#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AHNAK2	113146	hgsc.bcm.edu	37	14	105418155	105418155	+	Silent	SNP	G	G	C	rs141600524		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:105418155G>C	ENST00000333244.5	-	7	3752	c.3633C>G	c.(3631-3633)ctC>ctG	p.L1211L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1211						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGAATGCTGAGGTCAGTGG	0.647																																																	0								G		80,3750		19,42,1854	104.0	78.0	86.0		3633	-6.0	0.0	14	dbSNP_134	86	913,6543		290,333,3105	no	coding-synonymous	AHNAK2	NM_138420.2		309,375,4959	CC,CG,GG		12.2452,2.0888,8.7985		1211/5796	105418155	993,10293	1915	3728	5643	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3633C>G	14.37:g.105418155G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1		NM_138420	
ANKHD1	54882	broad.mit.edu;ucsc.edu	37	5	139876772	139876772	+	Silent	SNP	T	T	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr5:139876772T>C	ENST00000360839.2	+	15	3067	c.2913T>C	c.(2911-2913)caT>caC	p.H971H	ANKHD1_ENST00000462121.1_3'UTR|ANKHD1_ENST00000297183.6_Silent_p.H971H|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.H971H	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	971						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.H971H(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTACTGGACATGATCAGGGGC	0.448																																																	2	Substitution - coding silent(2)	kidney(2)											113.0	112.0	113.0					5																	139876772		2203	4300	6503	SO:0001819	synonymous_variant	404734			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.2913T>C	5.37:g.139876772T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1																																																																																				0.448	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1		NM_017747	
ANO3	63982	broad.mit.edu;hgsc.bcm.edu	37	11	26465333	26465333	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:26465333A>G	ENST00000256737.3	+	3	1115	c.263A>G	c.(262-264)aAc>aGc	p.N88S	ANO3_ENST00000531646.1_Missense_Mutation_p.N88S|ANO3_ENST00000537978.1_Missense_Mutation_p.N72S|ANO3_ENST00000525139.1_Missense_Mutation_p.N72S	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	88					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.N88S(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						GAGAATAAAAACGACTCTGTG	0.343																																																	1	Substitution - Missense(1)	kidney(1)											114.0	112.0	113.0					11																	26465333		2203	4300	6503	SO:0001583	missense	63982			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.263A>G	11.37:g.26465333A>G	ENSP00000256737:p.Asn88Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	A	1.419	-0.573399	0.03882	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000531646	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	4.72	2.27	0.28462	.	0.498586	0.20078	N	0.099708	T	0.33962	0.0881	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.26503	-1.0101	10	0.02654	T	1	.	5.6341	0.17526	0.6517:0.1779:0.0:0.1704	.	88	Q9BYT9	ANO3_HUMAN	S	72;72;88;88	ENSP00000440737:N72S;ENSP00000432576:N72S;ENSP00000256737:N88S;ENSP00000435275:N88S	ENSP00000256737:N88S	N	+	2	0	ANO3	26421909	0.754000	0.28360	0.035000	0.18076	0.006000	0.05464	4.403000	0.59729	0.330000	0.23485	-0.438000	0.05819	AAC		0.343	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1		NM_031418	
ANP32E	81611	hgsc.bcm.edu	37	1	150199042	150199042	+	Missense_Mutation	SNP	C	C	A	rs56692627|rs28594165|rs68136184	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:150199042C>A	ENST00000314136.8	-	5	948	c.579G>T	c.(577-579)gaG>gaT	p.E193D	ANP32E_ENST00000436748.2_Missense_Mutation_p.E152D|ANP32E_ENST00000369119.3_Missense_Mutation_p.E145D|ANP32E_ENST00000369115.2_Missense_Mutation_p.E61D|ANP32E_ENST00000369116.4_Missense_Mutation_p.E61D|ANP32E_ENST00000533654.1_Missense_Mutation_p.R138M|ANP32E_ENST00000369114.5_Intron	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	193	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			cctcatcctcctcttcctctt	0.443																																																	0													236.0	194.0	208.0					1																	150199042		2203	4300	6503	SO:0001583	missense	81611			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.579G>T	1.37:g.150199042C>A	ENSP00000324074:p.Glu193Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	ENST00000314136.8	37	CCDS946.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.397|0.397	-0.920493|-0.920493	0.02396|0.02396	.|.	.|.	ENSG00000143401|ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000369116;ENST00000436748;ENST00000534437;ENST00000369115;ENST00000534220|ENST00000533654	T;T;T|T	0.00351|0.00342	7.97;7.97;7.97|8.03	3.62|3.62	-7.24|-7.24	0.01475|0.01475	.|.	.|.	.|.	.|.	.|.	T|T	0.00039|0.00039	0.0001|0.0001	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B|B	0.02656|0.02656	0.0;0.0;0.0|0.0	B;B;B|B	0.04013|0.01281	0.001;0.0;0.0|0.0	T|T	0.45877|0.45877	-0.9231|-0.9231	9|9	0.11485|0.62326	T|D	0.65|0.03	.|.	0.0398|0.0398	0.00008|0.00008	0.2803:0.2244:0.1888:0.3065|0.2803:0.2244:0.1888:0.3065	rs28594165|rs28594165	152;193;145|138	E9PEA6;Q9BTT0;Q5TB20|E9PLC4	.;AN32E_HUMAN;.|.	D|M	193;145;61;152;7;61;71|138	ENSP00000324074:E193D;ENSP00000358115:E145D;ENSP00000393718:E152D|ENSP00000435215:R138M	ENSP00000324074:E193D|ENSP00000435215:R138M	E|R	-|-	3|2	2|0	ANP32E|ANP32E	148465666|148465666	0.087000|0.087000	0.21565|0.21565	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-2.245000|-2.245000	0.01192|0.01192	-3.665000|-3.665000	0.00124|0.00124	-2.619000|-2.619000	0.00157|0.00157	GAG|AGG		0.443	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1		NM_030920	
ANP32E	81611	hgsc.bcm.edu	37	1	150199045	150199045	+	Silent	SNP	T	T	C	rs56692627|rs68136184|rs28460085	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:150199045T>C	ENST00000314136.8	-	5	945	c.576A>G	c.(574-576)gaA>gaG	p.E192E	ANP32E_ENST00000436748.2_Silent_p.E151E|ANP32E_ENST00000369119.3_Silent_p.E144E|ANP32E_ENST00000369115.2_Silent_p.E60E|ANP32E_ENST00000369116.4_Silent_p.E60E|ANP32E_ENST00000533654.1_Missense_Mutation_p.K137R|ANP32E_ENST00000369114.5_Intron	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	192	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			catcctcctcttcctcttcct	0.438																																																	0													225.0	183.0	197.0					1																	150199045		2203	4300	6503	SO:0001819	synonymous_variant	81611			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.576A>G	1.37:g.150199045T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Silent	SNP	ENST00000314136.8	37	CCDS946.1	.	.	.	.	.	.	.	.	.	.	T	4.124	0.021213	0.08006	.	.	ENSG00000143401	ENST00000533654	T	0.00337	8.05	4.98	-1.51	0.08664	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.24003	N	0.996202	B	0.02656	0.0	B	0.04013	0.001	T	0.15925	-1.0420	8	0.56958	D	0.05	.	4.2912	0.10879	0.3012:0.342:0.0:0.3568	rs28460085	137	E9PLC4	.	R	137	ENSP00000435215:K137R	ENSP00000435215:K137R	K	-	2	0	ANP32E	148465669	0.097000	0.21791	0.054000	0.19295	0.014000	0.08584	-2.180000	0.01258	-0.128000	0.11641	-0.366000	0.07423	AAG		0.438	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1		NM_030920	
ASZ1	136991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	117025841	117025841	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr7:117025841A>G	ENST00000284629.2	-	5	525	c.463T>C	c.(463-465)Tat>Cat	p.Y155H		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1									p.Y155H(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CGAGCAGCATACATGATTGGG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											102.0	99.0	100.0					7																	117025841		2203	4300	6503	SO:0001583	missense	136991			AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.463T>C	7.37:g.117025841A>G	ENSP00000284629:p.Tyr155His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000284629.2	37	CCDS5772.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.393950	0.83011	.	.	ENSG00000154438	ENST00000284629	T	0.65364	-0.15	5.91	5.91	0.95273	Ankyrin repeat-containing domain (4);	0.226724	0.41823	D	0.000802	T	0.71517	0.3349	L	0.37750	1.13	0.47994	D	0.999569	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72554	-0.4258	10	0.51188	T	0.08	-2.0813	15.3295	0.74196	1.0:0.0:0.0:0.0	.	155;155	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	H	155	ENSP00000284629:Y155H	ENSP00000284629:Y155H	Y	-	1	0	ASZ1	116813077	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.715000	0.74697	2.263000	0.75096	0.528000	0.53228	TAT		0.413	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7		NM_130768	
ATCAY	85300	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	3905489	3905489	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:3905489C>T	ENST00000450849.2	+	4	661	c.194C>T	c.(193-195)gCc>gTc	p.A65V	ATCAY_ENST00000398448.3_Missense_Mutation_p.A71V|ATCAY_ENST00000301260.6_Missense_Mutation_p.A65V|ATCAY_ENST00000600960.1_Missense_Mutation_p.A65V	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	65					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)	p.A65V(2)		breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		ACGCTGGTGGCCCCAGAGATC	0.488																																																	2	Substitution - Missense(2)	kidney(2)											66.0	67.0	66.0					19																	3905489		1958	4142	6100	SO:0001583	missense	85300				CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.194C>T	19.37:g.3905489C>T	ENSP00000390941:p.Ala65Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109962	0.77210	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.61392	0.21;0.21;0.11	4.8	4.8	0.61643	.	0.108387	0.64402	D	0.000007	T	0.77658	0.4163	M	0.86097	2.795	0.50813	D	0.999896	D;D	0.67145	0.996;0.986	D;D	0.70016	0.967;0.936	T	0.79614	-0.1730	10	0.40728	T	0.16	.	16.8586	0.86012	0.0:1.0:0.0:0.0	.	71;65	B4DS11;Q86WG3	.;ATCAY_HUMAN	V	65;65;65;71;43	ENSP00000390941:A65V;ENSP00000301260:A65V;ENSP00000381466:A71V	ENSP00000301260:A65V	A	+	2	0	ATCAY	3856489	1.000000	0.71417	0.980000	0.43619	0.323000	0.28346	7.243000	0.78219	2.210000	0.71456	0.549000	0.68633	GCC		0.488	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2			
ATN1	1822	hgsc.bcm.edu	37	12	7045894	7045894	+	Silent	SNP	G	G	A	rs377147612|rs60216939		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr12:7045894G>A	ENST00000356654.4	+	5	1701	c.1464G>A	c.(1462-1464)caG>caA	p.Q488Q	ATN1_ENST00000396684.2_Silent_p.Q488Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	488	Poly-Gln.		Missing. {ECO:0000269|PubMed:7485154, ECO:0000269|PubMed:7842016, ECO:0000269|PubMed:8965642}.		cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.Q488delQ(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						aacagcaacagcagcagcagc	0.642																																																	1	Deletion - In frame(1)	breast(1)											61.0	73.0	69.0					12																	7045894		2202	4299	6501	SO:0001819	synonymous_variant	1822			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1464G>A	12.37:g.7045894G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																				0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2		NM_001940	
C12orf60	144608	broad.mit.edu;ucsc.edu	37	12	14976216	14976216	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr12:14976216A>G	ENST00000330828.2	+	2	551	c.347A>G	c.(346-348)aAa>aGa	p.K116R	C12orf60_ENST00000527783.1_Intron	NM_175874.3	NP_787070.2	Q5U649	CL060_HUMAN	chromosome 12 open reading frame 60	116								p.K116R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	9						GAAGTATTCAAAAGTGCCCAT	0.438																																																	1	Substitution - Missense(1)	kidney(1)											154.0	152.0	153.0					12																	14976216		2203	4300	6503	SO:0001583	missense	144608			BC038836	CCDS8667.1	12p12.3	2012-08-16			ENSG00000182993	ENSG00000182993			28726	protein-coding gene	gene with protein product						12477932	Standard	NM_175874		Approved	MGC47869	uc001rcj.4	Q5U649	OTTHUMG00000167473	ENST00000330828.2:c.347A>G	12.37:g.14976216A>G	ENSP00000331691:p.Lys116Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1M7|Q5XKK8|Q8IXY2	Missense_Mutation	SNP	ENST00000330828.2	37	CCDS8667.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.467134	0.43839	.	.	ENSG00000182993	ENST00000330828	T	0.16457	2.34	4.62	0.575	0.17374	.	0.289567	0.25068	N	0.033392	T	0.07593	0.0191	N	0.24115	0.695	0.09310	N	1	B	0.16802	0.019	B	0.16289	0.015	T	0.38693	-0.9649	10	0.08179	T	0.78	-0.2006	4.2945	0.10895	0.6401:0.1713:0.1886:0.0	.	116	Q5U649	CL060_HUMAN	R	116	ENSP00000331691:K116R	ENSP00000331691:K116R	K	+	2	0	C12orf60	14867483	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.485000	0.06520	0.010000	0.14839	0.459000	0.35465	AAA		0.438	C12orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394735.1		NM_175874	
NYAP1	222950	broad.mit.edu;hgsc.bcm.edu	37	7	100088627	100088627	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr7:100088627G>A	ENST00000300179.2	+	6	2336	c.2177G>A	c.(2176-2178)cGc>cAc	p.R726H	NYAP1_ENST00000496985.1_3'UTR|NYAP1_ENST00000454988.1_Missense_Mutation_p.R670H|NYAP1_ENST00000423930.1_Missense_Mutation_p.R727H	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	726					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.R726H(1)									GGAGGCTACCGCCTGGGGCGC	0.677																																																	1	Substitution - Missense(1)	kidney(1)											19.0	17.0	18.0					7																	100088627		2152	4230	6382	SO:0001583	missense	0			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.2177G>A	7.37:g.100088627G>A	ENSP00000300179:p.Arg726His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	ENST00000300179.2	37	CCDS5696.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082683	0.76528	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.38401	1.14;1.14;1.14	5.08	5.08	0.68730	.	0.000000	0.48286	D	0.000196	T	0.47229	0.1434	L	0.32530	0.975	0.44685	D	0.99767	D;D	0.76494	0.999;0.999	P;P	0.62435	0.818;0.902	T	0.46638	-0.9177	10	0.66056	D	0.02	-21.8013	16.3146	0.82913	0.0:0.0:1.0:0.0	.	670;726	C9JS30;Q6ZVC0	.;CG051_HUMAN	H	726;727;670	ENSP00000300179:R726H;ENSP00000411861:R727H;ENSP00000394424:R670H	ENSP00000300179:R726H	R	+	2	0	C7orf51	99926563	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	3.683000	0.54663	2.530000	0.85305	0.313000	0.20887	CGC		0.677	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2		NM_173564	
CDK3	1018	broad.mit.edu;ucsc.edu	37	17	73999460	73999460	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr17:73999460A>G	ENST00000425876.2	+	6	861	c.773A>G	c.(772-774)gAg>gGg	p.E258G	CDK3_ENST00000448471.1_Missense_Mutation_p.E258G|TEN1-CDK3_ENST00000567351.1_RNA			Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	258	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.E258G(1)		central_nervous_system(1)	1						CTGGAGCCAGAGGGCAGGGAC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											49.0	52.0	51.0					17																	73999460		2203	4300	6503	SO:0001583	missense	1018			X66357	CCDS11736.1	17q25.1	2012-09-20			ENSG00000250506	ENSG00000250506		"""Cyclin-dependent kinases"""	1772	protein-coding gene	gene with protein product		123828				1639063	Standard	NM_001258		Approved		uc010dgt.3	Q00526	OTTHUMG00000154861	ENST00000425876.2:c.773A>G	17.37:g.73999460A>G	ENSP00000410561:p.Glu258Gly	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000425876.2	37	CCDS11736.1	.	.	.	.	.	.	.	.	.	.	A	15.07	2.723009	0.48728	.	.	ENSG00000250506	ENST00000448471;ENST00000425876	T;T	0.69040	-0.37;-0.37	4.62	4.62	0.57501	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.371677	0.22808	N	0.055395	T	0.58637	0.2136	L	0.43554	1.36	0.47183	D	0.999344	B	0.10296	0.003	B	0.12837	0.008	T	0.54814	-0.8237	10	0.29301	T	0.29	-25.5515	14.1992	0.65690	1.0:0.0:0.0:0.0	.	258	Q00526	CDK3_HUMAN	G	258	ENSP00000400088:E258G;ENSP00000410561:E258G	ENSP00000410561:E258G	E	+	2	0	CDK3	71511055	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	5.860000	0.69546	1.942000	0.56320	0.418000	0.28097	GAG		0.582	CDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337389.2		NM_001258	
CELSR1	9620	broad.mit.edu;ucsc.edu	37	22	46807533	46807533	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr22:46807533A>G	ENST00000262738.3	-	6	4734	c.4735T>C	c.(4735-4737)Tgc>Cgc	p.C1579R		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1579	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.C1579R(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGGGCAGCGCAGCTGTAGTTC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											86.0	73.0	77.0					22																	46807533		2203	4300	6503	SO:0001583	missense	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4735T>C	22.37:g.46807533A>G	ENSP00000262738:p.Cys1579Arg	Somatic		WXS	Illumina GAIIx	Phase_I	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.983732	0.74474	.	.	ENSG00000075275	ENST00000262738	T	0.73152	-0.72	4.43	4.43	0.53597	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	U	0.000000	D	0.87346	0.6154	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90606	0.4548	10	0.87932	D	0	.	13.6763	0.62456	1.0:0.0:0.0:0.0	.	1579	Q9NYQ6	CELR1_HUMAN	R	1579	ENSP00000262738:C1579R	ENSP00000262738:C1579R	C	-	1	0	CELSR1	45186197	1.000000	0.71417	0.993000	0.49108	0.931000	0.56810	8.628000	0.90979	1.769000	0.52152	0.533000	0.62120	TGC		0.627	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1		NM_014246	
CIC	23152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	42793535	42793535	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:42793535A>T	ENST00000575354.2	+	8	1377	c.1337A>T	c.(1336-1338)gAg>gTg	p.E446V	CIC_ENST00000572681.2_Missense_Mutation_p.E1355V|CIC_ENST00000160740.3_Missense_Mutation_p.E446V	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	446					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E446V(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				ATCTGTGAGGAGGAAGGGGAT	0.612			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	kidney(1)											71.0	54.0	60.0					19																	42793535		2201	4291	6492	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.1337A>T	19.37:g.42793535A>T	ENSP00000458663:p.Glu446Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.019180	0.54576	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.61	3.59	0.41128	.	.	.	.	.	T	0.51618	0.1685	N	0.24115	0.695	0.50039	D	0.999847	D	0.69078	0.997	P	0.60789	0.879	T	0.53436	-0.8439	8	0.87932	D	0	-18.6633	8.2845	0.31920	0.9047:0.0:0.0953:0.0	.	446	Q96RK0	CIC_HUMAN	V	446	.	ENSP00000160740:E446V	E	+	2	0	CIC	47485375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.231000	0.78106	0.911000	0.36747	0.459000	0.35465	GAG		0.612	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			
COL11A1	1301	broad.mit.edu;ucsc.edu	37	1	103444415	103444415	+	Splice_Site	SNP	C	C	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:103444415C>A	ENST00000370096.3	-	34	3022		c.e34+1		COL11A1_ENST00000512756.1_Splice_Site|COL11A1_ENST00000353414.4_Splice_Site|COL11A1_ENST00000358392.2_Splice_Site	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.?(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACAGGTGATACCTTTGGCCCA	0.413																																																	2	Unknown(2)	kidney(2)											83.0	89.0	87.0					1																	103444415		2203	4300	6503	SO:0001630	splice_region_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2709+1G>T	1.37:g.103444415C>A		Somatic		WXS	Illumina GAIIx	Phase_I	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Splice_Site	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542032	0.85917	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0619	0.93096	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A1	103217003	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.343000	0.79319	2.506000	0.84524	0.655000	0.94253	.		0.413	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1		NM_080630	Intron
CRIPAK	285464	hgsc.bcm.edu	37	4	1388622	1388623	+	Frame_Shift_Ins	INS	-	-	CA	rs79704405|rs540461234|rs558358960	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr4:1388622_1388623insCA	ENST00000324803.4	+	1	3283_3284	c.323_324insCA	c.(322-327)ctcacgfs	p.LT108fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	108					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L108H(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCACGTGCCCAT	0.668														506	0.101038	0.0567	0.1427	5008	,	,		19207	0.0169		0.1759	False		,,,				2504	0.1411																1	Substitution - Missense(1)	pancreas(1)																																								SO:0001589	frameshift_variant	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.324_325dupCA	4.37:g.1388623_1388624dupCA	ENSP00000323978:p.Leu108fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB03	Frame_Shift_Ins	INS	ENST00000324803.4	37	CCDS3349.1																																																																																				0.668	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2		NM_175918	
CTDP1	9150	hgsc.bcm.edu;ucsc.edu	37	18	77488985	77488985	+	Silent	SNP	T	T	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr18:77488985T>A	ENST00000299543.7	+	11	2643	c.2496T>A	c.(2494-2496)tcT>tcA	p.S832S	CTDP1_ENST00000075430.7_Intron	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	832					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CTGGCCCTTCTAGAAGAAAGC	0.542																																																	0													190.0	201.0	197.0					18																	77488985		2203	4300	6503	SO:0001819	synonymous_variant	9150			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.2496T>A	18.37:g.77488985T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Silent	SNP	ENST00000299543.7	37	CCDS12017.1																																																																																				0.542	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1		NM_004715	
DGKB	1607	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	14378224	14378224	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr7:14378224G>A	ENST00000403951.2	-	23	2460	c.2041C>T	c.(2041-2043)Cga>Tga	p.R681*	DGKB_ENST00000399322.3_Nonsense_Mutation_p.R681*|DGKB_ENST00000444700.2_Nonsense_Mutation_p.R662*|DGKB_ENST00000402815.1_Nonsense_Mutation_p.R680*|DGKB_ENST00000406247.3_Nonsense_Mutation_p.R681*|DGKB_ENST00000258767.5_Nonsense_Mutation_p.R681*|DGKB_ENST00000407950.1_Nonsense_Mutation_p.R673*|DGKB_ENST00000403963.1_5'UTR			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	681					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.R681*(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CGATGGCTTCGTCTTTTCTTA	0.398																																																	2	Substitution - Nonsense(2)	large_intestine(1)|kidney(1)											173.0	157.0	162.0					7																	14378224		1861	4099	5960	SO:0001587	stop_gained	1607			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2041C>T	7.37:g.14378224G>A	ENSP00000385780:p.Arg681*	Somatic		WXS	Illumina HiSeq	Phase_I	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Nonsense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	G	40	8.316506	0.98757	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	.	.	.	5.5	-0.408	0.12381	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4311	0.87539	0.0:0.0:0.2508:0.7492	.	.	.	.	X	681;681;681;680;673;662;681	.	ENSP00000258767:R681X	R	-	1	2	DGKB	14344749	1.000000	0.71417	0.988000	0.46212	0.987000	0.75469	0.877000	0.28106	-0.425000	0.07371	0.650000	0.86243	CGA		0.398	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2		NM_004080	
DZIP1L	199221	broad.mit.edu;ucsc.edu	37	3	137813771	137813771	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:137813771G>T	ENST00000327532.2	-	4	1003	c.641C>A	c.(640-642)gCc>gAc	p.A214D	DZIP1L_ENST00000488595.1_5'Flank|DZIP1L_ENST00000469243.1_Missense_Mutation_p.A214D	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	214					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)	p.A214D(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						CTTTAGCTTGGCCCGTAGCTC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											205.0	185.0	192.0					3																	137813771		2203	4300	6503	SO:0001583	missense	199221			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.641C>A	3.37:g.137813771G>T	ENSP00000332148:p.Ala214Asp	Somatic		WXS	Illumina GAIIx	Phase_I	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098358	0.37048	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.62232	0.04;0.04	4.85	3.95	0.45737	.	0.328393	0.24289	N	0.039840	T	0.66645	0.2810	M	0.67953	2.075	0.29321	N	0.86734	P;D	0.55800	0.926;0.973	P;P	0.49085	0.6;0.593	T	0.66901	-0.5806	10	0.56958	D	0.05	-10.4563	13.1213	0.59327	0.0:0.0:0.8387:0.1613	.	214;214	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	D	214	ENSP00000332148:A214D;ENSP00000419486:A214D	ENSP00000332148:A214D	A	-	2	0	DZIP1L	139296461	0.995000	0.38212	0.979000	0.43373	0.357000	0.29423	1.838000	0.39211	1.198000	0.43158	0.563000	0.77884	GCC		0.552	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1		NM_173543	
ERP27	121506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	15091412	15091412	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr12:15091412G>T	ENST00000266397.2	-	1	604	c.31C>A	c.(31-33)Ctc>Atc	p.L11I		NM_152321.2	NP_689534.1	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27	11						endoplasmic reticulum (GO:0005783)		p.L11I(1)		breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(3)|prostate(2)|skin(1)	19						AGAAATAAGAGGAACATGAAC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											70.0	64.0	66.0					12																	15091412		2203	4300	6503	SO:0001583	missense	121506			AK056677	CCDS8670.1, CCDS73450.1	12p12.3	2011-10-19	2009-02-23	2007-03-26	ENSG00000139055	ENSG00000139055		"""Protein disulfide isomerases"""	26495	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 8"""	610642	"""chromosome 12 open reading frame 46"", ""endoplasmic reticulum protein 27 kDa"""	C12orf46		12975309, 16940051	Standard	XM_005253303		Approved	FLJ32115, ERp27, PDIA8	uc001rco.3	Q96DN0	OTTHUMG00000168741	ENST00000266397.2:c.31C>A	12.37:g.15091412G>T	ENSP00000266397:p.Leu11Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000266397.2	37	CCDS8670.1	.	.	.	.	.	.	.	.	.	.	G	9.376	1.071706	0.20147	.	.	ENSG00000139055	ENST00000266397	T	0.32023	1.47	5.54	1.29	0.21616	.	0.375021	0.23955	N	0.042915	T	0.25232	0.0613	L	0.56769	1.78	0.20489	N	0.999895	B	0.17268	0.021	B	0.15870	0.014	T	0.17868	-1.0355	10	0.40728	T	0.16	-5.1536	6.0467	0.19764	0.0751:0.2413:0.5601:0.1235	.	11	Q96DN0	ERP27_HUMAN	I	11	ENSP00000266397:L11I	ENSP00000266397:L11I	L	-	1	0	ERP27	14982679	0.016000	0.18221	0.001000	0.08648	0.002000	0.02628	0.465000	0.22004	0.118000	0.18165	-0.797000	0.03246	CTC		0.517	ERP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400868.1		NM_152321	
ESR2	2100	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	64746834	64746834	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:64746834C>T	ENST00000341099.4	-	3	817	c.400G>A	c.(400-402)Gcc>Acc	p.A134T	ESR2_ENST00000553796.1_Missense_Mutation_p.A134T|ESR2_ENST00000358599.5_Missense_Mutation_p.A134T|ESR2_ENST00000353772.3_Missense_Mutation_p.A134T|ESR2_ENST00000542956.1_Missense_Mutation_p.A134T|ESR2_ENST00000267525.6_Missense_Mutation_p.A134T|ESR2_ENST00000557772.1_Missense_Mutation_p.A134T|ESR2_ENST00000554572.1_Missense_Mutation_p.A134T|ESR2_ENST00000555483.1_Intron|ESR2_ENST00000555278.1_Missense_Mutation_p.A134T|ESR2_ENST00000357782.2_Missense_Mutation_p.A134T	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	134	Modulating.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A134T(2)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	ACAGGGCTGGCGCAACGGTTC	0.493																																																	2	Substitution - Missense(2)	kidney(2)											208.0	185.0	192.0					14																	64746834		2203	4300	6503	SO:0001583	missense	2100			X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.400G>A	14.37:g.64746834C>T	ENSP00000343925:p.Ala134Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	37	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	C	1.115	-0.657061	0.03480	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.90385	-2.65;-2.59;-2.58;-2.58;-2.58;-2.66;-2.65;-2.66;-2.65;-2.49;-2.19	5.41	-3.25	0.05079	.	0.975519	0.08421	N	0.948408	T	0.75309	0.3832	N	0.02286	-0.61	0.21675	N	0.999592	B;B;B;B;B	0.22346	0.068;0.001;0.005;0.002;0.001	B;B;B;B;B	0.15870	0.014;0.001;0.003;0.001;0.002	T	0.58375	-0.7647	10	0.24483	T	0.36	.	13.2313	0.59945	0.0:0.3803:0.0:0.6197	.	134;134;134;134;134	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	T	134	ENSP00000452485:A134T;ENSP00000441792:A134T;ENSP00000450699:A134T;ENSP00000335551:A134T;ENSP00000351412:A134T;ENSP00000450488:A134T;ENSP00000452426:A134T;ENSP00000350427:A134T;ENSP00000451582:A134T;ENSP00000343925:A134T;ENSP00000267525:A134T	ENSP00000267525:A134T	A	-	1	0	ESR2	63816587	0.001000	0.12720	0.050000	0.19076	0.001000	0.01503	-0.536000	0.06135	-0.805000	0.04404	-2.049000	0.00408	GCC		0.493	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1			
FILIP1	27145	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	76022977	76022977	+	Silent	SNP	A	A	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr6:76022977A>T	ENST00000237172.7	-	5	2901	c.2571T>A	c.(2569-2571)ccT>ccA	p.P857P	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Silent_p.P758P|FILIP1_ENST00000393004.2_Silent_p.P857P	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	857								p.P857P(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TTGCTGCTGGAGGATACCTGT	0.463																																																	1	Substitution - coding silent(1)	kidney(1)											102.0	111.0	107.0					6																	76022977		2203	4300	6503	SO:0001819	synonymous_variant	27145			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2571T>A	6.37:g.76022977A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	37	CCDS4984.1																																																																																				0.463	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1		XM_029179	
FMN2	56776	hgsc.bcm.edu;ucsc.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	GGC	-	rs71929261|rs140531536	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	GGC	GGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:240255569_240255571delGGC	ENST00000319653.9	+	1	390_392	c.160_162delGGC	c.(160-162)ggcdel	p.G59del		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	59					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G197delG(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.665														3539	0.706669	0.7821	0.7507	5008	,	,		10143	0.4514		0.7893	False		,,,				2504	0.7515																1	Deletion - In frame(1)	prostate(1)																																								SO:0001651	inframe_deletion	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.160_162delGGC	1.37:g.240255578_240255580delGGC	ENSP00000318884:p.Gly59del	Somatic		WXS	Illumina HiSeq	Phase_I	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	In_Frame_Del	DEL	ENST00000319653.9	37	CCDS31069.2																																																																																				0.665	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2		XM_371352	
GPHN	10243	broad.mit.edu;hgsc.bcm.edu	37	14	67389564	67389564	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:67389564A>G	ENST00000315266.5	+	7	1759	c.638A>G	c.(637-639)gAg>gGg	p.E213G	GPHN_ENST00000459628.1_Missense_Mutation_p.E195G|GPHN_ENST00000543237.1_Missense_Mutation_p.E226G|GPHN_ENST00000478722.1_Missense_Mutation_p.E213G|GPHN_ENST00000305960.9_Missense_Mutation_p.E182G|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	213	Interaction with GABARAP. {ECO:0000250}.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.E213G(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		GTTCAATGTGAGGAAGAGGAA	0.478			T	MLL	AL																																			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	1	Substitution - Missense(1)	kidney(1)											129.0	125.0	127.0					14																	67389564		2203	4300	6503	SO:0001583	missense	10243			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.638A>G	14.37:g.67389564A>G	ENSP00000312771:p.Glu213Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.565758	0.86439	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	N	0.14661	0.345	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.989;0.998;0.981;0.996;1.0	D;D;D;D;D	0.85130	0.969;0.993;0.932;0.986;0.997	T	0.47275	-0.9130	9	0.11794	T	0.64	-8.6358	14.4348	0.67274	1.0:0.0:0.0:0.0	.	182;226;213;213;195	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	G	213;213;195;226;182;146	.	ENSP00000303019:E182G	E	+	2	0	GPHN	66459317	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.039000	0.93777	1.817000	0.53016	0.528000	0.53228	GAG		0.478	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2		NM_020806	
GPR101	83550	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	136112680	136112680	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chrX:136112680C>T	ENST00000298110.1	-	1	1153	c.1154G>A	c.(1153-1155)aGc>aAc	p.S385N		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	385						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.S385N(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					AGGAGGGTTGCTGTTGCTGTT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											169.0	144.0	152.0					X																	136112680		2203	4300	6503	SO:0001583	missense	83550			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1154G>A	X.37:g.136112680C>T	ENSP00000298110:p.Ser385Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	4.583	0.108251	0.08780	.	.	ENSG00000165370	ENST00000298110	T	0.73047	-0.71	4.93	0.978	0.19740	GPCR, rhodopsin-like superfamily (1);	0.387908	0.19051	N	0.124040	T	0.50973	0.1647	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.28713	-1.0035	10	0.29301	T	0.29	-3.9898	1.0976	0.01676	0.1594:0.4104:0.1523:0.2778	.	385	Q96P66	GP101_HUMAN	N	385	ENSP00000298110:S385N	ENSP00000298110:S385N	S	-	2	0	GPR101	135940346	0.000000	0.05858	0.000000	0.03702	0.819000	0.46315	-0.301000	0.08232	-0.059000	0.13154	0.529000	0.55759	AGC		0.512	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			
GTSE1	51512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	46712158	46712158	+	Silent	SNP	C	C	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr22:46712158C>A	ENST00000454366.1	+	7	1493	c.1281C>A	c.(1279-1281)ggC>ggA	p.G427G		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	408					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)		p.G408G(1)|p.G427G(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CGGAAGGTGGCGGCCAGTGGC	0.567																																					GBM(153;542 1915 12487 29016 50495)												2	Substitution - coding silent(2)	kidney(2)											38.0	46.0	43.0					22																	46712158		2198	4298	6496	SO:0001819	synonymous_variant	51512			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1281C>A	22.37:g.46712158C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Silent	SNP	ENST00000454366.1	37	CCDS14074.2																																																																																				0.567	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2		NM_016426	
HACL1	26061	broad.mit.edu;ucsc.edu	37	3	15609989	15609989	+	Silent	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:15609989A>G	ENST00000321169.5	-	13	1567	c.1200T>C	c.(1198-1200)aaT>aaC	p.N400N	HACL1_ENST00000435217.2_Silent_p.N159N|HACL1_ENST00000456194.2_Silent_p.N373N|HACL1_ENST00000451445.2_Silent_p.N318N|HACL1_ENST00000457447.2_Silent_p.N340N	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	400					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)	p.N400N(1)		NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						TGTCCATAGTATTTGCTCCTT	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											204.0	178.0	187.0					3																	15609989		2203	4300	6503	SO:0001819	synonymous_variant	26061			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.1200T>C	3.37:g.15609989A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Silent	SNP	ENST00000321169.5	37	CCDS2627.1																																																																																				0.373	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252104.3		NM_012260	
INSC	387755	hgsc.bcm.edu	37	11	15243190	15243190	+	Silent	SNP	C	C	T	rs61742947	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:15243190C>T	ENST00000379554.3	+	8	1174	c.1128C>T	c.(1126-1128)ctC>ctT	p.L376L	INSC_ENST00000447214.2_3'UTR|INSC_ENST00000379556.3_Silent_p.L329L|INSC_ENST00000424273.1_Silent_p.L287L|INSC_ENST00000528567.1_Silent_p.L329L|INSC_ENST00000525218.1_Silent_p.L287L|INSC_ENST00000530161.1_Silent_p.L329L	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	376					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						TGACAGCCCTCGTCAGTGAGT	0.612													c|||	463	0.0924521	0.2073	0.0735	5008	,	,		17406	0.0585		0.0308	False		,,,				2504	0.0491																0								T	,	710,3424		64,582,1421	29.0	33.0	32.0		1128,987	-1.8	0.0	11	dbSNP_129	32	259,8129		4,251,3939	no	coding-synonymous,coding-synonymous	INSC	NM_001031853.3,NM_001042536.1	,	68,833,5360	TT,TC,CC		3.0877,17.1746,7.7384	,	376/580,329/533	15243190	969,11553	2067	4194	6261	SO:0001819	synonymous_variant	387755			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1128C>T	11.37:g.15243190C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Silent	SNP	ENST00000379554.3	37	CCDS41621.1																																																																																				0.612	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1		NM_001031853	
JAG2	3714	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	105617708	105617708	+	Silent	SNP	C	C	T	rs147768578		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:105617708C>T	ENST00000331782.3	-	9	1582	c.1179G>A	c.(1177-1179)ccG>ccA	p.P393P	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Silent_p.P393P	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	393	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)	p.P393P(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CGGCCGCACACGGGTTCGAAG	0.657																																																	1	Substitution - coding silent(1)	kidney(1)						C	,	3,4403	6.2+/-15.9	0,3,2200	36.0	34.0	35.0		1179,1179	-7.5	0.2	14	dbSNP_134	35	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	JAG2	NM_002226.3,NM_145159.1	,	0,3,6499	TT,TC,CC		0.0,0.0681,0.0231	,	393/1239,393/1201	105617708	3,13001	2203	4299	6502	SO:0001819	synonymous_variant	3714			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.1179G>A	14.37:g.105617708C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Silent	SNP	ENST00000331782.3	37	CCDS9998.1																																																																																				0.657	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2			
KRTAP5-4	387267	broad.mit.edu;hgsc.bcm.edu	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																																	1	Substitution - coding silent(1)	kidney(1)											4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000399682.1	37																																																																																					0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1		NM_001012709	
KRTAP5-10	387273	hgsc.bcm.edu	37	11	71276888	71276888	+	Silent	SNP	T	T	C	rs12793134		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:71276888T>C	ENST00000398531.1	+	1	280	c.255T>C	c.(253-255)ggT>ggC	p.G85G	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	85	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GGGGCTGTGGTTCCTGTGGGG	0.682																																																	0													44.0	64.0	57.0					11																	71276888		2125	4249	6374	SO:0001819	synonymous_variant	387273			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.255T>C	11.37:g.71276888T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																				0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2			
MAGEC3	139081	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	140953292	140953292	+	Silent	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chrX:140953292C>T	ENST00000298296.1	+	2	159	c.159C>T	c.(157-159)gcC>gcT	p.A53A		NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	53								p.A53A(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					ACTATTCTGCCTTTCATCTTG	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											190.0	150.0	164.0					X																	140953292		2203	4300	6503	SO:0001819	synonymous_variant	139081			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.159C>T	X.37:g.140953292C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	ENST00000298296.1	37	CCDS14676.1																																																																																				0.512	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1		NM_138702	
MEGF10	84466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	126778709	126778709	+	Nonsense_Mutation	SNP	T	T	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr5:126778709T>G	ENST00000274473.6	+	20	2649	c.2382T>G	c.(2380-2382)taT>taG	p.Y794*	MEGF10_ENST00000503335.2_Nonsense_Mutation_p.Y794*	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	794	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.Y794*(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CAGGAACATATGGCTATGGCT	0.517																																																	1	Substitution - Nonsense(1)	kidney(1)											70.0	69.0	70.0					5																	126778709		2203	4300	6503	SO:0001587	stop_gained	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2382T>G	5.37:g.126778709T>G	ENSP00000274473:p.Tyr794*	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DE5|Q8WUL3	Nonsense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	T	39	7.552123	0.98355	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	.	.	.	5.63	1.96	0.26148	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.1887	9.0203	0.36195	0.0:0.2138:0.0:0.7862	.	.	.	.	X	794	.	ENSP00000274473:Y794X	Y	+	3	2	MEGF10	126806608	0.964000	0.33143	0.996000	0.52242	0.443000	0.32047	0.068000	0.14531	0.167000	0.19631	-0.371000	0.07208	TAT		0.517	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2		NM_032446	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9072939	9072939	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:9072939C>T	ENST00000397910.4	-	3	14710	c.14507G>A	c.(14506-14508)gGg>gAg	p.G4836E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4838	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G4836E(2)|p.G469E(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACCGGTGGTCCCCACATTGGT	0.458																																																	3	Substitution - Missense(3)	kidney(3)											171.0	160.0	164.0					19																	9072939		2076	4202	6278	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14507G>A	19.37:g.9072939C>T	ENSP00000381008:p.Gly4836Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	4.290	0.053049	0.08291	.	.	ENSG00000181143	ENST00000397910	T	0.26223	1.75	2.21	-2.92	0.05615	.	.	.	.	.	T	0.27027	0.0662	L	0.46157	1.445	.	.	.	P	0.51791	0.948	P	0.55749	0.783	T	0.24333	-1.0163	8	0.87932	D	0	.	0.2531	0.00208	0.209:0.2945:0.206:0.2905	.	4836	B5ME49	.	E	4836	ENSP00000381008:G4836E	ENSP00000381008:G4836E	G	-	2	0	MUC16	8933939	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.099000	0.01346	-0.619000	0.05648	0.457000	0.33378	GGG		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MUC4	4585	hgsc.bcm.edu	37	3	195508133	195508133	+	Missense_Mutation	SNP	G	G	A	rs202065387		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:195508133G>A	ENST00000463781.3	-	2	10777	c.10318C>T	c.(10318-10320)Cct>Tct	p.P3440S	MUC4_ENST00000475231.1_Missense_Mutation_p.P3440S|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3440S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAACAGGGGTGGCGTGA	0.592																																																	2	Substitution - Missense(2)	endometrium(2)											30.0	24.0	26.0					3																	195508133		685	1583	2268	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10318C>T	3.37:g.195508133G>A	ENSP00000417498:p.Pro3440Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.286	-0.146045	0.06627	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.58;1.55	.	.	.	.	.	.	.	.	T	0.22003	0.0530	N	0.14661	0.345	0.09310	N	1	P	0.48350	0.909	P	0.50440	0.641	T	0.15809	-1.0424	6	.	.	.	.	.	.	.	.	3312	E7ESK3	.	S	3440	ENSP00000417498:P3440S;ENSP00000420243:P3440S	.	P	-	1	0	MUC4	196992912	0.016000	0.18221	0.006000	0.13384	0.005000	0.04900	-0.684000	0.05173	0.088000	0.17205	0.089000	0.15464	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195509795	195509795	+	Missense_Mutation	SNP	C	C	T	rs201497773		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:195509795C>T	ENST00000463781.3	-	2	9115	c.8656G>A	c.(8656-8658)Gct>Act	p.A2886T	MUC4_ENST00000475231.1_Missense_Mutation_p.A2886T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.592																																																	0													22.0	15.0	17.0					3																	195509795		682	1576	2258	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8656G>A	3.37:g.195509795C>T	ENSP00000417498:p.Ala2886Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	14.42	2.529251	0.44969	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.37	.	.	.	.	.	.	.	.	T	0.13586	0.0329	N	0.08118	0	0.09310	N	1	B	0.28350	0.208	B	0.09377	0.004	T	0.22138	-1.0225	7	.	.	.	.	4.4363	0.11552	0.0:0.666:0.0:0.334	.	2758	E7ESK3	.	T	2886	ENSP00000417498:A2886T;ENSP00000420243:A2886T	.	A	-	1	0	MUC4	196994574	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.261000	0.00536	-0.000000	0.14550	0.000000	0.15137	GCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195513826	195513826	+	Missense_Mutation	SNP	G	G	A	rs202029925		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:195513826G>A	ENST00000463781.3	-	2	5084	c.4625C>T	c.(4624-4626)cCt>cTt	p.P1542L	MUC4_ENST00000475231.1_Missense_Mutation_p.P1542L|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.M1535_T1550delMPLPVTSPSSASTGDT(4)|p.P1542L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGGGCTAGTGAC	0.592																																																	5	Deletion - In frame(4)|Substitution - Missense(1)	stomach(4)|kidney(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4625C>T	3.37:g.195513826G>A	ENSP00000417498:p.Pro1542Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	9.599	1.128178	0.20959	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26067	1.77;1.76	0.844	0.844	0.18943	.	.	.	.	.	T	0.21307	0.0513	N	0.19112	0.55	0.31987	N	0.6051	P	0.48350	0.909	P	0.52909	0.713	T	0.25779	-1.0122	8	.	.	.	.	5.3481	0.16020	1.0E-4:0.0:0.9999:0.0	.	1542	E7ESK3	.	L	1542	ENSP00000417498:P1542L;ENSP00000420243:P1542L	.	P	-	2	0	MUC4	196998221	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-0.058000	0.11750	0.088000	0.17205	0.089000	0.15464	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MUC5B	727897	hgsc.bcm.edu	37	11	1253969	1253969	+	Silent	SNP	A	A	G	rs72846370		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:1253969A>G	ENST00000529681.1	+	17	2092	c.2034A>G	c.(2032-2034)gtA>gtG	p.V678V	MUC5B_ENST00000447027.1_Silent_p.V681V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	678					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAAGGGCGTACAGCTCAGCG	0.682																																																	0													23.0	26.0	25.0					11																	1253969		2131	4242	6373	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2034A>G	11.37:g.1253969A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2		XM_001126093	
KAT6A	7994	broad.mit.edu;ucsc.edu	37	8	41791800	41791800	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr8:41791800T>C	ENST00000396930.3	-	18	4481	c.3938A>G	c.(3937-3939)gAc>gGc	p.D1313G	KAT6A_ENST00000265713.2_Missense_Mutation_p.D1313G|KAT6A_ENST00000406337.1_Missense_Mutation_p.D1313G	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1313					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.D1313G(1)									AGCGTCGTGGTCGTCATTCTG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											200.0	174.0	183.0					8																	41791800		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3938A>G	8.37:g.41791800T>C	ENSP00000380136:p.Asp1313Gly	Somatic		WXS	Illumina GAIIx	Phase_I	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	7.033	0.561044	0.13498	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.67865	-0.29;-0.29;-0.29	5.87	5.87	0.94306	.	0.063252	0.64402	D	0.000005	T	0.53384	0.1793	L	0.32530	0.975	0.47621	D	0.999477	P	0.36282	0.546	B	0.32980	0.156	T	0.52646	-0.8548	10	0.10902	T	0.67	-18.1588	16.2674	0.82597	0.0:0.0:0.0:1.0	.	1313	Q92794	KAT6A_HUMAN	G	1313	ENSP00000265713:D1313G;ENSP00000385888:D1313G;ENSP00000380136:D1313G	ENSP00000265713:D1313G	D	-	2	0	KAT6A	41910957	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	7.462000	0.80851	2.242000	0.73789	0.533000	0.62120	GAC		0.562	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1		NM_006766	
NFS1	9054	broad.mit.edu;hgsc.bcm.edu	37	20	34285610	34285610	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr20:34285610C>T	ENST00000374092.4	-	3	390	c.320G>A	c.(319-321)cGt>cAt	p.R107H	NFS1_ENST00000540053.1_5'UTR|ROMO1_ENST00000374072.1_5'Flank|NFS1_ENST00000397425.1_Missense_Mutation_p.R47H|NFS1_ENST00000541387.1_Missense_Mutation_p.R107H|NFS1_ENST00000374085.1_Missense_Mutation_p.R47H|ROMO1_ENST00000397416.1_5'Flank|ROMO1_ENST00000336695.4_5'Flank|ROMO1_ENST00000374077.3_5'Flank|NFS1_ENST00000306750.3_Missense_Mutation_p.R107H|ROMO1_ENST00000374078.1_5'Flank	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	107					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.R107H(1)		central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	ACTAACCTGACGAGCACGTTC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											96.0	88.0	90.0					20																	34285610		2203	4300	6503	SO:0001583	missense	9054			AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.320G>A	20.37:g.34285610C>T	ENSP00000363205:p.Arg107His	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Missense_Mutation	SNP	ENST00000374092.4	37	CCDS13262.1	.	.	.	.	.	.	.	.	.	.	C	36	5.803438	0.96960	.	.	ENSG00000244005	ENST00000374092;ENST00000374085;ENST00000397425;ENST00000541387;ENST00000537772;ENST00000419569;ENST00000306750	D;D;D;T;D;D	0.91295	-2.82;-2.82;-2.82;0.86;-2.82;-2.82	5.75	5.75	0.90469	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.98071	0.9364	H	0.99914	4.94	0.80722	D	1	P;D;D	0.89917	0.935;1.0;0.982	P;D;P	0.72982	0.54;0.979;0.631	D	0.99387	1.0924	10	0.87932	D	0	-4.8141	19.9273	0.97107	0.0:1.0:0.0:0.0	.	107;107;107	F5GYK5;Q8WV90;Q9Y697	.;.;NFS1_HUMAN	H	107;47;47;107;107;47;107	ENSP00000363205:R107H;ENSP00000363198:R47H;ENSP00000380570:R47H;ENSP00000440897:R107H;ENSP00000393482:R47H;ENSP00000304740:R107H	ENSP00000304740:R107H	R	-	2	0	NFS1	33749024	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.404000	0.79996	2.718000	0.92993	0.591000	0.81541	CGT		0.522	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078936.4		NM_021100	
OR5AP2	338675	broad.mit.edu;ucsc.edu	37	11	56409234	56409234	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:56409234A>G	ENST00000302981.1	-	1	681	c.682T>C	c.(682-684)Ttc>Ctc	p.F228L	OR5AP2_ENST00000544374.1_Missense_Mutation_p.F229L	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F228L(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						ACGGCAATGAAGATACACAGG	0.443																																																	1	Substitution - Missense(1)	kidney(1)											180.0	167.0	171.0					11																	56409234		2201	4296	6497	SO:0001583	missense	338675			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.682T>C	11.37:g.56409234A>G	ENSP00000303111:p.Phe228Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B2RNM8	Missense_Mutation	SNP	ENST00000302981.1	37	CCDS31534.1	.	.	.	.	.	.	.	.	.	.	A	1.435	-0.569271	0.03910	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00058	8.79;8.79	5.09	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	0.318367	0.22837	N	0.055026	T	0.00039	0.0001	N	0.00885	-1.115	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19712	-1.0297	10	0.02654	T	1	.	8.4892	0.33089	0.0801:0.2918:0.6281:0.0	.	228	Q8NGF4	O5AP2_HUMAN	L	229;228	ENSP00000442701:F229L;ENSP00000303111:F228L	ENSP00000303111:F228L	F	-	1	0	OR5AP2	56165810	0.054000	0.20591	1.000000	0.80357	0.989000	0.77384	0.189000	0.17037	0.710000	0.31997	-0.261000	0.10672	TTC		0.443	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1		NM_001002925	
OSBPL11	114885	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	125286405	125286405	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:125286405A>C	ENST00000296220.5	-	6	990	c.701T>G	c.(700-702)tTa>tGa	p.L234*		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	234					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.L234*(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						TCGTCTAATTAAGTCTCTTTG	0.403																																																	1	Substitution - Nonsense(1)	kidney(1)											174.0	153.0	160.0					3																	125286405		2203	4300	6503	SO:0001587	stop_gained	114885			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.701T>G	3.37:g.125286405A>C	ENSP00000296220:p.Leu234*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K9I7	Nonsense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	A	39	7.727721	0.98456	.	.	ENSG00000144909	ENST00000296220	.	.	.	4.68	4.68	0.58851	.	0.319329	0.24172	N	0.040891	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6419	14.3245	0.66509	1.0:0.0:0.0:0.0	.	.	.	.	X	234	.	ENSP00000296220:L234X	L	-	2	0	OSBPL11	126769095	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.608000	0.90895	1.957000	0.56846	0.533000	0.62120	TTA		0.403	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1		NM_022776	
PCK2	5106	broad.mit.edu;ucsc.edu	37	14	24568786	24568786	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:24568786C>A	ENST00000216780.4	+	6	1140	c.872C>A	c.(871-873)cCt>cAt	p.P291H	PCK2_ENST00000545054.2_Missense_Mutation_p.P157H|PCK2_ENST00000559250.1_Missense_Mutation_p.P303H|PCK2_ENST00000558096.1_Missense_Mutation_p.P157H|NRL_ENST00000561028.1_Intron|PCK2_ENST00000561286.1_Missense_Mutation_p.P157H|PCK2_ENST00000396973.4_Missense_Mutation_p.P291H	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	291					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)	p.P291H(2)		breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		ATCACCAGCCCTGCAGGGAAG	0.587																																																	2	Substitution - Missense(2)	kidney(2)											100.0	94.0	96.0					14																	24568786		2203	4300	6503	SO:0001583	missense	5106			AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.872C>A	14.37:g.24568786C>A	ENSP00000216780:p.Pro291His	Somatic		WXS	Illumina GAIIx	Phase_I	O43253|Q86U01|Q9BV62	Missense_Mutation	SNP	ENST00000216780.4	37	CCDS9609.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716553	0.89205	.	.	ENSG00000100889	ENST00000216780;ENST00000396973;ENST00000545054	T;T;T	0.14640	2.49;2.49;2.49	5.74	5.74	0.90152	Phosphoenolpyruvate carboxykinase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.54029	0.1833	H	0.97023	3.925	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;0.998	T	0.69587	-0.5105	10	0.87932	D	0	-11.0895	17.4169	0.87503	0.0:1.0:0.0:0.0	.	157;291;291;291	B4DW73;Q16822;Q16822-2;Q6IB91	.;PCKGM_HUMAN;.;.	H	291;291;157	ENSP00000216780:P291H;ENSP00000380171:P291H;ENSP00000441826:P157H	ENSP00000216780:P291H	P	+	2	0	PCK2	23638626	1.000000	0.71417	0.952000	0.39060	0.988000	0.76386	7.487000	0.81328	2.717000	0.92951	0.655000	0.94253	CCT		0.587	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3		NM_001018073	
PRRC2C	23215	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	171510546	171510546	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:171510546G>A	ENST00000338920.4	+	16	4172	c.3935G>A	c.(3934-3936)cGa>cAa	p.R1312Q	PRRC2C_ENST00000426496.2_Missense_Mutation_p.R1312Q|PRRC2C_ENST00000367742.3_Missense_Mutation_p.R1314Q|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R1314Q	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1312					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.R1314Q(2)									AATCATGTTCGAATAGATAAT	0.413																																																	2	Substitution - Missense(2)	kidney(2)											50.0	51.0	51.0					1																	171510546		2203	4300	6503	SO:0001583	missense	23215			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.3935G>A	1.37:g.171510546G>A	ENSP00000343629:p.Arg1312Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	11.05	1.523569	0.27299	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.02103	4.45;4.45;4.45;4.45	5.51	5.51	0.81932	.	0.000000	0.38164	N	0.001793	T	0.01222	0.0040	L	0.51422	1.61	0.40495	D	0.980587	B	0.33494	0.414	B	0.20767	0.031	T	0.55379	-0.8150	10	0.48119	T	0.1	.	11.9918	0.53180	0.0794:0.0:0.9206:0.0	.	1312	Q9Y520-4	.	Q	1314;1313;1312;1314;1312;1069	ENSP00000375928:R1314Q;ENSP00000410219:R1312Q;ENSP00000356716:R1314Q;ENSP00000343629:R1312Q	ENSP00000343629:R1312Q	R	+	2	0	PRRC2C	169777170	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.221000	0.78016	2.577000	0.86979	0.563000	0.77884	CGA		0.413	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4		NM_015172	
PSG5	5673	broad.mit.edu;hgsc.bcm.edu	37	19	43679580	43679580	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:43679580A>G	ENST00000366175.3	-	4	881	c.751T>C	c.(751-753)Tac>Cac	p.Y251H	PSG5_ENST00000407568.1_Intron|PSG5_ENST00000599812.1_Missense_Mutation_p.Y344H|PSG5_ENST00000342951.6_Missense_Mutation_p.Y251H|PSG5_ENST00000407356.1_Missense_Mutation_p.Y251H|PSG5_ENST00000404580.1_Missense_Mutation_p.Y251H			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	251	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.Y251H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				CCTGAACGGTAATAGGTGAAT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											145.0	160.0	154.0					19																	43679580		2202	4295	6497	SO:0001583	missense	5673				CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.751T>C	19.37:g.43679580A>G	ENSP00000382334:p.Tyr251His	Somatic		WXS	Illumina HiSeq	Phase_I	Q15239|Q96QJ1|Q9UQ75	Missense_Mutation	SNP	ENST00000366175.3	37	CCDS12617.1	.	.	.	.	.	.	.	.	.	.	a	10.89	1.477027	0.26511	.	.	ENSG00000204941	ENST00000366175;ENST00000407356;ENST00000342951;ENST00000404580	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	1.25	1.25	0.21368	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31040	0.0784	M	0.78916	2.43	0.09310	N	0.999999	B;B	0.31241	0.315;0.175	P;B	0.53224	0.721;0.33	T	0.43686	-0.9376	9	0.52906	T	0.07	.	4.5793	0.12252	1.0:0.0:0.0:0.0	.	344;251	Q15228;Q15238	.;PSG5_HUMAN	H	251	ENSP00000382334:Y251H;ENSP00000386008:Y251H;ENSP00000344413:Y251H;ENSP00000385250:Y251H	ENSP00000344413:Y251H	Y	-	1	0	PSG5	48371420	0.001000	0.12720	0.011000	0.14972	0.037000	0.13140	0.458000	0.21892	0.539000	0.28788	0.155000	0.16302	TAC		0.488	PSG5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323055.1		NM_002781	
RAG2	5897	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	36614945	36614945	+	Silent	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:36614945G>A	ENST00000311485.3	-	2	935	c.774C>T	c.(772-774)gtC>gtT	p.V258V	C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000534635.1_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000347206.4_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	258					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.V258V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				TTGCACTGGAGACAGAGATTC	0.433									Familial Hemophagocytic Lymphohistiocytosis																																								1	Substitution - coding silent(1)	kidney(1)											65.0	66.0	66.0					11																	36614945		2202	4298	6500	SO:0001819	synonymous_variant	5897	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.774C>T	11.37:g.36614945G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9E9|Q8TBL4	Silent	SNP	ENST00000311485.3	37	CCDS7903.1																																																																																				0.433	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1		NM_000536	
RLTPR	146206	broad.mit.edu;ucsc.edu	37	16	67685104	67685104	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr16:67685104G>T	ENST00000334583.6	+	23	2527	c.2199G>T	c.(2197-2199)ttG>ttT	p.L733F	RLTPR_ENST00000545661.1_Missense_Mutation_p.L697F	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	733					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)		p.L773F(1)|p.L733F(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGAATGAATTGTGTCAGTCGG	0.612																																																	2	Substitution - Missense(2)	kidney(2)											39.0	43.0	42.0					16																	67685104		2103	4235	6338	SO:0001583	missense	146206			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.2199G>T	16.37:g.67685104G>T	ENSP00000334958:p.Leu733Phe	Somatic		WXS	Illumina GAIIx	Phase_I	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248361	0.39797	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.54866	0.55;0.55	5.27	-0.372	0.12520	.	0.177005	0.35151	N	0.003402	T	0.52451	0.1735	M	0.62723	1.935	0.43688	D	0.99613	D;D	0.64830	0.994;0.994	P;P	0.56278	0.795;0.795	T	0.51212	-0.8734	10	0.54805	T	0.06	-10.6282	0.6903	0.00890	0.2425:0.1324:0.3542:0.271	.	697;733	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	F	733;697	ENSP00000334958:L733F;ENSP00000441481:L697F	ENSP00000334958:L733F	L	+	3	2	RLTPR	66242605	0.988000	0.35896	0.689000	0.30133	0.197000	0.23852	0.394000	0.20834	-0.289000	0.09038	-1.119000	0.02030	TTG		0.612	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1		NM_001013838	
SPTA1	6708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	158655094	158655094	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:158655094T>G	ENST00000368147.4	-	2	248	c.68A>C	c.(67-69)gAg>gCg	p.E23A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	23					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.E23A(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTCCTGGATCTCTTCTGCTGT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											146.0	144.0	145.0					1																	158655094		1890	4117	6007	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.68A>C	1.37:g.158655094T>G	ENSP00000357129:p.Glu23Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.962899	0.74016	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34472	1.36;1.36	4.98	3.84	0.44239	.	0.000000	0.32608	N	0.005863	T	0.19805	0.0476	L	0.45581	1.43	0.43846	D	0.996434	B	0.21688	0.059	B	0.35039	0.194	T	0.04400	-1.0954	10	0.31617	T	0.26	.	11.0377	0.47811	0.0:0.0:0.1561:0.8439	.	23	P02549	SPTA1_HUMAN	A	23	ENSP00000357130:E23A;ENSP00000357129:E23A	ENSP00000357129:E23A	E	-	2	0	SPTA1	156921718	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.558000	0.67319	0.907000	0.36646	0.383000	0.25322	GAG		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	
SRRM5	100170229	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	44116657	44116657	+	Silent	SNP	A	A	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:44116657A>C	ENST00000607544.1	+	3	706	c.384A>C	c.(382-384)ggA>ggC	p.G128G	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000526798.1_Silent_p.G143G|SRRM5_ENST00000417606.1_Silent_p.G128G			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	128	Ser-rich.							p.G128G(1)		endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						GCAGAAGGGGAAGCCGCAGCT	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											41.0	54.0	50.0					19																	44116657		692	1591	2283	SO:0001819	synonymous_variant	100170229			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.384A>C	19.37:g.44116657A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DNF0	Silent	SNP	ENST00000607544.1	37	CCDS46095.1																																																																																				0.642	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000384398.2		NM_001145641	
SRSF2	6427	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	74732441	74732441	+	Silent	SNP	T	T	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr17:74732441T>C	ENST00000392485.2	-	2	640	c.468A>G	c.(466-468)cgA>cgG	p.R156R	RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000586622.1_5'UTR|SRSF2_ENST00000359995.5_Silent_p.R156R|SRSF2_ENST00000508921.3_Silent_p.R144R|MFSD11_ENST00000593181.1_5'Flank|MFSD11_ENST00000336509.4_5'Flank|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000590514.1_5'Flank|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000588460.1_5'UTR|MFSD11_ENST00000355954.3_5'Flank|MFSD11_ENST00000591864.1_5'Flank	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	156	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)	p.R156R(1)|p.R136R(1)		haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						TCGACCGAGATCGAGAACGAG	0.652			Mis		"""MDS, CLL"""																																			Dom	yes		17	17q25	6427	serine/arginine-rich splicing factor 2		L	2	Substitution - coding silent(2)	kidney(2)											99.0	79.0	86.0					17																	74732441		2203	4300	6503	SO:0001819	synonymous_variant	6427			M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.468A>G	17.37:g.74732441T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B3KWD5|B4DN89|H0YG49	Silent	SNP	ENST00000392485.2	37	CCDS11749.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314994	0.23908	.	.	ENSG00000161547	ENST00000452355	.	.	.	4.97	-1.41	0.08941	.	.	.	.	.	T	0.54095	0.1837	.	.	.	0.47994	D	0.999569	.	.	.	.	.	.	T	0.48525	-0.9028	5	0.30078	T	0.28	.	9.2584	0.37597	0.0:0.2292:0.4363:0.3346	.	.	.	.	G	106	.	ENSP00000391278:D106G	D	-	2	0	SRSF2	72244036	0.007000	0.16637	0.004000	0.12327	0.724000	0.41520	-1.838000	0.01687	-0.177000	0.10690	-0.247000	0.11927	GAT		0.652	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437489.1		NM_003016	
SYNE1	23345	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	152443659	152443659	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr6:152443659T>A	ENST00000367255.5	-	146	26907	c.26306A>T	c.(26305-26307)gAg>gTg	p.E8769V	SYNE1_ENST00000539504.1_Missense_Mutation_p.E924V|SYNE1_ENST00000448038.1_Missense_Mutation_p.E8721V|ESR1_ENST00000427531.2_Intron|SYNE1_ENST00000423061.1_Missense_Mutation_p.E8721V|SYNE1_ENST00000356820.4_Missense_Mutation_p.E3293V|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000341594.5_Missense_Mutation_p.E8381V|SYNE1_ENST00000354674.4_Missense_Mutation_p.E947V|SYNE1_ENST00000265368.4_Missense_Mutation_p.E8769V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8769	KASH. {ECO:0000255|PROSITE- ProRule:PRU00385}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E8769V(2)|p.E8721V(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTAGTCTTCCTCTGACATTGG	0.572										HNSCC(10;0.0054)																																							3	Substitution - Missense(3)	kidney(3)											109.0	94.0	99.0					6																	152443659		2203	4300	6503	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.26306A>T	6.37:g.152443659T>A	ENSP00000356224:p.Glu8769Val	Somatic		WXS	Illumina HiSeq	Phase_I	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	29.1	4.979254	0.92982	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000354674	T;T;T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8	5.56	5.56	0.83823	Klarsicht/ANC-1/syne-1 homology (2);	0.000000	0.49916	D	0.000130	T	0.50888	0.1642	M	0.89478	3.035	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.62435	-0.6855	10	0.87932	D	0	.	15.7131	0.77646	0.0:0.0:0.0:1.0	.	8769;8769;8721	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	V	8769;924;8721;8769;8721;8381;3293;954;949;947	ENSP00000356224:E8769V;ENSP00000441052:E924V;ENSP00000396024:E8721V;ENSP00000265368:E8769V;ENSP00000390975:E8721V;ENSP00000341887:E8381V;ENSP00000349276:E3293V;ENSP00000346701:E947V	ENSP00000265368:E8769V	E	-	2	0	SYNE1	152485352	1.000000	0.71417	0.959000	0.39883	0.973000	0.67179	6.201000	0.72124	2.114000	0.64651	0.533000	0.62120	GAG		0.572	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2		NM_182961	
TAF7L	54457	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	100532702	100532702	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chrX:100532702C>A	ENST00000372907.3	-	9	852	c.841G>T	c.(841-843)Gaa>Taa	p.E281*	TAF7L_ENST00000324762.6_Nonsense_Mutation_p.E195*|TAF7L_ENST00000356784.1_Nonsense_Mutation_p.E195*|TAF7L_ENST00000372905.2_Nonsense_Mutation_p.E195*	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	281					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)		p.E281*(1)		NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GCAATGACTTCCCAACCTGAA	0.453																																					Ovarian(104;431 1530 3210 15406 18594)												1	Substitution - Nonsense(1)	kidney(1)											108.0	100.0	103.0					X																	100532702		2203	4300	6503	SO:0001587	stop_gained	54457			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.841G>T	X.37:g.100532702C>A	ENSP00000361998:p.Glu281*	Somatic		WXS	Illumina HiSeq	Phase_I	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Nonsense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	c	33	5.242906	0.95272	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	.	.	.	5.29	4.43	0.53597	.	0.130020	0.35555	N	0.003121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.4773	13.1451	0.59456	0.0:0.9204:0.0:0.0796	.	.	.	.	X	281;195;195;195	.	ENSP00000320283:E195X	E	-	1	0	TAF7L	100419358	1.000000	0.71417	0.999000	0.59377	0.150000	0.21749	3.967000	0.56802	1.107000	0.41642	0.597000	0.82753	GAA		0.453	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2			
TCERG1	10915	hgsc.bcm.edu	37	5	145838653	145838653	+	Silent	SNP	C	C	T	rs112548582		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr5:145838653C>T	ENST00000296702.5	+	4	683	c.645C>T	c.(643-645)gcC>gcT	p.A215A	TCERG1_ENST00000394421.2_Silent_p.A215A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	215	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aggcccaggcccaggcccagg	0.731																																																	0													10.0	14.0	12.0					5																	145838653		2181	4251	6432	SO:0001819	synonymous_variant	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.645C>T	5.37:g.145838653C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																				0.731	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1		NM_001040006	
TEKT3	64518	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	15207259	15207259	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr17:15207259G>C	ENST00000395930.1	-	9	1653	c.1467C>G	c.(1465-1467)ttC>ttG	p.F489L	TEKT3_ENST00000338696.2_Missense_Mutation_p.F489L|TEKT3_ENST00000462175.1_5'UTR	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	489					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.F489L(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		GTCCCTAGCAGAAGCCGACCA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											87.0	78.0	81.0					17																	15207259		2203	4300	6503	SO:0001583	missense	64518			AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.1467C>G	17.37:g.15207259G>C	ENSP00000379263:p.Phe489Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	37	CCDS11169.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533367	0.45073	.	.	ENSG00000125409	ENST00000395930;ENST00000338696	T;T	0.03663	3.85;3.85	5.36	4.39	0.52855	.	0.545336	0.21867	N	0.067950	T	0.05318	0.0141	L	0.40543	1.245	0.34223	D	0.675649	B	0.22800	0.075	B	0.24701	0.055	T	0.10109	-1.0644	10	0.72032	D	0.01	-2.9385	14.4635	0.67467	0.0713:0.0:0.9287:0.0	.	489	Q9BXF9	TEKT3_HUMAN	L	489	ENSP00000379263:F489L;ENSP00000343995:F489L	ENSP00000343995:F489L	F	-	3	2	TEKT3	15147984	0.999000	0.42202	0.981000	0.43875	0.940000	0.58332	1.393000	0.34497	1.406000	0.46857	0.561000	0.74099	TTC		0.512	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2		NM_031898	
TMTC3	160418	broad.mit.edu;hgsc.bcm.edu	37	12	88589406	88589406	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr12:88589406C>T	ENST00000266712.6	+	14	2945	c.2725C>T	c.(2725-2727)Cgt>Tgt	p.R909C		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	910					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)		p.R909C(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						AGAGATTGAACGTATTTTAAA	0.323																																																	1	Substitution - Missense(1)	kidney(1)											47.0	48.0	47.0					12																	88589406		2202	4296	6498	SO:0001583	missense	160418				CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.2725C>T	12.37:g.88589406C>T	ENSP00000266712:p.Arg909Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	ENST00000266712.6	37	CCDS9032.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475751	0.84640	.	.	ENSG00000139324	ENST00000266712	T	0.70399	-0.48	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.77791	0.4183	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80320	-0.1432	10	0.87932	D	0	-11.4981	19.5526	0.95328	0.0:1.0:0.0:0.0	.	909	Q6ZXV5-2	.	C	909	ENSP00000266712:R909C	ENSP00000266712:R909C	R	+	1	0	TMTC3	87113537	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.189000	0.77747	2.705000	0.92388	0.585000	0.79938	CGT		0.323	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1		NM_181783	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179604819	179604819	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr2:179604819C>T	ENST00000591111.1	-	46	12414	c.12190G>A	c.(12190-12192)Gaa>Aaa	p.E4064K	TTN_ENST00000342175.6_Missense_Mutation_p.E4210K|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Missense_Mutation_p.E4143K|TTN_ENST00000460472.2_Missense_Mutation_p.E4018K|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E4381K|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E4143K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAAGCTTTCCTTAGAAAGA	0.498																																																	1	Substitution - Missense(1)	kidney(1)											57.0	56.0	57.0					2																	179604819		1837	4098	5935	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12190G>A	2.37:g.179604819C>T	ENSP00000465570:p.Glu4064Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	17.55	3.418659	0.62622	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.66638	-0.14;-0.22;-0.22	5.7	5.7	0.88788	.	.	.	.	.	T	0.64327	0.2588	L	0.36672	1.1	0.43160	D	0.994948	P;P;P	0.52316	0.952;0.952;0.952	P;P;P	0.44518	0.452;0.452;0.452	T	0.69495	-0.5130	9	0.87932	D	0	.	19.8344	0.96650	0.0:1.0:0.0:0.0	.	4018;4143;4210	D3DPF9;E7EQE6;E7ET18	.;.;.	K	4018;4210;4143;4018	ENSP00000434586:E4018K;ENSP00000340554:E4210K;ENSP00000352154:E4143K	ENSP00000340554:E4210K	E	-	1	0	TTN	179313064	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.652000	0.83633	2.692000	0.91855	0.655000	0.94253	GAA		0.498	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
VHL	7428	hgsc.bcm.edu	37	3	10183820	10183820	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01W-1244-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	06d67c16-1bb7-4454-a190-9e19549a1150	g.chr3:10183820delC	ENST00000256474.2	+	1	1129	c.289delC	c.(289-291)cccfs	p.P97fs	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Frame_Shift_Del_p.P97fs	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	97			Missing (in VHLD; type I).		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.P95_P99del(1)|p.E94fs*62(1)|p.E94fs*34(1)|p.Q96fs*34(1)|p.Q96fs*62(1)|p.P95fs*59(1)|p.Q96fs*61(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGAGCCGCAGCCCTACCCAAC	0.697		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																													.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	7	Deletion - Frameshift(6)|Deletion - In frame(1)	kidney(7)											13.0	15.0	14.0					3																	10183820		1775	3680	5455	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.289delC	3.37:g.10183820delC	ENSP00000256474:p.Pro97fs	Somatic		WXS	Illumina MiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.697	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDR74	54663	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62606659	62606659	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr11:62606659C>T	ENST00000525239.1	-	4	757	c.220G>A	c.(220-222)Gat>Aat	p.D74N	WDR74_ENST00000525752.1_Missense_Mutation_p.D17N|WDR74_ENST00000540620.1_5'UTR|WDR74_ENST00000529106.1_Missense_Mutation_p.D74N|WDR74_ENST00000278856.4_Missense_Mutation_p.D74N|WDR74_ENST00000311713.7_Missense_Mutation_p.D74N|RNU2-2P_ENST00000410396.1_RNA			Q6RFH5	WDR74_HUMAN	WD repeat domain 74	74					blastocyst formation (GO:0001825)|RNA metabolic process (GO:0016070)	nucleolus (GO:0005730)|nucleus (GO:0005634)		p.D74N(2)		kidney(2)|large_intestine(1)|liver(1)|lung(3)|ovary(1)	8						AATATGCCATCCTCGGTGCTG	0.647																																																	2	Substitution - Missense(2)	kidney(2)											43.0	48.0	47.0					11																	62606659		2081	4206	6287	SO:0001583	missense	54663				CCDS44630.1	11q12.3	2013-01-09				ENSG00000133316		"""WD repeat domain containing"""	25529	protein-coding gene	gene with protein product							Standard	NM_018093		Approved	FLJ10439	uc001nvm.2	Q6RFH5		ENST00000525239.1:c.220G>A	11.37:g.62606659C>T	ENSP00000432119:p.Asp74Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8G5|Q9BRC9|Q9H6X8|Q9NVY2	Missense_Mutation	SNP	ENST00000525239.1	37	CCDS44630.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.40|13.40	2.224665|2.224665	0.39300|0.39300	.|.	.|.	ENSG00000133316|ENSG00000133316	ENST00000311713;ENST00000529106;ENST00000525239;ENST00000278856;ENST00000525752|ENST00000535048	T;T;T;T;T|.	0.28895|.	1.59;1.59;1.59;1.59;1.59|.	4.7|4.7	2.81|2.81	0.32909|0.32909	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.185860|.	0.46145|.	D|.	0.000312|.	T|T	0.15912|0.15912	0.0383|0.0383	N|N	0.04880|0.04880	-0.145|-0.145	0.24350|0.24350	N|N	0.994927|0.994927	B;B;B;B|.	0.16166|.	0.016;0.0;0.0;0.001|.	B;B;B;B|.	0.06405|.	0.002;0.001;0.001;0.001|.	T|T	0.22173|0.22173	-1.0224|-1.0224	10|5	0.18276|.	T|.	0.48|.	-7.7522|-7.7522	5.7151|5.7151	0.17956|0.17956	0.0:0.6858:0.0:0.3142|0.0:0.6858:0.0:0.3142	.|.	74;17;74;74|.	B4E018;E9PS41;Q6RFH5;Q6RFH5-2|.	.;.;WDR74_HUMAN;.|.	N|E	74;74;74;74;17|65	ENSP00000308931:D74N;ENSP00000435726:D74N;ENSP00000432119:D74N;ENSP00000278856:D74N;ENSP00000432113:D17N|.	ENSP00000278856:D74N|.	D|G	-|-	1|2	0|0	WDR74|WDR74	62363235|62363235	1.000000|1.000000	0.71417|0.71417	0.541000|0.541000	0.28102|0.28102	0.269000|0.269000	0.26545|0.26545	2.739000|2.739000	0.47409|0.47409	0.960000|0.960000	0.38005|0.38005	0.655000|0.655000	0.94253|0.94253	GAT|GGA		0.647	WDR74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395678.1		NM_018093	
ZNF200	7752	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	3274074	3274074	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr16:3274074A>T	ENST00000431561.3	-	5	1618	c.1006T>A	c.(1006-1008)Ttt>Att	p.F336I	ZNF200_ENST00000396871.4_Missense_Mutation_p.F335I|ZNF200_ENST00000396870.4_Missense_Mutation_p.F335I|ZNF200_ENST00000396868.3_Missense_Mutation_p.F335I|ZNF200_ENST00000575948.1_Missense_Mutation_p.F335I|AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000414144.2_Missense_Mutation_p.F336I	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.F336I(1)		breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						GGACACTTAAATATCTTCTCC	0.418																																																	1	Substitution - Missense(1)	kidney(1)											145.0	152.0	149.0					16																	3274074		2197	4300	6497	SO:0001583	missense	7752			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.1006T>A	16.37:g.3274074A>T	ENSP00000395723:p.Phe336Ile	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	ENST00000431561.3	37	CCDS10497.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.674452	0.47781	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T	0.23552	1.9;1.9;1.9	5.31	1.77	0.24775	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.342769	0.21481	N	0.073838	T	0.29158	0.0725	M	0.79926	2.475	0.20703	N	0.999861	B;B;B	0.32653	0.379;0.379;0.328	B;B;B	0.33121	0.158;0.158;0.098	T	0.25082	-1.0142	10	0.87932	D	0	-25.878	7.615	0.28152	0.7186:0.0:0.2814:0.0	.	335;336;335	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	I	336;335;335;335;336	ENSP00000380077:F335I;ENSP00000380080:F335I;ENSP00000395723:F336I	ENSP00000380077:F335I	F	-	1	0	ZNF200	3214075	0.170000	0.23016	0.995000	0.50966	0.994000	0.84299	2.831000	0.48144	0.472000	0.27344	0.455000	0.32223	TTT		0.418	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1			
ZNF423	23090	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	49672052	49672052	+	Silent	SNP	A	A	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr16:49672052A>T	ENST00000561648.1	-	4	1064	c.1011T>A	c.(1009-1011)ggT>ggA	p.G337G	ZNF423_ENST00000567169.1_Silent_p.G220G|ZNF423_ENST00000535559.1_Silent_p.G220G|ZNF423_ENST00000563137.2_Silent_p.G277G|ZNF423_ENST00000562871.1_Silent_p.G277G|ZNF423_ENST00000262383.2_Silent_p.G337G|ZNF423_ENST00000562520.1_Silent_p.G277G	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	337					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G337G(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GGCAGTAGACACCTTCCACTG	0.617																																																	2	Substitution - coding silent(2)	kidney(2)											81.0	65.0	70.0					16																	49672052		2198	4300	6498	SO:0001819	synonymous_variant	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1011T>A	16.37:g.49672052A>T		Somatic		WXS	Illumina HiSeq	Phase_I	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1																																																																																				0.617	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1		NM_015069	
ZNF519	162655	hgsc.bcm.edu	37	18	14105186	14105186	+	Silent	SNP	T	T	C	rs145376132	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr18:14105186T>C	ENST00000590202.1	-	3	1505	c.1353A>G	c.(1351-1353)caA>caG	p.Q451Q	ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	451					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TATGGATTCTTTGATGTCGAG	0.423													T|||	32	0.00638978	0.0008	0.0159	5008	,	,		22131	0.0		0.0159	False		,,,				2504	0.0041																0								T		11,4395	15.5+/-35.6	0,11,2192	66.0	65.0	65.0		1353	-1.3	0.1	18	dbSNP_134	65	155,8445	59.5+/-121.1	3,149,4148	no	coding-synonymous	ZNF519	NM_145287.3		3,160,6340	CC,CT,TT		1.8023,0.2497,1.2763		451/541	14105186	166,12840	2203	4300	6503	SO:0001819	synonymous_variant	162655			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1353A>G	18.37:g.14105186T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000590202.1	37	CCDS32797.1																																																																																				0.423	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1		NM_145287	
ZNF519	162655	hgsc.bcm.edu	37	18	14105246	14105246	+	Silent	SNP	G	G	A	rs149803578	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr18:14105246G>A	ENST00000590202.1	-	3	1445	c.1293C>T	c.(1291-1293)caC>caT	p.H431H	ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	431					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TACATTTGAAGTGTTTCTCTC	0.398													G|||	31	0.0061901	0.0008	0.0159	5008	,	,		23770	0.0		0.0149	False		,,,				2504	0.0041																0													70.0	69.0	69.0					18																	14105246		2203	4300	6503	SO:0001819	synonymous_variant	162655			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1293C>T	18.37:g.14105246G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000590202.1	37	CCDS32797.1																																																																																				0.398	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1		NM_145287	
ZNF519	162655	hgsc.bcm.edu	37	18	14105248	14105248	+	Missense_Mutation	SNP	G	G	A	rs148982947	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr18:14105248G>A	ENST00000590202.1	-	3	1443	c.1291C>T	c.(1291-1293)Cac>Tac	p.H431Y	ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	431					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						CATTTGAAGTGTTTCTCTCCA	0.408													G|||	31	0.0061901	0.0008	0.0159	5008	,	,		22765	0.0		0.0149	False		,,,				2504	0.0041																0													71.0	70.0	70.0					18																	14105248		2203	4300	6503	SO:0001583	missense	162655			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1291C>T	18.37:g.14105248G>A	ENSP00000464872:p.His431Tyr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000590202.1	37	CCDS32797.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631660	0.29068	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	0.646	0.17789	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20536	0.0494	N	0.16368	0.405	0.25009	N	0.991419	B	0.26876	0.162	B	0.19946	0.027	T	0.21895	-1.0232	8	0.87932	D	0	.	7.2226	0.25997	1.0E-4:0.0:0.9999:0.0	.	431	Q8TB69	ZN519_HUMAN	Y	431	.	ENSP00000307908:H431Y	H	-	1	0	ZNF519	14095248	0.608000	0.26966	0.761000	0.31378	0.511000	0.34104	2.966000	0.49208	0.661000	0.30985	0.089000	0.15464	CAC		0.408	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1		NM_145287	
ZNF621	285268	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	40574134	40574134	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:40574134T>A	ENST00000339296.5	+	5	1325	c.873T>A	c.(871-873)taT>taA	p.Y291*	ZNF621_ENST00000490457.1_Intron|ZNF621_ENST00000431278.1_Nonsense_Mutation_p.Y180*|ZNF621_ENST00000310898.1_Intron|ZNF621_ENST00000403205.2_Nonsense_Mutation_p.Y291*	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y291*(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		AGAAACCTTATCAATGTAAGG	0.428																																																	1	Substitution - Nonsense(1)	kidney(1)											64.0	70.0	68.0					3																	40574134		2203	4300	6503	SO:0001587	stop_gained	285268			AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.873T>A	3.37:g.40574134T>A	ENSP00000340841:p.Tyr291*	Somatic		WXS	Illumina HiSeq	Phase_I	Q14DC7|Q8TE91	Nonsense_Mutation	SNP	ENST00000339296.5	37	CCDS2693.1	.	.	.	.	.	.	.	.	.	.	t	35	5.535177	0.96460	.	.	ENSG00000172888	ENST00000403205;ENST00000339296;ENST00000431278	.	.	.	3.75	2.88	0.33553	.	.	.	.	.	.	.	.	.	.	.	0.25230	N	0.989834	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3065	0.21141	0.0:0.7779:0.0:0.2221	.	.	.	.	X	291;291;180	.	ENSP00000340841:Y291X	Y	+	3	2	ZNF621	40549138	0.000000	0.05858	0.835000	0.33067	0.284000	0.27059	-0.429000	0.06982	1.168000	0.42723	-0.147000	0.13772	TAT		0.428	ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254178.2		NM_198484	
Unknown	0	broad.mit.edu	37	14	106770438	106770439	+	IGR	INS	-	-	CT	rs201826648|rs375833692	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:106770438_106770439insCT								IGHV2-26 (12322 upstream) : IGHV4-28 (10073 downstream)																							CCTGGCCCAGCCTCTCTTGGCT	0.52														159	0.0317492	0.1074	0.0101	5008	,	,		13768	0.001		0.001	False		,,,				2504	0.0082																0																																										SO:0001628	intergenic_variant	8755																															14.37:g.106770443_106770444dupCT		Somatic		WXS	Illumina GAIIx	Phase_I		Splice_Site	INS		37																																																																																				0	0.520									
IGHV3-71	28411	broad.mit.edu	37	14	107183575	107183575	+	IGR	SNP	G	G	T	rs371950679		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:107183575G>T								IGHV2-70 (4237 upstream) : IGHV3-72 (15356 downstream)																							GCCCCTTCCCGGGAGCCTGGC	0.552																																																	0																																										SO:0001628	intergenic_variant	8755																															14.37:g.107183575G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.552									
IGHV3-71	28411	broad.mit.edu	37	14	107183594	107183594	+	IGR	SNP	C	C	T	rs376541486		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr14:107183594C>T								IGHV2-70 (4256 upstream) : IGHV3-72 (15337 downstream)																							GCGGACCCAGCTCATGTAGTA	0.582																																																	0																																										SO:0001628	intergenic_variant	8755																															14.37:g.107183594C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.582									
CADPS2	93664	broad.mit.edu	37	7	122303575	122303575	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr7:122303575A>C	ENST00000449022.2	-	3	521	c.502T>G	c.(502-504)Tgt>Ggt	p.C168G	CADPS2_ENST00000412584.2_Missense_Mutation_p.C168G|CADPS2_ENST00000313070.7_Missense_Mutation_p.C168G|CADPS2_ENST00000334010.7_Missense_Mutation_p.C168G	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	168					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.C168G(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						TTAGCAGAACACCCTCCACTC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											33.0	31.0	32.0					7																	122303575		1851	4110	5961	SO:0001583	missense	93664				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.502T>G	7.37:g.122303575A>C	ENSP00000398481:p.Cys168Gly	Somatic		WXS	Illumina GAIIx	Phase_I	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093183	0.76756	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.91290	0.7254	M	0.77313	2.365	0.80722	D	1	P;P	0.47106	0.696;0.89	B;B	0.43413	0.268;0.419	D	0.92551	0.6050	10	0.87932	D	0	-10.1063	15.1818	0.72965	1.0:0.0:0.0:0.0	.	168;168	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	G	168;168;168;135;168;168	ENSP00000325581:C168G;ENSP00000333940:C168G;ENSP00000400401:C168G;ENSP00000398481:C168G	ENSP00000325581:C168G	C	-	1	0	CADPS2	122090811	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.307000	0.96226	1.997000	0.58415	0.528000	0.53228	TGT		0.373	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2		NM_017954	
FAM174B	400451	broad.mit.edu	37	15	93198679	93198684	+	In_Frame_Del	DEL	TGGAGC	TGGAGC	-	rs66488707|rs111725167|rs68056278	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	TGGAGC	TGGAGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr15:93198679_93198684delTGGAGC	ENST00000327355.5	-	1	504_509	c.206_211delGCTCCA	c.(205-213)agctccaac>aac	p.SS69del	FAM174B_ENST00000555748.1_5'Flank|FAM174B_ENST00000555696.1_5'Flank	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	69						integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						CCACTGCTGTTGGAGCTGGAGCTGCC	0.714														4884	0.97524	0.9092	0.9942	5008	,	,		6551	1.0		1.0	False		,,,				2504	1.0																0										1931,417		927,77,170						2.2	1.0		dbSNP_130	8	5234,70		2614,6,32	no	coding	FAM174B	NM_207446.2		3541,83,202	A1A1,A1R,RR		1.3198,17.7598,6.3643				7165,487				SO:0001651	inframe_deletion	400451				CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.206_211delGCTCCA	15.37:g.93198685_93198690delTGGAGC	ENSP00000329040:p.Ser69_Ser70del	Somatic		WXS	Illumina GAIIx	Phase_I	Q3ZCR9|Q8NBH7	In_Frame_Del	DEL	ENST00000327355.5	37	CCDS45355.1																																																																																				0.714	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414931.1		NM_207446	
HIP1R	9026	broad.mit.edu	37	12	123343650	123343650	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr12:123343650A>G	ENST00000253083.4	+	22	2326	c.2201A>G	c.(2200-2202)gAg>gGg	p.E734G		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	734					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)	p.E734G(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		CGGGCTCTGGAGCTCATGGGG	0.682																																																	1	Substitution - Missense(1)	kidney(1)											10.0	12.0	11.0					12																	123343650		2186	4281	6467	SO:0001583	missense	9026			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.2201A>G	12.37:g.123343650A>G	ENSP00000253083:p.Glu734Gly	Somatic		WXS	Illumina GAIIx	Phase_I	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	ENST00000253083.4	37	CCDS31922.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.179560	0.38511	.	.	ENSG00000130787	ENST00000253083	T	0.14766	2.48	5.15	3.96	0.45880	.	0.286331	0.40554	N	0.001064	T	0.13543	0.0328	L	0.57536	1.79	0.32256	N	0.570789	B	0.10296	0.003	B	0.14578	0.011	T	0.09250	-1.0683	10	0.28530	T	0.3	-29.7105	7.9975	0.30277	0.8182:0.0:0.0:0.1818	.	734	O75146	HIP1R_HUMAN	G	734	ENSP00000253083:E734G	ENSP00000253083:E734G	E	+	2	0	HIP1R	121909603	0.992000	0.36948	1.000000	0.80357	0.862000	0.49288	1.998000	0.40796	0.760000	0.33108	0.459000	0.35465	GAG		0.682	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1		NM_003959	
IL9R	3581	broad.mit.edu	37	X	155239824	155239824	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chrX:155239824A>G	ENST00000244174.5	+	9	1495	c.1316A>G	c.(1315-1317)aAc>aGc	p.N439S	IL9R_ENST00000369423.2_3'UTR|IL9R_ENST00000424344.3_Missense_Mutation_p.N418S|IL9R_ENST00000540897.1_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	439	Poly-Asn.				cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.N439S(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					agcagcagcaacaacaacaAC	0.642													a|||	711	0.141973	0.0825	0.085	5008	,	,		13060	0.0883		0.1491	False		,,,				2504	0.3108																1	Substitution - Missense(1)	kidney(1)											7.0	14.0	12.0					X																	155239824		2081	4221	6302	SO:0001583	missense	3581			M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1316A>G	X.37:g.155239824A>G	ENSP00000244174:p.Asn439Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	a	1.685	-0.505533	0.04261	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.10192	2.9;2.9	.	.	.	.	3.894160	0.00911	N	0.002464	T	0.04634	0.0126	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27054	-1.0085	5	0.18710	T	0.47	.	.	.	.	.	439	Q01113	IL9R_HUMAN	S	439;418	ENSP00000244174:N439S;ENSP00000388918:N418S	ENSP00000244174:N439S	N	+	2	0	IL9R	154893018	0.003000	0.15002	0.007000	0.13788	0.007000	0.05969	-1.580000	0.02121	-1.735000	0.01353	-1.704000	0.00719	AAC		0.642	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1		NM_002186	
IL9R	3581	broad.mit.edu	37	X	155239827	155239827	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chrX:155239827A>G	ENST00000244174.5	+	9	1498	c.1319A>G	c.(1318-1320)aAc>aGc	p.N440S	IL9R_ENST00000369423.2_3'UTR|IL9R_ENST00000424344.3_Missense_Mutation_p.N419S|IL9R_ENST00000540897.1_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	440	Poly-Asn.				cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.N440S(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					agcagcaacaacaacaACTAC	0.642													a|||	523	0.104433	0.0136	0.0605	5008	,	,		13185	0.0298		0.1471	False		,,,				2504	0.2914																1	Substitution - Missense(1)	kidney(1)											7.0	13.0	11.0					X																	155239827		2072	4217	6289	SO:0001583	missense	3581			M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1319A>G	X.37:g.155239827A>G	ENSP00000244174:p.Asn440Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	a	0	-2.858724	0.00065	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.07908	3.16;3.15	.	.	.	.	12.144800	0.00166	N	0.000006	T	0.03827	0.0108	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33317	-0.9873	5	0.10636	T	0.68	.	.	.	.	.	440	Q01113	IL9R_HUMAN	S	440;419	ENSP00000244174:N440S;ENSP00000388918:N419S	ENSP00000244174:N440S	N	+	2	0	IL9R	154893021	0.004000	0.15560	0.007000	0.13788	0.007000	0.05969	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	AAC		0.642	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1		NM_002186	
INTS1	26173	broad.mit.edu	37	7	1538900	1538900	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr7:1538900A>G	ENST00000404767.3	-	7	1026	c.941T>C	c.(940-942)cTc>cCc	p.L314P	INTS1_ENST00000389470.4_Missense_Mutation_p.L442P|INTS1_ENST00000493531.1_5'Flank	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	314					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.L442P(1)		autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCTGGGCATGAGCTGGCCCTC	0.721																																																	1	Substitution - Missense(1)	kidney(1)											53.0	62.0	59.0					7																	1538900		2049	4184	6233	SO:0001583	missense	26173			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.941T>C	7.37:g.1538900A>G	ENSP00000385722:p.Leu314Pro	Somatic		WXS	Illumina GAIIx	Phase_I	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.810741	0.70797	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.49720	0.78;0.77	5.15	5.15	0.70609	.	0.275731	0.36444	N	0.002595	T	0.41971	0.1182	N	0.22421	0.69	0.80722	D	1	D;B	0.54397	0.966;0.016	P;B	0.47299	0.543;0.009	T	0.44667	-0.9313	10	0.62326	D	0.03	.	14.9513	0.71077	1.0:0.0:0.0:0.0	.	442;314	A4D212;Q8N201	.;INT1_HUMAN	P	314;442	ENSP00000385722:L314P;ENSP00000374121:L442P	ENSP00000374121:L442P	L	-	2	0	INTS1	1505426	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.865000	0.62998	1.927000	0.55829	0.460000	0.39030	CTC		0.721	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1			
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	TCGCTGTCGCCA	TCGCTGTCGCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374																2	Deletion - In frame(2)	large_intestine(1)|breast(1)								958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				SO:0001651	inframe_deletion	256949			AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic		WXS	Illumina GAIIx	Phase_I	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	ENST00000593649.1	37																																																																																					0.717	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1		NM_198471	
LOC344967	344967	broad.mit.edu	37	4	40045118	40045118	+	RNA	SNP	C	C	T	rs572536100		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr4:40045118C>T	ENST00000381811.2	-	0	1031					NR_027277.1																						AAGATCCCGGCGACCTCGTCC	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		20325	0.0		0.001	False		,,,				2504	0.0																0																																												344967																															4.37:g.40045118C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000381811.2	37																																																																																					0.552	RP11-333E13.4-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000361278.1			
MUC4	4585	broad.mit.edu	37	3	195511525	195511525	+	Missense_Mutation	SNP	T	T	C	rs199709753	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr3:195511525T>C	ENST00000463781.3	-	2	7385	c.6926A>G	c.(6925-6927)gAc>gGc	p.D2309G	MUC4_ENST00000475231.1_Missense_Mutation_p.D2309G|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D2309G(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGCGTCGGTGACATG	0.582													.|||	2463	0.491813	0.3918	0.4395	5008	,	,		11046	0.6597		0.5189	False		,,,				2504	0.4632																2	Substitution - Missense(2)	kidney(2)											4.0	5.0	5.0					3																	195511525		452	1186	1638	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6926A>G	3.37:g.195511525T>C	ENSP00000417498:p.Asp2309Gly	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	4.776	0.144295	0.09134	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.46;1.46	.	.	.	.	0.310550	0.14023	U	0.346674	T	0.13415	0.0325	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.01281	0.0	T	0.21621	-1.0240	8	.	.	.	.	1.4093	0.02287	0.3443:0.325:0.0:0.3307	.	2309	E7ESK3	.	G	2309	ENSP00000417498:D2309G;ENSP00000420243:D2309G	.	D	-	2	0	MUC4	196995920	0.000000	0.05858	0.003000	0.11579	0.070000	0.16714	-0.353000	0.07691	-0.423000	0.07394	0.055000	0.15244	GAC		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
PCDHA5	56143	broad.mit.edu	37	5	140202962	140202962	+	Silent	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr5:140202962G>A	ENST00000529859.1	+	1	1602	c.1602G>A	c.(1600-1602)gtG>gtA	p.V534V	PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Silent_p.V534V|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000378126.3_Silent_p.V534V|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	534	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V534V(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTCCAGGTGAGCGCGCGCG	0.687																																																	2	Substitution - coding silent(2)	kidney(2)											46.0	53.0	51.0					5																	140202962		2203	4298	6501	SO:0001819	synonymous_variant	56143			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1602G>A	5.37:g.140202962G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O75284|Q8N4R3	Silent	SNP	ENST00000529859.1	37	CCDS54917.1																																																																																				0.687	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2		NM_018908	
PRB1	5542	broad.mit.edu	37	12	11506356	11506356	+	Intron	SNP	G	G	A	rs201055825	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr12:11506356G>A	ENST00000500254.2	-	4	351				PRB1_ENST00000545626.1_Intron|PRB1_ENST00000546254.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGCTGGTTGCCTCCTTGTG	0.607																																																	0													69.0	68.0	68.0					12																	11506356		1929	4083	6012	SO:0001627	intron_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.314-32C>T	12.37:g.11506356G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Silent	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																				0.607	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1		NM_005039	
SCAF1	58506	broad.mit.edu	37	19	50154204	50154204	+	Silent	SNP	A	A	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:50154204A>C	ENST00000360565.3	+	7	682	c.558A>C	c.(556-558)ccA>ccC	p.P186P		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	186	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)	p.P186P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		Gccctgccccaccccctgccc	0.682																																																	1	Substitution - coding silent(1)	kidney(1)											23.0	19.0	20.0					19																	50154204		2202	4297	6499	SO:0001819	synonymous_variant	58506			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.558A>C	19.37:g.50154204A>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z5V7|Q8WVA1|Q9NR59	Silent	SNP	ENST00000360565.3	37	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	a	10.60	1.395298	0.25205	.	.	ENSG00000126461	ENST00000447618	.	.	.	4.92	-2.78	0.05859	.	.	.	.	.	T	0.38427	0.1040	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31194	-0.9952	4	.	.	.	-2.0478	1.067	0.01613	0.3126:0.1239:0.3208:0.2427	.	.	.	.	P	186	.	.	T	+	1	0	SCAF1	54846016	0.000000	0.05858	0.983000	0.44433	0.940000	0.58332	-2.801000	0.00761	-0.570000	0.06022	0.525000	0.51046	ACC		0.682	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1		NM_021228	
SNAPC4	6621	broad.mit.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	GCT	-	rs147271628|rs34427285|rs35266724|rs34222232	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr9:139277995_139277997delGCT	ENST00000298532.2	-	15	1992_1994	c.1624_1626delAGC	c.(1624-1626)agcdel	p.S542del		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa									p.S542delS(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTCCTCCTCgctgctgctgctg	0.69														955	0.190695	0.1808	0.3184	5008	,	,		11493	0.0565		0.2356	False		,,,				2504	0.2055																2	Deletion - In frame(2)	prostate(1)|central_nervous_system(1)																																								SO:0001651	inframe_deletion	6621			AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.1624_1626delAGC	9.37:g.139278004_139278006delGCT	ENSP00000298532:p.Ser542del	Somatic		WXS	Illumina GAIIx	Phase_I		In_Frame_Del	DEL	ENST00000298532.2	37	CCDS6998.1																																																																																				0.690	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1		NM_003086	
ST6GALNAC5	81849	broad.mit.edu	37	1	77334292	77334293	+	In_Frame_Ins	INS	-	-	CAGCAA	rs60179124|rs201548881|rs62637703	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr1:77334292_77334293insCAGCAA	ENST00000477717.1	+	2	361_362	c.126_127insCAGCAA	c.(127-129)cag>CAGCAAcag	p.43_43Q>QQQ	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	43	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						agcagcagcagcagcagcaaca	0.713														341	0.0680911	0.2216	0.0288	5008	,	,		11798	0.0		0.0258	False		,,,				2504	0.002																0										818,37,3099		139,15,525,4,14,1280						2.2	1.0		dbSNP_129	13	373,14,7183		30,0,313,2,10,3430	no	codingComplex	ST6GALNAC5	NM_030965.1		169,15,838,6,24,4710	A1A1,A1A2,A1R,A2A2,A2R,RR		5.1123,21.6237,10.7775				1191,51,10282				SO:0001652	inframe_insertion	81849				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	Exception_encountered	1.37:g.77334292_77334293insCAGCAA	ENSP00000417583:p.GlnGln49dup	Somatic		WXS	Illumina GAIIx	Phase_I	B1AK82	In_Frame_Ins	INS	ENST00000477717.1	37	CCDS673.1																																																																																				0.713	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2		NM_030965	
TCF19	6941	broad.mit.edu	37	6	31127384	31127384	+	Silent	SNP	C	C	T			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr6:31127384C>T	ENST00000376257.3	+	2	892	c.138C>T	c.(136-138)ccC>ccT	p.P46P	CCHCR1_ENST00000480060.1_5'Flank|CCHCR1_ENST00000396263.2_5'Flank|CCHCR1_ENST00000451521.2_5'Flank|TCF19_ENST00000376255.4_Silent_p.P46P|CCHCR1_ENST00000376266.5_5'Flank|CCHCR1_ENST00000396268.3_5'Flank	NM_007109.2	NP_009040.2	Q9Y242	TCF19_HUMAN	transcription factor 19	46	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				cell proliferation (GO:0008283)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P46P(1)		kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						CCCTGCGGCCCCAGCAGGAGC	0.682																																																	1	Substitution - coding silent(1)	kidney(1)											24.0	27.0	26.0					6																	31127384		1945	4130	6075	SO:0001819	synonymous_variant	6941			U25826	CCDS43446.1	6p21.3	2013-01-28	2009-02-05		ENSG00000137310	ENSG00000137310		"""Zinc fingers, PHD-type"""	11629	protein-coding gene	gene with protein product		600912				1868030, 8595903	Standard	NM_001077511		Approved	SC1	uc003nss.3	Q9Y242	OTTHUMG00000031274	ENST00000376257.3:c.138C>T	6.37:g.31127384C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NCT8|B0UY11|Q0EFA8|Q13176|Q15967|Q5SQ89|Q5STD6|Q5STF5|Q9BUM2|Q9UBH7	Silent	SNP	ENST00000376257.3	37	CCDS43446.1																																																																																				0.682	TCF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076595.2		NM_007109	
ROCK1P1	727758	broad.mit.edu	37	18	109344	109344	+	RNA	SNP	T	T	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr18:109344T>C	ENST00000608049.1	+	0	280					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		aggctttgcctacaggggaca	0.483																																																	0																																												0					18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.109344T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000608049.1	37																																																																																					0.483	ROCK1P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000472417.1			
MIR4477B	100616194	broad.mit.edu	37	9	68413585	68413585	+	RNA	SNP	G	G	T	rs145928615		TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr9:68413585G>T	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		ATCTAGGAAAGGTTGTGCCTT	0.597																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68413585G>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000581659.1	37																																																																																					0.597	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
USHBP1	83878	broad.mit.edu	37	19	17373404	17373404	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:17373404G>A	ENST00000252597.3	-	4	772	c.599C>T	c.(598-600)tCc>tTc	p.S200F	USHBP1_ENST00000598570.1_5'UTR|USHBP1_ENST00000431146.2_Missense_Mutation_p.S136F	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.S200F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						GGCCTCCAGGGAGGCCTGCGT	0.667																																																	1	Substitution - Missense(1)	kidney(1)											43.0	41.0	42.0					19																	17373404		2202	4299	6501	SO:0001583	missense	83878			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.599C>T	19.37:g.17373404G>A	ENSP00000252597:p.Ser200Phe	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000252597.3	37	CCDS12353.1	.	.	.	.	.	.	.	.	.	.	G	8.585	0.883273	0.17467	.	.	ENSG00000130307	ENST00000252597;ENST00000431146;ENST00000324554	T;T	0.25085	1.84;1.82	3.61	1.29	0.21616	.	0.679258	0.13392	N	0.391298	T	0.15349	0.0370	N	0.20986	0.625	0.09310	N	0.999996	B;B;B	0.15930	0.005;0.015;0.005	B;B;B	0.14578	0.007;0.011;0.007	T	0.21449	-1.0245	10	0.52906	T	0.07	-5.0796	5.7933	0.18373	0.1105:0.0:0.6987:0.1908	.	136;200;200	B4DUE8;Q8N8Y1;Q8N6Y0	.;.;USBP1_HUMAN	F	200;136;200	ENSP00000252597:S200F;ENSP00000407902:S136F	ENSP00000252597:S200F	S	-	2	0	USHBP1	17234404	0.204000	0.23447	0.018000	0.16275	0.646000	0.38490	2.306000	0.43673	0.139000	0.18822	0.313000	0.20887	TCC		0.667	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1		NM_031941	
WASH3P	374666	broad.mit.edu	37	15	102516350	102516350	+	RNA	SNP	G	G	A	rs62028685	byFrequency	TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr15:102516350G>A	ENST00000557932.1	+	0	1298				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G425R(2)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						CTCTGGGAAAGGACCTGGGGC	0.622																																																	2	Substitution - Missense(2)	urinary_tract(1)|kidney(1)																																										374666					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516350G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000557932.1	37		.	.	.	.	.	.	.	.	.	.	g	11.76	1.734997	0.30774	.	.	ENSG00000185596	ENST00000398121;ENST00000378819	.	.	.	0.906	0.906	0.19314	.	0.057886	0.64402	D	0.000001	T	0.37461	0.1004	.	.	.	0.38637	D	0.951517	.	.	.	.	.	.	T	0.38866	-0.9641	4	.	.	.	-6.1676	5.193	0.15220	0.0:0.0:1.0:0.0	.	.	.	.	R	425;320	.	.	G	+	1	0	WASH3P	100333873	1.000000	0.71417	0.848000	0.33437	0.551000	0.35334	7.617000	0.83032	0.793000	0.33875	0.184000	0.17185	GGA		0.622	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1		NM_199163	
ZNF98	148198	broad.mit.edu	37	19	22574754	22574754	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr19:22574754T>G	ENST00000357774.5	-	4	1404	c.1283A>C	c.(1282-1284)cAt>cCt	p.H428P		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H428P(2)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CTCTCCAGTATGAATTCTCTT	0.378																																																	2	Substitution - Missense(2)	kidney(2)											11.0	12.0	12.0					19																	22574754		1404	3312	4716	SO:0001583	missense	148198				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1283A>C	19.37:g.22574754T>G	ENSP00000350418:p.His428Pro	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	13.39	2.223916	0.39300	.	.	ENSG00000197360	ENST00000357774	T	0.67698	-0.28	1.26	1.26	0.21427	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85314	0.5668	H	0.97540	4.025	0.32855	D	0.507176	D	0.71674	0.998	D	0.77557	0.99	D	0.85251	0.1044	9	0.87932	D	0	.	7.4008	0.26962	0.0:0.0:0.0:1.0	.	428	A6NK75	ZNF98_HUMAN	P	428	ENSP00000350418:H428P	ENSP00000350418:H428P	H	-	2	0	ZNF98	22366594	1.000000	0.71417	0.001000	0.08648	0.007000	0.05969	3.874000	0.56101	0.557000	0.29117	0.240000	0.17902	CAT		0.378	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1		NM_001098626	
PPIL4	85313	broad.mit.edu	37	6	149855820	149855820	+	Silent	SNP	T	T	C			TCGA-BP-4167-01A-02D-1386-10	TCGA-BP-4167-11A-01D-1251-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	79b810e1-4de4-496d-9f70-ab62246e781b	be250c13-93c8-4e95-b0b9-c6a4fce00090	g.chr6:149855820T>C	ENST00000253329.2	-	6	587	c.555A>G	c.(553-555)caA>caG	p.Q185Q		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	185					protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)	p.Q185Q(1)		endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		TTACATCTAATTGTTCCCTTG	0.303																																						.											1	Substitution - coding silent(1)	kidney(1)											101.0	101.0	101.0					6																	149855820		2203	4298	6501	SO:0001819	synonymous_variant	85313				CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.555A>G	6.37:g.149855820T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RD34|Q7Z3Q5	Silent	SNP	ENST00000253329.2	37	CCDS34550.1																																																																																				0.303	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042642.1			
