Q61H	C10orf35_ENST00000491890.1_3'UTR	NM_145306.2	NP_660349.1	Q96D05	CJ035_HUMAN	chromosome 10 open reading frame 35	61						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GTGCTGCTCAGTCCCCCTTCA	0.632																																																	0													71.0	58.0	63.0					10																	71392632		2203	4300	6503	SO:0001583	missense	219738			BC013587	CCDS7295.1	10q22.2	2003-11-21			ENSG00000171224	ENSG00000171224			23519	protein-coding gene	gene with protein product						12477932	Standard	NM_145306		Approved		uc001jpq.4	Q96D05	OTTHUMG00000018383	ENST00000373279.4:c.183G>T	10.37:g.71392632G>T	ENSP00000362376:p.Gln61His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000373279.4	37	CCDS7295.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623288	0.46840	.	.	ENSG00000171224	ENST00000373279;ENST00000421716	.	.	.	4.81	2.83	0.33086	.	0.348665	0.23748	N	0.044948	T	0.18676	0.0448	N	0.14661	0.345	0.29536	N	0.852469	B	0.31351	0.32	B	0.31101	0.124	T	0.08743	-1.0707	9	0.41790	T	0.15	-10.4196	5.9677	0.19334	0.1135:0.3121:0.5743:0.0	.	61	Q96D05	CJ035_HUMAN	H	61;103	.	ENSP00000362376:Q61H	Q	+	3	2	C10orf35	71062638	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.180000	0.32005	1.226000	0.43582	0.561000	0.74099	CAG		0.632	C10orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048454.1		NM_145306	
C2orf47	79568	broad.mit.edu;hgsc.bcm.edu	37	2	200826508	200826508	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr2:200826508G>C	ENST00000392290.1	+	4	850	c.654G>C	c.(652-654)agG>agC	p.R218S	C2orf47_ENST00000469156.1_Intron|C2orf47_ENST00000295079.2_Missense_Mutation_p.R218S			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47	218						mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						TCTAAGGAAGGAAGTTTGTTA	0.358																																																	0													97.0	88.0	91.0					2																	200826508		2203	4300	6503	SO:0001583	missense	79568			BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.654G>C	2.37:g.200826508G>C	ENSP00000376111:p.Arg218Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q658V9|Q9H671	Missense_Mutation	SNP	ENST00000392290.1	37	CCDS2329.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178787	0.78564	.	.	ENSG00000162972	ENST00000295079;ENST00000392290	T;T	0.50813	0.73;0.73	6.06	6.06	0.98353	.	0.052233	0.64402	D	0.000001	T	0.61862	0.2381	L	0.59436	1.845	0.49798	D	0.999824	D	0.71674	0.998	D	0.66351	0.943	T	0.63024	-0.6729	10	0.72032	D	0.01	-16.4437	11.4709	0.50268	0.0811:0.0:0.9189:0.0	.	218	Q8WWC4	CB047_HUMAN	S	218	ENSP00000295079:R218S;ENSP00000376111:R218S	ENSP00000295079:R218S	R	+	3	2	C2orf47	200534753	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.842000	0.48230	2.880000	0.98712	0.650000	0.86243	AGG		0.358	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256146.1		NM_024520	
CCT8	10694	broad.mit.edu;hgsc.bcm.edu	37	21	30442608	30442608	+	Silent	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr21:30442608C>T	ENST00000286788.4	-	2	317	c.111G>A	c.(109-111)aaG>aaA	p.K37K	CCT8_ENST00000540844.1_5'UTR|CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000542732.1_Silent_p.K18K	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	37					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						GGGCAAGCTCCTTGCAAGCTT	0.358																																																	0													82.0	78.0	79.0					21																	30442608		2203	4300	6503	SO:0001819	synonymous_variant	10694			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.111G>A	21.37:g.30442608C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	ENST00000286788.4	37	CCDS33528.1	.	.	.	.	.	.	.	.	.	.	C	9.371	1.070493	0.20147	.	.	ENSG00000156261	ENST00000431234	.	.	.	4.74	1.94	0.25998	.	.	.	.	.	T	0.52273	0.1724	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43048	-0.9415	4	.	.	.	-17.9556	5.3509	0.16036	0.0:0.4715:0.0:0.5285	.	.	.	.	K	29	.	.	R	-	2	0	CCT8	29364479	0.992000	0.36948	1.000000	0.80357	0.991000	0.79684	0.350000	0.20079	0.724000	0.32296	0.561000	0.74099	AGG		0.358	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1			
CTNNA2	1496	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	80097056	80097056	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr2:80097056C>T	ENST00000402739.4	+	4	585	c.580C>T	c.(580-582)Caa>Taa	p.Q194*	CTNNA2_ENST00000541047.1_Nonsense_Mutation_p.Q194*|CTNNA2_ENST00000361291.4_Nonsense_Mutation_p.Q228*|CTNNA2_ENST00000496558.1_Nonsense_Mutation_p.Q194*|CTNNA2_ENST00000540488.1_Nonsense_Mutation_p.Q194*|CTNNA2_ENST00000466387.1_Nonsense_Mutation_p.Q194*	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	194					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AGCAAGAAGACAACAGGTGGG	0.403																																																	0													107.0	100.0	102.0					2																	80097056		1848	4106	5954	SO:0001587	stop_gained	1496				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.580C>T	2.37:g.80097056C>T	ENSP00000384638:p.Gln194*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Nonsense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	C	41	8.623966	0.98890	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	.	.	.	X	194;194;228;194;194;194	.	ENSP00000355398:Q228X	Q	+	1	0	CTNNA2	79950564	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.498000	0.81546	2.808000	0.96608	0.655000	0.94253	CAA		0.403	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4		NM_004389	
CYP1A1	1543	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	75013623	75013623	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr15:75013623G>C	ENST00000379727.3	-	5	1281	c.1083C>G	c.(1081-1083)gaC>gaG	p.D361E	CYP1A1_ENST00000564596.1_Missense_Mutation_p.D100E|CYP1A1_ENST00000395048.2_Missense_Mutation_p.D361E|CYP1A1_ENST00000567032.1_Missense_Mutation_p.D361E|CYP1A1_ENST00000395049.4_Missense_Mutation_p.D361E			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	361					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	GATGGGATCTGTCAGAGAGCC	0.612									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																																								0													78.0	80.0	79.0					15																	75013623		2197	4296	6493	SO:0001583	missense	1543	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.1083C>G	15.37:g.75013623G>C	ENSP00000369050:p.Asp361Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	37	CCDS10268.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.095945	0.36952	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.72282	-0.64;-0.64;-0.64	5.17	4.26	0.50523	.	0.000000	0.85682	D	0.000000	D	0.86100	0.5852	H	0.94183	3.505	0.80722	D	1	D;B	0.61697	0.99;0.427	D;P	0.63957	0.92;0.491	D	0.88455	0.3051	10	0.87932	D	0	.	10.8429	0.46726	0.1514:0.0:0.8486:0.0	.	361;361	E7EMT5;P04798	.;CP1A1_HUMAN	E	361;361;361;333	ENSP00000369050:D361E;ENSP00000378488:D361E;ENSP00000378489:D361E	ENSP00000268062:D333E	D	-	3	2	CYP1A1	72800676	1.000000	0.71417	0.948000	0.38648	0.099000	0.18886	2.893000	0.48633	1.193000	0.43086	-0.136000	0.14681	GAC		0.612	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1		NM_000499	
DENND1A	57706	hgsc.bcm.edu	37	9	126146189	126146197	+	Splice_Site	DEL	CGGCCTGTC	CGGCCTGTC	-	rs75693594|rs111273094|rs2808411	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	CGGCCTGTC	CGGCCTGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr9:126146189_126146197delCGGCCTGTC	ENST00000373624.2	-	21	1779_1782	c.1578_1581delGACAGGCCG	c.(1576-1581)cagaca>ca	p.QT526del	DENND1A_ENST00000394219.3_Splice_Site_p.WT537del|DENND1A_ENST00000542603.1_Splice_Site_p.WT311del|DENND1A_ENST00000473039.1_5'UTR	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	526					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P527P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GATACGGCTGCGGCCTGTCGGGGACAGAG	0.66																																																	1	Substitution - coding silent(1)	lung(1)																																								SO:0001630	splice_region_variant	57706			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1578-1GACAGGCCG>-	9.37:g.126146189_126146197delCGGCCTGTC		Somatic		WXS	Illumina HiSeq	Phase_I	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Frame_Shift_Del	DEL	ENST00000373624.2	37	CCDS35133.1																																																																																				0.660	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1		NM_024820	In_Frame_Del
DMXL2	23312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	51758414	51758414	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr15:51758414T>C	ENST00000251076.5	-	30	7771	c.7484A>G	c.(7483-7485)cAa>cGa	p.Q2495R	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.Q2496R|DMXL2_ENST00000449909.3_Missense_Mutation_p.Q1859R	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2495						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CTCCTGTATTTGTGTATCTGA	0.313																																																	0													103.0	106.0	105.0					15																	51758414		2195	4291	6486	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7484A>G	15.37:g.51758414T>C	ENSP00000251076:p.Gln2495Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.865800	0.51588	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.24908	1.97;1.97;1.83	5.16	4.04	0.47022	.	0.053994	0.85682	N	0.000000	T	0.27241	0.0668	M	0.61703	1.905	0.51767	D	0.999934	B;B;B;B	0.13145	0.0;0.007;0.0;0.003	B;B;B;B	0.10450	0.003;0.005;0.001;0.005	T	0.06552	-1.0820	10	0.62326	D	0.03	.	10.8924	0.47002	0.0:0.0734:0.0:0.9266	.	2496;1859;2495;2496	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	R	2495;2496;1859;40	ENSP00000251076:Q2495R;ENSP00000441858:Q2496R;ENSP00000400855:Q1859R	ENSP00000251076:Q2495R	Q	-	2	0	DMXL2	49545706	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.337000	0.59310	0.991000	0.38814	0.533000	0.62120	CAA		0.313	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2		NM_015263	
DNAH2	146754	broad.mit.edu;ucsc.edu	37	17	7630455	7630455	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr17:7630455T>C	ENST00000572933.1	+	4	1704	c.244T>C	c.(244-246)Tcc>Ccc	p.S82P	DNAH2_ENST00000082259.3_Missense_Mutation_p.S82P|DNAH2_ENST00000570791.1_Missense_Mutation_p.S82P|DNAH2_ENST00000389173.2_Missense_Mutation_p.S82P			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	82	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTCTTCCTTTCCCGAGCTGC	0.537																																																	0													120.0	99.0	106.0					17																	7630455		2203	4300	6503	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.244T>C	17.37:g.7630455T>C	ENSP00000458355:p.Ser82Pro	Somatic		WXS	Illumina GAIIx	Phase_I	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098754	0.56183	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.56611	0.45;0.45	4.38	0.467	0.16721	.	10.506500	0.00481	N	0.000123	T	0.48960	0.1529	N	0.08118	0	0.09310	N	1	B;D	0.67145	0.09;0.996	B;P	0.62014	0.042;0.897	T	0.47947	-0.9077	10	0.31617	T	0.26	.	6.5132	0.22234	0.1575:0.0:0.4862:0.3563	.	82;82	Q9P225;Q9P225-3	DYH2_HUMAN;.	P	82	ENSP00000373825:S82P;ENSP00000082259:S82P	ENSP00000082259:S82P	S	+	1	0	DNAH2	7571180	0.276000	0.24211	0.374000	0.26016	0.968000	0.65278	0.108000	0.15396	0.272000	0.22027	0.482000	0.46254	TCC		0.537	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1		NM_020877	
DNAJA4	55466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	78572439	78572439	+	Silent	SNP	C	C	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr15:78572439C>G	ENST00000394852.3	+	6	1120	c.930C>G	c.(928-930)ccC>ccG	p.P310P	RP11-762H8.4_ENST00000558192.1_RNA|DNAJA4_ENST00000343789.3_Silent_p.P310P|DNAJA4_ENST00000446172.2_Silent_p.P283P|DNAJA4_ENST00000394855.3_Silent_p.P339P	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	310					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						AAGGAATGCCCATCTACAAAG	0.458																																																	0													106.0	91.0	96.0					15																	78572439		2196	4293	6489	SO:0001819	synonymous_variant	55466			AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.930C>G	15.37:g.78572439C>G		Somatic		WXS	Illumina HiSeq	Phase_I	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Silent	SNP	ENST00000394852.3	37	CCDS45316.1																																																																																				0.458	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1		NM_018602	
EP300	2033	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	41566499	41566499	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr22:41566499A>T	ENST00000263253.7	+	27	5595	c.4376A>T	c.(4375-4377)aAg>aTg	p.K1459M	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1459	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.P1458_K1459delPK(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AAGATACCCAAGCCCAAGCGA	0.468			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	1	Deletion - In frame(1)	urinary_tract(1)											135.0	119.0	124.0					22																	41566499		2203	4300	6503	SO:0001583	missense	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4376A>T	22.37:g.41566499A>T	ENSP00000263253:p.Lys1459Met	Somatic		WXS	Illumina HiSeq	Phase_I	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.266175	0.80358	.	.	ENSG00000100393	ENST00000263253	D	0.94457	-3.43	5.5	5.5	0.81552	.	0.000000	0.50627	D	0.000114	D	0.98099	0.9373	H	0.95224	3.64	0.51233	D	0.999915	D	0.89917	1.0	D	0.91635	0.999	D	0.99457	1.0942	10	0.87932	D	0	-12.2287	15.6131	0.76744	1.0:0.0:0.0:0.0	.	1459	Q09472	EP300_HUMAN	M	1459	ENSP00000263253:K1459M	ENSP00000263253:K1459M	K	+	2	0	EP300	39896445	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.237000	0.95368	2.084000	0.62774	0.533000	0.62120	AAG		0.468	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1		NM_001429	
EPHB4	2050	broad.mit.edu;hgsc.bcm.edu	37	7	100401094	100401094	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr7:100401094G>C	ENST00000358173.3	-	17	3421	c.2953C>G	c.(2953-2955)Ccg>Gcg	p.P985A	EPHB4_ENST00000360620.3_Missense_Mutation_p.P933A	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	985					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CAGTACTGCGGGGCCGGTCCT	0.662																																					GBM(200;2113 3072 25865 52728)												0													35.0	37.0	36.0					7																	100401094		2201	4297	6498	SO:0001583	missense	2050			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2953C>G	7.37:g.100401094G>C	ENSP00000350896:p.Pro985Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	37	CCDS5706.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998855	0.54147	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.73363	-0.74;-0.69	4.85	4.85	0.62838	.	0.143292	0.32147	N	0.006512	T	0.60715	0.2290	N	0.14661	0.345	0.20074	N	0.999939	B;B	0.12630	0.006;0.002	B;B	0.14023	0.01;0.01	T	0.59166	-0.7505	10	0.87932	D	0	.	15.5311	0.75964	0.0:0.0:1.0:0.0	.	933;985	Q96L35;P54760	.;EPHB4_HUMAN	A	933;985	ENSP00000353833:P933A;ENSP00000350896:P985A	ENSP00000350896:P985A	P	-	1	0	EPHB4	100239030	.	.	0.813000	0.32504	0.106000	0.19336	.	.	2.249000	0.74217	0.456000	0.33151	CCG		0.662	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1		NM_004444	
ERCC2	2068	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	45857991	45857991	+	Silent	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr19:45857991C>T	ENST00000391945.4	-	17	1739	c.1662G>A	c.(1660-1662)gaG>gaA	p.E554E	ERCC2_ENST00000391944.3_Silent_p.E476E	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	554	Mediates interaction with MMS19.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGCGTACCTGCTCATACCAGG	0.602			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	0													128.0	102.0	111.0					19																	45857991		2203	4300	6503	SO:0001819	synonymous_variant	2068	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1662G>A	19.37:g.45857991C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Silent	SNP	ENST00000391945.4	37	CCDS33049.1																																																																																				0.602	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2		NM_000400	
FAM50B	26240	broad.mit.edu;ucsc.edu	37	6	3850568	3850568	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr6:3850568G>T	ENST00000380274.1	+	1	949	c.523G>T	c.(523-525)Gcg>Tcg	p.A175S	FAM50B_ENST00000380272.3_Missense_Mutation_p.A175S			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	175						nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				AGAGTGGGAGGCGCAGCGCGA	0.677																																																	0													34.0	34.0	34.0					6																	3850568		2202	4300	6502	SO:0001583	missense	26240			Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.523G>T	6.37:g.3850568G>T	ENSP00000369627:p.Ala175Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q5T2L6	Missense_Mutation	SNP	ENST00000380274.1	37	CCDS4487.1	.	.	.	.	.	.	.	.	.	.	G	5.907	0.351385	0.11182	.	.	ENSG00000145945	ENST00000380274;ENST00000380272	.	.	.	4.14	3.27	0.37495	.	0.304596	0.26324	N	0.025034	T	0.19927	0.0479	M	0.68317	2.08	0.25247	N	0.98971	B	0.19583	0.037	B	0.24701	0.055	T	0.21586	-1.0241	9	0.12766	T	0.61	-20.6488	5.9768	0.19385	0.1057:0.1934:0.7009:0.0	.	175	Q9Y247	FA50B_HUMAN	S	175	.	ENSP00000369625:A175S	A	+	1	0	FAM50B	3795567	1.000000	0.71417	0.942000	0.38095	0.622000	0.37654	2.008000	0.40893	1.108000	0.41662	0.485000	0.47835	GCG		0.677	FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1		NM_012135	
SPATA31D1	389763	hgsc.bcm.edu;ucsc.edu	37	9	84608721	84608721	+	Missense_Mutation	SNP	C	C	A	rs12340292	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr9:84608721C>A	ENST00000344803.2	+	4	3383	c.3336C>A	c.(3334-3336)agC>agA	p.S1112R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1112					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GTAGATGCAGCGCAGAGCTGC	0.512																																																	0													63.0	63.0	63.0					9																	84608721		1974	4167	6141	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3336C>A	9.37:g.84608721C>A	ENSP00000341988:p.Ser1112Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317569	0.23908	.	.	ENSG00000214929	ENST00000344803	T	0.06528	3.29	2.45	-2.3	0.06785	.	.	.	.	.	T	0.05090	0.0136	N	0.14661	0.345	0.09310	N	1	D	0.56968	0.978	P	0.55577	0.779	T	0.21586	-1.0241	9	0.23302	T	0.38	0.0	0.4889	0.00560	0.1965:0.3537:0.1929:0.2569	.	1112	Q6ZQQ2	F75D1_HUMAN	R	1112	ENSP00000341988:S1112R	ENSP00000341988:S1112R	S	+	3	2	FAM75D1	83798541	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.961000	0.03845	-0.525000	0.06391	-2.810000	0.00111	AGC		0.512	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1		NM_001001670	
FMO5	2330	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	146696569	146696569	+	Missense_Mutation	SNP	G	G	A	rs373414071		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:146696569G>A	ENST00000254090.4	-	2	441	c.53C>T	c.(52-54)tCc>tTc	p.S18F	FMO5_ENST00000441068.2_Missense_Mutation_p.S18F|FMO5_ENST00000369272.3_Missense_Mutation_p.S18F|FMO5_ENST00000465173.1_5'UTR|RP11-337C18.10_ENST00000606856.1_RNA	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	18						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					GCACTTGATGGAAGAGAGCCC	0.502																																																	0								G	PHE/SER,PHE/SER,PHE/SER	1,4405	2.1+/-5.4	0,1,2202	145.0	135.0	138.0		53,53,53	1.0	0.1	1		138	0,8600		0,0,4300	no	missense,missense,missense	FMO5	NM_001144829.1,NM_001144830.1,NM_001461.2	155,155,155	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	18/465,18/286,18/534	146696569	1,13005	2203	4300	6503	SO:0001583	missense	2330			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.53C>T	1.37:g.146696569G>A	ENSP00000254090:p.Ser18Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	37	CCDS926.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780700	0.70222	2.27E-4	0.0	ENSG00000131781	ENST00000441068;ENST00000254090;ENST00000369272;ENST00000533174;ENST00000533848	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.37	1.04	0.20106	.	0.472546	0.25654	N	0.029195	T	0.67277	0.2876	M	0.89904	3.07	0.19300	N	0.999974	D;D;P;D	0.71674	0.981;0.995;0.767;0.998	D;D;P;D	0.73708	0.948;0.958;0.74;0.981	T	0.69327	-0.5174	10	0.87932	D	0	-4.2792	16.4392	0.83894	0.0:0.5631:0.4369:0.0	.	18;18;18;18	Q9HA79;Q8IV22;P49326;C9JJD1	.;.;FMO5_HUMAN;.	F	18	ENSP00000416011:S18F;ENSP00000254090:S18F;ENSP00000358277:S18F;ENSP00000436429:S18F;ENSP00000432569:S18F	ENSP00000254090:S18F	S	-	2	0	FMO5	145163193	0.883000	0.30277	0.086000	0.20670	0.984000	0.73092	1.776000	0.38594	0.011000	0.14865	0.650000	0.86243	TCC		0.502	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2		NM_001461	
FMO1	2326	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	171244561	171244561	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:171244561A>C	ENST00000354841.4	+	3	529	c.398A>C	c.(397-399)gAg>gCg	p.E133A	FMO1_ENST00000367750.3_Missense_Mutation_p.E133A|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Missense_Mutation_p.E70A	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	133					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	ATGCATGAAGAGAAGCAAGAG	0.433																																																	0													171.0	157.0	162.0					1																	171244561		2203	4300	6503	SO:0001583	missense	2326			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.398A>C	1.37:g.171244561A>C	ENSP00000346901:p.Glu133Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.191759	0.38707	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000402921;ENST00000354841	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.36	4.44	0.53790	.	0.053294	0.85682	D	0.000000	T	0.19248	0.0462	N	0.05510	-0.035	0.38894	D	0.957173	B;B;B	0.19073	0.002;0.008;0.033	B;B;B	0.24155	0.001;0.051;0.033	T	0.10154	-1.0642	10	0.62326	D	0.03	-3.4659	12.5773	0.56371	0.0838:0.0:0.9162:0.0	.	70;133;133	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	A	133;133;70;133	ENSP00000356724:E133A;ENSP00000406982:E133A;ENSP00000385543:E70A;ENSP00000346901:E133A	ENSP00000346901:E133A	E	+	2	0	FMO1	169511185	1.000000	0.71417	0.999000	0.59377	0.253000	0.25986	3.127000	0.50484	1.352000	0.45808	-0.479000	0.04858	GAG		0.433	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1		NM_002021	
FRZB	2487	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	183731161	183731161	+	Silent	SNP	G	G	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr2:183731161G>T	ENST00000295113.4	-	1	729	c.120C>A	c.(118-120)atC>atA	p.I40I		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	40	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			TGCACAGGGGGATGCGGACGG	0.672																																																	0													52.0	43.0	46.0					2																	183731161		2203	4300	6503	SO:0001819	synonymous_variant	2487			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.120C>A	2.37:g.183731161G>T		Somatic		WXS	Illumina HiSeq	Phase_I	O00181|Q99686	Silent	SNP	ENST00000295113.4	37	CCDS2286.1																																																																																				0.672	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255808.1		NM_001463	
GALNT18	374378	hgsc.bcm.edu;ucsc.edu	37	11	11470318	11470318	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr11:11470318C>A	ENST00000227756.4	-	2	812	c.401G>T	c.(400-402)cGg>cTg	p.R134L		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	134					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										AGGCAGGGGCCGGTCCAGGGG	0.662																																																	0													26.0	25.0	25.0					11																	11470318		2183	4270	6453	SO:0001583	missense	374378			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.401G>T	11.37:g.11470318C>A	ENSP00000227756:p.Arg134Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O95903|Q8NDY9	Missense_Mutation	SNP	ENST00000227756.4	37	CCDS7807.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654708	0.88056	.	.	ENSG00000110328	ENST00000227756	T	0.68903	-0.36	5.66	4.75	0.60458	.	0.064020	0.64402	D	0.000018	T	0.69842	0.3156	M	0.87971	2.92	0.58432	D	0.999998	P	0.43024	0.798	B	0.37692	0.256	T	0.76526	-0.2927	10	0.87932	D	0	.	13.1866	0.59684	0.0:0.923:0.0:0.077	.	134	Q6P9A2	GLTL4_HUMAN	L	134	ENSP00000227756:R134L	ENSP00000227756:R134L	R	-	2	0	GALNTL4	11426894	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.071000	0.76770	1.397000	0.46682	0.561000	0.74099	CGG		0.662	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1		NM_198516	
GPR125	166647	broad.mit.edu;hgsc.bcm.edu	37	4	22437012	22437012	+	Silent	SNP	A	A	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr4:22437012A>T	ENST00000334304.5	-	10	1634	c.1365T>A	c.(1363-1365)tcT>tcA	p.S455S	GPR125_ENST00000502482.1_Silent_p.S455S|GPR125_ENST00000508133.1_Silent_p.S229S|GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	455					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCATTTTGTCAGAAAAGTTGG	0.378																																																	0													79.0	76.0	77.0					4																	22437012		2203	4300	6503	SO:0001819	synonymous_variant	166647			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1365T>A	4.37:g.22437012A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	37	CCDS33964.1																																																																																				0.378	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3			
HIPK2	28996	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	139281488	139281488	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr7:139281488C>T	ENST00000406875.3	-	12	2786	c.2692G>A	c.(2692-2694)Gag>Aag	p.E898K	HIPK2_ENST00000342645.6_Intron|HIPK2_ENST00000428878.2_Missense_Mutation_p.E871K	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	898	Interaction with TP53 and TP73.|Interaction with UBE2I. {ECO:0000250}.|Required for localization to nuclear speckles. {ECO:0000250}.|SUMO interaction motifs (SIM); required for nuclear localization and kinase activity.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TTCTGTTCCTCCTCCTCGTCC	0.607																																																	0													126.0	138.0	134.0					7																	139281488		2201	4291	6492	SO:0001583	missense	28996			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.2692G>A	7.37:g.139281488C>T	ENSP00000385571:p.Glu898Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	C	25.4	4.634415	0.87660	.	.	ENSG00000064393	ENST00000406875;ENST00000428878	T;T	0.25749	1.78;1.78	5.41	5.41	0.78517	.	.	.	.	.	T	0.24699	0.0599	.	.	.	0.58432	D	0.999999	P;P	0.39665	0.682;0.59	B;B	0.33121	0.108;0.158	T	0.03364	-1.1044	8	0.51188	T	0.08	.	19.3887	0.94570	0.0:1.0:0.0:0.0	.	898;871	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	K	898;871	ENSP00000385571:E898K;ENSP00000413724:E871K	ENSP00000385571:E898K	E	-	1	0	HIPK2	138932028	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.127000	0.77210	2.826000	0.97356	0.655000	0.94253	GAG		0.607	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3		NM_022740	
IFIT1	3434	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	91162071	91162071	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr10:91162071T>A	ENST00000371804.3	+	2	206	c.39T>A	c.(37-39)agT>agA	p.S13R	IFIT1_ENST00000546318.1_De_novo_Start_InFrame|LIPA_ENST00000371837.1_Intron	NM_001270927.1|NM_001548.4	NP_001257856.1|NP_001539.3	P09914	IFIT1_HUMAN	interferon-induced protein with tetratricopeptide repeats 1	13					cellular response to exogenous dsRNA (GO:0071360)|cellular response to type I interferon (GO:0071357)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|intracellular transport of viral protein in host cell (GO:0019060)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of helicase activity (GO:0051097)|negative regulation of protein binding (GO:0032091)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	15						TCAAGGATAGTCTGGAGCAAT	0.353																																																	0													124.0	115.0	118.0					10																	91162071		2203	4300	6503	SO:0001583	missense	3434			M24594	CCDS31243.1, CCDS59220.1	10q23.31	2014-05-22			ENSG00000185745	ENSG00000185745		"""Tetratricopeptide (TTC) repeat domain containing"""	5407	protein-coding gene	gene with protein product		147690		G10P1, IFI56, IFNAI1		1377167, 3360121	Standard	NM_001548		Approved	GARG-16	uc001kgi.4	P09914	OTTHUMG00000018712	ENST00000371804.3:c.39T>A	10.37:g.91162071T>A	ENSP00000360869:p.Ser13Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B3KS50|D3DR31|Q5T7J1|Q96QM5	Missense_Mutation	SNP	ENST00000371804.3	37	CCDS31243.1	.	.	.	.	.	.	.	.	.	.	T	9.492	1.100908	0.20552	.	.	ENSG00000185745	ENST00000371804	T	0.13901	2.55	5.02	-2.78	0.05859	.	0.764258	0.12047	N	0.504460	T	0.06188	0.0160	N	0.19112	0.55	0.44780	D	0.997789	B;B	0.13145	0.007;0.007	B;B	0.09377	0.004;0.004	T	0.40327	-0.9569	10	0.14656	T	0.56	.	5.3139	0.15845	0.0828:0.5106:0.1885:0.2182	.	13;13	Q5T7J1;P09914	.;IFIT1_HUMAN	R	13	ENSP00000360869:S13R	ENSP00000360869:S13R	S	+	3	2	IFIT1	91152051	0.001000	0.12720	0.002000	0.10522	0.083000	0.17756	-1.401000	0.02502	-0.339000	0.08401	-1.252000	0.01501	AGT		0.353	IFIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049302.1		NM_001548	
IGSF22	283284	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	18736130	18736130	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr11:18736130C>T	ENST00000513874.1	-	12	1712	c.1573G>A	c.(1573-1575)Gcg>Acg	p.A525T	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	525								p.A525T(2)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CCAGTGGCCGCGTGCACGTCG	0.612																																																	2	Substitution - Missense(2)	endometrium(2)											97.0	103.0	101.0					11																	18736130		2125	4236	6361	SO:0001583	missense	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1573G>A	11.37:g.18736130C>T	ENSP00000421191:p.Ala525Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684541	0.47991	.	.	ENSG00000179057	ENST00000513874	T	0.44881	0.91	4.51	2.56	0.30785	.	0.222355	0.22649	N	0.057359	T	0.43500	0.1250	L	0.31926	0.97	0.09310	N	1	D	0.89917	1.0	D	0.73708	0.981	T	0.20638	-1.0269	10	0.25751	T	0.34	.	3.8325	0.08880	0.1725:0.5787:0.156:0.0928	.	525	D6RGV7	.	T	525	ENSP00000421191:A525T	ENSP00000322422:A525T	A	-	1	0	IGSF22	18692706	0.014000	0.17966	0.147000	0.22382	0.477000	0.33069	1.404000	0.34623	0.315000	0.23110	0.551000	0.68910	GCG		0.612	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2		NM_173588	
KCNN3	3782	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	154744736	154744736	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:154744736G>A	ENST00000271915.4	-	3	1478	c.1163C>T	c.(1162-1164)gCa>gTa	p.A388V	KCNN3_ENST00000358505.2_Missense_Mutation_p.A75V|KCNN3_ENST00000361147.4_Missense_Mutation_p.A83V	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	393					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGCCAGGCGTGCCGTCCAGAA	0.607																																																	0													67.0	61.0	63.0					1																	154744736		2203	4300	6503	SO:0001583	missense	3782			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1163C>T	1.37:g.154744736G>A	ENSP00000271915:p.Ala388Val	Somatic		WXS	Illumina HiSeq	Phase_I	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915320	0.92178	.	.	ENSG00000143603	ENST00000361147;ENST00000271915;ENST00000358505	D;D;D	0.98531	-4.98;-3.85;-4.98	4.69	4.69	0.59074	.	0.000000	0.53938	D	0.000044	D	0.98661	0.9551	M	0.70595	2.14	0.58432	D	0.999999	D;D;P	0.76494	0.999;0.993;0.553	D;D;P	0.80764	0.994;0.978;0.559	D	0.99885	1.1121	10	0.87932	D	0	-8.3302	17.4259	0.87526	0.0:0.0:1.0:0.0	.	394;393;83	Q6JXY2;Q9UGI6;Q9UGI6-2	.;KCNN3_HUMAN;.	V	83;388;75	ENSP00000354764:A83V;ENSP00000271915:A388V;ENSP00000351295:A75V	ENSP00000271915:A388V	A	-	2	0	KCNN3	153011360	1.000000	0.71417	0.738000	0.30950	0.925000	0.55904	9.652000	0.98499	2.415000	0.81967	0.561000	0.74099	GCA		0.607	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3		NM_002249	
KRT82	3888	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	52793886	52793886	+	Silent	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr12:52793886C>T	ENST00000257974.2	-	5	902	c.825G>A	c.(823-825)gtG>gtA	p.V275V	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	275	Linker 12.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		TGTCCATCTTCACAATGACCG	0.602																																																	0													80.0	70.0	74.0					12																	52793886		2203	4300	6503	SO:0001819	synonymous_variant	3888			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.825G>A	12.37:g.52793886C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000257974.2	37	CCDS8826.1																																																																																				0.602	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1		NM_033033	
LELP1	149018	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	153177408	153177408	+	Silent	SNP	C	C	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:153177408C>A	ENST00000368747.1	+	2	335	c.225C>A	c.(223-225)acC>acA	p.T75T		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	75	Cys/Pro-rich.									NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCCCTGCACCAAGCCCTGTC	0.627																																																	0													118.0	94.0	102.0					1																	153177408		2203	4300	6503	SO:0001819	synonymous_variant	149018				CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.225C>A	1.37:g.153177408C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1L4E1	Silent	SNP	ENST00000368747.1	37	CCDS30869.1																																																																																				0.627	LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039104.1		NM_001010857	
LRBA	987	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	151511932	151511932	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr4:151511932C>A	ENST00000357115.3	-	40	6402	c.6159G>T	c.(6157-6159)gaG>gaT	p.E2053D	LRBA_ENST00000535741.1_Missense_Mutation_p.E2042D|LRBA_ENST00000510413.1_Missense_Mutation_p.E2042D|LRBA_ENST00000507224.1_Missense_Mutation_p.E2042D	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2053						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CCAGGAGGATCTCGTTTTCTG	0.413																																																	0													121.0	105.0	110.0					4																	151511932		2203	4300	6503	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6159G>T	4.37:g.151511932C>A	ENSP00000349629:p.Glu2053Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.54|15.54	2.862507|2.862507	0.51482|0.51482	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83|.	5.94|5.94	5.1|5.1	0.69264|0.69264	Domain of unknown function DUF1088 (1);|.	0.254929|.	0.39544|.	N|.	0.001334|.	T|T	0.54983|0.54983	0.1892|0.1892	L|L	0.41027|0.41027	1.25|1.25	0.54753|0.54753	D|D	0.999987|0.999987	B;B|.	0.25048|.	0.117;0.03|.	B;B|.	0.25884|.	0.064;0.028|.	T|T	0.49093|0.49093	-0.8975|-0.8975	10|5	0.22109|.	T|.	0.4|.	.|.	9.4796|9.4796	0.38893|0.38893	0.1434:0.7854:0.0:0.0712|0.1434:0.7854:0.0:0.0712	.|.	2053;2042|.	P50851;P50851-2|.	LRBA_HUMAN;.|.	D|I	2042;2042;2053;2042|695	ENSP00000446299:E2042D;ENSP00000421552:E2042D;ENSP00000349629:E2053D;ENSP00000422180:E2042D|.	ENSP00000349629:E2053D|.	E|R	-|-	3|2	2|0	LRBA|LRBA	151731382|151731382	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	2.356000|2.356000	0.44116|0.44116	2.817000|2.817000	0.96982|0.96982	0.557000|0.557000	0.71058|0.71058	GAG|AGA		0.413	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			
PIDD1	55367	broad.mit.edu;hgsc.bcm.edu	37	11	803579	803579	+	Missense_Mutation	SNP	G	G	A	rs527844115	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr11:803579G>A	ENST00000347755.5	-	3	445	c.304C>T	c.(304-306)Cgc>Tgc	p.R102C	PIDD_ENST00000411829.2_Missense_Mutation_p.R102C|PIDD_ENST00000534649.1_5'UTR	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					GTGTCCCGGCGTTGCCCTCCT	0.677													G|||	2	0.000399361	0.0	0.0	5008	,	,		15110	0.0		0.0	False		,,,				2504	0.002																0													21.0	26.0	24.0					11																	803579		2195	4294	6489	SO:0001583	missense	0																														ENST00000347755.5:c.304C>T	11.37:g.803579G>A	ENSP00000337797:p.Arg102Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000347755.5	37	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697293	0.30142	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.18174	2.23;2.23	4.34	1.24	0.21308	.	1.333460	0.04949	N	0.460070	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	P;D	0.53885	0.937;0.963	B;B	0.41571	0.197;0.36	T	0.07829	-1.0752	10	0.37606	T	0.19	.	0.8157	0.01102	0.1957:0.1405:0.3218:0.342	.	102;102	Q9HB75;Q9HB75-2	PIDD_HUMAN;.	C	102	ENSP00000416801:R102C;ENSP00000337797:R102C	ENSP00000337797:R102C	R	-	1	0	PIDD	793579	0.003000	0.15002	0.000000	0.03702	0.214000	0.24535	0.762000	0.26503	0.053000	0.16036	-0.379000	0.06801	CGC		0.677	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1			
LRRC61	65999	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	150034457	150034457	+	Silent	SNP	T	T	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr7:150034457T>A	ENST00000359623.4	+	3	1095	c.507T>A	c.(505-507)ggT>ggA	p.G169G	LRRC61_ENST00000323078.7_Silent_p.G169G|LRRC61_ENST00000493307.1_Silent_p.G169G	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	169	LRRCT.									endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			TTGGGCGTGGTAGTGAGTTCT	0.652																																																	0													89.0	90.0	90.0					7																	150034457		2203	4300	6503	SO:0001819	synonymous_variant	65999			BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.507T>A	7.37:g.150034457T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B3KUW0|D3DWY8	Silent	SNP	ENST00000359623.4	37	CCDS5901.1																																																																																				0.652	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350696.1		NM_023942	
LRRIQ1	84125	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	85546098	85546098	+	Missense_Mutation	SNP	G	G	A	rs532186985	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr12:85546098G>A	ENST00000393217.2	+	20	4431	c.4370G>A	c.(4369-4371)cGc>cAc	p.R1457H		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1457										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GATTCCACCCGCTTCCCTTCA	0.378													G|||	2	0.000399361	0.0	0.0	5008	,	,		15792	0.0		0.001	False		,,,				2504	0.001																0													141.0	134.0	136.0					12																	85546098		1890	4109	5999	SO:0001583	missense	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4370G>A	12.37:g.85546098G>A	ENSP00000376910:p.Arg1457His	Somatic		WXS	Illumina HiSeq	Phase_I	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709676	0.48517	.	.	ENSG00000133640	ENST00000393217	T	0.51817	0.69	5.22	1.82	0.25136	.	.	.	.	.	T	0.25827	0.0629	N	0.14661	0.345	0.21355	N	0.999716	B	0.26547	0.152	B	0.14023	0.01	T	0.13335	-1.0513	9	0.35671	T	0.21	.	6.0222	0.19634	0.3169:0.1473:0.5358:0.0	.	1457	Q96JM4	LRIQ1_HUMAN	H	1457	ENSP00000376910:R1457H	ENSP00000376910:R1457H	R	+	2	0	LRRIQ1	84070229	0.842000	0.29525	0.991000	0.47740	0.960000	0.62799	1.063000	0.30567	0.583000	0.29574	0.586000	0.80456	CGC		0.378	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2		NM_032165	
MAGEB6	158809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	26212326	26212326	+	Silent	SNP	C	C	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chrX:26212326C>G	ENST00000379034.1	+	2	512	c.363C>G	c.(361-363)ggC>ggG	p.G121G		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	121	Ser-rich.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GTGTTTCAGGCTCAAAATATG	0.542																																																	0													83.0	76.0	79.0					X																	26212326		2189	4254	6443	SO:0001819	synonymous_variant	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.363C>G	X.37:g.26212326C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6GS19|Q9H219	Silent	SNP	ENST00000379034.1	37	CCDS14217.1																																																																																				0.542	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1		NM_173523	
MAK16	84549	hgsc.bcm.edu	37	8	33354235	33354236	+	In_Frame_Ins	INS	-	-	GAT	rs376700753|rs71707869	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr8:33354235_33354236insGAT	ENST00000360128.6	+	8	1072_1073	c.615_616insGAT	c.(616-618)gat>GATgat	p.206_206D>DD	TTI2_ENST00000519356.1_Intron	NM_032509.3	NP_115898.2	Q9BXY0	MAK16_HUMAN	MAK16 homolog (S. cerevisiae)	206	Asp-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	8						CTGAGGAAAAAgatgatgatga	0.396														218	0.0435304	0.1165	0.0288	5008	,	,		19565	0.0		0.0308	False		,,,				2504	0.0133																0																																										SO:0001652	inframe_insertion	84549			AF251062	CCDS6089.1	8p12	2011-10-13	2008-06-04	2008-06-04	ENSG00000198042	ENSG00000198042		"""RNA binding motif (RRM) containing"""	13703	protein-coding gene	gene with protein product			"""RNA binding motif protein 13"""	RBM13			Standard	NM_032509		Approved	MAK16L	uc003xjj.3	Q9BXY0	OTTHUMG00000163957	ENST00000360128.6:c.631_633dupGAT	8.37:g.33354242_33354244dupGAT	ENSP00000353246:p.Asp211dup	Somatic		WXS	Illumina HiSeq	Phase_I	B2RB44|Q5U5T1|Q86UC4|Q96SY6	In_Frame_Ins	INS	ENST00000360128.6	37	CCDS6089.1																																																																																				0.396	MAK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376559.3		NM_032509	
MITF	4286	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	69928509	69928509	+	Missense_Mutation	SNP	C	C	T	rs190215588		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr3:69928509C>T	ENST00000448226.2	+	2	456	c.329C>T	c.(328-330)aCg>aTg	p.T110M	MITF_ENST00000314589.5_Missense_Mutation_p.T94M|MITF_ENST00000394355.2_Missense_Mutation_p.T85M|MITF_ENST00000472437.1_Missense_Mutation_p.T58M|MITF_ENST00000352241.4_Missense_Mutation_p.T110M|MITF_ENST00000328528.6_Missense_Mutation_p.T109M			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	110					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CCCTCTGCCACGCAGGTGCCG	0.527			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""						C|||	1	0.000199681	0.0	0.0014	5008	,	,		19008	0.0		0.0	False		,,,				2504	0.0				Melanoma(29;269 969 31479 41502 42961)			Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	0								C	MET/THR,MET/THR,MET/THR,MET/THR	0,4280		0,0,2140	59.0	68.0	65.0		173,326,329,281	6.0	1.0	3		65	3,8487		0,3,4242	yes	missense,missense,missense,missense	MITF	NM_001184967.1,NM_006722.2,NM_198159.2,NM_198177.2	81,81,81,81	0,3,6382	TT,TC,CC		0.0353,0.0,0.0235	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	58/469,109/520,110/521,94/505	69928509	3,12767	2140	4245	6385	SO:0001583	missense	4286				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.329C>T	3.37:g.69928509C>T	ENSP00000391803:p.Thr110Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	17.71	3.457179	0.63401	0.0	3.53E-4	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000429090;ENST00000433517;ENST00000472437;ENST00000457080;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355	T;T;T;T;T;T;T;T	0.45276	2.76;2.28;2.56;0.9;2.75;1.96;2.76;2.78	6.02	6.02	0.97574	.	0.259337	0.45361	D	0.000380	T	0.27027	0.0662	N	0.17474	0.49	0.50632	D	0.999887	B;P;P;B;P	0.36125	0.266;0.538;0.538;0.227;0.538	B;B;B;B;B	0.22601	0.012;0.04;0.04;0.024;0.04	T	0.05305	-1.0893	9	.	.	.	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	58;85;94;109;110	E9PFN0;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.	M	110;110;58;58;58;109;109;94;94;85	ENSP00000295600:T110M;ENSP00000391803:T110M;ENSP00000418845:T58M;ENSP00000391276:T109M;ENSP00000327867:T109M;ENSP00000398639:T94M;ENSP00000324443:T94M;ENSP00000377884:T85M	.	T	+	2	0	MITF	70011199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.456000	0.80751	2.865000	0.98341	0.655000	0.94253	ACG		0.527	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1		NM_198159	
MTUS2	23281	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	29608253	29608253	+	Missense_Mutation	SNP	G	G	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr13:29608253G>T	ENST00000431530.3	+	2	2525	c.2467G>T	c.(2467-2469)Gat>Tat	p.D823Y		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	813	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTACAGTTCCGATCCTTCAGG	0.458																																																	0													102.0	105.0	104.0					13																	29608253		2100	4213	6313	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2467G>T	13.37:g.29608253G>T	ENSP00000392057:p.Asp823Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592964	0.66219	.	.	ENSG00000132938	ENST00000431530	T	0.23754	1.89	5.27	5.27	0.74061	.	0.398317	0.23026	N	0.052792	T	0.49745	0.1575	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.37430	-0.9706	9	.	.	.	.	18.2493	0.89997	0.0:0.0:1.0:0.0	.	813	Q5JR59	MTUS2_HUMAN	Y	823	ENSP00000392057:D823Y	.	D	+	1	0	MTUS2	28506253	1.000000	0.71417	0.112000	0.21494	0.116000	0.19942	6.929000	0.75852	2.614000	0.88457	0.655000	0.94253	GAT		0.458	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3		XM_166270	
MUC2	4583	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1087470	1087470	+	Missense_Mutation	SNP	C	C	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr11:1087470C>A	ENST00000441003.2	+	24	3248	c.3221C>A	c.(3220-3222)gCc>gAc	p.A1074D	MUC2_ENST00000359061.5_Missense_Mutation_p.A1074D	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1074					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TTCTACGAGGCCTGTGTGCAC	0.657																																																	0													72.0	86.0	81.0					11																	1087470		2156	4249	6405	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3221C>A	11.37:g.1087470C>A	ENSP00000415183:p.Ala1074Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	14.44	2.537011	0.45176	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.77489	-1.1;-1.1	3.62	3.62	0.41486	.	0.359030	0.20301	U	0.095022	D	0.87289	0.6140	M	0.75264	2.295	0.25582	N	0.986785	D	0.76494	0.999	D	0.87578	0.998	T	0.80386	-0.1404	10	0.87932	D	0	.	15.867	0.79071	0.0:1.0:0.0:0.0	.	1074	E7EUV1	.	D	1074	ENSP00000415183:A1074D;ENSP00000351956:A1074D	ENSP00000351956:A1074D	A	+	2	0	MUC2	1077470	0.985000	0.35326	0.998000	0.56505	0.595000	0.36748	2.257000	0.43240	2.028000	0.59812	0.479000	0.44913	GCC		0.657	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
MYO1A	4640	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57437906	57437906	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr12:57437906C>T	ENST00000442789.2	-	10	1015	c.728G>A	c.(727-729)aGc>aAc	p.S243N	MYO1A_ENST00000300119.3_Missense_Mutation_p.S243N|MYO1A_ENST00000544473.1_Missense_Mutation_p.S81N	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	243	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						AGCCCTGAAGCTGGAGGCGTC	0.562																																																	0													100.0	90.0	94.0					12																	57437906		2203	4300	6503	SO:0001583	missense	4640			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.728G>A	12.37:g.57437906C>T	ENSP00000393392:p.Ser243Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	37	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	C	2.469	-0.322236	0.05350	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.71103	-0.54;-0.54;-0.54	4.81	2.5	0.30297	Myosin head, motor domain (2);	0.099755	0.64402	N	0.000003	T	0.35537	0.0935	N	0.02865	-0.47	0.25449	N	0.988025	B	0.02656	0.0	B	0.04013	0.001	T	0.33085	-0.9882	10	0.02654	T	1	.	5.3982	0.16281	0.0:0.2499:0.0:0.7501	.	243	Q9UBC5	MYO1A_HUMAN	N	243;243;81	ENSP00000300119:S243N;ENSP00000393392:S243N;ENSP00000440514:S81N	ENSP00000300119:S243N	S	-	2	0	MYO1A	55724173	1.000000	0.71417	0.996000	0.52242	0.875000	0.50365	3.489000	0.53237	0.446000	0.26666	0.563000	0.77884	AGC		0.562	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2		NM_005379	
NMT2	9397	hgsc.bcm.edu	37	10	15151779	15151779	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr10:15151779delT	ENST00000378165.4	-	11	1478	c.1398delA	c.(1396-1398)aaafs	p.K466fs	NMT2_ENST00000378150.1_Frame_Shift_Del_p.K453fs|NMT2_ENST00000535341.1_Frame_Shift_Del_p.K453fs|NMT2_ENST00000466201.1_5'UTR|NMT2_ENST00000540259.1_Frame_Shift_Del_p.K278fs|RPP38_ENST00000451677.1_Intron	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	466					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						CAAACTTGAGTTTTTCCAAGA	0.338																																					Melanoma(117;1345 1645 4130 12688 30625)												0													128.0	126.0	127.0					10																	15151779		2203	4300	6503	SO:0001589	frameshift_variant	9397			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1398delA	10.37:g.15151779delT	ENSP00000367407:p.Lys466fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Frame_Shift_Del	DEL	ENST00000378165.4	37	CCDS7109.1																																																																																				0.338	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046958.2		NM_004808	
NRAP	4892	hgsc.bcm.edu;ucsc.edu	37	10	115389356	115389356	+	Silent	SNP	G	G	C	rs2286736	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr10:115389356G>C	ENST00000359988.3	-	19	2275	c.2031C>G	c.(2029-2031)ctC>ctG	p.L677L	NRAP_ENST00000369360.3_Silent_p.L650L|NRAP_ENST00000369358.4_Silent_p.L685L|NRAP_ENST00000360478.3_Silent_p.L642L	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CCTCGCTCTGGAGCCCATAGG	0.483																																																	0													110.0	92.0	98.0					10																	115389356		2203	4300	6503	SO:0001819	synonymous_variant	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2031C>G	10.37:g.115389356G>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000359988.3	37	CCDS7579.1																																																																																				0.483	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2		NM_006175	
OR2J3	442186	broad.mit.edu;hgsc.bcm.edu	37	6	29079901	29079901	+	Silent	SNP	C	C	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr6:29079901C>G	ENST00000377169.1	+	1	234	c.234C>G	c.(232-234)acC>acG	p.T78T		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						GCTACACCACCAGCTCTATCC	0.473																																																	0													205.0	210.0	209.0					6																	29079901		1287	2612	3899	SO:0001819	synonymous_variant	442186				CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.234C>G	6.37:g.29079901C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Silent	SNP	ENST00000377169.1	37	CCDS43433.1																																																																																				0.473	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2			
PDC	5132	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	186415580	186415580	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:186415580G>A	ENST00000391997.2	-	3	278	c.191C>T	c.(190-192)tCa>tTa	p.S64L	PDC_ENST00000497198.1_Missense_Mutation_p.S12L|PDC_ENST00000340129.5_Missense_Mutation_p.S64L|PDC_ENST00000456239.2_Missense_Mutation_p.S12L	NM_002597.4	NP_002588.3	P20941	PHOS_HUMAN	phosducin	64					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of catalytic activity (GO:0043086)|phototransduction (GO:0007602)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	phospholipase inhibitor activity (GO:0004859)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		TCGTTCCTTTGAATCTTTGCC	0.338																																																	0													135.0	130.0	132.0					1																	186415580		2203	4300	6503	SO:0001583	missense	5132			AF076464	CCDS1370.1, CCDS41447.1	1q25.2	2013-01-08			ENSG00000116703	ENSG00000116703			8759	protein-coding gene	gene with protein product		171490				8288249	Standard	NM_022576		Approved	MEKA	uc001gsa.4	P20941	OTTHUMG00000035575	ENST00000391997.2:c.191C>T	1.37:g.186415580G>A	ENSP00000375855:p.Ser64Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14816|Q9UP22|Q9UP23	Missense_Mutation	SNP	ENST00000391997.2	37	CCDS1370.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123089	0.37436	.	.	ENSG00000116703	ENST00000391997;ENST00000497198;ENST00000456239;ENST00000340129	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	5.36	5.36	0.76844	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	0.595385	0.17558	N	0.169934	T	0.11623	0.0283	N	0.10874	0.06	0.50313	D	0.999868	B	0.26775	0.159	B	0.24701	0.055	T	0.26326	-1.0106	10	0.21014	T	0.42	-39.6172	19.0908	0.93225	0.0:0.0:1.0:0.0	.	64	P20941	PHOS_HUMAN	L	64;12;12;64	ENSP00000375855:S64L;ENSP00000422775:S12L;ENSP00000411564:S12L;ENSP00000342033:S64L	ENSP00000342033:S64L	S	-	2	0	PDC	184682203	1.000000	0.71417	0.584000	0.28653	0.166000	0.22503	6.988000	0.76212	2.498000	0.84270	0.591000	0.81541	TCA		0.338	PDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086347.2		NM_022577	
PDCD6IP	10015	broad.mit.edu;hgsc.bcm.edu	37	3	33887039	33887039	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr3:33887039A>T	ENST00000307296.3	+	12	1977	c.1600A>T	c.(1600-1602)Atc>Ttc	p.I534F	PDCD6IP_ENST00000457054.2_Missense_Mutation_p.I539F			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	534	Interaction with EIAV p9.|Self-association.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						GAATGCTGCCATCCCTTCTGC	0.468																																																	0													111.0	91.0	98.0					3																	33887039		2203	4298	6501	SO:0001583	missense	10015			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.1600A>T	3.37:g.33887039A>T	ENSP00000307387:p.Ile534Phe	Somatic		WXS	Illumina HiSeq	Phase_I	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	ENST00000307296.3	37	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	A	33	5.262669	0.95399	.	.	ENSG00000170248	ENST00000307296;ENST00000457054	T;T	0.33216	1.42;1.42	5.35	5.35	0.76521	.	0.159135	0.53938	D	0.000046	T	0.49253	0.1546	M	0.67953	2.075	0.80722	D	1	D;D;D	0.69078	0.98;0.991;0.997	P;P;P	0.58928	0.637;0.801;0.848	T	0.47711	-0.9096	10	0.42905	T	0.14	-11.4853	15.3395	0.74284	1.0:0.0:0.0:0.0	.	315;539;534	B7Z5C1;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	F	534;539	ENSP00000307387:I534F;ENSP00000411825:I539F	ENSP00000307387:I534F	I	+	1	0	PDCD6IP	33862043	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.228000	0.95250	2.032000	0.59987	0.455000	0.32223	ATC		0.468	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2			
PI4K2B	55300	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	25258214	25258214	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr4:25258214C>T	ENST00000264864.6	+	4	863	c.674C>T	c.(673-675)gCa>gTa	p.A225V	PI4K2B_ENST00000512921.1_Missense_Mutation_p.A129V	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	225	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				ATTGACCGTGCAAAATCAAGA	0.363																																																	0													119.0	118.0	118.0					4																	25258214		2203	4300	6503	SO:0001583	missense	55300			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.674C>T	4.37:g.25258214C>T	ENSP00000264864:p.Ala225Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NUW2	Missense_Mutation	SNP	ENST00000264864.6	37	CCDS3433.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164878	0.57476	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	T;T	0.74632	-0.86;-0.86	6.07	6.07	0.98685	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.82323	2.585	0.80722	D	1	P	0.39022	0.655	B	0.43018	0.405	T	0.77360	-0.2617	10	0.23302	T	0.38	-16.8072	20.6593	0.99626	0.0:1.0:0.0:0.0	.	225	Q8TCG2	P4K2B_HUMAN	V	129;225;194	ENSP00000423373:A129V;ENSP00000264864:A225V	ENSP00000264864:A225V	A	+	2	0	PI4K2B	24867312	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.188000	0.50958	2.885000	0.99019	0.655000	0.94253	GCA		0.363	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1		NM_018323	
PKHD1	5314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	51524031	51524031	+	Silent	SNP	A	A	G			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr6:51524031A>G	ENST00000371117.3	-	61	11168	c.10893T>C	c.(10891-10893)taT>taC	p.Y3631Y		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3631					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.Y3631Y(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CAACTCTTCTATAATGACTAG	0.448																																																	1	Substitution - coding silent(1)	ovary(1)											122.0	121.0	121.0					6																	51524031		2203	4300	6503	SO:0001819	synonymous_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10893T>C	6.37:g.51524031A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1																																																																																				0.448	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1		NM_138694	
PLG	5340	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	161152232	161152232	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr6:161152232T>C	ENST00000308192.9	+	11	1469	c.1406T>C	c.(1405-1407)cTg>cCg	p.L469P		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	469					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CCTGTTGTCCTGCTTCCAGAT	0.498																																																	0													101.0	92.0	95.0					6																	161152232		2203	4300	6503	SO:0001583	missense	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1406T>C	6.37:g.161152232T>C	ENSP00000308938:p.Leu469Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.775779	0.31411	.	.	ENSG00000122194	ENST00000308192	T	0.63417	-0.04	4.5	2.02	0.26589	Kringle-like fold (1);	0.563165	0.13282	U	0.399663	T	0.13457	0.0326	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19224	-1.0312	10	0.26408	T	0.33	.	0.8475	0.01165	0.4782:0.2073:0.1149:0.1995	.	469	P00747	PLMN_HUMAN	P	469	ENSP00000308938:L469P	ENSP00000308938:L469P	L	+	2	0	PLG	161072222	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.108000	0.10857	0.238000	0.21222	-0.364000	0.07487	CTG		0.498	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2		NM_000301	
POLR2A	5430	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7417116	7417116	+	Missense_Mutation	SNP	T	T	C	rs564268404		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr17:7417116T>C	ENST00000322644.6	+	29	5932	c.5533T>C	c.(5533-5535)Tct>Cct	p.S1845P		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1845	C-terminal domain (CTD); 52 X 7 AA approximate tandem repeats of Y-[ST]-P- [STQ]-[ST]-P-[SRTEVKGN].				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				AACCAGTCCTTCTTACAGTCC	0.572													T|||	1	0.000199681	0.0	0.0	5008	,	,		16315	0.0		0.0	False		,,,				2504	0.001																0													237.0	230.0	233.0					17																	7417116		2203	4300	6503	SO:0001583	missense	5430					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.5533T>C	17.37:g.7417116T>C	ENSP00000314949:p.Ser1845Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.277776	0.40294	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.71579	-0.58	3.94	2.84	0.33178	.	0.305275	0.19908	U	0.103359	T	0.76933	0.4057	M	0.84683	2.71	0.80722	D	1	P	0.43826	0.818	P	0.50314	0.637	T	0.72587	-0.4248	10	0.27082	T	0.32	.	8.7695	0.34724	0.1695:0.0:0.0:0.8305	.	1845	P24928	RPB1_HUMAN	P	1801;1845	ENSP00000314949:S1845P	ENSP00000314949:S1845P	S	+	1	0	SLC35G6	7357840	0.010000	0.17322	0.982000	0.44146	0.840000	0.47671	1.368000	0.34216	0.566000	0.29273	0.248000	0.18094	TCT		0.572	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1		NM_000937	
PPWD1	23398	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	64867889	64867889	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr5:64867889T>C	ENST00000261308.5	+	5	817	c.745T>C	c.(745-747)Tac>Cac	p.Y249H	PPWD1_ENST00000538977.1_Missense_Mutation_p.Y93H|PPWD1_ENST00000535264.1_Missense_Mutation_p.Y219H	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1	249					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		GATGATTGAATACTGGACTGG	0.373																																																	0													82.0	86.0	84.0					5																	64867889		2203	4300	6503	SO:0001583	missense	23398			AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.745T>C	5.37:g.64867889T>C	ENSP00000261308:p.Tyr249His	Somatic		WXS	Illumina HiSeq	Phase_I	B4DWR9|Q15002|Q7KZ89	Missense_Mutation	SNP	ENST00000261308.5	37	CCDS3985.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.030171	0.75504	.	.	ENSG00000113593	ENST00000261308;ENST00000535264;ENST00000538977;ENST00000505380	T;T;T;T	0.63096	-0.02;-0.02;5.02;-0.02	5.83	4.68	0.58851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.054065	0.85682	N	0.000000	T	0.81479	0.4831	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.84108	0.0399	10	0.87932	D	0	.	11.5754	0.50858	0.0:0.0694:0.0:0.9306	.	219;249	F5H7P7;Q96BP3	.;PPWD1_HUMAN	H	249;219;93;168	ENSP00000261308:Y249H;ENSP00000442371:Y219H;ENSP00000444496:Y93H;ENSP00000423234:Y168H	ENSP00000261308:Y249H	Y	+	1	0	PPWD1	64903645	1.000000	0.71417	0.974000	0.42286	0.992000	0.81027	7.979000	0.88103	1.043000	0.40175	0.402000	0.26972	TAC		0.373	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253970.2		NM_015342	
PRSS12	8492	hgsc.bcm.edu;ucsc.edu	37	4	119239601	119239601	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr4:119239601delT	ENST00000296498.3	-	5	1364	c.1082delA	c.(1081-1083)aagfs	p.K361fs		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	361	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CCAGGAGCTCTTTGGACACTG	0.483																																																	0													115.0	109.0	111.0					4																	119239601		2203	4300	6503	SO:0001589	frameshift_variant	8492			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.1082delA	4.37:g.119239601delT	ENSP00000296498:p.Lys361fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UP16	Frame_Shift_Del	DEL	ENST00000296498.3	37	CCDS3709.1																																																																																				0.483	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2			
PXDN	7837	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	1677555	1677555	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr2:1677555C>T	ENST00000252804.4	-	9	928	c.878G>A	c.(877-879)cGc>cAc	p.R293H	PXDN_ENST00000483018.1_5'UTR	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	293	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CAAGTTTAGGCGGGAATCTGT	0.507																																																	0													124.0	126.0	125.0					2																	1677555		2055	4200	6255	SO:0001583	missense	7837			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.878G>A	2.37:g.1677555C>T	ENSP00000252804:p.Arg293His	Somatic		WXS	Illumina HiSeq	Phase_I	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.356500|4.356500	0.82243|0.82243	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000433670|ENST00000252804	.|T	.|0.51574	.|0.7	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.056903	.|0.64402	.|D	.|0.000001	T|T	0.65637|0.65637	0.2710|0.2710	L|L	0.57536|0.57536	1.79|1.79	0.58432|0.58432	D|D	0.999998|0.999998	.|D;P	.|0.76494	.|0.999;0.58	.|D;B	.|0.70016	.|0.967;0.187	T|T	0.68078|0.68078	-0.5504|-0.5504	5|10	.|0.87932	.|D	.|0	-30.6332|-30.6332	17.3575|17.3575	0.87341|0.87341	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|293;293	.|Q92626-2;Q92626	.|.;PXDN_HUMAN	T|H	289|293	.|ENSP00000252804:R293H	.|ENSP00000252804:R293H	A|R	-|-	1|2	0|0	PXDN|PXDN	1656562|1656562	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.525000|0.525000	0.34531|0.34531	7.683000|7.683000	0.84093|0.84093	2.583000|2.583000	0.87209|0.87209	0.561000|0.561000	0.74099|0.74099	GCC|CGC		0.507	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1		XM_056455	
RHCG	51458	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	90039695	90039695	+	Silent	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr15:90039695C>T	ENST00000268122.4	-	1	149	c.81G>A	c.(79-81)ggG>ggA	p.G27G	RHCG_ENST00000544600.1_Silent_p.G27G	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	27					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					GCACGAACACCCCGAAGAGAA	0.607																																																	0													122.0	111.0	115.0					15																	90039695		2200	4299	6499	SO:0001819	synonymous_variant	51458			AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.81G>A	15.37:g.90039695C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4D4|Q6X3Y4	Silent	SNP	ENST00000268122.4	37	CCDS10351.1																																																																																				0.607	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2		NM_016321	
SATB2	23314	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	200213434	200213434	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr2:200213434T>C	ENST00000417098.1	-	7	1979	c.1163A>G	c.(1162-1164)aAc>aGc	p.N388S	SATB2_ENST00000443023.1_Missense_Mutation_p.N329S|SATB2_ENST00000260926.5_Missense_Mutation_p.N388S|SATB2_ENST00000428695.1_Missense_Mutation_p.N270S|SATB2_ENST00000457245.1_Missense_Mutation_p.N388S	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	388					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTGTGTGCGGTTGAATGCCAC	0.403																																					Colon(30;262 767 11040 24421 36230)												0													117.0	114.0	115.0					2																	200213434		2203	4300	6503	SO:0001583	missense	23314			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1163A>G	2.37:g.200213434T>C	ENSP00000401112:p.Asn388Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.526025	0.85600	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.54279	0.6;0.62;0.6;0.58;0.6	5.72	5.72	0.89469	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.66376	0.2783	L	0.42245	1.32	0.58432	D	0.999998	D;D;D	0.89917	0.997;1.0;0.999	D;D;D	0.87578	0.923;0.998;0.987	T	0.68254	-0.5457	10	0.62326	D	0.03	-5.8028	16.0102	0.80396	0.0:0.0:0.0:1.0	.	270;136;388	Q3ZB87;Q9H726;Q9UPW6	.;.;SATB2_HUMAN	S	388;329;388;270;388	ENSP00000401112:N388S;ENSP00000388764:N329S;ENSP00000260926:N388S;ENSP00000388581:N270S;ENSP00000405420:N388S	ENSP00000260926:N388S	N	-	2	0	SATB2	199921679	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.997000	0.88414	2.190000	0.69967	0.533000	0.62120	AAC		0.403	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1		NM_015265	
SENP1	29843	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	48442848	48442848	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr12:48442848G>A	ENST00000004980.5	-	14	1953	c.1475C>T	c.(1474-1476)gCa>gTa	p.A492V	SENP1_ENST00000551330.1_Missense_Mutation_p.A492V|SENP1_ENST00000549518.1_Missense_Mutation_p.A492V|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000549595.1_Missense_Mutation_p.A492V|SENP1_ENST00000448372.1_Missense_Mutation_p.A492V			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	492	Protease.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				GGTATTAAATGCATGCACACT	0.363																																																	0													111.0	105.0	107.0					12																	48442848		1865	4114	5979	SO:0001583	missense	29843			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.1475C>T	12.37:g.48442848G>A	ENSP00000004980:p.Ala492Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7P5|Q86XC8	Missense_Mutation	SNP	ENST00000004980.5	37	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764302	0.89932	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.62	5.62	0.85841	.	0.139486	0.52532	D	0.000072	T	0.29288	0.0729	L	0.37561	1.115	0.80722	D	1	D;P	0.53312	0.959;0.949	P;B	0.46339	0.513;0.379	T	0.00928	-1.1511	10	0.40728	T	0.16	-10.9154	19.2729	0.94018	0.0:0.0:1.0:0.0	.	492;492	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	V	492	ENSP00000004980:A492V;ENSP00000394791:A492V;ENSP00000446681:A492V;ENSP00000450076:A492V;ENSP00000447328:A492V	ENSP00000004980:A492V	A	-	2	0	SENP1	46729115	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.550000	0.73905	2.645000	0.89757	0.650000	0.86243	GCA		0.363	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1		NM_014554	
SERPING1	710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	57373959	57373959	+	Missense_Mutation	SNP	C	C	G	rs61761890	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr11:57373959C>G	ENST00000278407.4	+	6	1195	c.968C>G	c.(967-969)cCc>cGc	p.P323R	SERPING1_ENST00000378324.2_Missense_Mutation_p.P271R|SERPING1_ENST00000378323.4_Missense_Mutation_p.P328R|SERPING1_ENST00000340687.6_Missense_Mutation_p.P323R|SERPING1_ENST00000403558.1_Missense_Mutation_p.P366R	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	323					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						ATAAAAGTGCCCATGATGAAT	0.428																																																	0													159.0	153.0	155.0					11																	57373959		2201	4296	6497	SO:0001583	missense	710			X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.968C>G	11.37:g.57373959C>G	ENSP00000278407:p.Pro323Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Missense_Mutation	SNP	ENST00000278407.4	37	CCDS7962.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158135	0.57368	.	.	ENSG00000149131	ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62	5.49	0.471	0.16752	Serpin domain (3);	0.848145	0.10481	N	0.669631	D	0.92202	0.7527	M	0.69358	2.11	0.29260	N	0.871368	P;D;P;P	0.56968	0.869;0.978;0.869;0.869	P;P;P;P	0.58013	0.557;0.831;0.557;0.557	D	0.84894	0.0838	10	0.51188	T	0.08	.	8.6538	0.34051	0.0:0.6126:0.0:0.3874	.	328;366;323;323	B4E1F0;E9PGN7;E9KL26;P05155	.;.;.;IC1_HUMAN	R	323;323;328;271;366	ENSP00000278407:P323R;ENSP00000341861:P323R;ENSP00000367574:P328R;ENSP00000367575:P271R;ENSP00000384420:P366R	ENSP00000278407:P323R	P	+	2	0	SERPING1	57130535	0.029000	0.19370	0.964000	0.40570	0.885000	0.51271	-0.493000	0.06459	0.045000	0.15804	-0.137000	0.14449	CCC		0.428	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1		NM_000062	
SLC20A2	6575	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	42317465	42317465	+	Missense_Mutation	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr8:42317465C>T	ENST00000342228.3	-	5	931	c.562G>A	c.(562-564)Gct>Act	p.A188T	SLC20A2_ENST00000520262.1_Missense_Mutation_p.A188T|SLC20A2_ENST00000520179.1_Missense_Mutation_p.A188T	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	188					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ATGGTAGCAGCATAGAATACT	0.502																																																	0													108.0	91.0	96.0					8																	42317465		2203	4300	6503	SO:0001583	missense	6575				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.562G>A	8.37:g.42317465C>T	ENSP00000340465:p.Ala188Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	.	.	.	.	.	.	.	.	.	.	C	34	5.358206	0.95854	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.91521	-2.86;-2.86;-2.86	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.93190	0.7831	L	0.46741	1.465	0.80722	D	1	D	0.56287	0.975	D	0.69142	0.962	D	0.90790	0.4686	10	0.26408	T	0.33	-21.8667	17.9231	0.88973	0.0:1.0:0.0:0.0	.	188	Q08357	S20A2_HUMAN	T	188	ENSP00000340465:A188T;ENSP00000429754:A188T;ENSP00000429712:A188T	ENSP00000340465:A188T	A	-	1	0	SLC20A2	42436622	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.814000	0.86154	2.833000	0.97629	0.655000	0.94253	GCT		0.502	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1			
SYDE2	84144	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	85648743	85648743	+	Missense_Mutation	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:85648743T>C	ENST00000341460.5	-	3	1631	c.1582A>G	c.(1582-1584)Aaa>Gaa	p.K528E		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	528					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		ATGGAAAGTTTCCTCACAGTT	0.353																																																	0													149.0	153.0	152.0					1																	85648743		1822	4080	5902	SO:0001583	missense	84144			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1582A>G	1.37:g.85648743T>C	ENSP00000340594:p.Lys528Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	37	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041908	0.75732	.	.	ENSG00000097096	ENST00000341460	T	0.13420	2.59	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.29850	0.0746	M	0.78916	2.43	0.58432	D	0.999997	D;D	0.76494	0.998;0.999	D;D	0.75484	0.965;0.986	T	0.06588	-1.0818	10	0.56958	D	0.05	.	15.4204	0.75006	0.0:0.0:0.0:1.0	.	528;528	Q5VT97;Q5VT97-2	SYDE2_HUMAN;.	E	528	ENSP00000340594:K528E	ENSP00000340594:K528E	K	-	1	0	SYDE2	85421331	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.695000	0.84257	2.065000	0.61736	0.524000	0.50904	AAA		0.353	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2			
TNKS1BP1	85456	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	57077445	57077445	+	Missense_Mutation	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr11:57077445G>A	ENST00000532437.1	-	5	3051	c.2740C>T	c.(2740-2742)Cac>Tac	p.H914Y	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.H914Y|TNKS1BP1_ENST00000530920.1_5'UTR			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	914	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CTACCATGGTGGTCCCTCTTC	0.572																																																	0													190.0	184.0	186.0					11																	57077445		2201	4296	6497	SO:0001583	missense	85456			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.2740C>T	11.37:g.57077445G>A	ENSP00000437271:p.His914Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.651342	0.00785	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.30448	1.53;1.53	5.17	3.22	0.36961	.	1.395550	0.04569	N	0.392900	T	0.19046	0.0457	N	0.22421	0.69	0.09310	N	1	B	0.33135	0.399	B	0.31686	0.134	T	0.11891	-1.0569	10	0.02654	T	1	0.1175	8.2807	0.31898	0.0859:0.0:0.7561:0.158	.	914	Q9C0C2	TB182_HUMAN	Y	914	ENSP00000350990:H914Y;ENSP00000437271:H914Y	ENSP00000350990:H914Y	H	-	1	0	TNKS1BP1	56834021	0.000000	0.05858	0.042000	0.18584	0.114000	0.19823	0.786000	0.26844	1.286000	0.44565	0.462000	0.41574	CAC		0.572	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1		NM_033396	
USP24	23358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55622657	55622657	+	Silent	SNP	C	C	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:55622657C>T	ENST00000294383.6	-	12	1409	c.1410G>A	c.(1408-1410)ttG>ttA	p.L470L	USP24_ENST00000407756.1_Silent_p.L358L	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	470					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CATCTAACGACAATTTACTAC	0.368																																																	0													189.0	184.0	186.0					1																	55622657		1835	4091	5926	SO:0001819	synonymous_variant	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.1410G>A	1.37:g.55622657C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	37	CCDS44154.2																																																																																				0.368	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			
USP32	84669	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	58282987	58282987	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr17:58282987A>C	ENST00000300896.4	-	26	3264	c.3070T>G	c.(3070-3072)Ttc>Gtc	p.F1024V	USP32_ENST00000592339.1_Missense_Mutation_p.F694V	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1024	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			GTTAGGGTGAACATTTCATTT	0.398																																																	0													173.0	155.0	161.0					17																	58282987		2203	4300	6503	SO:0001583	missense	84669			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3070T>G	17.37:g.58282987A>C	ENSP00000300896:p.Phe1024Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	A	8.675	0.903734	0.17760	.	.	ENSG00000170832	ENST00000300896	T	0.39997	1.05	4.72	3.41	0.39046	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.533271	0.20961	N	0.082567	T	0.20251	0.0487	N	0.16567	0.415	0.42614	D	0.993327	B	0.02656	0.0	B	0.06405	0.002	T	0.10428	-1.0630	10	0.15952	T	0.53	.	3.4752	0.07582	0.6587:0.0:0.3413:0.0	.	1024	Q8NFA0	UBP32_HUMAN	V	1024	ENSP00000300896:F1024V	ENSP00000300896:F1024V	F	-	1	0	USP32	55637769	1.000000	0.71417	0.983000	0.44433	0.781000	0.44180	4.910000	0.63321	1.881000	0.54492	0.533000	0.62120	TTC		0.398	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2		NM_032582	
ZBTB1	22890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	64988623	64988623	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr14:64988623A>T	ENST00000554015.1	+	4	832	c.401A>T	c.(400-402)cAg>cTg	p.Q134L	ZBTB1_ENST00000394712.2_Missense_Mutation_p.Q134L|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Missense_Mutation_p.Q134L			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	134					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		TCCAGCAAACAGAACAGCAAA	0.418																																																	0													107.0	108.0	108.0					14																	64988623		2203	4300	6503	SO:0001583	missense	22890			AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.401A>T	14.37:g.64988623A>T	ENSP00000451000:p.Gln134Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	A	10.02	1.236555	0.22711	.	.	ENSG00000126804	ENST00000553583;ENST00000554015;ENST00000358738;ENST00000394712	T;T;T;T	0.59906	0.23;2.89;3.45;2.89	5.91	4.78	0.61160	.	0.342197	0.26567	N	0.023647	T	0.39200	0.1069	N	0.12182	0.205	0.38834	D	0.955913	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.39210	-0.9625	10	0.72032	D	0.01	-8.0448	11.4297	0.50032	0.9304:0.0:0.0696:0.0	.	134;134	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	L	134	ENSP00000451584:Q134L;ENSP00000451000:Q134L;ENSP00000351587:Q134L;ENSP00000378201:Q134L	ENSP00000351587:Q134L	Q	+	2	0	ZBTB1	64058376	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.036000	0.57304	2.254000	0.74563	0.533000	0.62120	CAG		0.418	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1			
ZNF107	51427	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	64166913	64166913	+	Missense_Mutation	SNP	G	G	C	rs201233350		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr7:64166913G>C	ENST00000395391.1	+	4	1606	c.231G>C	c.(229-231)caG>caC	p.Q77H	ZNF107_ENST00000344930.3_Missense_Mutation_p.Q77H|ZNF107_ENST00000423627.1_Missense_Mutation_p.Q77H			Q9UII5	ZN107_HUMAN	zinc finger protein 107	77					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q77H(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AAATATTCCAGTGTAATAAAT	0.333																																																	1	Substitution - Missense(1)	lung(1)											56.0	52.0	53.0					7																	64166913		2203	4300	6503	SO:0001583	missense	51427			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.231G>C	7.37:g.64166913G>C	ENSP00000378789:p.Gln77His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000395391.1	37	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	6.495	0.459614	0.12342	.	.	ENSG00000196247	ENST00000541526;ENST00000360117;ENST00000344930;ENST00000423627;ENST00000395391	T;T;T;T	0.36520	4.51;1.25;1.25;1.25	0.916	-1.83	0.07833	.	.	.	.	.	T	0.43656	0.1257	M	0.94142	3.5	0.09310	N	1	B	0.25206	0.12	B	0.23018	0.043	T	0.43196	-0.9406	9	0.59425	D	0.04	.	3.3593	0.07181	0.3596:0.2313:0.4091:0.0	.	77	Q9UII5	ZN107_HUMAN	H	77	ENSP00000353234:Q77H;ENSP00000343443:Q77H;ENSP00000400037:Q77H;ENSP00000378789:Q77H	ENSP00000343443:Q77H	Q	+	3	2	ZNF107	63804348	0.002000	0.14202	0.006000	0.13384	0.006000	0.05464	-1.325000	0.02687	-2.126000	0.00820	-2.125000	0.00346	CAG		0.333	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1		NM_016220	
ZNF182	7569	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	47836772	47836772	+	Silent	SNP	T	T	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chrX:47836772T>C	ENST00000396965.1	-	7	1064	c.714A>G	c.(712-714)gcA>gcG	p.A238A	ZNF182_ENST00000305127.6_Silent_p.A238A|ZNF182_ENST00000376943.3_Silent_p.A219A	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	238					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						TTTTCCTACATGCAGTACATT	0.408																																																	0													78.0	76.0	77.0					X																	47836772		2203	4300	6503	SO:0001819	synonymous_variant	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.714A>G	X.37:g.47836772T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2IDD7|Q3KP67|Q96QH7	Silent	SNP	ENST00000396965.1	37	CCDS35236.1																																																																																				0.408	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277055.1		NM_006962	
ZNF445	353274	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	44488853	44488853	+	Silent	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr3:44488853G>A	ENST00000396077.2	-	8	2657	c.2310C>T	c.(2308-2310)gcC>gcT	p.A770A	ZNF445_ENST00000425708.2_Silent_p.A770A	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	770					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		GATTGCGGAAGGCCTTGCCAC	0.527																																																	0													67.0	66.0	67.0					3																	44488853		2203	4300	6503	SO:0001819	synonymous_variant	353274			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.2310C>T	3.37:g.44488853G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJD1	Silent	SNP	ENST00000396077.2	37	CCDS2713.1																																																																																				0.527	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2		NM_181489	
ANGPTL4	51129	broad.mit.edu	37	19	8429515	8429515	+	Missense_Mutation	SNP	A	A	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr19:8429515A>T	ENST00000301455.2	+	1	481	c.310A>T	c.(310-312)Agc>Tgc	p.S104C	ANGPTL4_ENST00000393962.2_Missense_Mutation_p.S104C|ANGPTL4_ENST00000541807.1_5'UTR	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	104					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						GGTCCTTCACAGCCTGCAGGT	0.706																																																	0													13.0	11.0	12.0					19																	8429515		2149	4167	6316	SO:0001583	missense	51129			AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.310A>T	19.37:g.8429515A>T	ENSP00000301455:p.Ser104Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	ENST00000301455.2	37	CCDS12200.1	.	.	.	.	.	.	.	.	.	.	A	13.95	2.390030	0.42410	.	.	ENSG00000167772	ENST00000301455;ENST00000393962	T;T	0.42900	0.96;0.96	3.5	1.42	0.22433	.	7739.210000	0.00166	N	0.000000	T	0.35278	0.0926	L	0.32530	0.975	0.80722	D	1	B;B	0.18741	0.03;0.03	B;B	0.12156	0.007;0.007	T	0.20107	-1.0285	10	0.62326	D	0.03	.	6.509	0.22212	0.7916:0.0:0.2084:0.0	.	104;104	A8MY84;Q9BY76	.;ANGL4_HUMAN	C	104	ENSP00000301455:S104C;ENSP00000377534:S104C	ENSP00000301455:S104C	S	+	1	0	ANGPTL4	8335515	0.849000	0.29639	0.118000	0.21660	0.183000	0.23260	1.413000	0.34725	0.247000	0.21414	0.398000	0.26397	AGC		0.706	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460322.1		NM_139314	
ZNF543	125919	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	57839655	57839655	+	Silent	SNP	G	G	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr19:57839655G>A	ENST00000321545.4	+	4	1170	c.825G>A	c.(823-825)cgG>cgA	p.R275R		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GGCACCAGCGGATTCACAGTG	0.522																																																	0													56.0	56.0	56.0					19																	57839655		2203	4300	6503	SO:0001819	synonymous_variant	125919			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.825G>A	19.37:g.57839655G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Silent	SNP	ENST00000321545.4	37	CCDS33130.1																																																																																				0.522	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1		XM_064865	
CHRNA1	1134	broad.mit.edu	37	2	175612767	175612767	+	3'UTR	SNP	T	T	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr2:175612767T>A	ENST00000261007.5	-	0	1600				CHRNA1_ENST00000409219.1_3'UTR|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000348749.5_3'UTR|CHRNA1_ENST00000409542.1_3'UTR	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TAAGTGCGAGTGGAGCAAGTA	0.403																																																	0																																										SO:0001624	3_prime_UTR_variant	1134			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.*85A>T	2.37:g.175612767T>A		Somatic		WXS	Illumina GAIIx	Phase_I	B4DRV6|D3DPE8	3'UTR	SNP	ENST00000261007.5	37	CCDS33331.1																																																																																				0.403	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1			
DOPEY2	9980	broad.mit.edu	37	21	37653892	37653892	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr21:37653892A>C	ENST00000399151.3	+	32	6228	c.6143A>C	c.(6142-6144)tAc>tCc	p.Y2048S		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2048					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.Y2048S(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TACCACCTTTACCTTCCACTG	0.378																																																	2	Substitution - Missense(2)	kidney(2)											74.0	73.0	73.0					21																	37653892		2203	4300	6503	SO:0001583	missense	9980			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6143A>C	21.37:g.37653892A>C	ENSP00000382104:p.Tyr2048Ser	Somatic		WXS	Illumina GAIIx	Phase_I	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313454	0.81358	.	.	ENSG00000142197	ENST00000399151	T	0.52057	0.68	5.42	5.42	0.78866	.	0.061947	0.64402	D	0.000003	T	0.70325	0.3211	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71368	-0.4614	10	0.33940	T	0.23	-10.9093	15.4962	0.75653	1.0:0.0:0.0:0.0	.	2041;2048	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	S	2048	ENSP00000382104:Y2048S	ENSP00000382104:Y2048S	Y	+	2	0	DOPEY2	36575762	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.892000	0.75644	2.058000	0.61347	0.533000	0.62120	TAC		0.378	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1		NM_005128	
CLCNKA	1187	broad.mit.edu	37	1	16361916	16361916	+	IGR	SNP	G	G	A	rs11811753		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:16361916G>A	ENST00000331433.4	+	0	2475							P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GTGAGGGGCCGCTGGGAAGGC	0.647																																																	0																																										SO:0001628	intergenic_variant	348487				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529		1.37:g.16361916G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Silent	SNP	ENST00000331433.4	37	CCDS167.1																																																																																				0.647	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1			
GZMH	2999	broad.mit.edu	37	14	25076508	25076508	+	Silent	SNP	A	A	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr14:25076508A>C	ENST00000216338.4	-	4	488	c.444T>G	c.(442-444)ggT>ggG	p.G148G	RP11-104E19.1_ENST00000557736.1_RNA|GZMH_ENST00000382548.4_Intron|GZMH_ENST00000557220.2_Intron|RP11-104E19.1_ENST00000555300.1_RNA	NM_033423.4	NP_219491.1	P20718	GRAH_HUMAN	granzyme H (cathepsin G-like 2, protein h-CCPX)	148	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)	membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)	12				GBM - Glioblastoma multiforme(265;0.0267)		TTGAGACATAACCCCAGCCAG	0.557																																																	0													89.0	81.0	84.0					14																	25076508		2203	4300	6503	SO:0001819	synonymous_variant	2999			M72150	CCDS9632.1, CCDS59243.1	14q11.2	2003-10-20			ENSG00000100450	ENSG00000100450			4710	protein-coding gene	gene with protein product		116831		CTSGL2		2049336	Standard	NM_033423		Approved	CGL-2, CCP-X, CTLA1, CSP-C	uc001wpr.2	P20718	OTTHUMG00000140185	ENST00000216338.4:c.444T>G	14.37:g.25076508A>C		Somatic		WXS	Illumina GAIIx	Phase_I	G3V2C5|Q6XGZ0|Q6XGZ1	Silent	SNP	ENST00000216338.4	37	CCDS9632.1																																																																																				0.557	GZMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276538.2		NM_033423	
HIF3A	64344	broad.mit.edu	37	19	46811988	46811988	+	Missense_Mutation	SNP	A	A	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr19:46811988A>C	ENST00000377670.4	+	5	548	c.517A>C	c.(517-519)Acc>Ccc	p.T173P	HIF3A_ENST00000420102.2_Missense_Mutation_p.T122P|HIF3A_ENST00000525854.1_3'UTR|HIF3A_ENST00000472815.1_Missense_Mutation_p.T104P|HIF3A_ENST00000339613.2_Missense_Mutation_p.T117P|RNU6-924P_ENST00000362926.1_RNA|HIF3A_ENST00000244303.6_Missense_Mutation_p.T104P|HIF3A_ENST00000600383.1_Missense_Mutation_p.T104P|HIF3A_ENST00000300862.3_Missense_Mutation_p.T171P	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	173					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GAGTACACTCACCAGCCGCGG	0.721																																																	0													19.0	17.0	18.0					19																	46811988		2198	4294	6492	SO:0001583	missense	64344			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.517A>C	19.37:g.46811988A>C	ENSP00000366898:p.Thr173Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.2|23.2	4.387275|4.387275	0.82902|0.82902	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000472815|ENST00000475432;ENST00000244302;ENST00000377670;ENST00000457865;ENST00000414707;ENST00000244303;ENST00000339613;ENST00000457771;ENST00000291300;ENST00000300862;ENST00000420102	.|T;T;T;T;T	.|0.32753	.|1.44;1.44;1.44;1.44;1.44	4.8|4.8	4.8|4.8	0.61643|0.61643	.|.	.|0.206611	.|0.24554	.|N	.|0.037534	T|T	0.63663|0.63663	0.2530|0.2530	H|H	0.94964|0.94964	3.605|3.605	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;P;D;D	.|0.69078	.|0.987;0.981;0.971;0.997;0.977;0.943;0.971;0.985	.|D;P;P;D;P;P;P;P	.|0.65573	.|0.936;0.522;0.777;0.921;0.908;0.858;0.812;0.823	T|T	0.74390|0.74390	-0.3681|-0.3681	5|10	.|0.87932	.|D	.|0	.|.	12.5824|12.5824	0.56397|0.56397	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|122;104;171;122;117;173;173;173	.|F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185;E7EWV6	.|.;.;.;.;.;HIF3A_HUMAN;.;.	P|P	145|173;173;173;87;173;104;117;104;117;171;122	.|ENSP00000366898:T173P;ENSP00000244303:T104P;ENSP00000341877:T117P;ENSP00000300862:T171P;ENSP00000407771:T122P	.|ENSP00000244302:T173P	H|T	+|+	2|1	0|0	HIF3A|HIF3A	51503828|51503828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.770000|0.770000	0.43624|0.43624	8.909000|8.909000	0.92647|0.92647	1.927000|1.927000	0.55829|0.55829	0.459000|0.459000	0.35465|0.35465	CAC|ACC		0.721	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3			
HSF5	124535	broad.mit.edu	37	17	56565201	56565201	+	Silent	SNP	G	G	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr17:56565201G>T	ENST00000323777.3	-	1	544	c.435C>A	c.(433-435)ccC>ccA	p.P145P		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	145					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCGGGCGGCAGGGCACCTCCA	0.751																																																	0													10.0	15.0	13.0					17																	56565201		2166	4235	6401	SO:0001819	synonymous_variant	124535			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.435C>A	17.37:g.56565201G>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q08EH7|Q8N7V2	Silent	SNP	ENST00000323777.3	37	CCDS32690.1																																																																																				0.751	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1		XM_064190	
JAKMIP3	282973	broad.mit.edu	37	10	133961472	133961472	+	Missense_Mutation	SNP	C	C	T	rs138739966		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr10:133961472C>T	ENST00000298622.4	+	13	1904	c.1766C>T	c.(1765-1767)aCg>aTg	p.T589M	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	589						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAAATGGAGACGGAAGAGGCT	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		20765	0.0		0.001	False		,,,				2504	0.0																0									MET/THR	0,4404		0,0,2202	90.0	74.0	79.0		1766	0.2	0.0	10	dbSNP_134	79	1,8583	1.2+/-3.3	0,1,4291	no	missense	JAKMIP3	NM_001105521.2	81	0,1,6493	TT,TC,CC		0.0116,0.0,0.0077	benign	589/845	133961472	1,12987	2202	4292	6494	SO:0001583	missense	282973			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1766C>T	10.37:g.133961472C>T	ENSP00000298622:p.Thr589Met	Somatic		WXS	Illumina GAIIx	Phase_I	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.015	-1.541277	0.00934	0.0	1.16E-4	ENSG00000188385	ENST00000298622	T	0.22539	1.95	4.22	0.156	0.14910	.	.	.	.	.	T	0.09291	0.0229	N	0.04203	-0.255	0.09310	N	1	B;B	0.23058	0.079;0.004	B;B	0.19148	0.024;0.004	T	0.30794	-0.9966	9	0.45353	T	0.12	.	8.5099	0.33211	0.0:0.5798:0.0:0.4202	.	26;589	Q5VZ66-2;Q5VZ66	.;JKIP3_HUMAN	M	589	ENSP00000298622:T589M	ENSP00000298622:T589M	T	+	2	0	JAKMIP3	133811462	0.000000	0.05858	0.006000	0.13384	0.025000	0.11179	0.043000	0.13971	-0.024000	0.13941	0.556000	0.70494	ACG		0.557	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3		NM_194303	
LGALS9B	284194	broad.mit.edu	37	17	20370782	20370783	+	Start_Codon_Ins	INS	-	-	TC	rs10687699|rs554373055|rs372509656	byFrequency	TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr17:20370782_20370783insTC	ENST00000423676.3	-	0	64_65				LGALS9B_ENST00000324290.5_Start_Codon_Ins			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B								carbohydrate binding (GO:0030246)	p.M1fs*12(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						GCTGAAGGCCATCTCCACCGCC	0.584														831	0.165935	0.2504	0.1326	5008	,	,		9041	0.127		0.1481	False		,,,				2504	0.1339																1	Insertion - Frameshift(1)	central_nervous_system(1)								372,1470		152,68,701						2.5	0.7		dbSNP_130	3	715,5069		234,247,2411	no	frameshift	LGALS9B	NM_001042685.1		386,315,3112	A1A1,A1R,RR		12.3617,20.1954,14.2539				1087,6539				SO:0001582	initiator_codon_variant	284194				CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.0_1dupGA	17.37:g.20370785_20370786dupTC		Somatic		WXS	Illumina GAIIx	Phase_I	A6NLF8|A8K2J8	Frame_Shift_Ins	INS	ENST00000423676.3	37																																																																																					0.584	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000253230.2		NM_001042685	
PDS5B	23047	broad.mit.edu	37	13	33332255	33332255	+	Missense_Mutation	SNP	G	G	C			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr13:33332255G>C	ENST00000315596.10	+	27	3273	c.3087G>C	c.(3085-3087)atG>atC	p.M1029I		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1029					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AAATATTAATGGCTAAAAATG	0.264																																																	0													35.0	33.0	33.0					13																	33332255		1792	4051	5843	SO:0001583	missense	23047			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3087G>C	13.37:g.33332255G>C	ENSP00000313851:p.Met1029Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088093	0.55968	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.57	5.57	0.84162	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53498	0.1800	L	0.31294	0.92	0.80722	D	1	B	0.24483	0.104	B	0.25140	0.058	T	0.45848	-0.9233	9	0.23302	T	0.38	-26.2515	19.5578	0.95358	0.0:0.0:1.0:0.0	.	1029	Q9NTI5	PDS5B_HUMAN	I	1029	.	ENSP00000313851:M1029I	M	+	3	0	PDS5B	32230255	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.756000	0.98918	2.604000	0.88044	0.563000	0.77884	ATG		0.264	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3		NM_015032	
SGK3	23678	broad.mit.edu	37	8	67680233	67680233	+	Intron	SNP	G	G	T			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr8:67680233G>T	ENST00000521198.2	+	2	416				C8orf44-SGK3_ENST00000519289.1_Intron|C8orf44-SGK3_ENST00000520044.1_Intron	NM_001033578.2	NP_001028750.1	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3						ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			ATAGATCAGAGTAGCCATTCT	0.383																																																	0																																										SO:0001627	intron_variant	26255				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000521198.2:c.-121-25618G>T	8.37:g.67680233G>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	ENST00000521198.2	37	CCDS6195.1																																																																																				0.383	SGK3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379232.3			
Unknown	0	broad.mit.edu	37	12	92018	92018	+	IGR	SNP	T	T	C	rs376561453		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr12:92018T>C								AC215219.1 (18696 upstream) : AC026369.1 (55033 downstream)																							GACTCCACACTCTCCTGGGTT	0.592																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.92018T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.592									
NPIPA1	9284	broad.mit.edu	37	16	15023180	15023180	+	3'UTR	SNP	C	C	T	rs199802864		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr16:15023180C>T	ENST00000472413.1	+	0	1959							Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											GAGTCACCATCGCGGATGGTG	0.672																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.*1956C>T	16.37:g.15023180C>T		Somatic		WXS	Illumina GAIIx	Phase_I	O15102	Missense_Mutation	SNP	ENST00000472413.1	37																																																																																					0.672	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	protein_coding	OTTHUMT00000207327.1		NM_006985	
MIR4477B	100616194	broad.mit.edu	37	9	68413572	68413573	+	RNA	DNP	CG	CG	TC			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr9:68413572_68413573CG>TC	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		CCAGTGGCGCCGGATCTAGGAA	0.599																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b				Exception_encountered	9.37:g.68413572_68413573delinsTC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581659.1	37																																																																																					0.599	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																																	10	Substitution - Missense(10)	kidney(7)|prostate(2)|endometrium(1)																																										374666					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000557932.1	37		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1		NM_199163	
ZDHHC18	84243	broad.mit.edu	37	1	27176851	27176851	+	Missense_Mutation	SNP	T	T	A			TCGA-A3-3378-01A-01D-0966-08	TCGA-A3-3378-11A-01D-0966-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd	eacc4f56-30de-4978-a291-68a378436c34	g.chr1:27176851T>A	ENST00000374142.4	+	4	801	c.706T>A	c.(706-708)Ttc>Atc	p.F236I		NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	236					cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		GAACTATCGCTTCTTCTACGC	0.577																																																	0													193.0	164.0	174.0					1																	27176851		2203	4300	6503	SO:0001583	missense	84243			AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.706T>A	1.37:g.27176851T>A	ENSP00000363257:p.Phe236Ile	Somatic		WXS	Illumina GAIIx	Phase_I	A6NHY9|B4DQ84|Q5JYH0|Q9H020	Missense_Mutation	SNP	ENST00000374142.4	37	CCDS30650.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.004653	0.93287	.	.	ENSG00000204160	ENST00000374142;ENST00000374141;ENST00000534643	T;T;T	0.25085	1.82;1.82;1.82	5.05	5.05	0.67936	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.052238	0.85682	D	0.000000	T	0.42426	0.1202	M	0.67625	2.065	0.49687	D	0.999817	P	0.47484	0.896	P	0.53224	0.721	T	0.40942	-0.9536	10	0.87932	D	0	-9.7432	14.9513	0.71077	0.0:0.0:0.0:1.0	.	236	Q9NUE0	ZDH18_HUMAN	I	236;101;101	ENSP00000363257:F236I;ENSP00000363256:F101I;ENSP00000435510:F101I	ENSP00000363256:F101I	F	+	1	0	ZDHHC18	27049438	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.698000	0.68302	2.114000	0.64651	0.459000	0.35465	TTC		0.577	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011706.3		NM_032283	
