#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCD4	5826	broad.mit.edu;ucsc.edu	37	14	74763081	74763081	+	Missense_Mutation	SNP	A	A	G	rs145669133	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr14:74763081A>G	ENST00000356924.4	-	5	640	c.497T>C	c.(496-498)aTc>aCc	p.I166T	ABCD4_ENST00000557554.1_Intron|AC005519.4_ENST00000554532.2_RNA|ABCD4_ENST00000298816.7_Missense_Mutation_p.I79T|ABCD4_ENST00000557588.1_Missense_Mutation_p.I166T	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	166	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.I166T(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		GAACGGGGAGATGATGAGCTT	0.602																																																	1	Substitution - Missense(1)	kidney(1)						A	THR/ILE	3,4403	6.2+/-15.9	0,3,2200	118.0	97.0	104.0		497	4.8	1.0	14	dbSNP_134	104	0,8600		0,0,4300	yes	missense	ABCD4	NM_005050.3	89	0,3,6500	GG,GA,AA		0.0,0.0681,0.0231	benign	166/607	74763081	3,13003	2203	4300	6503	SO:0001583	missense	5826			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.497T>C	14.37:g.74763081A>G	ENSP00000349396:p.Ile166Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	ENST00000356924.4	37	CCDS9828.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.53|11.53	1.664967|1.664967	0.29604|0.29604	6.81E-4|6.81E-4	0.0|0.0	ENSG00000119688|ENSG00000119688	ENST00000356924;ENST00000298816;ENST00000557588|ENST00000556971	D;D;D|.	0.99557|.	-6.16;-6.16;-6.16|.	4.82|4.82	4.82|4.82	0.62117|0.62117	ABC transporter, N-terminal (1);ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);|.	0.212459|.	0.47852|.	D|.	0.000202|.	T|T	0.51415|0.51415	0.1673|0.1673	L|L	0.35593|0.35593	1.075|1.075	0.42832|0.42832	D|D	0.994028|0.994028	B;B;B|.	0.19445|.	0.036;0.014;0.006|.	B;B;B|.	0.30943|.	0.076;0.122;0.091|.	T|T	0.48875|0.48875	-0.8996|-0.8996	10|5	0.33940|.	T|.	0.23|.	.|.	9.1288|9.1288	0.36833|0.36833	0.9185:0.0:0.0815:0.0|0.9185:0.0:0.0815:0.0	.|.	79;166;166|.	F8W7M4;A8K5L7;O14678|.	.;.;ABCD4_HUMAN|.	T|P	166;79;166|126	ENSP00000349396:I166T;ENSP00000298816:I79T;ENSP00000451993:I166T|.	ENSP00000298816:I79T|.	I|S	-|-	2|1	0|0	ABCD4|ABCD4	73832834|73832834	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.563000|0.563000	0.35712|0.35712	7.383000|7.383000	0.79741|0.79741	2.012000|2.012000	0.59069|0.59069	0.528000|0.528000	0.53228|0.53228	ATC|TCT		0.602	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314382.1		NM_005050	
ANK2	287	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	114275680	114275680	+	Missense_Mutation	SNP	C	C	T	rs148760530		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr4:114275680C>T	ENST00000357077.4	+	38	5959	c.5906C>T	c.(5905-5907)aCa>aTa	p.T1969I	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.T1936I|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1969	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T1969I(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCTGGCAAAACAGAAAAGCAA	0.512																																																	1	Substitution - Missense(1)	kidney(1)						C	,ILE/THR,	0,4406		0,0,2203	92.0	97.0	95.0		,5906,	4.5	0.8	4	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,intron	ANK2	NM_001127493.1,NM_001148.4,NM_020977.3	,89,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,probably-damaging,	,1969/3958,	114275680	1,13005	2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5906C>T	4.37:g.114275680C>T	ENSP00000349588:p.Thr1969Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225233	0.39300	0.0	1.16E-4	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.65916	-0.18;-0.17	6.17	4.46	0.54185	.	0.618223	0.15326	N	0.268288	T	0.52629	0.1746	N	0.22421	0.69	0.20307	N	0.999916	P;P	0.50272	0.933;0.919	P;P	0.48704	0.462;0.587	T	0.36261	-0.9755	9	.	.	.	.	8.2485	0.31704	0.1288:0.7363:0.0:0.135	.	1936;1969	Q01484;Q01484-4	ANK2_HUMAN;.	I	1969;1936	ENSP00000349588:T1969I;ENSP00000264366:T1936I	.	T	+	2	0	ANK2	114495129	0.128000	0.22383	0.828000	0.32881	0.927000	0.56198	0.891000	0.28309	0.940000	0.37473	0.655000	0.94253	ACA		0.512	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2		NM_001148	
BTNL8	79908	broad.mit.edu;hgsc.bcm.edu	37	5	180377360	180377360	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr5:180377360T>A	ENST00000340184.4	+	8	1525	c.1319T>A	c.(1318-1320)tTg>tAg	p.L440*	BTNL8_ENST00000508408.1_3'UTR|BTNL8_ENST00000511704.1_Nonsense_Mutation_p.L324*|BTNL8_ENST00000533815.2_Nonsense_Mutation_p.L256*|BTNL8_ENST00000505126.1_Nonsense_Mutation_p.L233*|BTNL8_ENST00000400707.3_Nonsense_Mutation_p.L315*|BTNL8_ENST00000231229.4_3'UTR	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	440	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.L440*(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGGCTTATTGAGGCCCTAC	0.463																																																	1	Substitution - Nonsense(1)	kidney(1)											179.0	144.0	156.0					5																	180377360		1888	3814	5702	SO:0001587	stop_gained	79908			AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.1319T>A	5.37:g.180377360T>A	ENSP00000342197:p.Leu440*	Somatic		WXS	Illumina HiSeq	Phase_I	A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Nonsense_Mutation	SNP	ENST00000340184.4	37	CCDS43413.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243363	0.79912	.	.	ENSG00000113303	ENST00000340184;ENST00000400707;ENST00000511704;ENST00000505126;ENST00000533815	.	.	.	1.52	1.52	0.23074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0658	0.25151	0.0:0.0:0.0:1.0	.	.	.	.	X	440;315;324;233;256	.	ENSP00000342197:L440X	L	+	2	0	BTNL8	180309966	0.002000	0.14202	0.035000	0.18076	0.272000	0.26649	1.232000	0.32636	0.951000	0.37770	0.352000	0.21897	TTG		0.463	BTNL8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368440.1		NM_024850	
PCNXL4	64430	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	60587988	60587988	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr14:60587988G>T	ENST00000406854.1	+	8	2571	c.2017G>T	c.(2017-2019)Ggc>Tgc	p.G673C	PCNXL4_ENST00000404681.2_Missense_Mutation_p.G673C|PCNXL4_ENST00000317623.4_Missense_Mutation_p.G439C|PCNXL4_ENST00000535349.1_5'UTR|PCNXL4_ENST00000406949.1_Missense_Mutation_p.G439C			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	673						integral component of membrane (GO:0016021)		p.G439C(1)|p.G673C(1)									TCTGGAATGTGGCTATACTTA	0.328																																																	2	Substitution - Missense(2)	kidney(2)											155.0	144.0	148.0					14																	60587988		2203	4300	6503	SO:0001583	missense	0			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.2017G>T	14.37:g.60587988G>T	ENSP00000384801:p.Gly673Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.1|26.1	4.706988|4.706988	0.89018|0.89018	.|.	.|.	ENSG00000126773|ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681|ENST00000554534	T;T;T;T|.	0.47528|.	0.84;0.86;1.1;0.86|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.81978|0.81978	0.4937|0.4937	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.81529|0.81529	-0.0891|-0.0891	10|5	0.87932|.	D|.	0|.	.|.	19.9375|19.9375	0.97146|0.97146	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	673;439|.	Q63HM2;B5MC47|.	CN135_HUMAN;.|.	C|L	439;673;439;673|91	ENSP00000317396:G439C;ENSP00000384801:G673C;ENSP00000385201:G439C;ENSP00000385713:G673C|.	ENSP00000317396:G439C|.	G|W	+|+	1|2	0|0	C14orf135|C14orf135	59657741|59657741	1.000000|1.000000	0.71417|0.71417	0.973000|0.973000	0.42090|0.42090	0.842000|0.842000	0.47809|0.47809	9.011000|9.011000	0.93618|0.93618	2.717000|2.717000	0.92951|0.92951	0.650000|0.650000	0.86243|0.86243	GGC|TGG		0.328	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1		NM_022495	
C16orf52	730094	hgsc.bcm.edu	37	16	22019647	22019647	+	Frame_Shift_Del	DEL	G	G	-	rs201044196	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr16:22019647delG	ENST00000542527.2	+	1	118	c.25delG	c.(25-27)ggafs	p.G9fs	C16orf52_ENST00000562695.1_Frame_Shift_Del_p.G9fs|C16orf52_ENST00000567004.1_Intron|C16orf52_ENST00000569656.1_5'UTR	NM_001164579.1	NP_001158051.1	Q8NHV5	CP052_HUMAN	chromosome 16 open reading frame 52	9										endometrium(1)	1						CATCATCTCAGGATGTCTCTT	0.697													GG|GG|G|deletion	642	0.128195	0.1513	0.0807	5008	,	,		6774	0.1657		0.0477	False		,,,				2504	0.1748																0										301,1865		44,213,826	31.0	30.0	30.0			4.2	1.0	16		33	314,3876		29,256,1810	no	frameshift	C16orf52	NM_001164579.1		73,469,2636	A1A1,A1R,RR		7.494,13.8966,9.6759			22019647	615,5741	692	1591	2283	SO:0001589	frameshift_variant	730094			BC027604	CCDS58431.1	16p12.2	2012-10-09			ENSG00000185716	ENSG00000185716			27087	protein-coding gene	gene with protein product						12477932	Standard	NM_001164579		Approved		uc002dkd.2	Q8NHV5	OTTHUMG00000131587	ENST00000542527.2:c.25delG	16.37:g.22019647delG	ENSP00000454926:p.Gly9fs	Somatic		WXS	Illumina HiSeq	Phase_I	H3BNM6	Frame_Shift_Del	DEL	ENST00000542527.2	37	CCDS58431.1																																																																																				0.697	C16orf52-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430039.1		NM_001164579	
MIS18A	54069	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	33642036	33642036	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr21:33642036T>C	ENST00000290130.3	-	4	657	c.603A>G	c.(601-603)atA>atG	p.I201M	MIS18A_ENST00000486363.1_5'UTR	NM_018944.2	NP_061817.1	Q9NYP9	MS18A_HUMAN	MIS18 kinetochore protein A	201					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of DNA methylation (GO:0044030)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.I201M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	7						GAGACTTTTCTATTTCAACTC	0.338																																																	1	Substitution - Missense(1)	kidney(1)											58.0	59.0	59.0					21																	33642036		2202	4296	6498	SO:0001583	missense	0			AF231921	CCDS13611.1	21q22.11	2013-10-21	2013-10-21	2011-02-23	ENSG00000159055	ENSG00000159055			1286	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 46"", ""chromosome 21 open reading frame 45"", ""MIS18 kinetochore protein homolog A (S. pombe)"""	C21orf46, C21orf45		17199038	Standard	NM_018944		Approved	B28, FASP1, hMis18alpha	uc002ypi.3	Q9NYP9	OTTHUMG00000085308	ENST00000290130.3:c.603A>G	21.37:g.33642036T>C	ENSP00000290130:p.Ile201Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2R562|Q542Z0	Missense_Mutation	SNP	ENST00000290130.3	37	CCDS13611.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.541019	0.27563	.	.	ENSG00000159055	ENST00000290130	.	.	.	5.34	0.291	0.15732	.	0.061352	0.64402	D	0.000003	T	0.36853	0.0982	M	0.64997	1.995	0.31677	N	0.64362	B	0.27932	0.194	B	0.24848	0.056	T	0.27468	-1.0073	9	0.37606	T	0.19	-10.2684	4.8845	0.13696	0.0:0.2722:0.1562:0.5716	.	201	Q9NYP9	MS18A_HUMAN	M	201	.	ENSP00000290130:I201M	I	-	3	3	MIS18A	32563907	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	-0.049000	0.11924	0.131000	0.18576	0.528000	0.53228	ATA		0.338	MIS18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193090.1		NM_018944	
CR1	1378	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	207785153	207785153	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:207785153T>A	ENST00000367049.4	+	38	6427	c.6427T>A	c.(6427-6429)Tgc>Agc	p.C2143S	CR1_ENST00000367052.1_Missense_Mutation_p.C1693S|CR1_ENST00000367053.1_Missense_Mutation_p.C1693S|CR1_ENST00000400960.2_Missense_Mutation_p.C1693S|CR1_ENST00000367051.1_Missense_Mutation_p.C1693S	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1693					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.C1698S(1)|p.C2143S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTCTCTGCACTGCACGCCCCA	0.562																																																	2	Substitution - Missense(2)	kidney(2)											124.0	127.0	126.0					1																	207785153		1954	4137	6091	SO:0001583	missense	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6427T>A	1.37:g.207785153T>A	ENSP00000356016:p.Cys2143Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019256	0.54576	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	D;D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71;-4.71	3.48	3.48	0.39840	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.99269	0.9745	H	0.99668	4.69	0.09310	N	1	D;D	0.89917	1.0;0.979	D;P	0.85130	0.997;0.8	D	0.94726	0.7905	9	0.87932	D	0	.	8.6642	0.34110	0.0:0.0:0.0:1.0	.	1693;2143	P17927;E9PDY4	CR1_HUMAN;.	S	1693;1693;1693;1693;2143	ENSP00000356019:C1693S;ENSP00000356018:C1693S;ENSP00000356020:C1693S;ENSP00000383744:C1693S;ENSP00000356016:C2143S	ENSP00000356016:C2143S	C	+	1	0	CR1	205851776	0.821000	0.29204	0.030000	0.17652	0.108000	0.19459	2.070000	0.41491	1.803000	0.52742	0.459000	0.35465	TGC		0.562	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1		NM_000573	
DDO	8528	broad.mit.edu;hgsc.bcm.edu	37	6	110714419	110714419	+	Silent	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr6:110714419C>T	ENST00000368924.3	-	5	684	c.669G>A	c.(667-669)aaG>aaA	p.K223K	DDO_ENST00000368923.3_Silent_p.K164K	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	195					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.K223K(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CAGGGAAAATCTTTGAGTCTC	0.502																																																	1	Substitution - coding silent(1)	kidney(1)											108.0	117.0	114.0					6																	110714419		2203	4300	6503	SO:0001819	synonymous_variant	8528			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.669G>A	6.37:g.110714419C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Silent	SNP	ENST00000368924.3	37	CCDS5082.1																																																																																				0.502	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1			
DNAH2	146754	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7669721	7669721	+	Silent	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:7669721G>A	ENST00000572933.1	+	22	5057	c.3597G>A	c.(3595-3597)gaG>gaA	p.E1199E	DNAH2_ENST00000389173.2_Silent_p.E1199E			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1199	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E1199E(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGCGGGAAGAGGAAAATAGTC	0.552																																																	1	Substitution - coding silent(1)	kidney(1)											103.0	87.0	93.0					17																	7669721		2203	4300	6503	SO:0001819	synonymous_variant	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.3597G>A	17.37:g.7669721G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																				0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1		NM_020877	
DNMT3A	1788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	25458658	25458658	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr2:25458658delA	ENST00000264709.3	-	22	2852	c.2515delT	c.(2515-2517)tccfs	p.S839fs	DNMT3A_ENST00000321117.5_Frame_Shift_Del_p.S839fs|DNMT3A_ENST00000380746.4_Frame_Shift_Del_p.S650fs|DNMT3A_ENST00000402667.1_Frame_Shift_Del_p.S616fs|DNMT3A_ENST00000474887.1_5'UTR	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	839	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTTTATGGAGTTTGACCTC	0.458			"""Mis, F, N, S"""		AML																																			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0													187.0	167.0	174.0					2																	25458658		2203	4300	6503	SO:0001589	frameshift_variant	1788				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2515delT	2.37:g.25458658delA	ENSP00000264709:p.Ser839fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Frame_Shift_Del	DEL	ENST00000264709.3	37	CCDS33157.1																																																																																				0.458	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1		NM_022552	
DNAH6	1768	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	84756081	84756081	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr2:84756081T>A	ENST00000237449.6	+	3	461	c.453T>A	c.(451-453)caT>caA	p.H151Q	DNAH6_ENST00000398278.2_Missense_Mutation_p.H151Q|DNAH6_ENST00000468661.1_Intron|DNAH6_ENST00000389394.3_Missense_Mutation_p.H151Q			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	151	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H151Q(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AACTGCCACATACTGGTATTG	0.408																																																	1	Substitution - Missense(1)	kidney(1)											131.0	100.0	110.0					2																	84756081		692	1591	2283	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.453T>A	2.37:g.84756081T>A	ENSP00000237449:p.His151Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	T	5.094	0.203041	0.09704	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.22539	1.95;2.08;1.95	4.97	-7.13	0.01532	.	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38929	-0.9638	9	0.28530	T	0.3	.	8.9562	0.35818	0.0:0.1939:0.5249:0.2812	.	151	Q9C0G6	DYH6_HUMAN	Q	151	ENSP00000374045:H151Q;ENSP00000381326:H151Q;ENSP00000237449:H151Q	ENSP00000237449:H151Q	H	+	3	2	DNAH6	84609592	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.663000	0.05299	-0.948000	0.03668	-0.466000	0.05196	CAT		0.408	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2		NM_001370	
EGR1	1958	broad.mit.edu;hgsc.bcm.edu	37	5	137802682	137802682	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr5:137802682G>A	ENST00000239938.4	+	2	816	c.544G>A	c.(544-546)Gcc>Acc	p.A182T		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	182					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.A182T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GGCCTCCTCCGCCTCCGCCTC	0.652																																																	1	Substitution - Missense(1)	kidney(1)											111.0	114.0	113.0					5																	137802682		2203	4300	6503	SO:0001583	missense	1958			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.544G>A	5.37:g.137802682G>A	ENSP00000239938:p.Ala182Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000239938.4	37	CCDS4206.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.932384	0.92389	.	.	ENSG00000120738	ENST00000535792;ENST00000239938	T	0.20598	2.06	4.23	4.23	0.50019	.	0.072868	0.56097	D	0.000024	T	0.13114	0.0318	N	0.14661	0.345	0.25062	N	0.991055	B	0.06786	0.001	B	0.09377	0.004	T	0.18116	-1.0347	10	0.59425	D	0.04	-23.8891	10.8733	0.46896	0.0:0.0:0.1586:0.8413	.	182	P18146	EGR1_HUMAN	T	182	ENSP00000239938:A182T	ENSP00000239938:A182T	A	+	1	0	EGR1	137830581	0.797000	0.28877	0.132000	0.22025	0.700000	0.40528	1.159000	0.31749	0.507000	0.28148	-0.824000	0.03097	GCC		0.652	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1		NM_001964	
ENPP2	5168	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	120633703	120633703	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr8:120633703C>A	ENST00000075322.6	-	4	407	c.349G>T	c.(349-351)Gcc>Tcc	p.A117S	ENPP2_ENST00000522826.1_Missense_Mutation_p.A117S|ENPP2_ENST00000427067.2_Missense_Mutation_p.A113S|ENPP2_ENST00000259486.6_Missense_Mutation_p.A117S	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	117	SMB 2. {ECO:0000255|PROSITE- ProRule:PRU00350}.				cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A117S(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CAGTGACAGGCATTTTCTTCA	0.468																																					Melanoma(20;305 879 2501 4818 31020)												2	Substitution - Missense(2)	kidney(2)											124.0	117.0	119.0					8																	120633703		2203	4300	6503	SO:0001583	missense	5168			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.349G>T	8.37:g.120633703C>A	ENSP00000075322:p.Ala117Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163629	0.78226	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522826;ENST00000075322;ENST00000520066	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.92	5.92	0.95590	Somatomedin B domain (3);	0.046789	0.85682	D	0.000000	T	0.55986	0.1955	L	0.51422	1.61	0.80722	D	1	P;P;P	0.51653	0.947;0.597;0.935	P;P;P	0.57502	0.822;0.821;0.727	T	0.37641	-0.9697	10	0.27082	T	0.32	.	20.3343	0.98733	0.0:1.0:0.0:0.0	.	117;117;117	E9PHP7;Q13822;Q13822-2	.;ENPP2_HUMAN;.	S	117;113;117;117;99	ENSP00000259486:A117S;ENSP00000403315:A113S;ENSP00000428291:A117S;ENSP00000075322:A117S;ENSP00000428304:A99S	ENSP00000075322:A117S	A	-	1	0	ENPP2	120702884	1.000000	0.71417	0.971000	0.41717	0.951000	0.60555	6.089000	0.71384	2.822000	0.97130	0.650000	0.86243	GCC		0.468	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1			
FREM2	341640	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	39264065	39264065	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr13:39264065G>A	ENST00000280481.7	+	1	2800	c.2584G>A	c.(2584-2586)Gcc>Acc	p.A862T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	862					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A862T(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CACTGATGTTGCCCATATCTC	0.512																																																	1	Substitution - Missense(1)	kidney(1)											110.0	98.0	102.0					13																	39264065		2203	4300	6503	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2584G>A	13.37:g.39264065G>A	ENSP00000280481:p.Ala862Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	5.276	0.236273	0.10023	.	.	ENSG00000150893	ENST00000280481	T	0.26660	1.72	5.8	1.47	0.22746	.	0.523322	0.21830	N	0.068494	T	0.12518	0.0304	N	0.13043	0.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28902	-1.0029	10	0.20519	T	0.43	.	8.6943	0.34287	0.1332:0.0:0.6487:0.2181	.	862	Q5SZK8	FREM2_HUMAN	T	862	ENSP00000280481:A862T	ENSP00000280481:A862T	A	+	1	0	FREM2	38162065	0.000000	0.05858	0.234000	0.24042	0.125000	0.20455	-0.037000	0.12164	0.336000	0.23639	-0.152000	0.13540	GCC		0.512	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2		NM_207361	
GLB1	2720	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	33087643	33087643	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr3:33087643T>G	ENST00000399402.3	-	10	1078	c.947A>C	c.(946-948)aAg>aCg	p.K316T	GLB1_ENST00000307377.8_Missense_Mutation_p.K215T|GLB1_ENST00000445488.2_Missense_Mutation_p.K394T|GLB1_ENST00000307363.5_Missense_Mutation_p.K346T	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	346			Y -> C (in GM1G1). {ECO:0000269|PubMed:1907800}.		carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)	p.K346T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				AGCAAAATACTTCTCAGTGAG	0.522																																																	1	Substitution - Missense(1)	kidney(1)											84.0	87.0	86.0					3																	33087643		2044	4195	6239	SO:0001583	missense	2720			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.947A>C	3.37:g.33087643T>G	ENSP00000382333:p.Lys316Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	ENST00000399402.3	37	CCDS43062.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.507388	0.85282	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	D;D;D;D	0.99023	-5.34;-5.34;-5.34;-5.34	5.2	5.2	0.72013	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99396	0.9787	M	0.91038	3.17	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98664	1.0685	10	0.87932	D	0	-27.1432	15.0314	0.71710	0.0:0.0:0.0:1.0	.	346;215;346;394	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	T	316;346;394;215	ENSP00000382333:K316T;ENSP00000306920:K346T;ENSP00000393377:K394T;ENSP00000305920:K215T	ENSP00000306920:K346T	K	-	2	0	GLB1	33062647	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	7.415000	0.80131	2.090000	0.63153	0.379000	0.24179	AAG		0.522	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2		NM_000404	
GPR143	4935	hgsc.bcm.edu;ucsc.edu	37	X	9714193	9714193	+	Splice_Site	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chrX:9714193C>T	ENST00000467482.1	-	5	695	c.549G>A	c.(547-549)agG>agA	p.R183R	GPR143_ENST00000380929.2_Splice_Site_p.R203R			P51810	GP143_HUMAN	G protein-coupled receptor 143	183					calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)			endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				CCCGCTCACACCTGAGAGAGG	0.488																																																	0													58.0	50.0	53.0					X																	9714193		2203	4300	6503	SO:0001630	splice_region_variant	4935			Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.549-1G>A	X.37:g.9714193C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6NTI7	Silent	SNP	ENST00000467482.1	37	CCDS14134.2	.	.	.	.	.	.	.	.	.	.	C	11.19	1.564668	0.27915	.	.	ENSG00000101850	ENST00000447366	.	.	.	4.78	0.602	0.17535	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24728	-1.0152	4	.	.	.	.	0.5771	0.00706	0.3449:0.2987:0.1306:0.2258	.	.	.	.	M	119	.	.	V	-	1	0	GPR143	9674193	1.000000	0.71417	0.750000	0.31169	0.864000	0.49448	0.810000	0.27183	0.296000	0.22592	0.594000	0.82650	GTG		0.488	GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055714.2		NM_000273	Silent
GPR119	139760	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	129518457	129518457	+	Missense_Mutation	SNP	G	G	A	rs138209054	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chrX:129518457G>A	ENST00000276218.2	-	1	1054	c.965C>T	c.(964-966)tCc>tTc	p.S322F		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	322					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.S322F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						GATGTGACAGGAACTTTCCCT	0.542																																																	1	Substitution - Missense(1)	kidney(1)											102.0	93.0	96.0					X																	129518457		2203	4300	6503	SO:0001583	missense	139760			AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.965C>T	X.37:g.129518457G>A	ENSP00000276218:p.Ser322Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q495H7|Q4VBN3	Missense_Mutation	SNP	ENST00000276218.2	37	CCDS14625.1	.	.	.	.	.	.	.	.	.	.	G	7.269	0.606729	0.14002	.	.	ENSG00000147262	ENST00000276218	T	0.61392	0.11	5.25	3.49	0.39957	.	0.835826	0.10326	N	0.688123	T	0.42200	0.1192	N	0.24115	0.695	0.21967	N	0.999442	B	0.06786	0.001	B	0.06405	0.002	T	0.33675	-0.9859	10	0.56958	D	0.05	-0.9397	6.6711	0.23068	0.293:0.0:0.707:0.0	.	322	Q8TDV5	GP119_HUMAN	F	322	ENSP00000276218:S322F	ENSP00000276218:S322F	S	-	2	0	GPR119	129346138	0.376000	0.25098	0.058000	0.19502	0.750000	0.42670	2.339000	0.43965	0.595000	0.29777	0.600000	0.82982	TCC		0.542	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1		NM_178471	
HELLS	3070	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	96352150	96352150	+	Splice_Site	SNP	A	A	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr10:96352150A>T	ENST00000348459.5	+	17	1956		c.e17-1		HELLS_ENST00000394045.1_Splice_Site|RP11-119K6.6_ENST00000432120.1_RNA|HELLS_ENST00000371332.4_Splice_Site|HELLS_ENST00000394036.1_Splice_Site|HELLS_ENST00000239026.6_Splice_Site	NM_018063.3	NP_060533.2			helicase, lymphoid-specific									p.?(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		GTTTAATTTCAGGTGCTGCTT	0.328																																																	1	Unknown(1)	kidney(1)											57.0	58.0	57.0					10																	96352150		2203	4300	6503	SO:0001630	splice_region_variant	3070			AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.1852-1A>T	10.37:g.96352150A>T		Somatic		WXS	Illumina HiSeq	Phase_I		Splice_Site	SNP	ENST00000348459.5	37	CCDS7434.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845493	0.71603	.	.	ENSG00000119969	ENST00000348459;ENST00000394045;ENST00000371332;ENST00000371327	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6893	0.69072	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HELLS	96342140	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	8.791000	0.91849	2.062000	0.61559	0.460000	0.39030	.		0.328	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1		NM_018063	Intron
HEY1	23462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	80677934	80677934	+	Missense_Mutation	SNP	G	G	A	rs201298116		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr8:80677934G>A	ENST00000354724.3	-	5	603	c.404C>T	c.(403-405)gCg>gTg	p.A135V	HEY1_ENST00000337919.5_Missense_Mutation_p.A139V|HEY1_ENST00000523976.1_Missense_Mutation_p.A45V|HEY1_ENST00000435063.2_5'UTR|RP11-27N21.3_ENST00000607172.1_lincRNA	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	135	Orange. {ECO:0000255|PROSITE- ProRule:PRU00380}.				angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.A139V(1)|p.A135V(1)	HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			CAGATAACGCGCAACTTCTGC	0.507			T	NCOA2	mesenchymal chondrosarcoma						OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	2	Substitution - Missense(2)	kidney(2)											62.0	64.0	63.0					8																	80677934		2203	4300	6503	SO:0001583	missense	23462			AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.404C>T	8.37:g.80677934G>A	ENSP00000346761:p.Ala135Val	Somatic	1200	WXS	Illumina HiSeq	Phase_I	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Missense_Mutation	SNP	ENST00000354724.3	37	CCDS6225.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259285	0.80246	.	.	ENSG00000164683	ENST00000354724;ENST00000542205;ENST00000337919;ENST00000523976;ENST00000518733	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	4.98	4.98	0.66077	Orange subgroup (1);Orange (2);	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	N	0.25789	0.76	0.80722	D	1	D;D	0.89917	0.973;1.0	P;D	0.76575	0.844;0.988	T	0.53422	-0.8441	10	0.17369	T	0.5	-25.4928	18.6141	0.91296	0.0:0.0:1.0:0.0	.	135;139	Q9Y5J3;Q9Y5J3-2	HEY1_HUMAN;.	V	135;139;139;45;97	ENSP00000346761:A135V;ENSP00000338272:A139V;ENSP00000429792:A45V;ENSP00000429705:A97V	ENSP00000338272:A139V	A	-	2	0	HEY1	80840489	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.558000	0.82253	2.456000	0.83038	0.561000	0.74099	GCG		0.507	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379516.1		NM_012258	
IQSEC2	23096	broad.mit.edu;hgsc.bcm.edu	37	X	53284001	53284001	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chrX:53284001C>T	ENST00000375368.5	-	3	1282	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	IQSEC2_ENST00000396435.3_Missense_Mutation_p.R371H|IQSEC2_ENST00000375365.2_Missense_Mutation_p.R166H			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	361	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R368H(1)|p.R371H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GGCTGAGCTGCGTAGCCGCTC	0.592																																																	2	Substitution - Missense(2)	kidney(2)											41.0	29.0	33.0					X																	53284001		2200	4299	6499	SO:0001583	missense	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1082G>A	X.37:g.53284001C>T	ENSP00000364517:p.Arg361His	Somatic		WXS	Illumina HiSeq	Phase_I	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		.	.	.	.	.	.	.	.	.	.	C	35	5.432702	0.96150	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.63096	-0.02;-0.02;-0.02	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.77150	0.4088	M	0.62088	1.915	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.80051	-0.1544	10	0.87932	D	0	.	16.3278	0.82994	0.0:1.0:0.0:0.0	.	371;166	Q5JU85-2;Q5JU85-3	.;.	H	371;361;166	ENSP00000379712:R371H;ENSP00000364517:R361H;ENSP00000364514:R166H	ENSP00000364514:R166H	R	-	2	0	IQSEC2	53300726	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.784000	0.85713	2.108000	0.64289	0.513000	0.50165	CGC		0.592	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding			XM_291345	
JRK	8629	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	143746492	143746492	+	RNA	SNP	T	T	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr8:143746492T>A	ENST00000507178.2	-	0	1318							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				ctccatgggctgcaccaatga	0.607																																																	0													14.0	18.0	17.0					8																	143746492		1749	3548	5297			8629			AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143746492T>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75565	Missense_Mutation	SNP	ENST00000507178.2	37																																																																																					0.607	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1		NM_003724	
KCNH5	27133	broad.mit.edu;ucsc.edu	37	14	63473094	63473094	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr14:63473094G>T	ENST00000322893.7	-	3	562	c.294C>A	c.(292-294)taC>taA	p.Y98*	KCNH5_ENST00000420622.2_Nonsense_Mutation_p.Y98*|KCNH5_ENST00000394964.2_Nonsense_Mutation_p.Y40*|KCNH5_ENST00000394968.1_Nonsense_Mutation_p.Y40*	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	98	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.Y40*(1)|p.Y98*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TGTTTTTCTTGTACAGAAGAA	0.348																																																	2	Substitution - Nonsense(2)	kidney(2)											90.0	88.0	88.0					14																	63473094		2202	4299	6501	SO:0001587	stop_gained	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.294C>A	14.37:g.63473094G>T	ENSP00000321427:p.Tyr98*	Somatic		WXS	Illumina GAIIx	Phase_I	C9JP98	Nonsense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	37	6.487432	0.97607	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	.	.	.	5.35	3.49	0.39957	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2677	0.54686	0.1407:0.0:0.8593:0.0	.	.	.	.	X	98;98;40;40	.	ENSP00000321427:Y98X	Y	-	3	2	KCNH5	62542847	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.265000	0.33027	0.707000	0.31934	0.655000	0.94253	TAC		0.348	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1		NM_139318	
KLF9	687	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	73027803	73027803	+	Silent	SNP	A	A	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr9:73027803A>G	ENST00000377126.2	-	1	1737	c.477T>C	c.(475-477)caT>caC	p.H159H		NM_001206.2	NP_001197.1	Q13886	KLF9_HUMAN	Kruppel-like factor 9	159					cellular response to thyroid hormone stimulus (GO:0097067)|embryo implantation (GO:0007566)|progesterone receptor signaling pathway (GO:0050847)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H159H(1)		endometrium(2)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	9						GGGCTTTGAGATGGGAGGATT	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											110.0	111.0	111.0					9																	73027803		2203	4300	6503	SO:0001819	synonymous_variant	687			BC069431	CCDS6633.1	9q21.11	2013-01-08	2004-11-29	2004-12-01	ENSG00000119138	ENSG00000119138		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	1123	protein-coding gene	gene with protein product		602902	"""basic transcription element binding protein 1"""	BTEB1		1356762	Standard	NM_001206		Approved		uc004aht.3	Q13886	OTTHUMG00000019991	ENST00000377126.2:c.477T>C	9.37:g.73027803A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R943|Q16196	Silent	SNP	ENST00000377126.2	37	CCDS6633.1																																																																																				0.577	KLF9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052602.1		NM_001206	
KMO	8564	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	241723981	241723981	+	Silent	SNP	C	C	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:241723981C>G	ENST00000366559.4	+	6	689	c.378C>G	c.(376-378)ccC>ccG	p.P126P	KMO_ENST00000366558.3_Silent_p.P126P|KMO_ENST00000366557.4_Silent_p.P126P|KMO_ENST00000484628.1_3'UTR	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)									p.P126P(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			AGAAATACCCCAATGTGAAAA	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	94.0	95.0					1																	241723981		2203	4300	6503	SO:0001819	synonymous_variant	8564			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.378C>G	1.37:g.241723981C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000366559.4	37	CCDS1618.1																																																																																				0.383	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1		NM_003679	
LRBA	987	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	151511868	151511868	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr4:151511868C>G	ENST00000357115.3	-	40	6466	c.6223G>C	c.(6223-6225)Gcc>Ccc	p.A2075P	LRBA_ENST00000535741.1_Missense_Mutation_p.A2064P|LRBA_ENST00000507224.1_Missense_Mutation_p.A2064P|LRBA_ENST00000510413.1_Missense_Mutation_p.A2064P	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2075						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A2075P(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AATTTACCGGCAAGATTCTCT	0.418																																																	1	Substitution - Missense(1)	kidney(1)											107.0	105.0	106.0					4																	151511868		2203	4300	6503	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6223G>C	4.37:g.151511868C>G	ENSP00000349629:p.Ala2075Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.64|16.64	3.180236|3.180236	0.57800|0.57800	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|T	0.57107|0.48836	0.85;1.0;0.85;0.42|0.8	5.85|5.85	1.26|1.26	0.21427|0.21427	.|.	0.139726|.	0.28901|.	U|.	0.013778|.	T|T	0.39489|0.39489	0.1080|0.1080	L|L	0.38175|0.38175	1.15|1.15	0.41172|0.41172	D|D	0.98617|0.98617	B;B|.	0.31153|.	0.31;0.012|.	B;B|.	0.24974|.	0.057;0.007|.	T|T	0.24083|0.24083	-1.0170|-1.0170	10|7	0.41790|0.59425	T|D	0.15|0.04	.|.	3.4437|3.4437	0.07473|0.07473	0.171:0.3425:0.0:0.4865|0.171:0.3425:0.0:0.4865	.|.	2075;2064|.	P50851;P50851-2|.	LRBA_HUMAN;.|.	P|F	2064;2064;2075;2064|716	ENSP00000446299:A2064P;ENSP00000421552:A2064P;ENSP00000349629:A2075P;ENSP00000422180:A2064P|ENSP00000426669:L716F	ENSP00000349629:A2075P|ENSP00000426669:L716F	A|L	-|-	1|3	0|2	LRBA|LRBA	151731318|151731318	0.998000|0.998000	0.40836|0.40836	0.087000|0.087000	0.20705|0.20705	0.909000|0.909000	0.53808|0.53808	2.161000|2.161000	0.42358|0.42358	-0.011000|-0.011000	0.14247|0.14247	0.557000|0.557000	0.71058|0.71058	GCC|TTG		0.418	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			
LRRK1	79705	broad.mit.edu;hgsc.bcm.edu	37	15	101606007	101606007	+	Missense_Mutation	SNP	G	G	A	rs536296948		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr15:101606007G>A	ENST00000388948.3	+	32	5724	c.5365G>A	c.(5365-5367)Gtg>Atg	p.V1789M	LRRK1_ENST00000284395.5_Missense_Mutation_p.V1786M|LRRK1_ENST00000532145.1_3'UTR|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.V1789M(1)|p.V1801M(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CATGTTTCCCGTGCGGCCCTT	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		16930	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	kidney(2)											45.0	53.0	51.0					15																	101606007		2027	4177	6204	SO:0001583	missense	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5365G>A	15.37:g.101606007G>A	ENSP00000373600:p.Val1789Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402235	0.42613	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.77750	-1.1;-1.12	5.7	4.78	0.61160	.	0.204720	0.42420	D	0.000710	T	0.78578	0.4305	L	0.59436	1.845	0.31715	N	0.639083	D	0.63880	0.993	P	0.53224	0.721	T	0.81250	-0.1018	10	0.62326	D	0.03	.	7.2068	0.25911	0.1327:0.1615:0.7058:0.0	.	1789	Q38SD2	LRRK1_HUMAN	M	1789;1786;480;343	ENSP00000373600:V1789M;ENSP00000284395:V1786M	ENSP00000284395:V1786M	V	+	1	0	LRRK1	99423530	0.954000	0.32549	0.082000	0.20525	0.104000	0.19210	1.634000	0.37123	2.675000	0.91044	0.655000	0.94253	GTG		0.632	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2		NM_024652	
LRRTM3	347731	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	68687373	68687373	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr10:68687373C>A	ENST00000361320.4	+	2	1277	c.699C>A	c.(697-699)aaC>aaA	p.N233K	CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	233					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.N233K(2)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						GCCTTCAGAACCTTTACTTGC	0.453																																																	2	Substitution - Missense(2)	kidney(2)											85.0	87.0	86.0					10																	68687373		2203	4300	6503	SO:0001583	missense	347731			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.699C>A	10.37:g.68687373C>A	ENSP00000355187:p.Asn233Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	C	5.384	0.256115	0.10185	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.55760	0.5	5.66	0.396	0.16309	.	0.000000	0.64402	D	0.000001	T	0.27900	0.0687	N	0.12443	0.215	0.36438	D	0.865321	B;B	0.12013	0.005;0.004	B;B	0.12156	0.007;0.003	T	0.16778	-1.0391	10	0.12766	T	0.61	.	9.6794	0.40061	0.0:0.623:0.0:0.377	.	233;233	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	K	233	ENSP00000355187:N233K	ENSP00000355187:N233K	N	+	3	2	LRRTM3	68357379	0.868000	0.29978	0.970000	0.41538	0.991000	0.79684	0.098000	0.15189	-0.192000	0.10432	-0.355000	0.07637	AAC		0.453	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2		NM_178011	
MT1G	4495	broad.mit.edu;ucsc.edu	37	16	56700810	56700810	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr16:56700810T>C	ENST00000379811.3	-	3	241	c.170A>G	c.(169-171)aAg>aGg	p.K57R	MT1G_ENST00000569500.1_Missense_Mutation_p.K34R|MT1G_ENST00000568675.1_3'UTR|MT1G_ENST00000444837.2_Missense_Mutation_p.K56R|MT1H_ENST00000332374.4_5'Flank|MT1H_ENST00000569155.1_5'Flank			P13640	MT1G_HUMAN	metallothionein 1G	57	Alpha.				cellular response to cadmium ion (GO:0071276)|cellular response to copper ion (GO:0071280)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cellular response to zinc ion (GO:0071294)|monocyte activation (GO:0042117)|monocyte differentiation (GO:0030224)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.K56R(1)|p.K57R(1)		kidney(2)|large_intestine(1)|lung(2)	5						GCAGCTGCACTTCTCCGATGC	0.547																																																	2	Substitution - Missense(2)	kidney(2)											90.0	92.0	92.0					16																	56700810		2198	4300	6498	SO:0001583	missense	4495			BC020757	CCDS10766.1	16q13	2008-02-05			ENSG00000125144	ENSG00000125144		"""Metallothioneins"""	7399	protein-coding gene	gene with protein product	"""metallothionein 1K"""	156353		MT1		3403543, 6089206	Standard	NM_001301267		Approved	MT1K	uc002eju.1	P13640	OTTHUMG00000133275	ENST00000379811.3:c.170A>G	16.37:g.56700810T>C	ENSP00000369139:p.Lys57Arg	Somatic		WXS	Illumina GAIIx	Phase_I	P80296	Missense_Mutation	SNP	ENST00000379811.3	37		.	.	.	.	.	.	.	.	.	.	T	8.537	0.872332	0.17322	.	.	ENSG00000125144	ENST00000379811;ENST00000444837	T;T	0.11277	2.79;2.79	2.94	1.83	0.25207	.	0.174773	0.36066	U	0.002801	T	0.12561	0.0305	.	.	.	0.80722	D	1	P	0.38110	0.618	B	0.43386	0.418	T	0.03898	-1.0994	9	0.66056	D	0.02	.	7.3183	0.26513	0.0:0.1255:0.0:0.8745	.	56	P13640-2	.	R	57;56	ENSP00000369139:K57R;ENSP00000391397:K56R	ENSP00000369139:K57R	K	-	2	0	MT1G	55258311	1.000000	0.71417	0.989000	0.46669	0.010000	0.07245	3.101000	0.50283	1.338000	0.45544	0.147000	0.16070	AAG		0.547	MT1G-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000257054.1		NM_005950	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11217290	11217290	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:11217290T>G	ENST00000361445.4	-	30	4464	c.4388A>C	c.(4387-4389)tAt>tCt	p.Y1463S		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1463	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.Y1463S(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTTCTTGTCATAGGCCACAAG	0.537																																																	1	Substitution - Missense(1)	kidney(1)											174.0	144.0	154.0					1																	11217290		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4388A>C	1.37:g.11217290T>G	ENSP00000354558:p.Tyr1463Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.633047	0.67015	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.68624	-0.34	5.69	4.57	0.56435	PIK-related kinase (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71804	0.3383	M	0.92219	3.285	0.80722	D	1	P	0.47409	0.895	B	0.38842	0.283	T	0.77800	-0.2452	10	0.87932	D	0	.	11.5379	0.50648	0.0:0.07:0.0:0.93	.	1463	P42345	MTOR_HUMAN	S	1463	ENSP00000354558:Y1463S	ENSP00000354558:Y1463S	Y	-	2	0	MTOR	11139877	1.000000	0.71417	0.695000	0.30226	0.954000	0.61252	7.622000	0.83099	0.985000	0.38656	0.533000	0.62120	TAT		0.537	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
NCOA4	8031	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	51582263	51582263	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr10:51582263G>A	ENST00000443446.1	+	6	790	c.561G>A	c.(559-561)atG>atA	p.M187I	NCOA4_ENST00000452682.1_Missense_Mutation_p.M203I|NCOA4_ENST00000414907.2_Missense_Mutation_p.M21I|NCOA4_ENST00000498586.1_3'UTR|NCOA4_ENST00000438493.1_Missense_Mutation_p.M203I|NCOA4_ENST00000344348.6_Missense_Mutation_p.M187I|NCOA4_ENST00000430396.2_Missense_Mutation_p.M87I|NCOA4_ENST00000374087.4_Missense_Mutation_p.M187I|NCOA4_ENST00000374082.1_Missense_Mutation_p.M187I	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	187					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)	p.M203I(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTATCTCCATGCCAGAGCAGG	0.358			T	RET	papillary thyroid																																			Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	1	Substitution - Missense(1)	kidney(1)											106.0	104.0	104.0					10																	51582263		2203	4300	6503	SO:0001583	missense	8031			L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.561G>A	10.37:g.51582263G>A	ENSP00000390713:p.Met187Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.282|0.282	-0.985516|-0.985516	0.02180|0.02180	.|.	.|.	ENSG00000138293|ENSG00000138293	ENST00000431200|ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000330923;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	.|T;T;T;T;T;T;T;T	.|0.21191	.|2.62;2.61;2.35;2.62;2.02;2.62;2.34;2.62	5.35|5.35	1.47|1.47	0.22746|0.22746	.|.	.|1.240080	.|0.05111	.|N	.|0.488930	T|T	0.17066|0.17066	0.0410|0.0410	L|L	0.36672|0.36672	1.1|1.1	0.21416|0.21416	N|N	0.999695|0.999695	.|B;B;B;B	.|0.17667	.|0.023;0.002;0.01;0.0	.|B;B;B;B	.|0.11329	.|0.006;0.004;0.004;0.0	T|T	0.32561|0.32561	-0.9902|-0.9902	5|10	.|0.20046	.|T	.|0.44	-14.6911|-14.6911	7.1894|7.1894	0.25816|0.25816	0.3534:0.0:0.6466:0.0|0.3534:0.0:0.6466:0.0	.|.	.|87;203;203;187	.|B4DF87;B4E260;E9PAV7;Q13772	.|.;.;.;NCOA4_HUMAN	T|I	103|203;203;87;187;187;21;187;187;187	.|ENSP00000405146:M203I;ENSP00000395465:M203I;ENSP00000393053:M87I;ENSP00000363200:M187I;ENSP00000411018:M21I;ENSP00000344552:M187I;ENSP00000363195:M187I;ENSP00000390713:M187I	.|ENSP00000332421:M187I	A|M	+|+	1|3	0|0	NCOA4|NCOA4	51252269|51252269	0.885000|0.885000	0.30320|0.30320	0.609000|0.609000	0.28983|0.28983	0.032000|0.032000	0.12392|0.12392	0.866000|0.866000	0.27954|0.27954	0.187000|0.187000	0.20147|0.20147	-0.136000|-0.136000	0.14681|0.14681	GCC|ATG		0.358	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1		NM_005437	
NEUROG2	63973	hgsc.bcm.edu	37	4	113435835	113435835	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr4:113435835G>C	ENST00000313341.3	-	2	1123	c.797C>G	c.(796-798)cCc>cGc	p.P266R	RP11-402J6.1_ENST00000504009.1_RNA|RP11-402J6.1_ENST00000506057.1_RNA	NM_024019.3	NP_076924.1	Q9H2A3	NGN2_HUMAN	neurogenin 2	266					axon guidance (GO:0007411)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(6)|skin(2)	12		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		CCTGGCTATGGGGAGGTGAGG	0.622																																																	0													26.0	28.0	27.0					4																	113435835		2202	4298	6500	SO:0001583	missense	63973			AF303002	CCDS3698.1	4q25	2013-05-21			ENSG00000178403	ENSG00000178403		"""Basic helix-loop-helix proteins"""	13805	protein-coding gene	gene with protein product		606624					Standard	NM_024019		Approved	Atoh4, Math4A, ngn-2, bHLHa8, NGN2	uc003ias.3	Q9H2A3	OTTHUMG00000132907	ENST00000313341.3:c.797C>G	4.37:g.113435835G>C	ENSP00000317333:p.Pro266Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N416	Missense_Mutation	SNP	ENST00000313341.3	37	CCDS3698.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655533	0.29425	.	.	ENSG00000178403	ENST00000313341	D	0.92752	-3.1	4.46	3.59	0.41128	.	0.000000	0.45867	D	0.000327	D	0.91848	0.7420	L	0.27053	0.805	0.41352	D	0.987371	D	0.76494	0.999	D	0.73380	0.98	D	0.91689	0.5364	10	0.72032	D	0.01	-17.9808	10.0775	0.42368	0.0:0.2041:0.7959:0.0	.	266	Q9H2A3	NGN2_HUMAN	R	266	ENSP00000317333:P266R	ENSP00000317333:P266R	P	-	2	0	NEUROG2	113655284	0.006000	0.16342	0.687000	0.30102	0.877000	0.50540	1.121000	0.31283	1.041000	0.40125	0.655000	0.94253	CCC		0.622	NEUROG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256414.1		NM_024019	
NKD1	85407	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	50667285	50667285	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr16:50667285C>T	ENST00000268459.3	+	10	1230	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	336					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R336W(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		GCAACGGCTCCGGGGCACCCA	0.642																																																	1	Substitution - Missense(1)	kidney(1)											75.0	87.0	83.0					16																	50667285		2198	4300	6498	SO:0001583	missense	85407			AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.1006C>T	16.37:g.50667285C>T	ENSP00000268459:p.Arg336Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	37	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826653	0.71143	.	.	ENSG00000140807	ENST00000268459	T	0.70399	-0.48	4.44	4.44	0.53790	.	0.069272	0.64402	D	0.000017	T	0.69296	0.3095	M	0.74881	2.28	0.50467	D	0.999874	P	0.36125	0.538	B	0.31290	0.127	T	0.76274	-0.3019	10	0.87932	D	0	-23.2055	15.4353	0.75140	0.0:1.0:0.0:0.0	.	336	Q969G9	NKD1_HUMAN	W	336	ENSP00000268459:R336W	ENSP00000268459:R336W	R	+	1	2	NKD1	49224786	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.992000	0.63889	2.297000	0.77311	0.585000	0.79938	CGG		0.642	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1			
OR2T2	401992	broad.mit.edu;hgsc.bcm.edu	37	1	248616344	248616344	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:248616344G>A	ENST00000342927.3	+	1	268	c.246G>A	c.(244-246)atG>atA	p.M82I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M82I(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCCCAAGATGCTCCAGGACC	0.527																																																	1	Substitution - Missense(1)	kidney(1)											140.0	165.0	157.0					1																	248616344		2203	4297	6500	SO:0001583	missense	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.246G>A	1.37:g.248616344G>A	ENSP00000343062:p.Met82Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNM1|B9EH01	Missense_Mutation	SNP	ENST00000342927.3	37	CCDS31116.1	.	.	.	.	.	.	.	.	.	.	g	9.659	1.143721	0.21205	.	.	ENSG00000196240	ENST00000342927	T	0.05513	3.43	3.48	0.404	0.16355	GPCR, rhodopsin-like superfamily (1);	0.115594	0.39687	N	0.001287	T	0.06462	0.0166	M	0.68593	2.085	0.09310	N	1	B	0.21905	0.062	B	0.18561	0.022	T	0.33954	-0.9848	10	0.87932	D	0	.	1.391	0.02250	0.2055:0.1681:0.4544:0.172	.	82	Q6IF00	OR2T2_HUMAN	I	82	ENSP00000343062:M82I	ENSP00000343062:M82I	M	+	3	0	OR2T2	246682967	0.000000	0.05858	0.172000	0.22920	0.932000	0.56968	-0.050000	0.11904	-0.101000	0.12219	0.298000	0.19748	ATG		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1		NM_001004136	
OVCH2	341277	broad.mit.edu;ucsc.edu	37	11	7723751	7723751	+	lincRNA	SNP	A	A	G	rs531948527		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr11:7723751A>G	ENST00000527565.1	-	0	1178				OVCH2_ENST00000534193.2_RNA|OVCH2_ENST00000454689.1_RNA														p.M139T(1)									ATCATAGTCCATTGGTTTCTT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											129.0	122.0	124.0					11																	7723751		1885	4113	5998			341277																															11.37:g.7723751A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000527565.1	37		.	.	.	.	.	.	.	.	.	.	A	20.4	3.981458	0.74474	.	.	ENSG00000183378	ENST00000454689	D	0.87809	-2.3	5.77	5.77	0.91146	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.56097	D	0.000031	D	0.88024	0.6326	L	0.28608	0.87	0.26592	N	0.973181	D	0.65815	0.995	D	0.65773	0.938	T	0.80641	-0.1292	10	0.22706	T	0.39	-18.6511	14.0378	0.64656	1.0:0.0:0.0:0.0	.	139	Q7RTZ1	OVCH2_HUMAN	T	139	ENSP00000407158:M139T	ENSP00000407158:M139T	M	-	2	0	OVCH2	7680327	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.972000	0.76110	2.210000	0.71456	0.459000	0.35465	ATG		0.423	RP11-35J10.5-001	KNOWN	basic|readthrough_transcript	lincRNA	lincRNA	OTTHUMT00000385692.1			
PHF3	23469	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	64421671	64421671	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr6:64421671A>G	ENST00000262043.3	+	16	4527	c.4187A>G	c.(4186-4188)aAt>aGt	p.N1396S	PHF3_ENST00000393387.1_Missense_Mutation_p.N1396S			Q92576	PHF3_HUMAN	PHD finger protein 3	1396					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.N1396S(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GAGGAAGAAAATGACTTTTTT	0.368																																					GBM(135;136 1820 29512 34071 46235)												1	Substitution - Missense(1)	kidney(1)											93.0	105.0	101.0					6																	64421671		2202	4299	6501	SO:0001583	missense	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.4187A>G	6.37:g.64421671A>G	ENSP00000262043:p.Asn1396Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	A	9.262	1.043496	0.19748	.	.	ENSG00000118482	ENST00000515594;ENST00000262043;ENST00000393387	T;T;T	0.44881	0.91;2.16;2.16	5.95	2.3	0.28687	.	0.523755	0.15992	N	0.234775	T	0.12347	0.0300	L	0.33485	1.01	0.37335	D	0.910142	B	0.18461	0.028	B	0.12156	0.007	T	0.10222	-1.0639	10	0.16896	T	0.51	-14.156	9.1746	0.37105	0.791:0.0:0.209:0.0	.	1396	Q92576	PHF3_HUMAN	S	665;1396;1396	ENSP00000425338:N665S;ENSP00000262043:N1396S;ENSP00000377048:N1396S	ENSP00000262043:N1396S	N	+	2	0	PHF3	64479630	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.277000	0.58939	0.165000	0.19558	0.533000	0.62120	AAT		0.368	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2			
PARK2	5071	broad.mit.edu;ucsc.edu	37	6	161781136	161781136	+	Silent	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr6:161781136T>C	ENST00000366898.1	-	11	1371	c.1269A>G	c.(1267-1269)gtA>gtG	p.V423V	PARK2_ENST00000338468.3_Silent_p.V232V|PARK2_ENST00000366894.1_Silent_p.V232V|PARK2_ENST00000366897.1_Silent_p.V395V|PARK2_ENST00000366896.1_Silent_p.V274V	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	423					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)	p.V423V(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TTTCCACTGGTACATGGCAGC	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											238.0	228.0	231.0					6																	161781136		2203	4300	6503	SO:0001819	synonymous_variant	5071				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.1269A>G	6.37:g.161781136T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Silent	SNP	ENST00000366898.1	37	CCDS5281.1																																																																																				0.522	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1			
PIGQ	9091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	629095	629095	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr16:629095T>C	ENST00000026218.5	+	7	1338	c.1250T>C	c.(1249-1251)cTg>cCg	p.L417P	PIGQ_ENST00000321878.5_Missense_Mutation_p.L417P|PIGQ_ENST00000409527.2_Missense_Mutation_p.L417P	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	417	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)	p.L417P(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				ATCCATGGCCTGTCCTCACTG	0.687																																																	1	Substitution - Missense(1)	kidney(1)											89.0	83.0	85.0					16																	629095		2200	4300	6500	SO:0001583	missense	9091			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1250T>C	16.37:g.629095T>C	ENSP00000026218:p.Leu417Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	T	19.21	3.783849	0.70222	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000026218;ENST00000540241	T;T;T	0.56103	0.48;0.48;1.77	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.75679	0.3882	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.80103	-0.1522	10	0.87932	D	0	-21.6385	15.3314	0.74215	0.0:0.0:0.0:1.0	.	431;417;417	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	P	417;417;417;2	ENSP00000386760:L417P;ENSP00000326674:L417P;ENSP00000026218:L417P	ENSP00000026218:L417P	L	+	2	0	PIGQ	569096	1.000000	0.71417	0.582000	0.28627	0.083000	0.17756	7.990000	0.88215	2.224000	0.72417	0.533000	0.62120	CTG		0.687	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2		NM_004204	
PKHD1L1	93035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	110487349	110487349	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr8:110487349A>T	ENST00000378402.5	+	51	8712	c.8608A>T	c.(8608-8610)Aca>Tca	p.T2870S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2870					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T2872S(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCCTATAGGCACAAGCATTAT	0.348										HNSCC(38;0.096)																																							1	Substitution - Missense(1)	kidney(1)											102.0	95.0	97.0					8																	110487349		1873	4102	5975	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8608A>T	8.37:g.110487349A>T	ENSP00000367655:p.Thr2870Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.342249	0.41498	.	.	ENSG00000205038	ENST00000378402	D	0.86562	-2.14	5.79	5.79	0.91817	.	0.411616	0.22592	N	0.058063	T	0.79992	0.4542	L	0.33485	1.01	0.24308	N	0.99509	B	0.25955	0.138	B	0.24006	0.05	T	0.65598	-0.6129	10	0.19590	T	0.45	.	12.5117	0.56009	1.0:0.0:0.0:0.0	.	2870	Q86WI1	PKHL1_HUMAN	S	2870	ENSP00000367655:T2870S	ENSP00000367655:T2870S	T	+	1	0	PKHD1L1	110556525	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	3.018000	0.49625	2.194000	0.70268	0.533000	0.62120	ACA		0.348	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
PTPN13	5783	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	87684097	87684097	+	Silent	SNP	T	T	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr4:87684097T>A	ENST00000411767.2	+	24	3834	c.3771T>A	c.(3769-3771)tcT>tcA	p.S1257S	PTPN13_ENST00000316707.6_Silent_p.S1066S|PTPN13_ENST00000511467.1_Silent_p.S1257S|PTPN13_ENST00000427191.2_Silent_p.S1238S|PTPN13_ENST00000436978.1_Silent_p.S1257S			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1257					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.S1257S(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CCAGCTTGTCTCAAAGCCAGG	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											71.0	73.0	72.0					4																	87684097		1916	4135	6051	SO:0001819	synonymous_variant	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.3771T>A	4.37:g.87684097T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	ENST00000411767.2	37	CCDS47094.1																																																																																				0.542	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			
RBM25	58517	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	73550237	73550237	+	Silent	SNP	A	A	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr14:73550237A>G	ENST00000261973.7	+	5	645	c.360A>G	c.(358-360)caA>caG	p.Q120Q	RBM25_ENST00000527432.1_Silent_p.Q120Q|RBM25_ENST00000526754.1_Silent_p.Q120Q|RBM25_ENST00000525321.1_Silent_p.Q120Q|RBM25_ENST00000540173.1_Silent_p.Q120Q	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	120	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Q120Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		AGAGAGTACAAGGTGCTTCCG	0.318																																																	1	Substitution - coding silent(1)	kidney(1)											140.0	139.0	139.0					14																	73550237		2203	4300	6503	SO:0001819	synonymous_variant	58517			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.360A>G	14.37:g.73550237A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Silent	SNP	ENST00000261973.7	37	CCDS32113.1																																																																																				0.318	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1		XM_027330	
RDM1	201299	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	34249624	34249624	+	Silent	SNP	C	C	T	rs112692396		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:34249624C>T	ENST00000293273.6	-	5	669	c.624G>A	c.(622-624)aaG>aaA	p.K208K	RDM1_ENST00000394529.3_Silent_p.K185K|RDM1_ENST00000394528.3_Silent_p.K208K|RDM1_ENST00000591402.1_Intron|RDM1_ENST00000430160.2_Silent_p.K185K|RDM1_ENST00000419453.2_Intron|RDM1_ENST00000394527.1_3'UTR|RDM1_ENST00000425909.3_Intron|RDM1_ENST00000431884.2_Intron	NM_145654.3	NP_663629.1	Q8NG50	RDM1_HUMAN	RAD52 motif containing 1	208					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.K208K(2)		breast(1)|kidney(3)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)	9		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CTGACAAAGCCTTCTGAATAG	0.373								Other identified genes with known or suspected DNA repair function																																									2	Substitution - coding silent(2)	kidney(2)											150.0	147.0	148.0					17																	34249624		2203	4300	6503	SO:0001819	synonymous_variant	201299			AB080728	CCDS11301.1, CCDS42299.1, CCDS54111.1, CCDS54108.1, CCDS54109.1, CCDS54110.1, CCDS59280.1, CCDS59281.1	17q11.2	2014-04-10	2014-04-10	2005-10-20	ENSG00000187456	ENSG00000278023		"""RNA binding motif (RRM) containing"""	19950	protein-coding gene	gene with protein product		612896	"""RAD52 homolog B (S. cerevisiae)"", ""RAD52 motif 1"""	RAD52B		15611051	Standard	NM_001163120		Approved	MGC33977	uc002hkh.3	Q8NG50	OTTHUMG00000188399	ENST00000293273.6:c.624G>A	17.37:g.34249624C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0JP55|A8MV46|A8MY68|A8MZ92|A8RCS5|A8RCT0|A8RCT5|A8RCT8|A8RCU3|A8RCU8|A8RCW0|A8RCW5	Silent	SNP	ENST00000293273.6	37	CCDS11301.1																																																																																				0.373	RDM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256588.2		NM_145654	
RPS6KC1	26750	broad.mit.edu;ucsc.edu	37	1	213341274	213341274	+	Silent	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:213341274C>T	ENST00000366960.3	+	7	1059	c.909C>T	c.(907-909)atC>atT	p.I303I	RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543470.1_Silent_p.I122I|RPS6KC1_ENST00000543354.1_Silent_p.I6I|RPS6KC1_ENST00000366959.3_Silent_p.I291I	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	303	MIT.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)	p.I303I(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		CAGAAAGTATCTCTAGTCTTT	0.423																																																	1	Substitution - coding silent(1)	kidney(1)											165.0	135.0	145.0					1																	213341274		2203	4300	6503	SO:0001819	synonymous_variant	26750			AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.909C>T	1.37:g.213341274C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Silent	SNP	ENST00000366960.3	37	CCDS1513.1																																																																																				0.423	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3		NM_012424	
S1PR3	1903	broad.mit.edu;ucsc.edu	37	9	91616249	91616249	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr9:91616249T>C	ENST00000375846.3	+	1	4829	c.134T>C	c.(133-135)cTc>cCc	p.L45P	S1PR3_ENST00000358157.2_Missense_Mutation_p.L45P			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	45					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.L45P(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						ACCACCGTGCTCTTCTTGGTC	0.532											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											120.0	118.0	119.0					9																	91616249		2203	4300	6503	SO:0001583	missense	1903			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.134T>C	9.37:g.91616249T>C	ENSP00000365006:p.Leu45Pro	Somatic	1283	WXS	Illumina GAIIx	Phase_I	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	CCDS6680.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.412545	0.42817	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.17691	2.26;2.26	5.14	5.14	0.70334	.	0.553579	0.18054	N	0.153174	T	0.14700	0.0355	L	0.55990	1.75	0.24350	N	0.994928	P	0.38642	0.641	B	0.31614	0.133	T	0.26052	-1.0114	10	0.56958	D	0.05	.	7.6075	0.28110	0.0:0.123:0.0:0.877	.	45	Q99500	S1PR3_HUMAN	P	45	ENSP00000350878:L45P;ENSP00000365006:L45P	ENSP00000350878:L45P	L	+	2	0	S1PR3	90806069	0.027000	0.19231	0.309000	0.25155	0.975000	0.68041	1.932000	0.40143	2.155000	0.67459	0.459000	0.35465	CTC		0.532	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2		NM_005226	
SCMH1	22955	broad.mit.edu;hgsc.bcm.edu	37	1	41579130	41579130	+	Missense_Mutation	SNP	G	G	T	rs377356235		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:41579130G>T	ENST00000326197.7	-	7	839	c.540C>A	c.(538-540)aaC>aaA	p.N180K	SCMH1_ENST00000372597.1_Missense_Mutation_p.N133K|SCMH1_ENST00000397171.2_Missense_Mutation_p.N119K|SCMH1_ENST00000456518.2_Intron|SCMH1_ENST00000402904.2_Missense_Mutation_p.N180K|SCMH1_ENST00000337495.5_Missense_Mutation_p.N190K|SCMH1_ENST00000397174.2_Missense_Mutation_p.N160K|SCMH1_ENST00000372596.1_Missense_Mutation_p.N119K|SCMH1_ENST00000361191.5_Missense_Mutation_p.N119K|SCMH1_ENST00000372595.1_Missense_Mutation_p.N119K|SCMH1_ENST00000361705.3_Missense_Mutation_p.N133K					sex comb on midleg homolog 1 (Drosophila)									p.N133K(1)|p.N190K(1)|p.N180K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				TGAAATGAGGGTTCTTCCTGT	0.512																																																	3	Substitution - Missense(3)	kidney(3)											82.0	81.0	82.0					1																	41579130		2203	4300	6503	SO:0001583	missense	22955			AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.540C>A	1.37:g.41579130G>T	ENSP00000318094:p.Asn180Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000326197.7	37	CCDS30688.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780394	0.70222	.	.	ENSG00000010803	ENST00000361705;ENST00000402904;ENST00000397174;ENST00000397171;ENST00000361191;ENST00000372597;ENST00000372596;ENST00000337495;ENST00000372595;ENST00000326197	T;T;T;T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.59238	0.2179	M	0.90814	3.15	0.58432	D	0.999999	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.80764	0.994;0.99;0.99	T	0.64601	-0.6369	10	0.52906	T	0.07	.	9.7276	0.40342	0.1581:0.0:0.8419:0.0	.	190;133;180	Q96GD3-2;Q96GD3-4;Q96GD3	.;.;SCMH1_HUMAN	K	133;180;160;119;119;133;119;190;119;180	ENSP00000354996:N133K;ENSP00000386079:N180K;ENSP00000380359:N160K;ENSP00000380356:N119K;ENSP00000354656:N119K;ENSP00000361678:N133K;ENSP00000361677:N119K;ENSP00000337352:N190K;ENSP00000361676:N119K;ENSP00000318094:N180K	ENSP00000318094:N180K	N	-	3	2	SCMH1	41351717	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.752000	0.38349	1.431000	0.47355	0.557000	0.71058	AAC		0.512	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1			
SEPT11	55752	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	77941776	77941776	+	Silent	SNP	T	T	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr4:77941776T>G	ENST00000264893.6	+	7	1107	c.906T>G	c.(904-906)ctT>ctG	p.L302L	SEPT11_ENST00000512575.1_Intron|SEPT11_ENST00000502584.1_Silent_p.L302L|SEPT11_ENST00000541121.1_Silent_p.L312L|SEPT11_ENST00000510515.1_Silent_p.L312L|SEPT11_ENST00000505788.1_Silent_p.L302L	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	302	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)	p.L302L(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						GCTGTAAGCTTGAAGAGATGG	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											96.0	80.0	85.0					4																	77941776		2203	4300	6503	SO:0001819	synonymous_variant	55752			AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.906T>G	4.37:g.77941776T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Silent	SNP	ENST00000264893.6	37	CCDS34018.1	.	.	.	.	.	.	.	.	.	.	T	7.309	0.614586	0.14129	.	.	ENSG00000138758	ENST00000506731	T	0.67345	-0.26	5.53	-8.43	0.00953	.	0.092093	0.47093	D	0.000253	T	0.61677	0.2366	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66148	-0.5996	7	0.87932	D	0	.	5.6107	0.17404	0.0653:0.2101:0.367:0.3576	.	.	.	.	W	31	ENSP00000423103:L31W	ENSP00000423103:L31W	L	+	2	0	SEPT11	78160800	0.001000	0.12720	0.720000	0.30636	0.589000	0.36550	-2.287000	0.01151	-1.600000	0.01603	-1.063000	0.02288	TTG		0.512	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362676.1		NM_018243	
SERPINB5	5268	broad.mit.edu;hgsc.bcm.edu	37	18	61154179	61154179	+	Splice_Site	SNP	G	G	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr18:61154179G>C	ENST00000382771.4	+	3	461	c.169G>C	c.(169-171)Gtt>Ctt	p.V57L	RP11-635N19.3_ENST00000602456.1_RNA|SERPINB5_ENST00000489441.1_Splice_Site_p.V57L	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	57					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V57L(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						CTCTTAACAGGTTCTTCATTT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											84.0	86.0	85.0					18																	61154179		2203	4300	6503	SO:0001630	splice_region_variant	5268			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.169-1G>C	18.37:g.61154179G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	CCDS32839.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068408	0.55539	.	.	ENSG00000206075	ENST00000382771;ENST00000424602	D;D	0.85861	-2.04;-2.04	5.21	5.21	0.72293	Serpin domain (3);	0.587182	0.16534	N	0.210224	D	0.87034	0.6077	M	0.78916	2.43	0.58432	D	0.999992	B;B	0.31968	0.349;0.233	B;B	0.35859	0.1;0.212	D	0.84944	0.0867	9	.	.	.	.	17.8844	0.88849	0.0:0.0:1.0:0.0	.	57;57	P36952;P36952-2	SPB5_HUMAN;.	L	57	ENSP00000372221:V57L;ENSP00000408821:V57L	.	V	+	1	0	SERPINB5	59305159	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	4.341000	0.59335	2.588000	0.87417	0.650000	0.86243	GTT		0.383	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1		NM_002639	Missense_Mutation
SIGLEC12	89858	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52004612	52004612	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr19:52004612C>T	ENST00000291707.3	-	1	431	c.376G>A	c.(376-378)Gga>Aga	p.G126R	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	126	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G126R(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TTCATATTTCCTCTCTCTACA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											127.0	118.0	121.0					19																	52004612		2203	4300	6503	SO:0001583	missense	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.376G>A	19.37:g.52004612C>T	ENSP00000291707:p.Gly126Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	12.01	1.811032	0.32053	.	.	ENSG00000254521	ENST00000291707	T	0.65364	-0.15	2.09	0.946	0.19549	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76090	0.3939	M	0.85542	2.76	0.09310	N	1	D	0.89917	1.0	D	0.71656	0.974	T	0.62553	-0.6830	9	0.87932	D	0	.	5.4617	0.16619	0.3293:0.6707:0.0:0.0	.	126	Q96PQ1	SIG12_HUMAN	R	126	ENSP00000291707:G126R	ENSP00000291707:G126R	G	-	1	0	SIGLEC12	56696424	0.001000	0.12720	0.002000	0.10522	0.023000	0.10783	0.629000	0.24538	0.052000	0.16007	0.395000	0.25975	GGA		0.473	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2		NM_053003	
SLC1A7	6512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	53608095	53608095	+	Silent	SNP	C	C	T	rs267598645		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:53608095C>T	ENST00000371494.4	-	1	154	c.27G>A	c.(25-27)cgG>cgA	p.R9R	SLC1A7_ENST00000371491.4_Silent_p.R9R	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	9					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.R9R(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		CGTCCCTCCCCCGTGCCAAGA	0.657																																					NSCLC(128;80 1811 21245 38490 51715)												1	Substitution - coding silent(1)	kidney(1)											137.0	85.0	102.0					1																	53608095		2203	4300	6503	SO:0001819	synonymous_variant	6512			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.27G>A	1.37:g.53608095C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVZ0|Q969Z8|Q9BW45	Silent	SNP	ENST00000371494.4	37	CCDS574.1																																																																																				0.657	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1		NM_006671	
SLC38A10	124565	hgsc.bcm.edu	37	17	79225074	79225075	+	Intron	INS	-	-	T	rs142504417|rs386799869|rs147245242	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:79225074_79225075insT	ENST00000374759.3	-	14	2449				SLC38A10_ENST00000288439.5_Frame_Shift_Ins_p.H762fs	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10						amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TGCCGCAGGTGTTTAAAGGGGA	0.515													TTT|TTT|TTTT|insertion	425	0.0848642	0.2625	0.0418	5008	,	,		17888	0.0		0.0388	False		,,,				2504	0.0102																0									,	811,3449		102,607,1421					,	-3.9	0.0		dbSNP_134	67	326,7926		9,308,3809	no	frameshift,intron	SLC38A10	NM_138570.2,NM_001037984.1	,	111,915,5230	A1A1,A1R,RR		3.9506,19.0376,9.0873	,	,		1137,11375				SO:0001627	intron_variant	124565			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2065+217->A	17.37:g.79225077_79225077dupT		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZRC5|Q8NA99|Q96C66	Frame_Shift_Ins	INS	ENST00000374759.3	37	CCDS42397.1																																																																																				0.515	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1		NM_138570	
SYT15	83849	broad.mit.edu;hgsc.bcm.edu	37	10	46962003	46962003	+	Silent	SNP	G	G	C	rs370972253		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr10:46962003G>C	ENST00000374321.4	-	8	1299	c.1233C>G	c.(1231-1233)cgC>cgG	p.R411R	SYT15_ENST00000374325.3_Intron|SYT15_ENST00000503753.1_Intron|SYT15_ENST00000374323.4_Silent_p.R464R|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000449358.2_5'Flank	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	411						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R411R(1)		cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						GCGCATGCCAGCGCTTCACCA	0.662																																					Ovarian(57;1152 1428 19651 37745)												1	Substitution - coding silent(1)	kidney(1)						G	,	0,4186		0,0,2093	47.0	58.0	55.0		1233,	0.3	1.0	10		55	6,8432		0,6,4213	no	coding-synonymous,intron	SYT15	NM_031912.4,NM_181519.2	,	0,6,6306	CC,CG,GG		0.0711,0.0,0.0475	,	411/422,	46962003	6,12618	2093	4219	6312	SO:0001819	synonymous_variant	83849			AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.1233C>G	10.37:g.46962003G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Silent	SNP	ENST00000374321.4	37	CCDS44376.1																																																																																				0.662	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1		NM_031912	
TAF15	8148	hgsc.bcm.edu	37	17	34171576	34171605	+	In_Frame_Del	DEL	GGTGGCTATGGTGGAGACAGAAGCAGCGGT	GGTGGCTATGGTGGAGACAGAAGCAGCGGT	-	rs576937289|rs4251785|rs574534265|rs200046706	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	GGTGGCTATGGTGGAGACAGAAGCAGCGGT	GGTGGCTATGGTGGAGACAGAAGCAGCGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:34171576_34171605delGGTGGCTATGGTGGAGACAGAAGCAGCGGT	ENST00000588240.1	+	15	1388_1417	c.1273_1302delGGTGGCTATGGTGGAGACAGAAGCAGCGGT	c.(1273-1302)ggtggctatggtggagacagaagcagcggtdel	p.GGYGGDRSSG425del	TAF15_ENST00000592237.1_Intron|TAF15_ENST00000311979.3_In_Frame_Del_p.GGYGGDRSSG422del	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		cagaagtgggggtggctatggtggagacagaagcagcggtggtggctaca	0.635			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																			Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	0																																										SO:0001651	inframe_deletion	8148			U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1273_1302delGGTGGCTATGGTGGAGACAGAAGCAGCGGT	17.37:g.34171576_34171605delGGTGGCTATGGTGGAGACAGAAGCAGCGGT	ENSP00000466950:p.Gly425_Gly434del	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPM5|Q15775|Q5T077	In_Frame_Del	DEL	ENST00000588240.1	37	CCDS32623.1																																																																																				0.635	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1		NM_139215	
TBC1D3C	414060	hgsc.bcm.edu	37	17	34581565	34581566	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:34581565_34581566insG	ENST00000457979.3	-	14	1633_1634	c.1484_1485insC	c.(1483-1485)gctfs	p.A495fs	TBC1D3C_ENST00000451448.2_Frame_Shift_Ins_p.A473fs|TBC1D3H_ENST00000400684.4_Frame_Shift_Ins_p.A415fs|TBC1D3H_ENST00000535446.1_Frame_Shift_Ins_p.A415fs|TBC1D3C_ENST00000308078.7_Frame_Shift_Ins_p.A495fs|TBC1D3C_ENST00000336331.5_Frame_Shift_Ins_p.A473fs	NM_001001418.4	NP_001001418.4	Q6IPX1	TBC3C_HUMAN	TBC1 domain family, member 3C	495						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			kidney(5)|pancreas(1)	6		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGGGTGTTCAGCCTGCCAGCA	0.624																																																	0																																										SO:0001589	frameshift_variant	414060			BC033670	CCDS74045.1	17q12	2014-09-16				ENSG00000274933			24889	protein-coding gene	gene with protein product		610806				12359748, 16863688	Standard	XM_005257981		Approved	MGC44903	uc002hlk.2	Q6IPX1	OTTHUMG00000188484	ENST00000457979.3:c.1485dupC	17.37:g.34581566_34581566dupG	ENSP00000390761:p.Ala495fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000457979.3	37	CCDS11309.2																																																																																				0.624	TBC1D3C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256090.2		NM_001001418	
TBC1D3	729873	hgsc.bcm.edu	37	17	36338191	36338192	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:36338191_36338192insG	ENST00000354664.4	-	14	1640_1641	c.1484_1485insC	c.(1483-1485)gctfs	p.A495fs	TBC1D3_ENST00000339023.4_3'UTR|TBC1D3_ENST00000519532.1_Frame_Shift_Ins_p.A473fs|TBC1D3_ENST00000537432.1_Frame_Shift_Ins_p.A495fs	NM_001123391.2	NP_001116863.2	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3	495						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGGGTGTTCAGCCTGCCAGCA	0.629																																																	0																																										SO:0001589	frameshift_variant	84218				CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000354664.4:c.1485dupC	17.37:g.36338192_36338192dupG	ENSP00000346691:p.Ala495fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Frame_Shift_Ins	INS	ENST00000354664.4	37	CCDS45658.1																																																																																				0.629	TBC1D3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378681.1		NM_001123391	
TRHR	7201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	110131432	110131432	+	Silent	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr8:110131432C>T	ENST00000518632.1	+	3	1296	c.945C>T	c.(943-945)atC>atT	p.I315I	TRHR_ENST00000311762.2_Silent_p.I315I			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	315					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)	p.I315I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			ACAGTGCCATCAACCCGGTGA	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											224.0	220.0	221.0					8																	110131432		2203	4300	6503	SO:0001819	synonymous_variant	7201				CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.945C>T	8.37:g.110131432C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2M339	Silent	SNP	ENST00000518632.1	37	CCDS6311.1																																																																																				0.433	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1			
TXLNA	200081	hgsc.bcm.edu	37	1	32658881	32658881	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:32658881T>C	ENST00000373609.1	+	8	1512	c.1231T>C	c.(1231-1233)Ttc>Ctc	p.F411L	TXLNA_ENST00000373610.3_Missense_Mutation_p.F411L			P40222	TXLNA_HUMAN	taxilin alpha	411					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				ATTCACCACATTCAAGCAGGA	0.502																																																	0													115.0	96.0	102.0					1																	32658881		2203	4300	6503	SO:0001583	missense	200081			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.1231T>C	1.37:g.32658881T>C	ENSP00000362711:p.Phe411Leu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Missense_Mutation	SNP	ENST00000373609.1	37	CCDS353.1	.	.	.	.	.	.	.	.	.	.	T	36	5.605186	0.96626	.	.	ENSG00000084652	ENST00000373610;ENST00000373609	T;T	0.54866	0.55;0.55	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.76821	0.4041	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81261	-0.1013	10	0.87932	D	0	-14.2712	16.3686	0.83344	0.0:0.0:0.0:1.0	.	411	P40222	TXLNA_HUMAN	L	411	ENSP00000362712:F411L;ENSP00000362711:F411L	ENSP00000362711:F411L	F	+	1	0	TXLNA	32431468	1.000000	0.71417	0.987000	0.45799	0.978000	0.69477	8.013000	0.88655	2.330000	0.79161	0.533000	0.62120	TTC		0.502	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1		NM_175852	
TXLNA	200081	hgsc.bcm.edu;ucsc.edu	37	1	32658884	32658885	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:32658884_32658885insC	ENST00000373609.1	+	8	1515_1516	c.1234_1235insC	c.(1234-1236)aagfs	p.K412fs	TXLNA_ENST00000373610.3_Frame_Shift_Ins_p.K412fs			P40222	TXLNA_HUMAN	taxilin alpha	412				K -> E (in Ref. 2; CAD89951). {ECO:0000305}.	B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CACCACATTCAAGCAGGAGATG	0.515																																																	0																																										SO:0001589	frameshift_variant	200081			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	Exception_encountered	1.37:g.32658884_32658885insC	ENSP00000362711:p.Lys412fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Frame_Shift_Ins	INS	ENST00000373609.1	37	CCDS353.1																																																																																				0.515	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1		NM_175852	
TXLNA	200081	hgsc.bcm.edu;ucsc.edu	37	1	32658886	32658887	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:32658886_32658887delGC	ENST00000373609.1	+	8	1517_1518	c.1236_1237delGC	c.(1234-1239)aagcagfs	p.Q413fs	TXLNA_ENST00000373610.3_Frame_Shift_Del_p.Q413fs			P40222	TXLNA_HUMAN	taxilin alpha	413					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCACATTCAAGCAGGAGATGGA	0.51																																																	0																																										SO:0001589	frameshift_variant	200081			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.1236_1237delGC	1.37:g.32658886_32658887delGC	ENSP00000362711:p.Gln413fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Frame_Shift_Del	DEL	ENST00000373609.1	37	CCDS353.1																																																																																				0.510	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1		NM_175852	
VPS39	23339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	42454241	42454241	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr15:42454241C>T	ENST00000348544.4	-	24	2481	c.2482G>A	c.(2482-2484)Gaa>Aaa	p.E828K	VPS39_ENST00000318006.5_Missense_Mutation_p.E817K			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	828					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)	p.E817K(1)		breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		CTCAGGAATTCTGCATGGAGA	0.448																																																	1	Substitution - Missense(1)	kidney(1)											171.0	153.0	159.0					15																	42454241		2203	4299	6502	SO:0001583	missense	23339			AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.2482G>A	15.37:g.42454241C>T	ENSP00000335193:p.Glu828Lys	Somatic		WXS	Illumina HiSeq	Phase_I	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	37	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426408	0.83667	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.53640	0.61;0.62	5.21	5.21	0.72293	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 2 (1);	0.104173	0.64402	D	0.000003	T	0.60612	0.2282	M	0.82517	2.595	0.80722	D	1	P;P	0.38129	0.619;0.565	B;B	0.44133	0.442;0.386	T	0.60367	-0.7277	10	0.28530	T	0.3	-11.592	19.1161	0.93340	0.0:1.0:0.0:0.0	.	828;817	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	K	817;828	ENSP00000326534:E817K;ENSP00000335193:E828K	ENSP00000326534:E817K	E	-	1	0	VPS39	40241533	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	7.396000	0.79891	2.599000	0.87857	0.561000	0.74099	GAA		0.448	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1		NM_015289	
WASL	8976	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	123335918	123335918	+	Splice_Site	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr7:123335918G>A	ENST00000223023.4	-	7	963	c.631C>T	c.(631-633)Cac>Tac	p.H211Y		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	211	CRIB. {ECO:0000255|PROSITE- ProRule:PRU00057}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)	p.H211Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGTCCAATGTGCCTGAAGTAG	0.308																																																	1	Substitution - Missense(1)	kidney(1)											70.0	69.0	69.0					7																	123335918		2203	4297	6500	SO:0001630	splice_region_variant	8976			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.630-1C>T	7.37:g.123335918G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A1JUI9|Q7Z746	Missense_Mutation	SNP	ENST00000223023.4	37	CCDS34743.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853098	0.71719	.	.	ENSG00000106299	ENST00000223023	D	0.98968	-5.28	5.09	5.09	0.68999	Wiscott-Aldrich syndrome, C-terminal (1);PAK-box/P21-Rho-binding (3);	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	M	0.93939	3.475	0.80722	D	1	P	0.48162	0.906	P	0.51487	0.671	D	0.99835	1.1057	10	0.87932	D	0	-9.9412	18.8389	0.92174	0.0:0.0:1.0:0.0	.	211	O00401	WASL_HUMAN	Y	211	ENSP00000223023:H211Y	ENSP00000223023:H211Y	H	-	1	0	WASL	123123154	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	7.708000	0.84633	2.524000	0.85096	0.467000	0.42956	CAC		0.308	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348522.1		NM_003941	Missense_Mutation
ZMAT2	153527	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140085215	140085215	+	Silent	SNP	G	G	T	rs143727913	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr5:140085215G>T	ENST00000274712.3	+	6	601	c.474G>T	c.(472-474)gcG>gcT	p.A158A		NM_144723.1	NP_653324.1	Q96NC0	ZMAT2_HUMAN	zinc finger, matrin-type 2	158						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A158A(1)		breast(2)|kidney(2)|large_intestine(1)|liver(1)|lung(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			aggccaaagcgtacaagaaag	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											123.0	108.0	113.0					5																	140085215		2203	4300	6503	SO:0001819	synonymous_variant	153527			AK055683	CCDS4239.1	5q31	2012-10-05	2010-09-15		ENSG00000146007	ENSG00000146007		"""Zinc fingers, matrin-type"""	26433	protein-coding gene	gene with protein product						12477932	Standard	NM_144723		Approved	FLJ31121, hSNU23, Snu23	uc003lgy.1	Q96NC0	OTTHUMG00000129503	ENST00000274712.3:c.474G>T	5.37:g.140085215G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000274712.3	37	CCDS4239.1																																																																																				0.468	ZMAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468143.1		NM_144723	
ZMIZ1	57178	hgsc.bcm.edu	37	10	81070821	81070822	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr10:81070821_81070822insC	ENST00000334512.5	+	24	3548_3549	c.2976_2977insC	c.(2977-2979)ccgfs	p.P993fs	ZMIZ1_ENST00000446377.2_Intron	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	993	Pro-rich.				artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CTCCCCGGCAGCCGCCACAGGC	0.639																																																	0																																										SO:0001589	frameshift_variant	57178			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2978dupC	10.37:g.81070823_81070823dupC	ENSP00000334474:p.Pro993fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JSH9|Q7Z7E6	Frame_Shift_Ins	INS	ENST00000334512.5	37	CCDS7357.1																																																																																				0.639	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2		NM_020338	
ZMYM5	9205	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	20426164	20426164	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr13:20426164C>A	ENST00000337963.4	-	3	421	c.157G>T	c.(157-159)Gat>Tat	p.D53Y	ZMYM5_ENST00000382905.4_Missense_Mutation_p.D53Y|ZMYM5_ENST00000382907.4_Missense_Mutation_p.D53Y	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	53	Poly-Asp.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.D53Y(2)		kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		tcatcatcatcTTCCACTGGT	0.403																																																	2	Substitution - Missense(2)	kidney(2)											115.0	109.0	111.0					13																	20426164		2203	4300	6503	SO:0001583	missense	9205			AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.157G>T	13.37:g.20426164C>A	ENSP00000337034:p.Asp53Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	ENST00000337963.4	37		.	.	.	.	.	.	.	.	.	.	C	14.34	2.505134	0.44558	.	.	ENSG00000132950	ENST00000337963;ENST00000502168;ENST00000382907;ENST00000382905	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	4.25	3.4	0.38934	.	.	.	.	.	T	0.51669	0.1688	M	0.69823	2.125	0.28218	N	0.926667	D;D;D	0.76494	0.992;0.999;0.997	P;D;D	0.66351	0.751;0.943;0.912	T	0.46219	-0.9207	9	0.72032	D	0.01	.	12.2366	0.54518	0.0:0.9166:0.0:0.0834	.	53;53;53	Q9UJ78;Q9UJ78-2;Q9UJ78-1	ZMYM5_HUMAN;.;.	Y	53;43;53;53	ENSP00000337034:D53Y;ENSP00000445779:D43Y;ENSP00000372364:D53Y;ENSP00000372361:D53Y	ENSP00000337034:D53Y	D	-	1	0	ZMYM5	19324164	1.000000	0.71417	0.377000	0.26055	0.722000	0.41435	3.591000	0.53986	1.154000	0.42482	0.561000	0.74099	GAT		0.403	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_014242	
ZNF184	7738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	27420477	27420477	+	Silent	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr6:27420477G>A	ENST00000211936.6	-	6	1145	c.861C>T	c.(859-861)ttC>ttT	p.F287F	ZNF184_ENST00000377419.1_Silent_p.F287F	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.F287F(2)		breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GACCCTCAATGAAGCCTTTTC	0.378																																																	2	Substitution - coding silent(2)	cervix(1)|kidney(1)											77.0	80.0	79.0					6																	27420477		2203	4300	6503	SO:0001819	synonymous_variant	7738			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.861C>T	6.37:g.27420477G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R715|O60792|Q8TBA9	Silent	SNP	ENST00000211936.6	37	CCDS4624.1																																																																																				0.378	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1		NM_007149	
NADK2	133686	broad.mit.edu	37	5	36241678	36241680	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	CCA	CCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr5:36241678_36241680delCCA	ENST00000381937.4	-	1	220_222	c.221_223delTGG	c.(220-225)gtggcc>gcc	p.V74del	NADK2_ENST00000514504.1_In_Frame_Del_p.V74del|NADK2_ENST00000282512.3_Intron|NADK2_ENST00000506945.1_Intron|NADK2_ENST00000397338.1_5'Flank	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	74					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										GTGGTTTTGGCCACCACCACCAC	0.744																																																	0									,	10,3310		1,8,1651					,	3.3	1.0			9	37,7299		0,37,3631	no	intron,coding	NADKD1	NM_153013.3,NM_001085411.1	,	1,45,5282	A1A1,A1R,RR		0.5044,0.3012,0.4411	,	,		47,10609				SO:0001651	inframe_deletion	0			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.221_223delTGG	5.37:g.36241687_36241689delCCA	ENSP00000371362:p.Val74del	Somatic		WXS	Illumina GAIIx	Phase_I	B5MC93|Q6UTX5|Q96NM0	In_Frame_Del	DEL	ENST00000381937.4	37	CCDS47197.1																																																																																				0.744	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1		NM_153013	
TMEM246	84302	broad.mit.edu	37	9	104239059	104239059	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr9:104239059T>C	ENST00000374851.1	-	4	1463	c.316A>G	c.(316-318)Atc>Gtc	p.I106V	RP11-490D19.6_ENST00000425734.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.I106V|RP11-490D19.6_ENST00000424154.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.I106V			Q9BRR3	TM246_HUMAN	transmembrane protein 246	106						integral component of membrane (GO:0016021)		p.I106V(1)									ACAGTGATGATGGTGATCACC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											49.0	45.0	46.0					9																	104239059		2203	4300	6503	SO:0001583	missense	0			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.316A>G	9.37:g.104239059T>C	ENSP00000363984:p.Ile106Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q49AQ4	Missense_Mutation	SNP	ENST00000374851.1	37	CCDS6757.1	.	.	.	.	.	.	.	.	.	.	t	5.172	0.217234	0.09810	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.63	4.48	0.54585	.	0.480634	0.22900	N	0.054274	T	0.29061	0.0722	N	0.05306	-0.075	0.40996	D	0.984894	B	0.22541	0.071	B	0.18561	0.022	T	0.13926	-1.0491	9	0.22706	T	0.39	-27.6801	11.0577	0.47929	0.0:0.074:0.0:0.926	.	106	Q9BRR3	CI125_HUMAN	V	106	.	ENSP00000363980:I106V	I	-	1	0	C9orf125	103278880	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.785000	0.55424	2.130000	0.65690	0.524000	0.50904	ATC		0.622	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1		NM_032342	
CD209	30835	broad.mit.edu	37	19	7810629	7810629	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr19:7810629G>A	ENST00000315599.7	-	4	545	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	CD209_ENST00000354397.6_Missense_Mutation_p.R175W|CD209_ENST00000315591.8_Missense_Mutation_p.R151W|CD209_ENST00000593660.1_Missense_Mutation_p.R151W|CD209_ENST00000301357.8_Intron|CD209_ENST00000593821.1_Intron|CD209_ENST00000204801.8_Missense_Mutation_p.R131W|CD209_ENST00000394173.4_Intron|CD209_ENST00000394161.5_Intron|CD209_ENST00000601256.1_Missense_Mutation_p.R151W|CD209_ENST00000601951.1_Missense_Mutation_p.R151W|CD209_ENST00000602261.1_Intron	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	175	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)	p.R175W(2)		endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCCTTCAGCCGAGTCAGCTCC	0.557																																																	2	Substitution - Missense(2)	kidney(2)											118.0	116.0	117.0					19																	7810629		2196	4296	6492	SO:0001583	missense	30835			M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.523C>T	19.37:g.7810629G>A	ENSP00000315477:p.Arg175Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	CCDS12186.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.763042	0.31228	.	.	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000540789	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	0.461	-0.711	0.11230	.	.	.	.	.	T	0.35799	0.0944	L	0.43152	1.355	0.09310	N	1	D;D;B;D;D;D;B;D	0.89917	0.998;1.0;0.032;0.998;0.994;0.99;0.032;0.999	P;D;B;P;P;P;B;P	0.79108	0.718;0.992;0.003;0.742;0.689;0.663;0.003;0.804	T	0.18524	-1.0334	8	0.62326	D	0.03	.	.	.	.	.	175;151;131;151;175;151;151;175	Q9NNX6-2;Q9NNX6-12;Q9NNX6-7;Q9NNX6-6;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;CD209_HUMAN;.;.;.	W	175;175;151;131;159	ENSP00000315477:R175W;ENSP00000346373:R175W;ENSP00000315407:R151W;ENSP00000204801:R131W	ENSP00000204801:R131W	R	-	1	2	CD209	7716629	0.017000	0.18338	0.006000	0.13384	0.152000	0.21847	1.766000	0.38491	-0.326000	0.08564	0.298000	0.19748	CGG		0.557	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1		NM_021155	
DFNB31	25861	broad.mit.edu	37	9	117165567	117165567	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr9:117165567G>T	ENST00000362057.3	-	11	2639	c.2471C>A	c.(2470-2472)gCc>gAc	p.A824D	DFNB31_ENST00000265134.6_Missense_Mutation_p.A441D|DFNB31_ENST00000374059.3_Missense_Mutation_p.A473D	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	824	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.A824D(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCCCAGGGTGGCCGCACTTTT	0.617																																																	1	Substitution - Missense(1)	kidney(1)											54.0	58.0	57.0					9																	117165567		2203	4300	6503	SO:0001583	missense	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2471C>A	9.37:g.117165567G>T	ENSP00000354623:p.Ala824Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452898	0.63290	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.27104	1.69;1.69;1.69	4.96	4.96	0.65561	PDZ/DHR/GLGF (4);	0.225081	0.37623	N	0.002018	T	0.29126	0.0724	N	0.12887	0.27	0.33013	D	0.527853	P;P;P	0.50443	0.918;0.863;0.935	P;B;P	0.54965	0.524;0.438;0.765	T	0.42050	-0.9474	10	0.62326	D	0.03	-31.7792	18.2113	0.89871	0.0:0.0:1.0:0.0	.	823;824;473	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	D	441;473;824	ENSP00000265134:A441D;ENSP00000363172:A473D;ENSP00000354623:A824D	ENSP00000265134:A441D	A	-	2	0	DFNB31	116205388	1.000000	0.71417	0.998000	0.56505	0.742000	0.42306	4.122000	0.57910	2.287000	0.76781	0.655000	0.94253	GCC		0.617	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2		NM_015404	
FOXS1	2307	broad.mit.edu	37	20	30432839	30432839	+	Silent	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr20:30432839C>T	ENST00000375978.3	-	1	581	c.507G>A	c.(505-507)ctG>ctA	p.L169L		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	169					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L169L(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						TGGCCCCCACCAGACCCCCAA	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											29.0	27.0	28.0					20																	30432839		2203	4300	6503	SO:0001819	synonymous_variant	2307			AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.507G>A	20.37:g.30432839C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q96D28	Silent	SNP	ENST00000375978.3	37	CCDS13192.1																																																																																				0.647	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2		NM_004118	
ISL2	64843	broad.mit.edu	37	15	76634124	76634124	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr15:76634124C>T	ENST00000290759.4	+	6	1188	c.1028C>T	c.(1027-1029)tCg>tTg	p.S343L	RP11-685G9.4_ENST00000602530.1_lincRNA|RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	343					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S343L(1)		breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						TCCCTGTCCTCGCAGCTCCCG	0.682																																					GBM(97;953 1391 16164 31496 36951)												1	Substitution - Missense(1)	kidney(1)											62.0	63.0	63.0					15																	76634124		2197	4294	6491	SO:0001583	missense	64843			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.1028C>T	15.37:g.76634124C>T	ENSP00000290759:p.Ser343Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B3KM37	Missense_Mutation	SNP	ENST00000290759.4	37	CCDS10290.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234479	0.95207	.	.	ENSG00000159556	ENST00000290759	D	0.85171	-1.95	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.88672	0.6500	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	P	0.56788	0.806	D	0.88794	0.3280	10	0.49607	T	0.09	.	12.5772	0.56369	0.0:0.9164:0.0:0.0836	.	343	Q96A47	ISL2_HUMAN	L	343	ENSP00000290759:S343L	ENSP00000290759:S343L	S	+	2	0	ISL2	74421179	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.939000	0.70179	2.255000	0.74692	0.462000	0.41574	TCG		0.682	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289779.1			
LOC494141	494141	broad.mit.edu	37	11	18231982	18231982	+	3'UTR	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr11:18231982G>A	ENST00000527059.1	+	0	1228				RP11-113D6.10_ENST00000340135.3_3'UTR|RP11-113D6.10_ENST00000534640.1_3'UTR																							CTTTCCCCAAGGTTTTCCAAA	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	494141																														ENST00000527059.1:c.*303G>A	11.37:g.18231982G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000527059.1	37																																																																																					0.408	RP11-113D6.10-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389801.2			
LOC644669	644669	broad.mit.edu	37	18	15325675	15325675	+	RNA	SNP	C	C	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr18:15325675C>A	ENST00000455308.2	-	0	367					NR_027417.1																						ATATTTGGATCAGCACCAGAA	0.398																																																	0																																												644669																															18.37:g.15325675C>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000455308.2	37																																																																																					0.398	AP005901.1-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373635.1			
Unknown	0	broad.mit.edu	37	1	16974549	16974549	+	IGR	SNP	C	C	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:16974549C>G								CROCCP2 (13495 upstream) : RNU1-3 (18730 downstream)																							GGGCTGAGTGCAGCGCCTGCT	0.692																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974549C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.692									
MST1L	11223	broad.mit.edu	37	1	17085848	17085848	+	RNA	SNP	G	G	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr1:17085848G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.P315S(1)|p.P325S(1)									AAGCACCAGGGCGCCTCTGAG	0.667																																																	2	Substitution - Missense(2)	kidney(2)																																										0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085848G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	14.92	2.680882	0.47886	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.41823	D	0.000801	T	0.64832	0.2634	.	.	.	.	.	.	D	0.89917	1.0	D	0.76575	0.988	T	0.68727	-0.5332	6	0.87932	D	0	.	5.8178	0.18506	0.001:0.0:0.999:0.0	.	325	Q2TV78-2	.	S	315;325;325	.	ENSP00000439273:P325S	P	-	1	0	MST1P9	16958435	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	6.473000	0.73572	-0.000000	0.14550	0.000000	0.15137	CCC		0.667	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1		NM_001271733	
BACE2	25825	broad.mit.edu	37	21	42551676	42551677	+	Intron	INS	-	-	A			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr21:42551676_42551677insA	ENST00000330333.6	+	1	775				PLAC4_ENST00000430327.2_RNA|BACE2-IT1_ENST00000433378.1_RNA|BACE2_ENST00000347667.5_Intron|PLAC4_ENST00000536486.1_RNA|BACE2_ENST00000328735.6_Intron|PLAC4_ENST00000414699.1_RNA|PLAC4_ENST00000440221.2_RNA	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CTGAGGGTGCCTGGTGTGGGGT	0.45																																																	0																																										SO:0001627	intron_variant	191585			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+11174->A	21.37:g.42551676_42551677insA		Somatic		WXS	Illumina GAIIx	Phase_I	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Translation_Start_Site	INS	ENST00000330333.6	37	CCDS13668.1																																																																																				0.450	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1			
PREX1	57580	broad.mit.edu	37	20	47246011	47246011	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr20:47246011A>G	ENST00000371941.3	-	37	4764	c.4742T>C	c.(4741-4743)gTc>gCc	p.V1581A	PREX1_ENST00000396220.1_3'UTR	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1581					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V1581A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCCACACATGACCATCTGGCA	0.652																																																	1	Substitution - Missense(1)	kidney(1)											67.0	72.0	71.0					20																	47246011		2203	4300	6503	SO:0001583	missense	57580			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4742T>C	20.37:g.47246011A>G	ENSP00000361009:p.Val1581Ala	Somatic		WXS	Illumina GAIIx	Phase_I	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	A	8.405	0.842756	0.16963	.	.	ENSG00000124126	ENST00000371941	T	0.61859	0.07	4.25	2.26	0.28386	.	0.648109	0.13857	N	0.357990	T	0.44117	0.1278	L	0.39898	1.24	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.002	T	0.16719	-1.0393	10	0.30078	T	0.28	.	7.0475	0.25055	0.3769:0.0:0.6231:0.0	.	1581;878	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	A	1581	ENSP00000361009:V1581A	ENSP00000361009:V1581A	V	-	2	0	PREX1	46679418	0.997000	0.39634	0.959000	0.39883	0.927000	0.56198	2.531000	0.45650	0.254000	0.21573	-0.464000	0.05259	GTC		0.652	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1		NM_020820	
TBC1D3P5	440419	broad.mit.edu	37	17	25758643	25758644	+	RNA	DEL	GA	GA	-			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:25758643_25758644delGA	ENST00000586223.1	+	0	3077_3078					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GTTTACTGTTGAAATGATTTTA	0.416											OREG0024258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25758643_25758644delGA		Somatic	781	WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000586223.1	37																																																																																					0.416	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	pseudogene	OTTHUMT00000451073.1		NR_033892	
ERN1	2081	broad.mit.edu	37	17	62117156	62117157	+	3'UTR	DEL	AC	AC	-			TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr17:62117156_62117157delAC	ENST00000433197.3	-	0	7220_7221					NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						TATCCACCAAACACACACACAG	0.51																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.*4192GT>-	17.37:g.62117164_62117165delAC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000433197.3	37	CCDS45762.1																																																																																				0.510	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443734.2		NM_001433	
SMPD4P1	645280	broad.mit.edu	37	22	20976999	20976999	+	RNA	SNP	C	C	G	rs372495514		TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr22:20976999C>G	ENST00000443839.1	-	0	1535									sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) pseudogene 1																		AACCTACCTTCCCAGGGTCGA	0.498																																																	0																																												0					22q11.21	2011-03-22			ENSG00000223553	ENSG00000223553			39673	pseudogene	pseudogene							Standard	NG_028286		Approved				OTTHUMG00000030245		22.37:g.20976999C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000443839.1	37																																																																																					0.498	SMPD4P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319965.1			
LINC01410	103352539	broad.mit.edu	37	9	66466327	66466327	+	lincRNA	DEL	G	G	-	rs58593495	byFrequency	TCGA-B0-5697-01A-11D-1534-10	TCGA-B0-5697-11A-01D-1534-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66	2641ff9a-cb27-4feb-b9ec-c191e56673bb	g.chr9:66466327delG	ENST00000424345.1	+	0	960																											agcaggtccaggaatgcactt	0.483													|||unknown(NO_COVERAGE)	2677	0.534545	0.5023	0.5447	5008	,	,		41720	0.5357		0.5447	False		,,,				2504	0.5593																0																																												0																															9.37:g.66466327delG		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000424345.1	37																																																																																					0.483	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000128851.1			
