#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ANO2	57101	hgsc.bcm.edu;ucsc.edu	37	12	5744453	5744453	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr12:5744453C>T	ENST00000356134.5	-	18	1755	c.1684G>A	c.(1684-1686)Gct>Act	p.A562T	ANO2_ENST00000546188.1_Missense_Mutation_p.A562T|ANO2_ENST00000538154.1_5'Flank|ANO2_ENST00000327087.8_Missense_Mutation_p.A561T	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	566					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.A562T(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						AGAGACAGAGCGGCTGCAGTT	0.493																																																	1	Substitution - Missense(1)	large_intestine(1)											102.0	101.0	101.0					12																	5744453		2041	4191	6232	SO:0001583	missense	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1684G>A	12.37:g.5744453C>T	ENSP00000348453:p.Ala562Thr	Somatic		WXS	SOLID	Phase_I	C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37		.	.	.	.	.	.	.	.	.	.	C	34	5.298869	0.95574	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277;ENST00000545860	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.26	5.26	0.73747	.	0.176574	0.50627	D	0.000103	T	0.68201	0.2975	L	0.45352	1.415	0.80722	D	1	D	0.67145	0.996	P	0.57468	0.821	T	0.62329	-0.6877	10	0.24483	T	0.36	.	18.1054	0.89518	0.0:1.0:0.0:0.0	.	561	Q9NQ90-3	.	T	561;562;562;566;121	ENSP00000314048:A561T;ENSP00000348453:A562T;ENSP00000440981:A562T;ENSP00000443813:A121T	ENSP00000314048:A561T	A	-	1	0	ANO2	5614714	0.699000	0.27786	0.999000	0.59377	0.966000	0.64601	1.203000	0.32284	2.754000	0.94517	0.545000	0.68477	GCT		0.493	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4		NM_020373	
ARHGAP21	57584	hgsc.bcm.edu;ucsc.edu	37	10	24886905	24886905	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr10:24886905G>A	ENST00000396432.2	-	15	3652	c.3166C>T	c.(3166-3168)Cga>Tga	p.R1056*	ARHGAP21_ENST00000493154.1_5'UTR|ARHGAP21_ENST00000320481.6_Nonsense_Mutation_p.R843*	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1055	Interaction with ARF1 and ARF6.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.R1055*(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TTTATTCTTCGACTAATTAGA	0.338																																																	1	Substitution - Nonsense(1)	lung(1)											180.0	170.0	173.0					10																	24886905		2203	4300	6503	SO:0001587	stop_gained	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3166C>T	10.37:g.24886905G>A	ENSP00000379709:p.Arg1056*	Somatic		WXS	SOLID	Phase_I	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Nonsense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	G	45	11.298239	0.99543	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	.	.	.	5.87	5.87	0.94306	.	0.172159	0.48286	D	0.000186	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3178	0.74095	0.0:0.0:0.8602:0.1398	.	.	.	.	X	1056;843;1046;1056;891	.	ENSP00000365604:R843X	R	-	1	2	ARHGAP21	24926911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.697000	0.54764	2.941000	0.99782	0.655000	0.94253	CGA		0.338	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4		NM_020824	
ASAP1	50807	hgsc.bcm.edu;ucsc.edu	37	8	131130417	131130417	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr8:131130417C>A	ENST00000518721.1	-	20	2097	c.1870G>T	c.(1870-1872)Gta>Tta	p.V624L	ASAP1_ENST00000357668.1_Missense_Mutation_p.V624L	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	624					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CAGTTTTGTACAAGGAAGTCA	0.418																																																	0													73.0	72.0	72.0					8																	131130417		2203	4300	6503	SO:0001583	missense	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1870G>T	8.37:g.131130417C>A	ENSP00000429900:p.Val624Leu	Somatic		WXS	SOLID	Phase_I	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.79|18.79	3.698249|3.698249	0.68386|0.68386	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000524124;ENST00000519483|ENST00000343135;ENST00000357668;ENST00000518721	.|T;T	.|0.58652	.|0.32;0.32	5.6|5.6	5.6|5.6	0.85130|0.85130	.|Ankyrin repeat-containing domain (4);	.|0.131736	.|0.51477	.|D	.|0.000091	T|T	0.34048|0.34048	0.0884|0.0884	N|N	0.01464|0.01464	-0.85|-0.85	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.37038	.|0.579;0.579;0.524	.|B;B;B	.|0.35312	.|0.2;0.2;0.081	T|T	0.51934|0.51934	-0.8642|-0.8642	5|10	.|0.72032	.|D	.|0.01	.|.	18.2004|18.2004	0.89836|0.89836	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|624;624;627	.|B2RNV3;Q9ULH1;Q9ULH1-2	.|.;ASAP1_HUMAN;.	F|L	444;37|627;624;624	.|ENSP00000350297:V624L;ENSP00000429900:V624L	.|ENSP00000344591:V627L	C|V	-|-	2|1	0|0	ASAP1|ASAP1	131199599|131199599	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.799000|0.799000	0.45148|0.45148	5.733000|5.733000	0.68571|0.68571	2.635000|2.635000	0.89317|0.89317	0.650000|0.650000	0.86243|0.86243	TGT|GTA		0.418	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1		NM_018482	
ATP6V1C2	245973	hgsc.bcm.edu;ucsc.edu	37	2	10923347	10923347	+	Silent	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:10923347T>C	ENST00000272238.4	+	14	1351	c.1242T>C	c.(1240-1242)ttT>ttC	p.F414F	ATP6V1C2_ENST00000381661.3_Silent_p.F368F	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	414					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		AAGACTATTTTCCTTATGTCT	0.423																																					NSCLC(188;1042 2136 10807 16813 47705)												0													180.0	163.0	169.0					2																	10923347		2203	4300	6503	SO:0001819	synonymous_variant	245973			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.1242T>C	2.37:g.10923347T>C		Somatic		WXS	SOLID	Phase_I	Q96EL8	Silent	SNP	ENST00000272238.4	37	CCDS42653.1																																																																																				0.423	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1		NM_144583	
C1RL	51279	hgsc.bcm.edu	37	12	7249550	7249550	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr12:7249550C>A	ENST00000266542.4	-	6	993	c.901G>T	c.(901-903)Gtg>Ttg	p.V301L	C1RL_ENST00000504702.2_Intron|C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_3'UTR	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	301	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCCAAGAACACATTCACACTC	0.577																																																	0													194.0	146.0	162.0					12																	7249550		2203	4300	6503	SO:0001583	missense	51279			AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.901G>T	12.37:g.7249550C>A	ENSP00000266542:p.Val301Leu	Somatic		WXS	SOLID	Phase_I	Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	37	CCDS8573.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.26|17.26	3.343677|3.343677	0.61073|0.61073	.|.	.|.	ENSG00000139178|ENSG00000139178	ENST00000534950|ENST00000266542;ENST00000396661	.|T	.|0.56776	.|0.44	4.98|4.98	4.98|4.98	0.66077|0.66077	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.|0.091789	.|0.46145	.|D	.|0.000317	T|T	0.68293|0.68293	0.2985|0.2985	M|M	0.81239|0.81239	2.535|2.535	0.80722|0.80722	D|D	1|1	.|P	.|0.51057	.|0.941	.|P	.|0.60345	.|0.873	T|T	0.68530|0.68530	-0.5384|-0.5384	5|10	.|0.40728	.|T	.|0.16	.|.	11.343|11.343	0.49543|0.49543	0.0:0.9125:0.0:0.0875|0.0:0.9125:0.0:0.0875	.|.	.|301	.|Q9NZP8	.|C1RL_HUMAN	F|L	133|301	.|ENSP00000266542:V301L	.|ENSP00000266542:V301L	C|V	-|-	2|1	0|0	C1RL|C1RL	7140692|7140692	0.975000|0.975000	0.34042|0.34042	0.947000|0.947000	0.38551|0.38551	0.365000|0.365000	0.29674|0.29674	2.823000|2.823000	0.48081|0.48081	2.595000|2.595000	0.87683|0.87683	0.511000|0.511000	0.50034|0.50034	TGT|GTG		0.577	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1		NM_016546	
CAD	790	hgsc.bcm.edu;ucsc.edu	37	2	27449432	27449432	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:27449432T>C	ENST00000403525.1	+	13	2026	c.1882T>C	c.(1882-1884)Tct>Cct	p.S628P	CAD_ENST00000264705.4_Missense_Mutation_p.S691P			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCTCGCAGCTCTGCCCTGGC	0.522																																																	0													88.0	91.0	90.0					2																	27449432		2203	4300	6503	SO:0001583	missense	790			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.1882T>C	2.37:g.27449432T>C	ENSP00000384510:p.Ser628Pro	Somatic		WXS	SOLID	Phase_I	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	T	18.72	3.684113	0.68157	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97731	-4.51;-4.51	5.06	5.06	0.68205	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Carbamoyl-phosphate synthase, large subunit, CPS-domain (1);	0.058749	0.64402	N	0.000001	D	0.99336	0.9767	H	0.99650	4.68	0.80722	D	1	D;B	0.89917	1.0;0.035	D;B	0.97110	1.0;0.008	D	0.98145	1.0438	10	0.87932	D	0	-10.5088	12.227	0.54465	0.0:0.0:0.0:1.0	.	628;691	F8VPD4;P27708	.;PYR1_HUMAN	P	691;628	ENSP00000264705:S691P;ENSP00000384510:S628P	ENSP00000264705:S691P	S	+	1	0	CAD	27302936	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.628000	0.83189	1.911000	0.55334	0.397000	0.26171	TCT		0.522	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			
CAPN6	827	hgsc.bcm.edu	37	X	110494190	110494190	+	Silent	SNP	T	T	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:110494190T>G	ENST00000324068.1	-	8	1280	c.1113A>C	c.(1111-1113)tcA>tcC	p.S371S	CAPN6_ENST00000541758.1_Silent_p.S116S	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	371	Domain III.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						AGCAGCCTCCTGAGCGGTTCA	0.473																																																	0													256.0	231.0	239.0					X																	110494190		2203	4300	6503	SO:0001819	synonymous_variant	827			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1113A>C	X.37:g.110494190T>G		Somatic		WXS	SOLID	Phase_I	D3DUY7|Q9UEQ1|Q9UJA8	Silent	SNP	ENST00000324068.1	37	CCDS14555.1																																																																																				0.473	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1			
CCDC108	255101	hgsc.bcm.edu	37	2	219875351	219875351	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:219875351T>A	ENST00000341552.5	-	26	4308	c.4225A>T	c.(4225-4227)Atg>Ttg	p.M1409L	CCDC108_ENST00000453220.1_Missense_Mutation_p.M1409L|AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000441968.1_Missense_Mutation_p.M1409L	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1409						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCCCATCATATGGGGGTTG	0.592																																																	0													73.0	57.0	62.0					2																	219875351		2202	4300	6502	SO:0001583	missense	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4225A>T	2.37:g.219875351T>A	ENSP00000340776:p.Met1409Leu	Somatic		WXS	SOLID	Phase_I	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	T	8.303	0.820419	0.16678	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04603	3.59;3.59;3.59	5.05	-3.65	0.04502	.	1.341560	0.05196	N	0.504056	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47129	-0.9141	10	0.15499	T	0.54	-8.9879	13.2473	0.60029	0.0:0.4225:0.0:0.5775	.	1409	Q6ZU64	CC108_HUMAN	L	1409	ENSP00000340776:M1409L;ENSP00000413377:M1409L;ENSP00000409117:M1409L	ENSP00000340776:M1409L	M	-	1	0	CCDC108	219583595	0.000000	0.05858	0.001000	0.08648	0.607000	0.37147	-1.753000	0.01818	-0.674000	0.05253	-0.375000	0.07067	ATG		0.592	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4		NM_194302	
COCH	1690	hgsc.bcm.edu;ucsc.edu	37	14	31348659	31348659	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr14:31348659G>A	ENST00000396618.3	+	6	460	c.404G>A	c.(403-405)gGa>gAa	p.G135E	COCH_ENST00000460581.2_Missense_Mutation_p.G23E|COCH_ENST00000216361.4_Missense_Mutation_p.G135E|COCH_ENST00000475087.1_Missense_Mutation_p.G135E|COCH_ENST00000382493.4_5'Flank|RP11-829H16.3_ENST00000555108.1_RNA	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	135			G -> R (in dbSNP:rs28400035). {ECO:0000269|Ref.4}.		defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		GAGGCCACAGGACAAGCAGTG	0.378																																																	0													94.0	87.0	89.0					14																	31348659		2203	4300	6503	SO:0001583	missense	1690				CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.404G>A	14.37:g.31348659G>A	ENSP00000379862:p.Gly135Glu	Somatic		WXS	SOLID	Phase_I	A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	ENST00000396618.3	37	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.151193	0.78001	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000556908;ENST00000460581;ENST00000542225	T;T;T;T;T	0.77877	-0.09;-0.09;-0.09;-1.13;0.04	5.74	5.74	0.90152	.	0.607497	0.18102	N	0.151652	T	0.68732	0.3033	L	0.27053	0.805	0.80722	D	1	D;B	0.54047	0.964;0.421	P;B	0.47118	0.538;0.05	T	0.64283	-0.6444	10	0.07482	T	0.82	-8.6384	14.2181	0.65807	0.0:0.1491:0.8509:0.0	.	135;135	Q96IU6;O43405	.;COCH_HUMAN	E	135;135;135;119;23;23	ENSP00000216361:G135E;ENSP00000379862:G135E;ENSP00000451528:G135E;ENSP00000452541:G119E;ENSP00000451713:G23E	ENSP00000216361:G135E	G	+	2	0	COCH	30418410	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	4.172000	0.58243	2.702000	0.92279	0.591000	0.81541	GGA		0.378	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1		NM_004086	
COL20A1	57642	hgsc.bcm.edu	37	20	61929274	61929274	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr20:61929274T>A	ENST00000358894.6	+	3	195	c.95T>A	c.(94-96)cTg>cAg	p.L32Q	COL20A1_ENST00000326996.6_Missense_Mutation_p.L32Q|COL20A1_ENST00000435874.1_Missense_Mutation_p.L32Q|COL20A1_ENST00000422202.1_Missense_Mutation_p.L32Q	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	32	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					AGCGGTCTCCTGAGGCTGGCT	0.622																																																	0													41.0	50.0	47.0					20																	61929274		2033	4181	6214	SO:0001583	missense	57642			BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.95T>A	20.37:g.61929274T>A	ENSP00000351767:p.Leu32Gln	Somatic		WXS	SOLID	Phase_I	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.554546	0.45487	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	D;D;D;D	0.92495	-2.92;-2.97;-3.05;-3.05	3.79	3.79	0.43588	Fibronectin, type III (3);	0.094859	0.44285	U	0.000469	D	0.92795	0.7709	L	0.34521	1.04	0.39522	D	0.968526	D	0.89917	1.0	D	0.76071	0.987	D	0.93632	0.6957	10	0.87932	D	0	.	12.2287	0.54476	0.0:0.0:0.0:1.0	.	32	Q9P218	COKA1_HUMAN	Q	32	ENSP00000351767:L32Q;ENSP00000323077:L32Q;ENSP00000408690:L32Q;ENSP00000414753:L32Q	ENSP00000323077:L32Q	L	+	2	0	COL20A1	61399719	.	.	0.972000	0.41901	0.034000	0.12701	.	.	1.367000	0.46095	0.383000	0.25322	CTG		0.622	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2		NM_020882	
CPAMD8	27151	hgsc.bcm.edu;ucsc.edu	37	19	17068709	17068709	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr19:17068709T>C	ENST00000443236.1	-	19	2402	c.2371A>G	c.(2371-2373)Agg>Ggg	p.R791G	CPAMD8_ENST00000388925.4_3'UTR	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	744						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						AAGAAAGTCCTTTTTCTCTTC	0.368																																																	0													190.0	179.0	182.0					19																	17068709		1883	4119	6002	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2371A>G	19.37:g.17068709T>C	ENSP00000402505:p.Arg791Gly	Somatic		WXS	SOLID	Phase_I	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.150313	0.57151	.	.	ENSG00000160111	ENST00000291440	.	.	.	3.3	3.3	0.37823	.	0.000000	0.64402	U	0.000001	T	0.76292	0.3967	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.78934	-0.2008	9	0.87932	D	0	.	11.7346	0.51757	0.0:0.0:0.0:1.0	.	744	Q8IZJ3	CPMD8_HUMAN	G	791	.	ENSP00000291440:R791G	R	-	1	2	CPAMD8	16929709	1.000000	0.71417	0.997000	0.53966	0.785000	0.44390	2.867000	0.48428	1.180000	0.42898	0.477000	0.44152	AGG		0.368	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2		NM_015692	
CWC25	54883	hgsc.bcm.edu;ucsc.edu	37	17	36959026	36959026	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr17:36959026T>C	ENST00000225428.5	-	9	1387	c.1090A>G	c.(1090-1092)Aag>Gag	p.K364E	PIP4K2B_ENST00000269554.3_5'Flank|CWC25_ENST00000536127.1_Missense_Mutation_p.K301E	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	364										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						GCATGCCTCTTGAGGATGTTC	0.517																																																	0													196.0	200.0	199.0					17																	36959026		2011	4177	6188	SO:0001583	missense	54883			AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.1090A>G	17.37:g.36959026T>C	ENSP00000225428:p.Lys364Glu	Somatic		WXS	SOLID	Phase_I	A0JLM3|Q68DK5	Missense_Mutation	SNP	ENST00000225428.5	37	CCDS45663.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.321099	0.41096	.	.	ENSG00000108296	ENST00000225428;ENST00000536127	.	.	.	5.71	2.18	0.27775	.	0.291903	0.42548	N	0.000688	T	0.48277	0.1491	M	0.63843	1.955	0.40942	D	0.984474	B;B	0.24258	0.1;0.1	B;B	0.23852	0.049;0.03	T	0.28586	-1.0039	9	0.21014	T	0.42	.	7.2386	0.26084	0.0:0.0726:0.2768:0.6505	.	301;364	B4DJK2;Q9NXE8	.;CWC25_HUMAN	E	364;301	.	ENSP00000225428:K364E	K	-	1	0	CWC25	34212552	0.990000	0.36364	0.773000	0.31616	0.423000	0.31445	0.705000	0.25675	0.086000	0.17137	0.533000	0.62120	AAG		0.517	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6		NM_017748	
CYLC1	1538	hgsc.bcm.edu;ucsc.edu	37	X	83128851	83128851	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:83128851G>A	ENST00000329312.4	+	4	1172	c.1135G>A	c.(1135-1137)Gat>Aat	p.D379N		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	379					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AGATGCAAAGGATGCAAGAAA	0.323																																																	0													33.0	29.0	30.0					X																	83128851		2192	4290	6482	SO:0001583	missense	1538			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1135G>A	X.37:g.83128851G>A	ENSP00000331556:p.Asp379Asn	Somatic		WXS	SOLID	Phase_I	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	0.089	-1.170628	0.01660	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.27720	1.65	3.94	1.38	0.22167	.	.	.	.	.	T	0.16557	0.0398	N	0.16903	0.455	0.09310	N	1	B;B	0.19331	0.035;0.017	B;B	0.14023	0.01;0.007	T	0.21280	-1.0250	9	0.40728	T	0.16	.	5.2548	0.15542	0.3929:0.0:0.6071:0.0	.	379;379	P35663;F5H4V5	CYLC1_HUMAN;.	N	379	ENSP00000331556:D379N	ENSP00000331556:D379N	D	+	1	0	CYLC1	83015507	0.350000	0.24878	0.004000	0.12327	0.020000	0.10135	0.559000	0.23485	0.268000	0.21939	0.600000	0.82982	GAT		0.323	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1		NM_021118	
DHX37	57647	hgsc.bcm.edu;ucsc.edu	37	12	125435249	125435249	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr12:125435249C>G	ENST00000308736.2	-	22	3068	c.2970G>C	c.(2968-2970)aaG>aaC	p.K990N	DHX37_ENST00000544745.1_Missense_Mutation_p.K777N	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	990							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TCATGTACATCTTAGTGGTCT	0.607																																																	0													67.0	68.0	68.0					12																	125435249		2203	4300	6503	SO:0001583	missense	57647			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2970G>C	12.37:g.125435249C>G	ENSP00000311135:p.Lys990Asn	Somatic		WXS	SOLID	Phase_I	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300107	0.60195	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.04234	3.73;3.67	5.26	4.37	0.52481	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.24661	0.0598	M	0.90977	3.165	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.01613	-1.1312	10	0.87932	D	0	-14.958	8.4808	0.33040	0.0:0.7103:0.0:0.2897	.	777;990	F5H3Y4;Q8IY37	.;DHX37_HUMAN	N	990;777	ENSP00000311135:K990N;ENSP00000439009:K777N	ENSP00000311135:K990N	K	-	3	2	DHX37	124001202	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	0.828000	0.27435	1.218000	0.43458	0.561000	0.74099	AAG		0.607	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_032656	
DUOX1	53905	hgsc.bcm.edu	37	15	45436426	45436426	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr15:45436426A>G	ENST00000321429.4	+	18	2536	c.2129A>G	c.(2128-2130)tAt>tGt	p.Y710C	DUOX1_ENST00000389037.3_Missense_Mutation_p.Y710C|DUOX1_ENST00000561166.1_Missense_Mutation_p.Y356C	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	710					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCCAAGGAGTATGACCTGGTA	0.617																																																	0													74.0	57.0	63.0					15																	45436426		2198	4298	6496	SO:0001583	missense	53905			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2129A>G	15.37:g.45436426A>G	ENSP00000317997:p.Tyr710Cys	Somatic		WXS	SOLID	Phase_I	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.682673	0.68157	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.87571	-2.27;-2.27	4.78	4.78	0.61160	.	0.271361	0.38492	N	0.001675	D	0.91935	0.7446	M	0.69358	2.11	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	D	0.92617	0.6104	10	0.87932	D	0	-13.4924	12.5745	0.56355	1.0:0.0:0.0:0.0	.	710	Q9NRD9	DUOX1_HUMAN	C	710	ENSP00000317997:Y710C;ENSP00000373689:Y710C	ENSP00000317997:Y710C	Y	+	2	0	DUOX1	43223718	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.892000	0.75644	2.126000	0.65437	0.533000	0.62120	TAT		0.617	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1		NM_017434	
EPDR1	54749	hgsc.bcm.edu	37	7	37960275	37960275	+	5'UTR	SNP	C	C	A	rs201513905|rs62443108|rs76859517	byFrequency	TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr7:37960275C>A	ENST00000199448.4	+	0	113				EPDR1_ENST00000559325.1_Missense_Mutation_p.Q32K|EPDR1_ENST00000423717.1_5'UTR|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A36fs*79(3)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GCAGTGGCAGCAGGCAGTGGC	0.637																																																	3	Deletion - Frameshift(3)	urinary_tract(1)|ovary(1)|breast(1)											19.0	20.0	20.0					7																	37960275		2203	4300	6503	SO:0001623	5_prime_UTR_variant	54749			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-267C>A	7.37:g.37960275C>A		Somatic		WXS	SOLID	Phase_I	A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	ENST00000199448.4	37	CCDS5454.2	188	0.08608058608058608	8	0.016260162601626018	32	0.08839779005524862	36	0.06293706293706294	112	0.14775725593667546	C	7.882	0.730413	0.15507	.	.	ENSG00000086289	ENST00000199448;ENST00000423717	.	.	.	.	.	.	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.19300	N	0.999978	.	.	.	.	.	.	T	0.19976	-1.0289	4	0.54805	T	0.06	.	.	.	.	rs62443108	32	A4D1W8	.	K	32;6	.	ENSP00000199448:Q32K	Q	+	1	0	EPDR1	37926800	0.086000	0.21541	0.083000	0.20561	0.138000	0.21146	0.113000	0.15499	0.064000	0.16427	0.064000	0.15345	CAG		0.637	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3		NM_017549	
HDHD1	8226	hgsc.bcm.edu;ucsc.edu	37	X	7035035	7035035	+	Intron	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:7035035G>A	ENST00000381077.5	-	2	138				HDHD1_ENST00000498474.2_Intron|HDHD1_ENST00000424830.2_Silent_p.S34S|HDHD1_ENST00000540122.1_Intron|HDHD1_ENST00000412827.2_Intron	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1						nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						agcctcttgaggactcccccg	0.493																																																	0													82.0	75.0	77.0					X																	7035035		692	1590	2282	SO:0001627	intron_variant	8226			M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.62-11156C>T	X.37:g.7035035G>A		Somatic		WXS	SOLID	Phase_I	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Silent	SNP	ENST00000381077.5	37	CCDS48075.1																																																																																				0.493	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055683.2		NM_012080	
FOXP3	50943	hgsc.bcm.edu	37	X	49113206	49113206	+	Splice_Site	SNP	A	A	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:49113206A>T	ENST00000376207.4	-	6	835		c.e6+1		FOXP3_ENST00000557224.1_Splice_Site|FOXP3_ENST00000376199.2_Splice_Site|FOXP3_ENST00000455775.2_Splice_Site|FOXP3_ENST00000376197.1_Splice_Site|FOXP3_ENST00000518685.1_Splice_Site	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3						B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					TGGGCCACTCACTTGAGGAAG	0.577																																					GBM(182;1432 2112 16160 23073 31774)												0													53.0	43.0	46.0					X																	49113206		2203	4300	6503	SO:0001630	splice_region_variant	50943				CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.647+1T>A	X.37:g.49113206A>T		Somatic		WXS	SOLID	Phase_I	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Splice_Site	SNP	ENST00000376207.4	37	CCDS14323.1	.	.	.	.	.	.	.	.	.	.	A	18.90	3.721485	0.68959	.	.	ENSG00000049768	ENST00000376207;ENST00000376199;ENST00000557224;ENST00000518685;ENST00000376197;ENST00000455775	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7025	0.45934	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FOXP3	49000150	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.939000	0.75911	1.796000	0.52611	0.486000	0.48141	.		0.577	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060814.1		NM_014009	Intron
FLNA	2316	hgsc.bcm.edu	37	X	153593804	153593804	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:153593804C>G	ENST00000369850.3	-	10	1716	c.1480G>C	c.(1480-1482)Ggt>Cgt	p.G494R	FLNA_ENST00000422373.1_Missense_Mutation_p.G494R|FLNA_ENST00000360319.4_Missense_Mutation_p.G494R|FLNA_ENST00000344736.4_Missense_Mutation_p.G494R	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	494					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCCGCACACCCTTGGGCTGG	0.672																																																	0													41.0	43.0	42.0					X																	153593804		1996	4146	6142	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1480G>C	X.37:g.153593804C>G	ENSP00000358866:p.Gly494Arg	Somatic		WXS	SOLID	Phase_I	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324204	0.41197	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06	4.53	4.53	0.55603	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000001	D	0.96706	0.8925	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	0.968;1.0	P;D	0.91635	0.622;0.999	D	0.97807	1.0248	10	0.87932	D	0	.	16.5883	0.84745	0.0:1.0:0.0:0.0	.	494;494	P21333-2;P21333	.;FLNA_HUMAN	R	494;467;494;494;494	ENSP00000353467:G494R;ENSP00000416926:G494R;ENSP00000358866:G494R;ENSP00000358863:G494R	ENSP00000358863:G494R	G	-	1	0	FLNA	153246998	1.000000	0.71417	0.996000	0.52242	0.912000	0.54170	7.815000	0.86186	1.826000	0.53198	0.597000	0.82753	GGT		0.672	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			
HHLA1	10086	hgsc.bcm.edu;ucsc.edu	37	8	133111178	133111178	+	Silent	SNP	C	C	T	rs367849861		TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr8:133111178C>T	ENST00000414222.1	-	4	230	c.231G>A	c.(229-231)gcG>gcA	p.A77A	HHLA1_ENST00000434736.2_Silent_p.A113A	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	77						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						TCAGGTTAAGCGCGGACAGAT	0.423																																																	0								C		1,1383		0,1,691	127.0	119.0	122.0		231	-12.1	0.0	8		122	0,3182		0,0,1591	no	coding-synonymous	HHLA1	NM_001145095.1		0,1,2282	TT,TC,CC		0.0,0.0723,0.0219		77/532	133111178	1,4565	692	1591	2283	SO:0001819	synonymous_variant	10086			AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.231G>A	8.37:g.133111178C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000414222.1	37																																																																																					0.423	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			XR_017860	
HRH2	3274	hgsc.bcm.edu;ucsc.edu	37	5	175111276	175111276	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr5:175111276G>T	ENST00000231683.2	+	1	2813	c.1040G>T	c.(1039-1041)gGg>gTg	p.G347V	HRH2_ENST00000377291.2_Missense_Mutation_p.G347V	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2	347					digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	GTGTGGAGTGGGACAGAAGTC	0.577																																																	0													76.0	85.0	82.0					5																	175111276		2203	4300	6503	SO:0001583	missense	3274				CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660	ENST00000231683.2:c.1040G>T	5.37:g.175111276G>T	ENSP00000231683:p.Gly347Val	Somatic		WXS	SOLID	Phase_I	B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	37	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894078	0.52121	.	.	ENSG00000113749	ENST00000377291;ENST00000231683	T;T	0.66995	-0.24;-0.14	4.83	3.97	0.46021	.	0.200843	0.30667	N	0.009130	T	0.70316	0.3210	L	0.32530	0.975	0.43994	D	0.996698	D;D	0.76494	0.986;0.999	P;D	0.69307	0.741;0.963	T	0.72320	-0.4329	10	0.72032	D	0.01	.	10.4335	0.44421	0.1625:0.0:0.8375:0.0	.	347;347	P25021;Q7Z5R9	HRH2_HUMAN;.	V	347	ENSP00000366506:G347V;ENSP00000231683:G347V	ENSP00000231683:G347V	G	+	2	0	HRH2	175043882	1.000000	0.71417	0.986000	0.45419	0.984000	0.73092	2.863000	0.48396	1.274000	0.44362	0.650000	0.86243	GGG		0.577	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1			
HSPG2	3339	hgsc.bcm.edu	37	1	22213976	22213976	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr1:22213976G>A	ENST00000374695.3	-	8	974	c.895C>T	c.(895-897)Ccc>Tcc	p.P299S		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	299	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TAGTCTCTGGGGATGCAGTGC	0.697																																																	0													76.0	87.0	83.0					1																	22213976		2203	4300	6503	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.895C>T	1.37:g.22213976G>A	ENSP00000363827:p.Pro299Ser	Somatic		WXS	SOLID	Phase_I	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	9.177	1.022537	0.19433	.	.	ENSG00000142798	ENST00000374695	D	0.95554	-3.74	5.09	5.09	0.68999	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.188493	0.26062	N	0.026563	D	0.96555	0.8876	L	0.55213	1.73	0.41216	D	0.986472	D	0.69078	0.997	D	0.67725	0.953	D	0.96186	0.9134	9	.	.	.	.	15.9725	0.80031	0.0:0.0:1.0:0.0	.	299	P98160	PGBM_HUMAN	S	299	ENSP00000363827:P299S	.	P	-	1	0	HSPG2	22086563	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	1.955000	0.40372	2.384000	0.81235	0.462000	0.41574	CCC		0.697	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1		NM_005529	
IL25	64806	hgsc.bcm.edu	37	14	23844833	23844833	+	Splice_Site	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr14:23844833G>A	ENST00000329715.2	+	2	536		c.e2-1		CMTM5_ENST00000359320.3_5'Flank|CMTM5_ENST00000339180.4_5'Flank|CMTM5_ENST00000397227.3_5'Flank|CMTM5_ENST00000382809.2_5'Flank|IL25_ENST00000397242.2_Splice_Site|CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000342473.4_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25						eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)	p.?(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		CGCCCCCACAGGTTGGACAGA	0.637																																																	1	Unknown(1)	ovary(1)											106.0	110.0	109.0					14																	23844833		2203	4300	6503	SO:0001630	splice_region_variant	64806			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.279-1G>A	14.37:g.23844833G>A		Somatic		WXS	SOLID	Phase_I	Q2M3F0|Q8IZV3|Q8WXB0	Splice_Site	SNP	ENST00000329715.2	37	CCDS9597.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.576708	0.65878	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7287	0.57185	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL25	22914673	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.629000	0.61290	2.378000	0.81104	0.491000	0.48974	.		0.637	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2			Intron
INHBA	3624	hgsc.bcm.edu	37	7	41729840	41729840	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr7:41729840A>G	ENST00000242208.4	-	3	935	c.689T>C	c.(688-690)tTg>tCg	p.L230S	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.L230S|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	230					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTGGTCCAGCAACCGCTGGAT	0.557										TSP Lung(11;0.080)																																							0													51.0	50.0	50.0					7																	41729840		2203	4300	6503	SO:0001583	missense	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.689T>C	7.37:g.41729840A>G	ENSP00000242208:p.Leu230Ser	Somatic		WXS	SOLID	Phase_I	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	20.3	3.964489	0.74131	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.63913	-0.07;-0.07	6.06	6.06	0.98353	Transforming growth factor-beta, N-terminal (1);	0.363079	0.24443	N	0.038492	T	0.78960	0.4366	M	0.71206	2.165	0.49213	D	0.999763	D	0.76494	0.999	D	0.76071	0.987	T	0.80795	-0.1223	10	0.87932	D	0	-14.5358	16.6093	0.84858	1.0:0.0:0.0:0.0	.	230	P08476	INHBA_HUMAN	S	230	ENSP00000242208:L230S;ENSP00000397197:L230S	ENSP00000242208:L230S	L	-	2	0	INHBA	41696365	1.000000	0.71417	0.988000	0.46212	0.987000	0.75469	6.183000	0.72002	2.324000	0.78689	0.533000	0.62120	TTG		0.557	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			
KAT2A	2648	hgsc.bcm.edu	37	17	40269163	40269163	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr17:40269163C>A	ENST00000225916.5	-	11	1707	c.1654G>T	c.(1654-1656)Gcc>Tcc	p.A552S		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	552	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TTGATCAAGGCCAGAGTCTTG	0.572											OREG0024419	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													47.0	46.0	46.0					17																	40269163		2203	4300	6503	SO:0001583	missense	2648			AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1654G>T	17.37:g.40269163C>A	ENSP00000225916:p.Ala552Ser	Somatic	892	WXS	SOLID	Phase_I	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	ENST00000225916.5	37	CCDS11417.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.620632	0.28889	.	.	ENSG00000108773	ENST00000225916	T	0.07216	3.21	4.35	3.36	0.38483	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.107962	0.64402	N	0.000007	T	0.16471	0.0396	M	0.82923	2.615	0.80722	D	1	B	0.27656	0.184	B	0.31614	0.133	T	0.05068	-1.0908	10	0.66056	D	0.02	-19.2664	14.2239	0.65845	0.151:0.849:0.0:0.0	.	552	Q92830	KAT2A_HUMAN	S	552	ENSP00000225916:A552S	ENSP00000225916:A552S	A	-	1	0	KAT2A	37522689	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	7.776000	0.85560	1.118000	0.41863	-0.314000	0.08810	GCC		0.572	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1		NM_021078	
KCNJ4	3761	hgsc.bcm.edu	37	22	38823676	38823676	+	Silent	SNP	C	C	G	rs77032485	byFrequency	TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr22:38823676C>G	ENST00000303592.3	-	2	720	c.462G>C	c.(460-462)gtG>gtC	p.V154V	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	154					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					TGGACTGGACCACCACAGCGA	0.617													C|||	6	0.00119808	0.0	0.0014	5008	,	,		17014	0.0		0.003	False		,,,				2504	0.002																0								C	,	2,4404	4.2+/-10.8	0,2,2201	78.0	69.0	72.0		462,462	2.6	1.0	22	dbSNP_131	72	57,8543	35.9+/-90.5	0,57,4243	no	coding-synonymous,coding-synonymous	KCNJ4	NM_004981.1,NM_152868.1	,	0,59,6444	GG,GC,CC		0.6628,0.0454,0.4536	,	154/446,154/446	38823676	59,12947	2203	4300	6503	SO:0001819	synonymous_variant	3761			U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.462G>C	22.37:g.38823676C>G		Somatic		WXS	SOLID	Phase_I	Q14D44	Silent	SNP	ENST00000303592.3	37	CCDS13971.1																																																																																				0.617	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1		NM_004981	
KCNJ4	3761	hgsc.bcm.edu	37	22	38823945	38823945	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr22:38823945C>T	ENST00000303592.3	-	2	451	c.193G>A	c.(193-195)Gcc>Acc	p.A65T	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	65					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					ACAAGGAAGGCCGCGGAGAAG	0.627																																																	0													167.0	107.0	127.0					22																	38823945		2203	4300	6503	SO:0001583	missense	3761			U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.193G>A	22.37:g.38823945C>T	ENSP00000306497:p.Ala65Thr	Somatic		WXS	SOLID	Phase_I	Q14D44	Missense_Mutation	SNP	ENST00000303592.3	37	CCDS13971.1	.	.	.	.	.	.	.	.	.	.	C	9.440	1.087865	0.20390	.	.	ENSG00000168135	ENST00000303592	D	0.94376	-3.41	4.86	4.86	0.63082	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.059719	0.64402	D	0.000001	D	0.83557	0.5280	N	0.11818	0.18	0.34061	D	0.657293	B	0.12013	0.005	B	0.12837	0.008	T	0.79769	-0.1664	10	0.11794	T	0.64	.	9.3054	0.37872	0.0:0.8387:0.0:0.1613	.	65	P48050	IRK4_HUMAN	T	65	ENSP00000306497:A65T	ENSP00000306497:A65T	A	-	1	0	KCNJ4	37153891	0.968000	0.33430	1.000000	0.80357	0.970000	0.65996	2.092000	0.41700	2.428000	0.82296	0.555000	0.69702	GCC		0.627	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1		NM_004981	
KRT77	374454	hgsc.bcm.edu	37	12	53086577	53086577	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr12:53086577G>T	ENST00000341809.3	-	6	1196	c.1168C>A	c.(1168-1170)Cag>Aag	p.Q390K	KRT77_ENST00000537195.1_Missense_Mutation_p.Q157K|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	390	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TGCAGCCTCTGGACGGTGCGG	0.592																																																	0													182.0	131.0	148.0					12																	53086577		2202	4272	6474	SO:0001583	missense	374454			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1168C>A	12.37:g.53086577G>T	ENSP00000342710:p.Gln390Lys	Somatic		WXS	SOLID	Phase_I	Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	37	CCDS8837.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.197006	0.58126	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	D;D	0.90900	-2.75;-2.75	3.44	0.493	0.16878	Filament (1);	.	.	.	.	D	0.92977	0.7765	M	0.90759	3.145	0.20489	N	0.999895	P	0.49696	0.927	P	0.51777	0.679	D	0.85359	0.1106	9	0.87932	D	0	.	5.9768	0.19385	0.1712:0.0:0.676:0.1528	.	390	Q7Z794	K2C1B_HUMAN	K	390;157	ENSP00000342710:Q390K;ENSP00000440803:Q157K	ENSP00000342710:Q390K	Q	-	1	0	KRT77	51372844	1.000000	0.71417	0.193000	0.23327	0.243000	0.25628	2.164000	0.42387	0.103000	0.17682	0.456000	0.33151	CAG		0.592	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1		NM_175078	
LATS2	26524	hgsc.bcm.edu;ucsc.edu	37	13	21557669	21557669	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr13:21557669C>T	ENST00000382592.4	-	5	2581	c.2176G>A	c.(2176-2178)Gag>Aag	p.E726K	LATS2_ENST00000542899.1_Missense_Mutation_p.E726K	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		ACCACCCACTCATTGTCTGCC	0.542																																																	0													169.0	162.0	164.0					13																	21557669		2203	4300	6503	SO:0001583	missense	26524			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2176G>A	13.37:g.21557669C>T	ENSP00000372035:p.Glu726Lys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372392	0.82573	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.07688	3.17;3.17	5.19	5.19	0.71726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.18467	0.0443	N	0.21240	0.645	0.80722	D	1	D	0.64830	0.994	D	0.71870	0.975	T	0.02075	-1.1218	10	0.59425	D	0.04	.	18.9571	0.92662	0.0:1.0:0.0:0.0	.	726	Q9NRM7	LATS2_HUMAN	K	726	ENSP00000372035:E726K;ENSP00000441817:E726K	ENSP00000372035:E726K	E	-	1	0	LATS2	20455669	1.000000	0.71417	0.981000	0.43875	0.900000	0.52787	5.796000	0.69080	2.709000	0.92574	0.555000	0.69702	GAG		0.542	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			
MRAP	56246	hgsc.bcm.edu	37	21	33684178	33684178	+	Silent	SNP	C	C	G	rs17855143	byFrequency	TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr21:33684178C>G	ENST00000399784.2	+	5	577	c.390C>G	c.(388-390)acC>acG	p.T130T	MRAP_ENST00000303645.5_Silent_p.T130T|MRAP_ENST00000399786.3_Intron|MRAP_ENST00000339944.4_Intron|URB1_ENST00000382751.3_3'UTR|MRAP_ENST00000497833.1_3'UTR	NM_178817.3	NP_848932.1	Q8TCY5	MRAP_HUMAN	melanocortin 2 receptor accessory protein	130					brown fat cell differentiation (GO:0050873)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			endometrium(1)|large_intestine(2)|lung(3)	6						GCTCCTCCACCTTGCCCCTCG	0.662													C|||	157	0.0313498	0.0008	0.0	5008	,	,		18769	0.0833		0.004	False		,,,				2504	0.0695																0								C	,,	7,4399	12.9+/-30.5	0,7,2196	43.0	41.0	42.0		,390,	2.5	0.0	21	dbSNP_123	42	4,8596	3.7+/-12.6	0,4,4296	no	utr-3,coding-synonymous,intron	URB1,MRAP	NM_014825.2,NM_178817.3,NM_206898.1	,,	0,11,6492	GG,GC,CC		0.0465,0.1589,0.0846	,,	,130/173,	33684178	11,12995	2203	4300	6503	SO:0001819	synonymous_variant	56246			AF454915	CCDS13612.1, CCDS13613.1	21q22.1	2005-10-30	2005-02-01	2005-02-07	ENSG00000170262	ENSG00000170262			1304	protein-coding gene	gene with protein product		609196	"""chromosome 21 open reading frame 61"""	C21orf61		12036298, 15654338	Standard	NM_178817		Approved	B27, FALP	uc002ypj.3	Q8TCY5	OTTHUMG00000085309	ENST00000399784.2:c.390C>G	21.37:g.33684178C>G		Somatic		WXS	SOLID	Phase_I	Q5EBR3|Q8TDB7|Q8WXC1|Q8WXC2	Silent	SNP	ENST00000399784.2	37	CCDS13613.1																																																																																				0.662	MRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000193092.1		NM_178817	
MYO18B	84700	hgsc.bcm.edu;ucsc.edu	37	22	26348307	26348307	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr22:26348307C>A	ENST00000407587.2	+	38	6060	c.5891C>A	c.(5890-5892)gCc>gAc	p.A1964D	MYO18B_ENST00000536101.1_Missense_Mutation_p.A1963D|MYO18B_ENST00000335473.7_Missense_Mutation_p.A1963D			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1963	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTGGATCGAGCCATCGTCAGC	0.493																																																	0													64.0	69.0	67.0					22																	26348307		2060	4203	6263	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5891C>A	22.37:g.26348307C>A	ENSP00000386096:p.Ala1964Asp	Somatic		WXS	SOLID	Phase_I	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	20.6	4.009461	0.75046	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87029	-2.18;-2.18;-2.2	5.49	3.12	0.35913	.	0.291150	0.33631	N	0.004712	D	0.85075	0.5614	L	0.43152	1.355	0.40312	D	0.978724	P;P;P;P	0.52316	0.926;0.773;0.952;0.855	P;B;P;P	0.49085	0.6;0.321;0.52;0.52	D	0.86309	0.1685	10	0.59425	D	0.04	.	12.1456	0.54022	0.1185:0.7019:0.1797:0.0	.	1476;1963;1964;1963	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	D	1963;1963;1964	ENSP00000441229:A1963D;ENSP00000334563:A1963D;ENSP00000386096:A1964D	ENSP00000334563:A1963D	A	+	2	0	MYO18B	24678307	0.023000	0.18921	0.994000	0.49952	0.970000	0.65996	1.020000	0.30027	2.592000	0.87571	0.655000	0.94253	GCC		0.493	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1		NM_032608	
NF1	4763	hgsc.bcm.edu;ucsc.edu	37	17	29670103	29670103	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr17:29670103T>G	ENST00000358273.4	+	48	7522	c.7139T>G	c.(7138-7140)cTc>cGc	p.L2380R	NF1_ENST00000417592.2_Missense_Mutation_p.L93R|NF1_ENST00000444181.2_Missense_Mutation_p.L173R|NF1_ENST00000356175.3_Missense_Mutation_p.L2359R	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2380					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTGTTGGACTCAATTTCAAC	0.343			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											111.0	111.0	111.0					17																	29670103		2203	4300	6503	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7139T>G	17.37:g.29670103T>G	ENSP00000351015:p.Leu2380Arg	Somatic		WXS	SOLID	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.613884	0.87359	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181;ENST00000417592	T;T;T;T	0.54675	1.4;1.4;1.4;0.56	5.44	5.44	0.79542	Armadillo-type fold (2);	0.067200	0.64402	D	0.000010	T	0.72350	0.3449	M	0.76574	2.34	0.80722	D	1	D;D	0.69078	0.997;0.967	D;P	0.80764	0.994;0.741	T	0.76375	-0.2982	10	0.87932	D	0	.	15.4927	0.75624	0.0:0.0:0.0:1.0	.	2359;2380	P21359-2;P21359	.;NF1_HUMAN	R	2380;2359;2025;173;93	ENSP00000351015:L2380R;ENSP00000348498:L2359R;ENSP00000389907:L2025R;ENSP00000396481:L173R	ENSP00000348498:L2359R	L	+	2	0	NF1	26694229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.333000	0.79214	2.070000	0.61991	0.460000	0.39030	CTC		0.343	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2		NM_000267	
NKAP	79576	hgsc.bcm.edu;ucsc.edu	37	X	119059315	119059315	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:119059315C>A	ENST00000371410.3	-	9	1282	c.1116G>T	c.(1114-1116)caG>caT	p.Q372H	NKAP_ENST00000477789.1_5'UTR|AC002477.1_ENST00000581061.1_RNA|RP3-327A19.5_ENST00000455986.1_RNA	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	372	Necessary for interaction with HDAC3 and transcriptional repression.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						CACTGTAGATCTGGTTCTCTT	0.413																																																	0													141.0	127.0	132.0					X																	119059315		2203	4300	6503	SO:0001583	missense	79576			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.1116G>T	X.37:g.119059315C>A	ENSP00000360464:p.Gln372His	Somatic		WXS	SOLID	Phase_I	Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	ENST00000371410.3	37	CCDS14592.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391715	0.83011	.	.	ENSG00000101882	ENST00000371410	T	0.29397	1.57	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72896	-0.4153	10	0.87932	D	0	-22.5307	13.191	0.59711	0.0:0.92:0.0:0.0799	.	372	Q8N5F7	NKAP_HUMAN	H	372	ENSP00000360464:Q372H	ENSP00000360464:Q372H	Q	-	3	2	NKAP	118943343	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.026000	0.70873	2.432000	0.82394	0.600000	0.82982	CAG		0.413	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1		NM_024528	
NR5A2	2494	hgsc.bcm.edu;ucsc.edu	37	1	200014705	200014705	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr1:200014705G>T	ENST00000367362.3	+	4	702	c.456G>T	c.(454-456)aaG>aaT	p.K152N	NR5A2_ENST00000544748.1_Missense_Mutation_p.K80N|NR5A2_ENST00000236914.3_Missense_Mutation_p.K106N	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	152					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					TTGGAATGAAGCTAGAAGGTA	0.348																																					Melanoma(179;1138 2773 15678 26136)												0													80.0	81.0	81.0					1																	200014705		2203	4300	6503	SO:0001583	missense	2494			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.456G>T	1.37:g.200014705G>T	ENSP00000356331:p.Lys152Asn	Somatic		WXS	SOLID	Phase_I	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	ENST00000367362.3	37	CCDS1401.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.01|18.01	3.527702|3.527702	0.64860|0.64860	.|.	.|.	ENSG00000116833|ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480|ENST00000367357	T;T;T|.	0.55930|.	0.49;0.49;0.49|.	5.5|5.5	3.59|3.59	0.41128|0.41128	Zinc finger, NHR/GATA-type (1);Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58864|0.58864	0.2152|0.2152	L|L	0.46614|0.46614	1.455|1.455	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.77004|.	0.981;0.989|.	T|T	0.56329|0.56329	-0.7997|-0.7997	9|5	.|.	.|.	.|.	.|.	12.3589|12.3589	0.55192|0.55192	0.1956:0.0:0.8044:0.0|0.1956:0.0:0.8044:0.0	.|.	106;152|.	F1D8R9;O00482|.	.;NR5A2_HUMAN|.	N|I	152;106;80;72|73	ENSP00000356331:K152N;ENSP00000236914:K106N;ENSP00000439116:K80N|.	.|.	K|S	+|+	3|2	2|0	NR5A2|NR5A2	198281328|198281328	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.467000|1.467000	0.35321|0.35321	1.455000|1.455000	0.47813|0.47813	0.655000|0.655000	0.94253|0.94253	AAG|AGC		0.348	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2			
PFKM	5213	hgsc.bcm.edu;ucsc.edu	37	12	48526705	48526705	+	Nonsense_Mutation	SNP	C	C	T	rs138893744		TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr12:48526705C>T	ENST00000312352.7	+	5	331	c.292C>T	c.(292-294)Cga>Tga	p.R98*	PFKM_ENST00000551804.1_Nonsense_Mutation_p.R98*|PFKM_ENST00000340802.6_Nonsense_Mutation_p.R169*|PFKM_ENST00000395233.2_Nonsense_Mutation_p.R98*|PFKM_ENST00000547587.1_Nonsense_Mutation_p.R98*|PFKM_ENST00000359794.5_Nonsense_Mutation_p.R98*	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	98	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						ACGAGAAGGACGACTCCGAGC	0.572																																																	0								C	stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	100.0	83.0	89.0		292,505,292,292	2.5	1.0	12	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained,stop-gained,stop-gained,stop-gained	PFKM	NM_000289.5,NM_001166686.1,NM_001166687.1,NM_001166688.1	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	98/781,169/852,98/781,98/781	48526705	1,13005	2203	4300	6503	SO:0001587	stop_gained	5213			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.292C>T	12.37:g.48526705C>T	ENSP00000309438:p.Arg98*	Somatic		WXS	SOLID	Phase_I	J3KNX3|Q16814|Q16815|Q6ZTT1	Nonsense_Mutation	SNP	ENST00000312352.7	37	CCDS8760.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624029	0.87560	0.0	1.16E-4	ENSG00000152556	ENST00000550345;ENST00000549003;ENST00000549941;ENST00000340802;ENST00000359794;ENST00000551339;ENST00000395233;ENST00000548345;ENST00000551804;ENST00000549022;ENST00000547587;ENST00000312352	.	.	.	4.54	2.51	0.30379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3059	12.4557	0.55702	0.3574:0.6426:0.0:0.0	.	.	.	.	X	98;98;131;169;98;98;98;98;98;98;98;98	.	ENSP00000309438:R98X	R	+	1	2	PFKM	46812972	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	3.079000	0.50104	0.667000	0.31107	0.555000	0.69702	CGA		0.572	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1		NM_000289	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110530539	110530539	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr8:110530539T>C	ENST00000378402.5	+	73	11937	c.11833T>C	c.(11833-11835)Tct>Cct	p.S3945P		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3945					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTCCAATTATCTGTTGCAAC	0.353										HNSCC(38;0.096)																																							0													135.0	132.0	133.0					8																	110530539		1842	4088	5930	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11833T>C	8.37:g.110530539T>C	ENSP00000367655:p.Ser3945Pro	Somatic		WXS	SOLID	Phase_I	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	7.451	0.642625	0.14451	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.83755	-1.76;-1.59	5.75	5.75	0.90469	.	0.000000	0.85682	N	0.000000	T	0.42381	0.1200	N	0.00031	-2.6	0.28777	N	0.900026	B	0.02656	0.0	B	0.01281	0.0	T	0.48198	-0.9056	10	0.02654	T	1	.	12.8354	0.57770	0.0:0.9208:0.0:0.0792	.	3945	Q86WI1	PKHL1_HUMAN	P	3945;873	ENSP00000367655:S3945P;ENSP00000437376:S873P	ENSP00000367655:S3945P	S	+	1	0	PKHD1L1	110599715	1.000000	0.71417	0.992000	0.48379	0.767000	0.43475	5.019000	0.64060	1.440000	0.47531	-0.119000	0.15052	TCT		0.353	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
PTEN	5728	hgsc.bcm.edu;ucsc.edu	37	10	89653858	89653860	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	TGT	TGT	TGT	-	TGT	TGT	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr10:89653858_89653860delTGT	ENST00000371953.3	+	2	1513_1515	c.156_158delTGT	c.(154-159)gatgta>gaa	p.52_53DV>E		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	52	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(2)|p.D52del(2)|p.V53G(1)|p.V53del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ATATTGATGATGTAGTAAGGTAA	0.296		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	51	Whole gene deletion(37)|Unknown(8)|Deletion - In frame(3)|Deletion - Frameshift(2)|Substitution - Missense(1)	prostate(14)|central_nervous_system(9)|skin(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|ovary(3)|endometrium(2)|breast(2)|kidney(2)|soft_tissue(1)|urinary_tract(1)|NS(1)	GRCh37	CD982912|CI972689	PTEN	D|I																																				SO:0001651	inframe_deletion	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.156_158delTGT	10.37:g.89653858_89653860delTGT	ENSP00000361021:p.Asp52_Val53delinsGlu	Somatic		WXS	SOLID	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	In_Frame_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.296	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1		NM_000314	
PTEN	5728	hgsc.bcm.edu;ucsc.edu	37	10	89653859	89653861	+	In_Frame_Del	DEL	GTA	GTA	-	rs189583426		TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	GTA	GTA	GTA	-	GTA	GTA	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr10:89653859_89653861delGTA	ENST00000371953.3	+	2	1514_1516	c.157_159delGTA	c.(157-159)gtadel	p.V54del		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	54	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(2)|p.V53G(1)|p.V53del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TATTGATGATGTAGTAAGGTAAG	0.3		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	49	Whole gene deletion(37)|Unknown(8)|Deletion - Frameshift(2)|Substitution - Missense(1)|Deletion - In frame(1)	prostate(14)|central_nervous_system(9)|skin(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|ovary(3)|breast(2)|kidney(2)|soft_tissue(1)|urinary_tract(1)|NS(1)	GRCh37	CD982912|CI972689|CI983200	PTEN	D|I	rs189583426																																			SO:0001651	inframe_deletion	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.157_159delGTA	10.37:g.89653862_89653864delGTA	ENSP00000361021:p.Val54del	Somatic		WXS	SOLID	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	In_Frame_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.300	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1		NM_000314	
PTP4A3	11156	hgsc.bcm.edu;ucsc.edu	37	8	142437880	142437880	+	Silent	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr8:142437880T>C	ENST00000521578.1	+	5	1305	c.360T>C	c.(358-360)atT>atC	p.I120I	PTP4A3_ENST00000329397.1_Silent_p.I120I|PTP4A3_ENST00000349124.1_Intron|PTP4A3_ENST00000520105.1_Intron|PTP4A3_ENST00000524028.1_Intron			O75365	TP4A3_HUMAN	protein tyrosine phosphatase type IVA, member 3	120	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	endosome (GO:0005768)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			endometrium(2)|large_intestine(1)|lung(3)	6	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			TGGCCCTTATTGAGAGCGGGA	0.682																																																	0													47.0	37.0	40.0					8																	142437880		2130	4191	6321	SO:0001819	synonymous_variant	11156			AF041434	CCDS6382.1, CCDS6383.1	8q24.3	2011-06-09				ENSG00000184489		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9636	protein-coding gene	gene with protein product		606449					Standard	NM_032611		Approved	PRL-3, PRL-R, PRL3	uc003ywg.1	O75365		ENST00000521578.1:c.360T>C	8.37:g.142437880T>C		Somatic		WXS	SOLID	Phase_I	Q8IVN5|Q99849|Q9BTW5	Silent	SNP	ENST00000521578.1	37	CCDS6383.1																																																																																				0.682	PTP4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378977.1		NM_032611	
RALB	5899	hgsc.bcm.edu	37	2	121036308	121036308	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:121036308G>C	ENST00000272519.5	+	2	338	c.68G>C	c.(67-69)gGa>gCa	p.G23A	RALB_ENST00000420510.1_Missense_Mutation_p.G23A|RALB_ENST00000474855.2_Missense_Mutation_p.G45A|RALB_ENST00000404963.3_Missense_Mutation_p.G23A|RALB_ENST00000470417.1_Intron	NM_002881.2	NP_002872.1	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B	23					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of exocyst assembly (GO:0001928)|regulation of exocyst localization (GO:0060178)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G23V(1)		endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(154;0.122)				GTTGGCAGCGGAGGCGTTGGC	0.567																																																	1	Substitution - Missense(1)	lung(1)											108.0	83.0	92.0					2																	121036308		2203	4300	6503	SO:0001583	missense	5899				CCDS2131.1	2q14.2	2014-05-09	2013-07-09		ENSG00000144118	ENSG00000144118			9840	protein-coding gene	gene with protein product	"""ras related GTP binding protein B"""	179551					Standard	NM_002881		Approved		uc002tmk.3	P11234	OTTHUMG00000131435	ENST00000272519.5:c.68G>C	2.37:g.121036308G>C	ENSP00000272519:p.Gly23Ala	Somatic		WXS	SOLID	Phase_I	B4E040|Q53T32|Q6ZS74	Missense_Mutation	SNP	ENST00000272519.5	37	CCDS2131.1	.	.	.	.	.	.	.	.	.	.	g	34	5.327024	0.95708	.	.	ENSG00000144118	ENST00000447591;ENST00000474855;ENST00000272519;ENST00000420510;ENST00000404963;ENST00000412383;ENST00000449649	T;T;T;T;T;T;T	0.79749	-1.14;-1.14;-1.14;-1.14;-1.3;-1.14;-1.14	5.89	5.89	0.94794	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.87775	0.6262	L	0.56280	1.765	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.99	D;P;D	0.65233	0.933;0.899;0.933	D	0.87858	0.2662	10	0.87932	D	0	.	20.2266	0.98341	0.0:0.0:1.0:0.0	.	45;23;23	B4E040;Q6ZS74;P11234	.;.;RALB_HUMAN	A	45;45;23;23;23;23;23	ENSP00000402866:G45A;ENSP00000438764:G45A;ENSP00000272519:G23A;ENSP00000414224:G23A;ENSP00000384328:G23A;ENSP00000398162:G23A;ENSP00000407062:G23A	ENSP00000272519:G23A	G	+	2	0	RALB	120752778	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	9.620000	0.98373	2.792000	0.96026	0.586000	0.80456	GGA		0.567	RALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254232.3		NM_002881	
ROPN1	54763	hgsc.bcm.edu	37	3	123694287	123694287	+	Missense_Mutation	SNP	C	C	T	rs201837719		TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr3:123694287C>T	ENST00000184183.4	-	5	675	c.335G>A	c.(334-336)cGc>cAc	p.R112H	ROPN1_ENST00000405845.3_Missense_Mutation_p.R112H	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	112						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		CTCCGTGAAGCGACCCACATT	0.493																																																	0													9.0	10.0	9.0					3																	123694287		2099	4217	6316	SO:0001583	missense	54763			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.335G>A	3.37:g.123694287C>T	ENSP00000184183:p.Arg112His	Somatic		WXS	SOLID	Phase_I	D3DN99|Q9UF38	Missense_Mutation	SNP	ENST00000184183.4	37	CCDS3026.1	22	0.010073260073260074	2	0.0040650406504065045	5	0.013812154696132596	4	0.006993006993006993	11	0.014511873350923483	C	15.89	2.966945	0.53507	.	.	ENSG00000065371	ENST00000184183;ENST00000405845;ENST00000467907;ENST00000460743	T;T;T;T	0.31769	1.87;1.87;1.87;1.48	4.61	2.83	0.33086	.	0.146541	0.47455	N	0.000231	T	0.14874	0.0359	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.04103	-1.0977	10	0.44086	T	0.13	-21.1911	8.9829	0.35977	0.0:0.8232:0.0:0.1768	.	112	Q9HAT0	ROP1A_HUMAN	H	112	ENSP00000184183:R112H;ENSP00000385919:R112H;ENSP00000417067:R112H;ENSP00000420310:R112H	ENSP00000184183:R112H	R	-	2	0	ROPN1	125176977	0.938000	0.31826	1.000000	0.80357	0.724000	0.41520	-0.169000	0.09911	0.727000	0.32360	-0.147000	0.13772	CGC		0.493	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356188.2		NM_017578	
SELE	6401	hgsc.bcm.edu	37	1	169701011	169701011	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr1:169701011C>A	ENST00000333360.7	-	4	633	c.494G>T	c.(493-495)tGt>tTt	p.C165F	SELE_ENST00000367780.4_Missense_Mutation_p.C165F|SELE_ENST00000367775.1_Missense_Mutation_p.C165F|SELE_ENST00000367776.1_Missense_Mutation_p.C165F|SELE_ENST00000367774.1_Missense_Mutation_p.C165F|SELE_ENST00000367777.1_Missense_Mutation_p.C165F|SELE_ENST00000367781.4_Missense_Mutation_p.C165F|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367782.4_Missense_Mutation_p.C165F|SELE_ENST00000367779.4_Missense_Mutation_p.C165F	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	165	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	GCCAGGGTCACACTTGCAAGT	0.473																																																	0													153.0	122.0	132.0					1																	169701011		2203	4300	6503	SO:0001583	missense	6401			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.494G>T	1.37:g.169701011C>A	ENSP00000331736:p.Cys165Phe	Somatic		WXS	SOLID	Phase_I	A2RRD6|P16111	Missense_Mutation	SNP	ENST00000333360.7	37	CCDS1283.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097532	0.76870	.	.	ENSG00000007908	ENST00000367781;ENST00000367782;ENST00000367780;ENST00000367779;ENST00000333360;ENST00000367777;ENST00000367775;ENST00000367776;ENST00000367774	D;D;D;D;D;D;D;D;D	0.99992	-12.4;-12.4;-12.4;-12.4;-12.4;-12.4;-12.4;-12.4;-12.4	5.5	5.5	0.81552	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.44097	D	0.000490	D	0.99994	0.9999	H	0.99956	5.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99997	1.5793	10	0.54805	T	0.06	-21.9506	16.9766	0.86315	0.0:1.0:0.0:0.0	.	165	P16581	LYAM2_HUMAN	F	165	ENSP00000356755:C165F;ENSP00000356756:C165F;ENSP00000356754:C165F;ENSP00000356753:C165F;ENSP00000331736:C165F;ENSP00000356751:C165F;ENSP00000356749:C165F;ENSP00000356750:C165F;ENSP00000356748:C165F	ENSP00000331736:C165F	C	-	2	0	SELE	167967635	1.000000	0.71417	0.288000	0.24862	0.809000	0.45718	7.040000	0.76551	2.601000	0.87937	0.586000	0.80456	TGT		0.473	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1		NM_000450	
SELE	6401	hgsc.bcm.edu;ucsc.edu	37	1	169701067	169701067	+	Silent	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr1:169701067T>C	ENST00000333360.7	-	4	577	c.438A>G	c.(436-438)acA>acG	p.T146T	SELE_ENST00000367780.4_Silent_p.T146T|SELE_ENST00000367775.1_Silent_p.T146T|SELE_ENST00000367776.1_Silent_p.T146T|SELE_ENST00000367774.1_Silent_p.T146T|SELE_ENST00000367777.1_Silent_p.T146T|SELE_ENST00000367781.4_Silent_p.T146T|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367782.4_Silent_p.T146T|SELE_ENST00000367779.4_Silent_p.T146T	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	146	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	CACTGCAGGATGTATTGGTAC	0.438																																																	0													117.0	99.0	105.0					1																	169701067		2203	4300	6503	SO:0001819	synonymous_variant	6401			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.438A>G	1.37:g.169701067T>C		Somatic		WXS	SOLID	Phase_I	A2RRD6|P16111	Silent	SNP	ENST00000333360.7	37	CCDS1283.1																																																																																				0.438	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1		NM_000450	
SH2D7	646892	hgsc.bcm.edu;ucsc.edu	37	15	78385103	78385103	+	Splice_Site	SNP	G	G	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr15:78385103G>A	ENST00000328828.5	+	1	176		c.e1+1		SH2D7_ENST00000409568.2_Intron|SNORA63_ENST00000362763.1_RNA	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7											endometrium(2)|kidney(2)|lung(3)	7						TCACCCGCAAGTAAGGCTGCT	0.567																																																	0													41.0	42.0	42.0					15																	78385103		1972	4131	6103	SO:0001630	splice_region_variant	646892				CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	ENST00000328828.5:c.176+1G>A	15.37:g.78385103G>A		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000328828.5	37	CCDS45315.1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884446	0.72410	.	.	ENSG00000183476	ENST00000328828	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8627	0.70392	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SH2D7	76172158	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.970000	0.76099	2.568000	0.86640	0.655000	0.94253	.		0.567	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000334660.2		NM_001101404	Intron
SLC17A2	10246	hgsc.bcm.edu;ucsc.edu	37	6	25923943	25923943	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr6:25923943T>C	ENST00000265425.3	-	2	240	c.220A>G	c.(220-222)Atc>Gtc	p.I74V	SLC17A2_ENST00000360488.3_Missense_Mutation_p.I74V|SLC17A2_ENST00000377850.3_Missense_Mutation_p.I74V			O00624	NPT3_HUMAN	solute carrier family 17, member 2	74					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						AATTCCTTGATGGATATGCTG	0.433																																																	0													167.0	167.0	167.0					6																	25923943		2203	4300	6503	SO:0001583	missense	10246			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.220A>G	6.37:g.25923943T>C	ENSP00000265425:p.Ile74Val	Somatic		WXS	SOLID	Phase_I	A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	ENST00000265425.3	37		.	.	.	.	.	.	.	.	.	.	T	4.970	0.180238	0.09443	.	.	ENSG00000112337	ENST00000360488;ENST00000377850;ENST00000265425	T;T;T	0.63096	-0.02;-0.02;-0.02	5.23	-0.114	0.13564	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.303190	0.00541	N	0.000227	T	0.15912	0.0383	N	0.05124	-0.11	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.05162	-1.0902	10	0.29301	T	0.29	.	3.1548	0.06500	0.2975:0.169:0.0:0.5335	.	74;74;74	O00624;A6NK81;O00624-2	NPT3_HUMAN;.;.	V	74	ENSP00000353677:I74V;ENSP00000367081:I74V;ENSP00000265425:I74V	ENSP00000265425:I74V	I	-	1	0	SLC17A2	26031922	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.669000	0.05262	-0.085000	0.12573	0.528000	0.53228	ATC		0.433	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1			
SLC27A3	11000	hgsc.bcm.edu	37	1	153750666	153750666	+	Silent	SNP	G	G	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr1:153750666G>T	ENST00000368661.3	+	5	1397	c.1332G>T	c.(1330-1332)cgG>cgT	p.R444R	SLC27A3_ENST00000484014.1_3'UTR|SLC27A3_ENST00000271857.2_Silent_p.R525R	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	444					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATAAGGTCCGGCTGGCAGTGG	0.627																																																	0													36.0	42.0	40.0					1																	153750666		2202	4300	6502	SO:0001819	synonymous_variant	11000			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.1332G>T	1.37:g.153750666G>T		Somatic		WXS	SOLID	Phase_I	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Silent	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341633	0.24339	.	.	ENSG00000143554	ENST00000458027	.	.	.	5.03	-2.07	0.07276	.	.	.	.	.	T	0.26340	0.0643	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30031	-0.9992	4	.	.	.	-30.0404	3.9143	0.09216	0.1428:0.344:0.3958:0.1175	.	.	.	.	V	149	.	.	G	+	2	0	SLC27A3	152017290	0.000000	0.05858	0.991000	0.47740	0.962000	0.63368	-1.345000	0.02637	-0.196000	0.10366	0.462000	0.41574	GGC		0.627	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_024330	
SLC7A13	157724	hgsc.bcm.edu	37	8	87229702	87229702	+	Silent	SNP	A	A	G	rs4546639	byFrequency	TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr8:87229702A>G	ENST00000297524.3	-	3	1279	c.1176T>C	c.(1174-1176)taT>taC	p.Y392Y	SLC7A13_ENST00000419776.2_Silent_p.Y383Y|SLC7A13_ENST00000520624.1_5'Flank	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	392						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						ATTTTACCTTATAAGGTATAG	0.289													A|||	1014	0.202476	0.0688	0.1974	5008	,	,		17572	0.3383		0.1372	False		,,,				2504	0.3139																0								A		394,3954		20,354,1800	21.0	23.0	22.0		1176	5.0	1.0	8	dbSNP_111	22	1098,7456		81,936,3260	no	coding-synonymous	SLC7A13	NM_138817.2		101,1290,5060	GG,GA,AA		12.8361,9.0616,11.5641		392/471	87229702	1492,11410	2174	4277	6451	SO:0001819	synonymous_variant	157724			AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.1176T>C	8.37:g.87229702A>G		Somatic		WXS	SOLID	Phase_I	Q05C37|Q08AH9|Q96N84	Silent	SNP	ENST00000297524.3	37	CCDS34917.1																																																																																				0.289	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1		NM_138817	
SLITRK1	114798	hgsc.bcm.edu;ucsc.edu	37	13	84453865	84453865	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr13:84453865C>A	ENST00000377084.2	-	1	2663	c.1778G>T	c.(1777-1779)aGt>aTt	p.S593I		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	593					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GCTGTTTTTACTGTGCGAAGT	0.557																																																	0													97.0	86.0	90.0					13																	84453865		2203	4300	6503	SO:0001583	missense	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1778G>T	13.37:g.84453865C>A	ENSP00000366288:p.Ser593Ile	Somatic		WXS	SOLID	Phase_I	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	9.033	0.987886	0.18966	.	.	ENSG00000178235	ENST00000377084	T	0.58652	0.32	5.41	5.41	0.78517	.	0.219666	0.49916	D	0.000133	T	0.52629	0.1746	M	0.74881	2.28	0.34518	D	0.707831	B	0.29508	0.246	B	0.22601	0.04	T	0.61734	-0.7002	10	0.33141	T	0.24	-9.5847	8.7559	0.34645	0.0:0.8392:0.0:0.1608	.	593	Q96PX8	SLIK1_HUMAN	I	593	ENSP00000366288:S593I	ENSP00000366288:S593I	S	-	2	0	SLITRK1	83351866	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.440000	0.35024	2.709000	0.92574	0.655000	0.94253	AGT		0.557	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1		NM_052910	
SMTN	6525	hgsc.bcm.edu	37	22	31496960	31496960	+	Intron	SNP	A	A	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr22:31496960A>G	ENST00000347557.2	+	19	2821				SMTN_ENST00000404574.1_Missense_Mutation_p.Q421R|SMTN_ENST00000358743.1_Intron|SMTN_ENST00000333137.7_Missense_Mutation_p.Q898R	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin						muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						ACGTACATCCAGGAATTCTAC	0.597																																																	0													52.0	44.0	47.0					22																	31496960		2203	4300	6503	SO:0001627	intron_variant	6525			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.2603+1078A>G	22.37:g.31496960A>G		Somatic		WXS	SOLID	Phase_I	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.069672	0.55539	.	.	ENSG00000183963	ENST00000333137;ENST00000329852;ENST00000404496;ENST00000404574;ENST00000403419	D;D	0.95001	-3.58;-3.58	4.41	4.41	0.53225	.	.	.	.	.	D	0.97489	0.9178	M	0.89840	3.065	0.80722	D	1	P;D;D;D;P	0.60160	0.593;0.965;0.98;0.987;0.852	P;D;D;D;D	0.79784	0.886;0.985;0.99;0.993;0.94	D	0.98179	1.0456	8	.	.	.	-25.7055	14.3464	0.66668	1.0:0.0:0.0:0.0	.	954;278;421;921;898	E7ETT8;B5MBZ4;B5MCI0;B5MC56;P53814-5	.;.;.;.;.	R	898;896;921;421;278	ENSP00000329532:Q898R;ENSP00000383919:Q421R	.	Q	+	2	0	SMTN	29826960	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.732000	0.91534	1.935000	0.56089	0.460000	0.39030	CAG		0.597	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1		NM_134270	
SPINK9	643394	hgsc.bcm.edu;ucsc.edu	37	5	147718053	147718053	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr5:147718053C>T	ENST00000377906.1	+	3	155	c.100C>T	c.(100-102)Cat>Tat	p.H34Y	RP11-373N22.3_ENST00000501695.3_RNA|SPINK9_ENST00000511717.2_Missense_Mutation_p.H55Y	NM_001040433.1	NP_001035523.1	Q5DT21	ISK9_HUMAN	serine peptidase inhibitor, Kazal type 9	34	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)|urinary_tract(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACTGCAGTCATTATAAAAA	0.333																																																	0													88.0	91.0	90.0					5																	147718053		2203	4299	6502	SO:0001583	missense	643394			AY396740	CCDS34269.1	5q33.1	2011-08-31				ENSG00000204909		"""Serine peptidase inhibitors, Kazal type"""	32951	protein-coding gene	gene with protein product		613511					Standard	NM_001040433		Approved		uc003lpe.1	Q5DT21		ENST00000377906.1:c.100C>T	5.37:g.147718053C>T	ENSP00000367139:p.His34Tyr	Somatic		WXS	SOLID	Phase_I	B2RPN9	Missense_Mutation	SNP	ENST00000377906.1	37	CCDS34269.1	.	.	.	.	.	.	.	.	.	.	C	5.666	0.307463	0.10733	.	.	ENSG00000204909	ENST00000511717;ENST00000377906	T;T	0.74737	-0.87;-0.87	4.1	-4.91	0.03085	Proteinase inhibitor I1, Kazal (2);	3.256310	0.00879	N	0.002102	T	0.61553	0.2356	.	.	.	0.09310	N	1	P	0.39282	0.666	B	0.32624	0.149	T	0.59789	-0.7388	9	0.59425	D	0.04	0.1167	8.7593	0.34665	0.295:0.5301:0.1749:0.0	.	34	Q5DT21	ISK9_HUMAN	Y	55;34	ENSP00000427240:H55Y;ENSP00000367139:H34Y	ENSP00000367139:H34Y	H	+	1	0	SPINK9	147698246	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.071000	0.01378	-1.676000	0.01457	-2.547000	0.00178	CAT		0.333	SPINK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373382.1		NM_001040433	
STARD9	57519	hgsc.bcm.edu;ucsc.edu	37	15	42985732	42985732	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr15:42985732C>T	ENST00000290607.7	+	23	12013	c.11956C>T	c.(11956-11958)Cag>Tag	p.Q3986*		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	3986					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ACACAGCCCACAGCAGAGTCC	0.532																																																	0													98.0	89.0	92.0					15																	42985732		692	1590	2282	SO:0001587	stop_gained	57519			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.11956C>T	15.37:g.42985732C>T	ENSP00000290607:p.Gln3986*	Somatic		WXS	SOLID	Phase_I	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Nonsense_Mutation	SNP	ENST00000290607.7	37	CCDS53935.1	.	.	.	.	.	.	.	.	.	.	C	52	18.868485	0.99911	.	.	ENSG00000159433	ENST00000290607	.	.	.	5.28	2.08	0.27032	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	7.8914	0.29680	0.1842:0.5005:0.3153:0.0	.	.	.	.	X	3986	.	ENSP00000290607:Q3986X	Q	+	1	0	STARD9	40773024	0.000000	0.05858	0.033000	0.17914	0.022000	0.10575	0.371000	0.20450	0.770000	0.33336	0.462000	0.41574	CAG		0.532	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431094.1			
TMC7	79905	hgsc.bcm.edu	37	16	19070743	19070743	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr16:19070743T>C	ENST00000304381.5	+	15	2163	c.2033T>C	c.(2032-2034)aTc>aCc	p.I678T	TMC7_ENST00000421369.3_Missense_Mutation_p.I568T|TMC7_ENST00000569532.1_Missense_Mutation_p.I678T	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	678					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						TGCAGCCTCATCATGTTTTAC	0.468																																																	0													199.0	175.0	183.0					16																	19070743		2197	4300	6497	SO:0001583	missense	79905			AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.2033T>C	16.37:g.19070743T>C	ENSP00000304710:p.Ile678Thr	Somatic		WXS	SOLID	Phase_I	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	37	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.958541	0.34565	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.74315	-0.73;-0.83	5.6	5.6	0.85130	.	0.536740	0.19699	N	0.108092	T	0.68155	0.2970	L	0.36672	1.1	0.09310	N	1	B;B	0.19706	0.015;0.038	B;B	0.26614	0.027;0.071	T	0.63120	-0.6708	10	0.62326	D	0.03	.	14.0074	0.64473	0.0:0.0:0.0:1.0	.	678;678	Q7Z402;B3KSZ3	TMC7_HUMAN;.	T	678;568	ENSP00000304710:I678T;ENSP00000397081:I568T	ENSP00000304710:I678T	I	+	2	0	TMC7	18978244	0.115000	0.22152	0.003000	0.11579	0.833000	0.47200	3.603000	0.54074	2.130000	0.65690	0.533000	0.62120	ATC		0.468	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3		NM_024847	
TMEM131	23505	hgsc.bcm.edu;ucsc.edu	37	2	98373848	98373848	+	Splice_Site	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:98373848T>C	ENST00000186436.5	-	41	5596		c.e41-2			NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GAGGACCGACTGCGACAAAAC	0.587																																																	0													104.0	104.0	104.0					2																	98373848		2091	4213	6304	SO:0001630	splice_region_variant	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.5368-2A>G	2.37:g.98373848T>C		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000186436.5	37	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901113	0.72754	.	.	ENSG00000075568	ENST00000186436	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7287	0.77784	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM131	97740280	1.000000	0.71417	0.990000	0.47175	0.920000	0.55202	6.892000	0.75644	2.304000	0.77564	0.523000	0.50628	.		0.587	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2		XM_371542	Intron
TOR1AIP1	26092	hgsc.bcm.edu;ucsc.edu	37	1	179869288	179869288	+	Missense_Mutation	SNP	A	A	G	rs200495464		TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr1:179869288A>G	ENST00000606911.2	+	4	829	c.638A>G	c.(637-639)aAt>aGt	p.N213S	RN7SL230P_ENST00000580835.1_RNA|TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.N214S|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.N214S|TOR1AIP1_ENST00000474875.1_3'UTR|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.N92S			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	213					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						CAGAAGGTCAATTTCTCTGAA	0.279													A|||	1	0.000199681	0.0	0.0	5008	,	,		16602	0.001		0.0	False		,,,				2504	0.0																0													49.0	50.0	50.0					1																	179869288		2200	4297	6497	SO:0001583	missense	26092				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.638A>G	1.37:g.179869288A>G	ENSP00000476687:p.Asn213Ser	Somatic		WXS	SOLID	Phase_I	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	1.506	-0.550850	0.03996	.	.	ENSG00000143337	ENST00000528443;ENST00000325993;ENST00000271583;ENST00000435319	T;T;T	0.20463	2.07;2.07;2.07	3.84	-2.98	0.05513	.	1.003600	0.08023	N	0.992297	T	0.11495	0.0280	L	0.31294	0.92	0.09310	N	1	B;B	0.16166	0.003;0.016	B;B	0.14578	0.008;0.011	T	0.35748	-0.9776	9	.	.	.	-2.2	2.9918	0.05986	0.3372:0.0:0.3277:0.3351	.	213;214	Q5JTV8;E9PKD1	TOIP1_HUMAN;.	S	214;213;214;213	ENSP00000435365:N214S;ENSP00000271583:N214S;ENSP00000393292:N213S	.	N	+	2	0	TOR1AIP1	178135911	0.137000	0.22531	0.004000	0.12327	0.163000	0.22366	0.387000	0.20718	-0.596000	0.05821	-0.301000	0.09380	AAT		0.279	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4		NM_015602	
TRIP4	9325	hgsc.bcm.edu;ucsc.edu	37	15	64717797	64717797	+	Silent	SNP	T	T	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr15:64717797T>C	ENST00000261884.3	+	11	1602	c.1542T>C	c.(1540-1542)atT>atC	p.I514I		NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	514					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TGGACCTAATTGACTGCTTGT	0.393																																																	0													129.0	128.0	128.0					15																	64717797		2203	4300	6503	SO:0001819	synonymous_variant	9325			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.1542T>C	15.37:g.64717797T>C		Somatic		WXS	SOLID	Phase_I	B2RAS0|Q96ED7|Q9UKH0	Silent	SNP	ENST00000261884.3	37	CCDS10194.1																																																																																				0.393	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2		NM_016213	
TRPM6	140803	hgsc.bcm.edu	37	9	77436728	77436728	+	Silent	SNP	C	C	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr9:77436728C>A	ENST00000360774.1	-	8	1104	c.867G>T	c.(865-867)gtG>gtT	p.V289V	TRPM6_ENST00000376864.4_Silent_p.V289V|TRPM6_ENST00000376872.3_Silent_p.V289V|TRPM6_ENST00000483186.1_5'UTR|TRPM6_ENST00000376871.3_Silent_p.V289V|TRPM6_ENST00000361255.3_Silent_p.V284V|TRPM6_ENST00000449912.2_Silent_p.V284V|TRPM6_ENST00000451710.3_Silent_p.V289V	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	289					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CCACCAGCCCCACGACCGGCA	0.577																																																	0													132.0	95.0	108.0					9																	77436728		2203	4300	6503	SO:0001819	synonymous_variant	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.867G>T	9.37:g.77436728C>A		Somatic		WXS	SOLID	Phase_I	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	CCDS6647.1																																																																																				0.577	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1		NM_017662	
TTN	7273	hgsc.bcm.edu	37	2	179464025	179464025	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:179464025C>T	ENST00000591111.1	-	240	51796	c.51572G>A	c.(51571-51573)tGg>tAg	p.W17191*	TTN_ENST00000359218.5_Nonsense_Mutation_p.W9892*|TTN_ENST00000460472.2_Nonsense_Mutation_p.W9767*|TTN_ENST00000342992.6_Nonsense_Mutation_p.W16264*|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.W9959*|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.W18832*|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17191	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACATGGACCCATGTCTTCCT	0.408																																																	0													140.0	130.0	133.0					2																	179464025		1898	4115	6013	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51572G>A	2.37:g.179464025C>T	ENSP00000465570:p.Trp17191*	Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	60	47.627058	0.99987	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3658	0.98878	0.0:1.0:0.0:0.0	.	.	.	.	X	16264;9767;9959;9892;9765	.	ENSP00000340554:W9959X	W	-	2	0	TTN	179172270	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.760000	0.85248	2.820000	0.97059	0.650000	0.86243	TGG		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
WDFY3	23001	hgsc.bcm.edu;ucsc.edu	37	4	85724467	85724467	+	Silent	SNP	A	A	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr4:85724467A>T	ENST00000295888.4	-	16	2990	c.2583T>A	c.(2581-2583)tcT>tcA	p.S861S	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Silent_p.S861S|WDFY3_ENST00000512267.1_5'UTR	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	861					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTGACCCAACAGAGGCCAGTA	0.448																																																	0													67.0	62.0	64.0					4																	85724467		2203	4300	6503	SO:0001819	synonymous_variant	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2583T>A	4.37:g.85724467A>T		Somatic		WXS	SOLID	Phase_I	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	CCDS3609.1																																																																																				0.448	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2		NM_014991	
ZNF182	7569	hgsc.bcm.edu;ucsc.edu	37	X	47836677	47836677	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chrX:47836677G>C	ENST00000396965.1	-	7	1159	c.809C>G	c.(808-810)gCt>gGt	p.A270G	ZNF182_ENST00000305127.6_Missense_Mutation_p.A270G|ZNF182_ENST00000376943.3_Missense_Mutation_p.A251G	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						TTGGCTAAAAGCTTTTCCACA	0.423																																																	0													75.0	71.0	72.0					X																	47836677		2203	4300	6503	SO:0001583	missense	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.809C>G	X.37:g.47836677G>C	ENSP00000380165:p.Ala270Gly	Somatic		WXS	SOLID	Phase_I	A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	ENST00000396965.1	37	CCDS35236.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438357	0.43326	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.08458	3.09;3.09;3.09	4.54	4.54	0.55810	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15782	0.0380	L	0.33710	1.025	0.22982	N	0.998472	P;B;B	0.45212	0.853;0.048;0.238	P;B;B	0.58266	0.836;0.208;0.085	T	0.06391	-1.0829	9	0.87932	D	0	.	9.8088	0.40810	0.0:0.2043:0.7957:0.0	.	250;251;270	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	G	251;270;270	ENSP00000366142:A251G;ENSP00000380165:A270G;ENSP00000306351:A270G	ENSP00000306351:A270G	A	-	2	0	ZNF182	47721621	0.069000	0.21087	0.999000	0.59377	0.994000	0.84299	0.742000	0.26216	2.239000	0.73571	0.594000	0.82650	GCT		0.423	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277055.1		NM_006962	
ZNF550	162972	hgsc.bcm.edu;ucsc.edu	37	19	58067635	58067635	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr19:58067635C>T	ENST00000457177.1	-	2	298	c.118G>A	c.(118-120)Gtg>Atg	p.V40M	ZNF550_ENST00000601415.1_Missense_Mutation_p.V40M|ZNF550_ENST00000325134.5_Missense_Mutation_p.V40M|ZNF550_ENST00000506609.2_Missense_Mutation_p.V31M|ZNF549_ENST00000602149.1_3'UTR			Q7Z398	ZN550_HUMAN	zinc finger protein 550	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	7		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCCAGCATCACCTCTCGGTAC	0.552																																																	0													108.0	102.0	104.0					19																	58067635		2203	4300	6503	SO:0001583	missense	162972			AL833214	CCDS35500.1, CCDS35500.2	19q13.43	2013-05-22			ENSG00000251369	ENSG00000251369		"""Zinc fingers, C2H2-type"""	28643	protein-coding gene	gene with protein product						12477932	Standard	NM_001277090		Approved	MGC41917	uc002qpd.4	Q7Z398	OTTHUMG00000133709	ENST00000457177.1:c.118G>A	19.37:g.58067635C>T	ENSP00000469679:p.Val40Met	Somatic		WXS	SOLID	Phase_I	B3KVF6|O43337|Q7Z6D7|Q8NE45	Missense_Mutation	SNP	ENST00000457177.1	37		.	.	.	.	.	.	.	.	.	.	C	19.88	3.909184	0.72868	.	.	ENSG00000251369	ENST00000344222;ENST00000325134;ENST00000506609	T;T	0.04015	3.73;3.73	4.23	4.23	0.50019	.	.	.	.	.	T	0.29028	0.0721	M	0.92784	3.345	0.28858	N	0.895655	D	0.89917	1.0	D	0.87578	0.998	T	0.18777	-1.0326	9	0.62326	D	0.03	.	14.1776	0.65552	0.0:1.0:0.0:0.0	.	40	Q7Z398-2	.	M	40;40;31	ENSP00000446224:V40M;ENSP00000422344:V31M	ENSP00000446224:V40M	V	-	1	0	AC003682.1	62759447	0.980000	0.34600	0.993000	0.49108	0.990000	0.78478	2.753000	0.47524	2.174000	0.68829	0.563000	0.77884	GTG		0.552	ZNF550-001	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000257992.2		NM_153231	
ZNF713	349075	hgsc.bcm.edu	37	7	55991394	55991394	+	Splice_Site	SNP	T	T	A			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr7:55991394T>A	ENST00000429591.2	+	3	306		c.e3+2		ZNF713_ENST00000482436.1_Splice_Site|MRPS17_ENST00000426595.1_Splice_Site	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTCATCCAGGTAAGTGCACAC	0.473																																																	0													79.0	66.0	70.0					7																	55991394		2203	4300	6503	SO:0001630	splice_region_variant	349075			AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.268+2T>A	7.37:g.55991394T>A		Somatic		WXS	SOLID	Phase_I		Splice_Site	SNP	ENST00000429591.2	37	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	T	9.184	1.024398	0.19433	.	.	ENSG00000249773;ENSG00000178665	ENST00000426595;ENST00000429591	.	.	.	3.76	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1523	0.36971	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RP11-15K19.2;ZNF713	55958888	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	2.894000	0.48640	1.927000	0.55829	0.533000	0.62120	.		0.473	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1		NM_182633	Intron
ZNF92	168374	hgsc.bcm.edu;ucsc.edu	37	7	64852852	64852852	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr7:64852852C>G	ENST00000328747.7	+	2	240	c.41C>G	c.(40-42)tCt>tGt	p.S14C	ZNF92_ENST00000431504.1_Intron|ZNF92_ENST00000357512.2_Missense_Mutation_p.S14C|ZNF92_ENST00000450302.2_Intron	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	14	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				ATAGAATTCTCTCTAGAGGAA	0.423																																																	0													108.0	111.0	110.0					7																	64852852		2203	4300	6503	SO:0001583	missense	168374			M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.41C>G	7.37:g.64852852C>G	ENSP00000332595:p.Ser14Cys	Somatic		WXS	SOLID	Phase_I	A6NNF9|Q8N492|Q8NB35	Missense_Mutation	SNP	ENST00000328747.7	37	CCDS34646.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978732	0.34942	.	.	ENSG00000146757	ENST00000328747;ENST00000357512	T;T	0.02944	4.1;4.1	0.603	0.603	0.17541	Krueppel-associated box (4);	.	.	.	.	T	0.16385	0.0394	H	0.97829	4.085	0.09310	N	1	B;P	0.40909	0.34;0.732	P;P	0.49953	0.627;0.624	T	0.02837	-1.1104	8	0.62326	D	0.03	.	.	.	.	.	14;14	Q03936-3;Q03936	.;ZNF92_HUMAN	C	14	ENSP00000332595:S14C;ENSP00000350113:S14C	ENSP00000332595:S14C	S	+	2	0	ZNF92	64490287	0.060000	0.20803	0.216000	0.23742	0.209000	0.24338	1.732000	0.38146	0.585000	0.29608	0.591000	0.81541	TCT		0.423	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344589.2		NM_152626	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60839363	60839364	+	Frame_Shift_Del	DEL	CC	CC	-	rs374211669		TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr5:60839363_60839364delCC	ENST00000252744.5	+	14	2867_2868	c.2867_2868delCC	c.(2866-2868)accfs	p.T956fs		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	956					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GTTGCAACTACCGTGATGTCCA	0.559																																																	0																																										SO:0001589	frameshift_variant	57688			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.2867_2868delCC	5.37:g.60839363_60839364delCC	ENSP00000252744:p.Thr956fs	Somatic		WXS	SOLID	Phase_I		Frame_Shift_Del	DEL	ENST00000252744.5	37	CCDS47215.1																																																																																				0.559	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1		NM_020928	
NDUFS1	4719	ucsc.edu	37	2	207006752	207006758	+	Frame_Shift_Del	DEL	GCAATTG	GCAATTG	-			TCGA-BP-4326-01A-01D-1366-10	TCGA-BP-4326-11A-01D-1366-10	GCAATTG	GCAATTG	GCAATTG	-	GCAATTG	GCAATTG	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	a8e77f8d-f08e-4686-9a40-f5298529da15	fa112d8a-9ce9-4c3f-83ee-0c449f2fc9a9	g.chr2:207006752_207006758delGCAATTG	ENST00000233190.6	-	12	1435_1441	c.1169_1175delCAATTGC	c.(1168-1176)acaattgctfs	p.TIA390fs	NDUFS1_ENST00000449699.1_Frame_Shift_Del_p.TIA390fs|NDUFS1_ENST00000440274.1_Frame_Shift_Del_p.TIA354fs|NDUFS1_ENST00000455934.2_Frame_Shift_Del_p.TIA404fs|NDUFS1_ENST00000457011.1_Frame_Shift_Del_p.TIA274fs|NDUFS1_ENST00000432169.1_Frame_Shift_Del_p.TIA279fs|NDUFS1_ENST00000423725.1_Frame_Shift_Del_p.TIA333fs	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	390					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTCCACACCAGCAATTGTAGTATTAAG	0.343																																						.											0																																										SO:0001589	frameshift_variant	4719				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.1169_1175delCAATTGC	2.37:g.207006752_207006758delGCAATTG	ENSP00000233190:p.Thr390fs	Somatic		WXS	SOLID	.	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Frame_Shift_Del	DEL	ENST00000233190.6	37	CCDS2366.1																																																																																				0.343	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4		NM_005006	
