#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AKR1B15	441282	broad.mit.edu;hgsc.bcm.edu	37	7	134254201	134254201	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr7:134254201A>C	ENST00000457545.2	+	5	615	c.355A>C	c.(355-357)Aaa>Caa	p.K119Q	AKR1B15_ENST00000423958.1_Missense_Mutation_p.K91Q	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	119							oxidoreductase activity (GO:0016491)	p.K91Q(1)|p.K97Q(1)|p.K119Q(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						CCTTGTGAGGAAAGCCTTTGA	0.473																																																	3	Substitution - Missense(3)	kidney(3)											135.0	127.0	129.0					7																	134254201		2203	4300	6503	SO:0001583	missense	441282				CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.355A>C	7.37:g.134254201A>C	ENSP00000389289:p.Lys119Gln	Somatic		WXS	Illumina HiSeq	Phase_I	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	-	9.268	1.044995	0.19748	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.26067	1.76;1.76	2.72	-5.44	0.02624	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.15132	0.0365	L	0.33189	0.99	0.09310	N	1	B;B;B	0.21821	0.001;0.009;0.061	B;B;B	0.22152	0.002;0.006;0.038	T	0.34775	-0.9815	9	0.52906	T	0.07	.	4.6982	0.12815	0.4363:0.0:0.4189:0.1448	.	91;119;97	C9JRZ8-2;C9JRZ8;A4D1P0	.;AK1BF_HUMAN;.	Q	119;91	ENSP00000389289:K119Q;ENSP00000397009:K91Q	ENSP00000397009:K91Q	K	+	1	0	AKR1B15	133904741	0.084000	0.21492	0.000000	0.03702	0.023000	0.10783	0.214000	0.17541	-0.765000	0.04645	-0.540000	0.04249	AAA		0.473	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2			
CCDC186	55088	broad.mit.edu;hgsc.bcm.edu	37	10	115885644	115885644	+	Splice_Site	SNP	C	C	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr10:115885644C>A	ENST00000369287.3	-	15	2880		c.e15+1		C10orf118_ENST00000543782.1_Intron	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN										p.?(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AACACAAATACCTTCAAAGTA	0.388																																																	1	Unknown(1)	kidney(1)											60.0	61.0	61.0					10																	115885644		2203	4300	6503	SO:0001630	splice_region_variant	55088																														ENST00000369287.3:c.2613+1G>T	10.37:g.115885644C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Splice_Site	SNP	ENST00000369287.3	37	CCDS7587.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729883	0.89390	.	.	ENSG00000165813	ENST00000369287;ENST00000430353	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3258	0.90254	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C10orf118	115875634	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.699000	0.84547	2.748000	0.94277	0.650000	0.86243	.		0.388	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1			Intron
C19orf26	255057	broad.mit.edu;hgsc.bcm.edu	37	19	1234610	1234610	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr19:1234610T>C	ENST00000382477.2	-	6	921	c.647A>G	c.(646-648)cAc>cGc	p.H216R	C19orf26_ENST00000590083.1_Missense_Mutation_p.H196R|C19orf26_ENST00000215376.6_Missense_Mutation_p.H190R			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	216						integral component of membrane (GO:0016021)		p.H190R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGGCCGGGTGGGGCGTGGT	0.682										HNSCC(14;0.022)																																							1	Substitution - Missense(1)	kidney(1)											60.0	52.0	55.0					19																	1234610		2193	4294	6487	SO:0001583	missense	255057			BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.647A>G	19.37:g.1234610T>C	ENSP00000371917:p.His216Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O43385	Missense_Mutation	SNP	ENST00000382477.2	37		.	.	.	.	.	.	.	.	.	.	T	0.006	-2.090645	0.00367	.	.	ENSG00000099625	ENST00000382477;ENST00000215376	.	.	.	3.06	2.04	0.26737	.	0.433800	0.21195	N	0.078564	T	0.13756	0.0333	N	0.12746	0.255	0.22996	N	0.998453	B	0.06786	0.001	B	0.09377	0.004	T	0.29579	-1.0007	9	0.05721	T	0.95	0.5935	4.3315	0.11066	0.0:0.1583:0.0:0.8417	.	190	Q8N350-2	.	R	216;190	.	ENSP00000215376:H190R	H	-	2	0	C19orf26	1185610	1.000000	0.71417	0.521000	0.27850	0.059000	0.15707	2.454000	0.44979	1.407000	0.46875	0.459000	0.35465	CAC		0.682	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_152769	
DAGLA	747	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	61495757	61495757	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr11:61495757G>A	ENST00000257215.5	+	7	885	c.769G>A	c.(769-771)Gag>Aag	p.E257K		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	257					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.E257K(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CGTGCTGGACGAGGTGAGCAC	0.662																																																	1	Substitution - Missense(1)	kidney(1)											96.0	84.0	88.0					11																	61495757		2202	4299	6501	SO:0001583	missense	747			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.769G>A	11.37:g.61495757G>A	ENSP00000257215:p.Glu257Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260765	0.59431	.	.	ENSG00000134780	ENST00000257215	T	0.22945	1.93	4.74	4.74	0.60224	.	0.057271	0.64402	D	0.000001	T	0.12987	0.0315	N	0.08118	0	0.58432	D	0.999998	P	0.38711	0.643	B	0.27887	0.084	T	0.11518	-1.0584	10	0.35671	T	0.21	-28.9157	18.1135	0.89543	0.0:0.0:1.0:0.0	.	257	Q9Y4D2	DGLA_HUMAN	K	257	ENSP00000257215:E257K	ENSP00000257215:E257K	E	+	1	0	DAGLA	61252333	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.144000	0.77357	2.341000	0.79615	0.555000	0.69702	GAG		0.662	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1		NM_006133	
DDX31	64794	hgsc.bcm.edu	37	9	135545604	135545607	+	Frame_Shift_Del	DEL	TGAA	TGAA	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	TGAA	TGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr9:135545604_135545607delTGAA	ENST00000372159.3	-	1	181_184	c.30_33delTTCA	c.(28-33)cattcafs	p.HS10fs	GTF3C4_ENST00000483873.2_5'UTR|DDX31_ENST00000310532.2_Frame_Shift_Del_p.HS10fs|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000372153.1_Frame_Shift_Del_p.HS10fs|DDX31_ENST00000544003.1_5'Flank|GTF3C4_ENST00000372146.4_5'UTR	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	10						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GGAAGCTCTCTGAATGCCTCTGAG	0.627																																																	0									,	1,4189		0,1,2094					,	-2.9	0.0			23	0,8076		0,0,4038	no	frameshift,frameshift	DDX31	NM_138620.1,NM_022779.7	,	0,1,6132	A1A1,A1R,RR		0.0,0.0239,0.0082	,	,		1,12265				SO:0001589	frameshift_variant	64794			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.30_33delTTCA	9.37:g.135545604_135545607delTGAA	ENSP00000361232:p.His10fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Frame_Shift_Del	DEL	ENST00000372159.3	37	CCDS6951.1																																																																																				0.627	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1		NM_138620	
DOLPP1	57171	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	131851258	131851258	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr9:131851258A>C	ENST00000372546.4	+	8	721	c.689A>C	c.(688-690)cAa>cCa	p.Q230P	DOLPP1_ENST00000406974.3_Missense_Mutation_p.Q187P|DOLPP1_ENST00000540102.1_Missense_Mutation_p.Q89P	NM_020438.4	NP_065171.2	Q86YN1	DOPP1_HUMAN	dolichyldiphosphatase 1	230					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|lipid biosynthetic process (GO:0008610)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichyldiphosphatase activity (GO:0047874)	p.Q230P(1)		endometrium(3)|kidney(2)|lung(7)|skin(1)	13						AGGAACAGACAACGCAAGCTG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											142.0	104.0	117.0					9																	131851258		2203	4300	6503	SO:0001583	missense	57171			BC009493	CCDS6918.1, CCDS48039.1	9q34.1	2013-05-21	2013-05-21		ENSG00000167130	ENSG00000167130	3.6.1.43		29565	protein-coding gene	gene with protein product	"""linked to Surfeit genes in Fugu rubripes 2"""	614516	"""dolichyl pyrophosphate phosphatase 1"""			10369878, 12198133	Standard	NM_020438		Approved	LSFR2	uc004bxc.3	Q86YN1	OTTHUMG00000020771	ENST00000372546.4:c.689A>C	9.37:g.131851258A>C	ENSP00000361625:p.Gln230Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3U8|B0QZG4|Q96GF8|Q9Y3G1	Missense_Mutation	SNP	ENST00000372546.4	37	CCDS6918.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.964159	0.53507	.	.	ENSG00000167130	ENST00000372546;ENST00000406974;ENST00000540102	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.48429	0.1499	L	0.40543	1.245	0.80722	D	1	P;D	0.53151	0.949;0.958	B;P	0.45232	0.368;0.474	T	0.46428	-0.9192	9	0.37606	T	0.19	-15.6381	14.5546	0.68091	1.0:0.0:0.0:0.0	.	187;230	B0QZG4;Q86YN1	.;DOPP1_HUMAN	P	230;187;89	.	ENSP00000361625:Q230P	Q	+	2	0	DOLPP1	130891079	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	8.894000	0.92506	2.117000	0.64856	0.459000	0.35465	CAA		0.582	DOLPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054548.4		NM_020438	
DOT1L	84444	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	2223398	2223398	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr19:2223398G>A	ENST00000398665.3	+	25	3545	c.3509G>A	c.(3508-3510)cGg>cAg	p.R1170Q		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1170					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)	p.R1170Q(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAAGGAGCGGCCTCTGAGC	0.657																																																	2	Substitution - Missense(2)	kidney(2)											59.0	68.0	65.0					19																	2223398		1990	4162	6152	SO:0001583	missense	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3509G>A	19.37:g.2223398G>A	ENSP00000381657:p.Arg1170Gln	Somatic		WXS	Illumina HiSeq	Phase_I	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.651998|4.651998	0.88056|0.88056	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000440640|ENST00000398665;ENST00000221482;ENST00000457590	.|T;T	.|0.37584	.|1.51;1.19	5.01|5.01	3.99|3.99	0.46301|0.46301	.|.	.|0.130189	.|0.50627	.|D	.|0.000105	T|T	0.19005|0.19005	0.0456|0.0456	L|L	0.34521|0.34521	1.04|1.04	0.28952|0.28952	N|N	0.890337|0.890337	.|P;P	.|0.48640	.|0.913;0.733	.|B;B	.|0.31495	.|0.091;0.131	T|T	0.30765|0.30765	-0.9967|-0.9967	5|10	.|0.87932	.|D	.|0	-20.7251|-20.7251	4.6411|4.6411	0.12548|0.12548	0.7964:0.0:0.2036:0.0|0.7964:0.0:0.2036:0.0	.|.	.|1170;1170	.|Q8TEK3;Q8TEK3-2	.|DOT1L_HUMAN;.	S|Q	957|1170;1170;50	.|ENSP00000381657:R1170Q;ENSP00000407411:R50Q	.|ENSP00000221482:R1170Q	G|R	+|+	1|2	0|0	DOT1L|DOT1L	2174398|2174398	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.559000|3.559000	0.53756|0.53756	0.921000|0.921000	0.36994|0.36994	0.561000|0.561000	0.74099|0.74099	GGC|CGG		0.657	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1		NM_032482	
FAM179B	23116	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	45537687	45537687	+	Silent	SNP	C	C	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr14:45537687C>T	ENST00000361577.3	+	17	4865	c.4651C>T	c.(4651-4653)Ctg>Ttg	p.L1551L	FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Silent_p.L1604L	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1551								p.L1551L(1)		endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						TCTGGTGGCTCTGGAAACAAT	0.299																																																	1	Substitution - coding silent(1)	kidney(1)											75.0	76.0	76.0					14																	45537687		2203	4300	6503	SO:0001819	synonymous_variant	23116			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4651C>T	14.37:g.45537687C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	CCDS9681.1																																																																																				0.299	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1		XM_113781	
FOXD4L2	100036519	hgsc.bcm.edu	37	9	42719309	42719311	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr9:42719309_42719311delGCT	ENST00000377590.1	+	1	2076_2078	c.1244_1246delGCT	c.(1243-1248)cgctgc>cgc	p.C416del		NM_001099279.1	NP_001092749.1	Q6VB85	FX4L2_HUMAN	forkhead box D4-like 2	416					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)	1				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CCTCGTCGGCGCTGCTGAGGTAT	0.64																																																	0																																										SO:0001651	inframe_deletion	349334					9p12	2008-07-21			ENSG00000204828				24813	protein-coding gene	gene with protein product						12421752	Standard			Approved	OTTHUMG00000066752	uc004acn.3	Q6VB85	OTTHUMG00000066752	ENST00000377590.1:c.1244_1246delGCT	9.37:g.42719312_42719314delGCT	ENSP00000366814:p.Cys416del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000377590.1	37	CCDS43817.1																																																																																				0.640	FOXD4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143077.1		NM_001099279	
GPC5	2262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	92345764	92345764	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr13:92345764A>T	ENST00000377067.3	+	3	1021	c.649A>T	c.(649-651)Agg>Tgg	p.R217W		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	217					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R217W(2)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ACAGATGGGGAGGTCCCTGCT	0.522																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)											49.0	47.0	48.0					13																	92345764		2203	4300	6503	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.649A>T	13.37:g.92345764A>T	ENSP00000366267:p.Arg217Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	A	17.94	3.511943	0.64522	.	.	ENSG00000179399	ENST00000377067	T	0.62364	0.03	5.07	2.57	0.30868	.	0.212839	0.47852	D	0.000203	T	0.76399	0.3982	M	0.77313	2.365	0.30884	N	0.731073	D	0.69078	0.997	D	0.73380	0.98	T	0.77046	-0.2733	10	0.87932	D	0	.	11.281	0.49195	0.6792:0.3208:0.0:0.0	.	217	P78333	GPC5_HUMAN	W	217	ENSP00000366267:R217W	ENSP00000366267:R217W	R	+	1	2	GPC5	91143765	0.348000	0.24861	0.997000	0.53966	0.886000	0.51366	1.181000	0.32017	0.247000	0.21414	0.383000	0.25322	AGG		0.522	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1		NM_004466	
GPATCH3	63906	broad.mit.edu;hgsc.bcm.edu	37	1	27216524	27216524	+	IGR	SNP	T	T	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr1:27216524T>C	ENST00000361720.5	-	0	2123				GPN2_ENST00000374135.4_Missense_Mutation_p.K22E|GPN2_ENST00000461282.1_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3								nucleic acid binding (GO:0003676)	p.K22E(1)		endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		TACGTGGTCTTCCCTGAGCCC	0.731																																																	1	Substitution - Missense(1)	kidney(1)											11.0	13.0	12.0					1																	27216524		2170	4269	6439	SO:0001628	intergenic_variant	54707			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229		1.37:g.27216524T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	ENST00000361720.5	37	CCDS290.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.807764	0.90623	.	.	ENSG00000142751	ENST00000374135;ENST00000374131;ENST00000431781	T	0.81163	-1.46	4.8	4.8	0.61643	.	0.102660	0.64402	D	0.000004	D	0.93530	0.7935	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95606	0.8667	10	0.66056	D	0.02	-20.9288	14.1803	0.65568	0.0:0.0:0.0:1.0	.	22	Q9H9Y4	GPN2_HUMAN	E	22	ENSP00000363250:K22E	ENSP00000363246:K22E	K	-	1	0	GPN2	27089111	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.778000	0.85637	2.018000	0.59344	0.533000	0.62120	AAG		0.731	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1		NM_022078	
HAPLN1	1404	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	82948369	82948369	+	Silent	SNP	G	G	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr5:82948369G>T	ENST00000274341.4	-	3	1225	c.375C>A	c.(373-375)gtC>gtA	p.V125V	HAPLN1_ENST00000514416.1_Silent_p.V125V	NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	125	Ig-like V-type.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.V125V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	GGTCTGTGATGACCAGAGAAG	0.433																																																	1	Substitution - coding silent(1)	kidney(1)											157.0	151.0	153.0					5																	82948369		2203	4300	6503	SO:0001819	synonymous_variant	1404				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.375C>A	5.37:g.82948369G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9A9	Silent	SNP	ENST00000274341.4	37	CCDS4061.1																																																																																				0.433	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2		NM_001884	
HLA-A	3105	hgsc.bcm.edu	37	6	29911271	29911271	+	Missense_Mutation	SNP	G	G	C	rs3098019	byFrequency	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr6:29911271G>C	ENST00000396634.1	+	5	911	c.570G>C	c.(568-570)gaG>gaC	p.E190D	HLA-A_ENST00000376802.2_Missense_Mutation_p.E190D|HLA-A_ENST00000376809.5_Missense_Mutation_p.E190D|HLA-A_ENST00000376806.5_Missense_Mutation_p.E190D			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	190	Alpha-2.		EW -> DG (in allele A*31:05).		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGTGCGTGGAGTGGCTCCGCA	0.677									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			g|||	1082	0.216054	0.1679	0.2089	5008	,	,		13958	0.2183		0.2167	False		,,,				2504	0.2832																0								G	ASP/GLU	8,3012		1,6,1503	48.0	39.0	42.0		570	0.6	0.0	6	dbSNP_131	42	10,5400		1,8,2696	no	missense	HLA-A	NM_002116.7	45	2,14,4199	CC,CG,GG		0.1848,0.2649,0.2135	benign	190/366	29911271	18,8412	1510	2705	4215	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.570G>C	6.37:g.29911271G>C	ENSP00000379873:p.Glu190Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	419	0.19184981684981686	56	0.11382113821138211	78	0.2154696132596685	139	0.243006993006993	146	0.19261213720316622	.	9.897	1.205898	0.22205	0.002649	0.001848	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000376802	T;T;T;T	0.00995	5.46;5.46;5.46;5.46	3.78	0.557	0.17260	MHC class I, alpha chain, alpha1/alpha2 (8);MHC classes I/II-like antigen recognition protein (4);MHC class I-like antigen recognition (4);	1.991270	0.03551	U	0.225458	T	0.00637	0.0021	M	0.78916	2.43	0.80722	P	0.0	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0;0.001;0.001	T	0.46582	-0.9181	9	0.62326	D	0.03	.	4.9635	0.14078	0.111:0.0:0.5236:0.3654	rs3129016;rs9260160;rs41553132	69;190;190;190;190;190;190	B4DVB9;P13746;Q5SRN7;P16188;Q5SRN5;P30455;P04439	.;1A11_HUMAN;.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	D	190	ENSP00000379873:E190D;ENSP00000366002:E190D;ENSP00000366005:E190D;ENSP00000365998:E190D	ENSP00000365998:E190D	E	+	3	2	HLA-A	30019250	0.578000	0.26717	0.003000	0.11579	0.119000	0.20118	1.433000	0.34947	-0.016000	0.14127	0.485000	0.47835	GAG		0.677	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1		NM_002116	
HOXC8	3224	broad.mit.edu;ucsc.edu	37	12	54403161	54403161	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr12:54403161C>A	ENST00000040584.4	+	1	330	c.93C>A	c.(91-93)agC>agA	p.S31R	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	31					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S31R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						TCCCTCAGAGCGTGGGCAGGA	0.632																																					GBM(197;701 2226 7002 18822 41696)												1	Substitution - Missense(1)	kidney(1)											73.0	87.0	82.0					12																	54403161		2203	4300	6503	SO:0001583	missense	3224			X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.93C>A	12.37:g.54403161C>A	ENSP00000040584:p.Ser31Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A8K4J4|O15221|O15362	Missense_Mutation	SNP	ENST00000040584.4	37	CCDS8870.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813935	0.32053	.	.	ENSG00000037965	ENST00000040584	T	0.49720	0.77	4.01	1.05	0.20165	.	0.103275	0.64402	D	0.000006	T	0.50616	0.1626	M	0.73598	2.24	0.48185	D	0.999601	D	0.55385	0.971	P	0.49561	0.615	T	0.51434	-0.8706	10	0.66056	D	0.02	.	7.1537	0.25624	0.0:0.5126:0.0:0.4874	.	31	P31273	HXC8_HUMAN	R	31	ENSP00000040584:S31R	ENSP00000040584:S31R	S	+	3	2	HOXC8	52689428	1.000000	0.71417	0.987000	0.45799	0.016000	0.09150	1.851000	0.39338	0.288000	0.22398	-0.350000	0.07774	AGC		0.632	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358957.2			
IFIT3	3437	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	91099779	91099779	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr10:91099779delT	ENST00000371818.4	+	2	1547	c.1367delT	c.(1366-1368)attfs	p.I456fs	LIPA_ENST00000371837.1_Intron|IFIT3_ENST00000371811.4_Frame_Shift_Del_p.I456fs|LIPA_ENST00000487618.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	456					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						ATAGGCAGTATTTTCCTGTCA	0.517																																																	0													75.0	77.0	76.0					10																	91099779		2203	4300	6503	SO:0001589	frameshift_variant	3437			U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.1367delT	10.37:g.91099779delT	ENSP00000360883:p.Ile456fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q99634|Q9BSK7	Frame_Shift_Del	DEL	ENST00000371818.4	37	CCDS7402.1																																																																																				0.517	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1		NM_001549	
IFT140	9742	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	1639724	1639724	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr16:1639724C>T	ENST00000426508.2	-	7	1055	c.692G>A	c.(691-693)aGc>aAc	p.S231N	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	231					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)		p.S231N(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CTGAATCGTGCTGTCTGCGGA	0.572																																																	1	Substitution - Missense(1)	kidney(1)											149.0	107.0	121.0					16																	1639724		2199	4300	6499	SO:0001583	missense	9742			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.692G>A	16.37:g.1639724C>T	ENSP00000406012:p.Ser231Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	C	6.305	0.424337	0.11928	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.30714	1.52	4.87	4.87	0.63330	WD40 repeat-like-containing domain (1);	0.193191	0.56097	D	0.000040	T	0.25865	0.0630	L	0.48877	1.53	0.50632	D	0.999888	B	0.16166	0.016	B	0.09377	0.004	T	0.05289	-1.0894	10	0.18276	T	0.48	.	12.5427	0.56182	0.0:0.9154:0.0:0.0846	.	231	Q96RY7	IF140_HUMAN	N	231	ENSP00000406012:S231N	ENSP00000380562:S231N	S	-	2	0	IFT140	1579725	1.000000	0.71417	0.030000	0.17652	0.027000	0.11550	5.486000	0.66856	2.247000	0.74100	0.313000	0.20887	AGC		0.572	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2		NM_014714	
KIF19	124602	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	72340956	72340956	+	Silent	SNP	C	C	A	rs564644989		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr17:72340956C>A	ENST00000389916.4	+	7	777	c.639C>A	c.(637-639)gcC>gcA	p.A213A		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	213	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.A213A(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CCACGGCCGCCAACCAGACGT	0.672																																																	1	Substitution - coding silent(1)	kidney(1)											37.0	40.0	39.0					17																	72340956		2201	4298	6499	SO:0001819	synonymous_variant	124602			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.639C>A	17.37:g.72340956C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	ENST00000389916.4	37	CCDS32718.2																																																																																				0.672	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2		NM_153209	
LMAN1	3998	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	57026429	57026429	+	Silent	SNP	C	C	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr18:57026429C>T	ENST00000251047.5	-	1	765	c.48G>A	c.(46-48)ctG>ctA	p.L16L	RP11-27G24.1_ENST00000591331.1_lincRNA	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	16					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)	p.L16L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	AGGCGCAGAACAGCGGCCGAA	0.672																																																	1	Substitution - coding silent(1)	kidney(1)											54.0	64.0	60.0					18																	57026429		2203	4300	6503	SO:0001819	synonymous_variant	3998			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.48G>A	18.37:g.57026429C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Silent	SNP	ENST00000251047.5	37	CCDS11974.1																																																																																				0.672	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2		NM_005570	
MS4A12	54860	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	60265014	60265014	+	Missense_Mutation	SNP	C	C	G	rs146116909		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr11:60265014C>G	ENST00000016913.4	+	2	280	c.223C>G	c.(223-225)Cca>Gca	p.P75A	MS4A12_ENST00000537076.1_Missense_Mutation_p.P75A|MS4A12_ENST00000525951.1_3'UTR	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	75						integral component of membrane (GO:0016021)		p.P75A(1)		breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						AATGATAAATCCAAGTGTGGG	0.438																																																	1	Substitution - Missense(1)	kidney(1)						C	ALA/PRO,ALA/PRO	0,4406		0,0,2203	55.0	54.0	54.0		223,223	-4.7	0.0	11	dbSNP_134	54	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	MS4A12	NM_001164470.1,NM_017716.2	27,27	0,2,6501	GG,GC,CC		0.0233,0.0,0.0154	benign,benign	75/222,75/268	60265014	2,13004	2203	4300	6503	SO:0001583	missense	54860			AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.223C>G	11.37:g.60265014C>G	ENSP00000016913:p.Pro75Ala	Somatic		WXS	Illumina HiSeq	Phase_I	F5GX98|Q8N6L4	Missense_Mutation	SNP	ENST00000016913.4	37	CCDS7988.1	.	.	.	.	.	.	.	.	.	.	C	9.856	1.194925	0.22037	0.0	2.33E-4	ENSG00000071203	ENST00000537076;ENST00000526784;ENST00000016913;ENST00000530007	T;T;T;T	0.70282	0.36;-0.47;3.33;0.73	4.83	-4.68	0.03309	.	.	.	.	.	T	0.55417	0.1919	L	0.29908	0.895	0.09310	N	1	P;B	0.34639	0.461;0.197	B;B	0.39562	0.303;0.036	T	0.51942	-0.8641	9	0.40728	T	0.16	.	6.889	0.24218	0.0:0.2687:0.1351:0.5962	.	75;75	E9PNI3;Q9NXJ0	.;M4A12_HUMAN	A	75	ENSP00000440424:P75A;ENSP00000431959:P75A;ENSP00000016913:P75A;ENSP00000434783:P75A	ENSP00000016913:P75A	P	+	1	0	MS4A12	60021590	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-1.063000	0.03465	-0.783000	0.04534	0.462000	0.41574	CCA		0.438	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383627.1			
MYSM1	114803	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	59125681	59125681	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr1:59125681T>A	ENST00000472487.1	-	20	2514	c.2475A>T	c.(2473-2475)gaA>gaT	p.E825D	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	825			E -> K (in dbSNP:rs232777).		chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.E825D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					ACATTAACAATTCCTTTGTAC	0.299																																																	1	Substitution - Missense(1)	kidney(1)											78.0	76.0	76.0					1																	59125681		1805	4073	5878	SO:0001583	missense	114803			AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.2475A>T	1.37:g.59125681T>A	ENSP00000418734:p.Glu825Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	ENST00000472487.1	37	CCDS41343.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845827	0.51164	.	.	ENSG00000162601	ENST00000472487	T	0.26223	1.75	5.46	3.11	0.35812	.	0.862293	0.10295	N	0.691878	T	0.21674	0.0522	L	0.44542	1.39	0.09310	N	1	P	0.37781	0.608	B	0.32980	0.156	T	0.13019	-1.0525	10	0.66056	D	0.02	-8.4071	9.6639	0.39972	0.0:0.1612:0.0:0.8388	.	825	Q5VVJ2	MYSM1_HUMAN	D	825	ENSP00000418734:E825D	ENSP00000418734:E825D	E	-	3	2	MYSM1	58898269	0.005000	0.15991	0.588000	0.28705	0.989000	0.77384	-0.042000	0.12063	1.078000	0.41014	0.482000	0.46254	GAA		0.299	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2		XM_055481	
PARD6B	84612	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	49366663	49366664	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	AA	AA	AA	-	AA	AA	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr20:49366663_49366664delAA	ENST00000371610.2	+	3	1000_1001	c.757_758delAA	c.(757-759)aatfs	p.N254fs	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	254					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AAACCAGAGGAATAATGTTGTG	0.465																																																	0																																										SO:0001589	frameshift_variant	84612			AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.757_758delAA	20.37:g.49366663_49366664delAA	ENSP00000360672:p.Asn254fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2A7|Q9Y510	Frame_Shift_Del	DEL	ENST00000371610.2	37	CCDS33485.1																																																																																				0.465	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2		NM_032521	
PIF1	80119	hgsc.bcm.edu	37	15	65114501	65114502	+	Frame_Shift_Ins	INS	-	-	G	rs138942444		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr15:65114501_65114502insG	ENST00000268043.4	-	4	874_875	c.780_781insC	c.(778-783)gcctgcfs	p.C261fs	PIF1_ENST00000559239.1_Frame_Shift_Ins_p.C261fs|PIF1_ENST00000333425.6_Frame_Shift_Ins_p.C261fs					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						CCGATGTGGCAGGCTGCCACCC	0.619																																																	0																																										SO:0001589	frameshift_variant	80119			AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.781dupC	15.37:g.65114503_65114503dupG	ENSP00000268043:p.Cys261fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000268043.4	37	CCDS10195.2																																																																																				0.619	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1		NM_025049	
RUFY2	55680	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	70140991	70140991	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr10:70140991G>A	ENST00000602465.1	-	11	1205	c.1105C>T	c.(1105-1107)Cag>Tag	p.Q369*	RUFY2_ENST00000454950.2_Nonsense_Mutation_p.Q311*|RUFY2_ENST00000388768.2_Nonsense_Mutation_p.Q404*|RUFY2_ENST00000399200.2_Nonsense_Mutation_p.Q335*|RUFY2_ENST00000472394.2_5'UTR			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	418						nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.Q404*(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						ATCCTTACCTGCAACTTTTGA	0.318																																																	1	Substitution - Nonsense(1)	kidney(1)											126.0	115.0	118.0					10																	70140991		1822	4081	5903	SO:0001587	stop_gained	55680			AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.1105C>T	10.37:g.70140991G>A	ENSP00000473462:p.Gln369*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Nonsense_Mutation	SNP	ENST00000602465.1	37		.	.	.	.	.	.	.	.	.	.	G	38	6.868091	0.97897	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950	.	.	.	5.29	5.29	0.74685	.	0.110486	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	14.8186	0.70052	0.0:0.0:0.8556:0.1444	.	.	.	.	X	404;335;311	.	ENSP00000373420:Q404X	Q	-	1	0	RUFY2	69810997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.008000	0.70739	2.757000	0.94681	0.585000	0.79938	CAG		0.318	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467567.1		NM_017987	
SCAF4	57466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	33066569	33066569	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr21:33066569C>T	ENST00000286835.7	-	11	1652	c.1270G>A	c.(1270-1272)Gtt>Att	p.V424I	SCAF4_ENST00000399804.1_Missense_Mutation_p.V424I|SCAF4_ENST00000434667.3_Missense_Mutation_p.V409I	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	424						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V424I(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TGTCGCTTAACCTCTTGAATA	0.318																																																	1	Substitution - Missense(1)	kidney(1)											78.0	74.0	76.0					21																	33066569		2203	4298	6501	SO:0001583	missense	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.1270G>A	21.37:g.33066569C>T	ENSP00000286835:p.Val424Ile	Somatic		WXS	Illumina HiSeq	Phase_I	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	37	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481876	0.44147	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.30981	4.29;4.29;1.51	6.17	3.25	0.37280	Nucleotide-binding, alpha-beta plait (1);	0.860921	0.10482	N	0.669426	T	0.20495	0.0493	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.19817	0.011;0.039;0.019;0.011	B;B;B;B	0.17722	0.008;0.015;0.019;0.008	T	0.13124	-1.0521	10	0.37606	T	0.19	-10.6533	4.9483	0.14000	0.1184:0.6107:0.1155:0.1554	.	409;424;424;424	C9JLZ0;C9J1W7;O95104-2;O95104	.;.;.;SFR15_HUMAN	I	409;424;424	ENSP00000402377:V409I;ENSP00000286835:V424I;ENSP00000382703:V424I	ENSP00000286835:V424I	V	-	1	0	SCAF4	31988440	0.444000	0.25649	0.935000	0.37517	0.985000	0.73830	1.266000	0.33039	1.612000	0.50221	0.655000	0.94253	GTT		0.318	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1		XM_047889	
SLC17A4	10050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	25770630	25770630	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr6:25770630C>G	ENST00000377905.4	+	5	669	c.550C>G	c.(550-552)Cag>Gag	p.Q184E	SLC17A4_ENST00000397076.2_Intron|SLC17A4_ENST00000439485.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	184					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.Q184E(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ATTAACTGGTCAGTATTCAAT	0.438																																																	1	Substitution - Missense(1)	kidney(1)											142.0	152.0	149.0					6																	25770630		2203	4300	6503	SO:0001583	missense	10050			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.550C>G	6.37:g.25770630C>G	ENSP00000367137:p.Gln184Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723121	0.48728	.	.	ENSG00000146039	ENST00000377905	T	0.57436	0.4	5.37	4.41	0.53225	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.417225	0.20553	N	0.090079	T	0.31544	0.0800	M	0.75085	2.285	0.21064	N	0.999794	B	0.15473	0.013	B	0.21151	0.033	T	0.22765	-1.0207	10	0.23891	T	0.37	.	10.0524	0.42223	0.0:0.8973:0.0:0.1027	.	184	Q9Y2C5	S17A4_HUMAN	E	184	ENSP00000367137:Q184E	ENSP00000367137:Q184E	Q	+	1	0	SLC17A4	25878609	0.003000	0.15002	0.497000	0.27552	0.736000	0.42039	0.845000	0.27668	1.248000	0.43934	0.563000	0.77884	CAG		0.438	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1			
SUPT7L	9913	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27880496	27880497	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr2:27880496_27880497delAG	ENST00000337768.5	-	4	1028_1029	c.459_460delCT	c.(457-462)tcctgtfs	p.C154fs	SUPT7L_ENST00000464789.2_Frame_Shift_Del_p.C152fs|SUPT7L_ENST00000406540.1_Frame_Shift_Del_p.C152fs|SUPT7L_ENST00000404798.2_Frame_Shift_Del_p.C19fs|SUPT7L_ENST00000405491.1_Frame_Shift_Del_p.C152fs	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	154					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					AGCTGCCGACAGGAGTGCCAGC	0.55																																																	0																																										SO:0001589	frameshift_variant	9913			AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.459_460delCT	2.37:g.27880496_27880497delAG	ENSP00000336750:p.Cys154fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3W3|Q6IB21|Q9H2T6	Frame_Shift_Del	DEL	ENST00000337768.5	37	CCDS42667.1																																																																																				0.550	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324568.1		NM_014860	
VEZT	55591	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	95645766	95645766	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr12:95645766A>T	ENST00000436874.1	+	2	192	c.87A>T	c.(85-87)gaA>gaT	p.E29D	VEZT_ENST00000261219.6_5'UTR|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	29					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)		p.E29D(2)		endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						CAGACTTTGAAATATGTTCTT	0.358																																																	2	Substitution - Missense(2)	kidney(2)											126.0	121.0	122.0					12																	95645766		1852	4087	5939	SO:0001583	missense	55591			AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.87A>T	12.37:g.95645766A>T	ENSP00000410083:p.Glu29Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	ENST00000436874.1	37	CCDS44954.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347105	0.82022	.	.	ENSG00000028203	ENST00000436874;ENST00000549002;ENST00000551472;ENST00000552821;ENST00000397796	T;T;T	0.64438	1.46;0.16;-0.1	5.76	4.58	0.56647	.	0.000000	0.85682	U	0.000000	T	0.73682	0.3618	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.70016	0.918;0.967	T	0.71663	-0.4525	10	0.36615	T	0.2	-35.9006	10.4615	0.44583	0.9243:0.0:0.0757:0.0	.	29;29	C9J154;Q9HBM0	.;VEZA_HUMAN	D	29;29;48;20;29	ENSP00000410083:E29D;ENSP00000449591:E29D;ENSP00000449701:E48D	ENSP00000380898:E29D	E	+	3	2	VEZT	94169897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.950000	0.56676	0.962000	0.38057	0.533000	0.62120	GAA		0.358	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407804.2		NM_017599	
WDR72	256764	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	53908347	53908347	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr15:53908347G>C	ENST00000396328.1	-	15	2295	c.2056C>G	c.(2056-2058)Ctg>Gtg	p.L686V	WDR72_ENST00000360509.5_Missense_Mutation_p.L686V|WDR72_ENST00000557913.1_Missense_Mutation_p.L683V|WDR72_ENST00000559418.1_Missense_Mutation_p.L696V	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	686								p.L686V(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		AGGTTTTCCAGATCAAATAGA	0.423																																																	1	Substitution - Missense(1)	kidney(1)											81.0	76.0	78.0					15																	53908347		2194	4291	6485	SO:0001583	missense	256764			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2056C>G	15.37:g.53908347G>C	ENSP00000379619:p.Leu686Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	G	9.238	1.037449	0.19669	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.35421	1.31;1.31	5.23	4.31	0.51392	.	0.000000	0.56097	D	0.000032	T	0.44286	0.1286	L	0.36672	1.1	0.34779	D	0.734491	D	0.76494	0.999	D	0.80764	0.994	T	0.45716	-0.9242	10	0.08837	T	0.75	.	12.7416	0.57255	0.0799:0.0:0.9201:0.0	.	686	Q3MJ13	WDR72_HUMAN	V	686	ENSP00000379619:L686V;ENSP00000353699:L686V	ENSP00000353699:L686V	L	-	1	2	WDR72	51695639	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.258000	0.32944	1.187000	0.43000	0.313000	0.20887	CTG		0.423	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2		NM_182758	
WDR73	84942	hgsc.bcm.edu	37	15	85186877	85186894	+	In_Frame_Del	DEL	CTTGGCTCCGTGTTCCAT	CTTGGCTCCGTGTTCCAT	-	rs370347033|rs373448317|rs11267906|rs372798651|rs199676984	byFrequency	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	CTTGGCTCCGTGTTCCAT	CTTGGCTCCGTGTTCCAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr15:85186877_85186894delCTTGGCTCCGTGTTCCAT	ENST00000434634.2	-	8	1004_1021	c.944_961delATGGAACACGGAGCCAAG	c.(943-963)gatggaacacggagccaagta>gta	p.DGTRSQ315del	SCAND2P_ENST00000348993.5_RNA|WDR73_ENST00000398528.3_5'UTR	NM_032856.2	NP_116245.2	Q6P4I2	WDR73_HUMAN	WD repeat domain 73	315										cervix(1)|large_intestine(1)|lung(1)	3						AGAGGTTCTACTTGGCTCCGTGTTCCATCTTGGCTCCG	0.509														794	0.158546	0.1399	0.1383	5008	,	,		21272	0.0843		0.2038	False		,,,				2504	0.228																0										344,3500		48,248,1626						-0.4	0.0		dbSNP_120	111	1220,6750		177,866,2942	no	coding	WDR73	NM_032856.2		225,1114,4568	A1A1,A1R,RR		15.3074,8.949,13.2385				1564,10250				SO:0001651	inframe_deletion	84942			AK027200	CCDS45339.1	15q25.2	2013-01-09				ENSG00000177082		"""WD repeat domain containing"""	25928	protein-coding gene	gene with protein product						12477932	Standard	NM_032856		Approved	FLJ14888, HSPC264	uc002bkw.2	Q6P4I2		ENST00000434634.2:c.944_961delATGGAACACGGAGCCAAG	15.37:g.85186877_85186894delCTTGGCTCCGTGTTCCAT	ENSP00000387982:p.Asp315_Gln320del	Somatic		WXS	Illumina HiSeq	Phase_I	Q96JZ1|Q9P0B7	In_Frame_Del	DEL	ENST00000434634.2	37	CCDS45339.1																																																																																				0.509	WDR73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418195.1		NM_032856	
ZNF100	163227	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	21909595	21909595	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr19:21909595G>T	ENST00000358296.6	-	5	1717	c.1519C>A	c.(1519-1521)Cat>Aat	p.H507N	ZNF100_ENST00000305570.6_Missense_Mutation_p.H443N	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	507					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H507N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						TCTCCAGTATGAGTTATCTTA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											61.0	69.0	67.0					19																	21909595		2197	4291	6488	SO:0001583	missense	163227			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.1519C>A	19.37:g.21909595G>T	ENSP00000351042:p.His507Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	8.078	0.771846	0.16051	.	.	ENSG00000197020	ENST00000358296	T	0.28895	1.59	0.867	0.867	0.19085	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57519	0.2059	M	0.91612	3.225	0.30950	N	0.724897	D;D	0.89917	0.999;1.0	D;D	0.97110	1.0;0.997	T	0.57963	-0.7720	9	0.87932	D	0	.	6.4243	0.21760	0.0:0.3102:0.6898:0.0	.	507;561	Q8IYN0;Q4G131	ZN100_HUMAN;.	N	507	ENSP00000351042:H507N	ENSP00000351042:H507N	H	-	1	0	ZNF100	21701435	1.000000	0.71417	0.080000	0.20451	0.078000	0.17371	3.867000	0.56047	0.284000	0.22305	0.289000	0.19496	CAT		0.373	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1		NM_173531	
ZSCAN16	80345	hgsc.bcm.edu;ucsc.edu	37	6	28093441	28093441	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr6:28093441delT	ENST00000340487.4	+	2	369	c.220delT	c.(220-222)tgcfs	p.C74fs	ZSCAN16-AS1_ENST00000600652.1_RNA|ZSCAN16-AS1_ENST00000602810.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	74	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GAGGCCAGAATGCCACACCAA	0.542																																																	0													142.0	135.0	137.0					6																	28093441		2203	4300	6503	SO:0001589	frameshift_variant	80345			AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.220delT	6.37:g.28093441delT	ENSP00000366527:p.Cys74fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H6K2	Frame_Shift_Del	DEL	ENST00000340487.4	37	CCDS4644.1																																																																																				0.542	ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040177.1		NM_025231	
GOLGA6L5P	374650	broad.mit.edu	37	15	85056021	85056021	+	RNA	SNP	T	T	C	rs1062001		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr15:85056021T>C	ENST00000560239.1	-	0	984				GOLGA6L5_ENST00000414190.2_RNA																							GTAGCTGCTCTACCTTAGATG	0.502																																																	0																																												374650																															15.37:g.85056021T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000560239.1	37																																																																																					0.502	RP11-182J1.12-001	KNOWN	mRNA_end_NF|basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000418581.1			
IGSF21	84966	broad.mit.edu	37	1	18688657	18688657	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr1:18688657T>C	ENST00000251296.1	+	5	856	c.473T>C	c.(472-474)tTc>tCc	p.F158S		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	158						extracellular region (GO:0005576)		p.F158S(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CCAGCCCCCTTCAGCCGCTAC	0.582																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.473T>C	1.37:g.18688657T>C	ENSP00000251296:p.Phe158Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455454	0.63401	.	.	ENSG00000117154	ENST00000251296	T	0.74209	-0.82	4.58	4.58	0.56647	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.65954	0.2741	L	0.34521	1.04	0.80722	D	1	B	0.30542	0.284	B	0.33521	0.165	T	0.66999	-0.5781	10	0.49607	T	0.09	-8.405	13.04	0.58893	0.0:0.0:0.0:1.0	.	158	Q96ID5	IGS21_HUMAN	S	158	ENSP00000251296:F158S	ENSP00000251296:F158S	F	+	2	0	IGSF21	18561244	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.555000	0.82223	1.841000	0.53522	0.402000	0.26972	TTC		0.582	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1		NM_032880	
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	TCGCTGTCGCCA	TCGCTGTCGCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374																2	Deletion - In frame(2)	large_intestine(1)|breast(1)								958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				SO:0001651	inframe_deletion	256949			AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic		WXS	Illumina GAIIx	Phase_I	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	ENST00000593649.1	37																																																																																					0.717	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1		NM_198471	
NCF1C	654817	broad.mit.edu	37	7	74573755	74573755	+	IGR	SNP	G	G	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr7:74573755G>T								GTF2IRD2B (8132 upstream) : Y_RNA (139091 downstream)																							TGGACGGAAAGTAGCCTGTGA	0.652																																																	0																																										SO:0001628	intergenic_variant	654817																															7.37:g.74573755G>T		Somatic		WXS	Illumina GAIIx	Phase_I		Nonsense_Mutation	SNP		37																																																																																				0	0.652									
TMEM199	147007	broad.mit.edu	37	17	26684390	26684391	+	5'Flank	INS	-	-	C	rs11448856|rs67934205		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr17:26684390_26684391insC	ENST00000292114.3	+	0	0				TMEM199_ENST00000395404.3_5'Flank|TMEM199_ENST00000509083.1_5'Flank|POLDIP2_ENST00000540200.1_Frame_Shift_Ins_p.P28fs|CTB-96E2.3_ENST00000591482.1_RNA|POLDIP2_ENST00000003607.4_5'UTR	NM_152464.1	NP_689677.1	Q8N511	TM199_HUMAN	transmembrane protein 199							integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GCACAGAGCGGCTTTGCCACCG	0.762													?|C|CC|unsure	5008	1.0	1.0	1.0	5008	,	,		11683	1.0		1.0	False		,,,				2504	1.0																0										2752,40		1369,14,13						3.8	0.1		dbSNP_130	4	6434,100		3190,54,23	no	frameshift	POLDIP2	NM_015584.3		4559,68,36	A1A1,A1R,RR		1.5305,1.4327,1.5012				9186,140				SO:0001631	upstream_gene_variant	26073			AY074907	CCDS11228.1	17q11.2	2007-12-17	2007-12-17	2007-12-17	ENSG00000244045	ENSG00000244045			18085	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 32"""	C17orf32			Standard	NM_152464		Approved	MGC45714	uc002hba.3	Q8N511	OTTHUMG00000132498		17.37:g.26684391_26684391dupC	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_I		Splice_Site	INS	ENST00000292114.3	37	CCDS11228.1																																																																																				0.762	TMEM199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255676.2		NM_152464	
RECQL5	9400	broad.mit.edu	37	17	73626918	73626919	+	Splice_Site	INS	-	-	TG	rs377391469|rs142406301		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr17:73626918_73626919insTG	ENST00000317905.5	-	12	1745		c.e12-1		SMIM5_ENST00000375215.3_5'Flank|RECQL5_ENST00000443199.2_Splice_Site|RECQL5_ENST00000423245.2_Splice_Site	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)	p.?(1)		breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGGG	0.644								Other identified genes with known or suspected DNA repair function																																									1	Unknown(1)	upper_aerodigestive_tract(1)																																								SO:0001630	splice_region_variant	9400			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1586-1->CA	17.37:g.73626921_73626922dupTG		Somatic		WXS	Illumina GAIIx	Phase_I	Q9H0B1|Q9P1W7|Q9UNC8	Splice_Site	INS	ENST00000317905.5	37	CCDS42380.1																																																																																				0.644	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1		NM_004259	Intron
TBC1D10B	26000	broad.mit.edu	37	16	30380671	30380671	+	Silent	SNP	C	C	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr16:30380671C>T	ENST00000409939.3	-	1	914	c.834G>A	c.(832-834)ggG>ggA	p.G278G		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	278					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)	p.G278G(1)|p.G3G(1)		endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			ACTCCAAGGTCCCAGACATGA	0.617																																																	2	Substitution - coding silent(2)	kidney(2)											37.0	29.0	31.0					16																	30380671		2197	4300	6497	SO:0001819	synonymous_variant	26000			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.834G>A	16.37:g.30380671C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Silent	SNP	ENST00000409939.3	37	CCDS10676.2																																																																																				0.617	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3		NM_015527	
MTOR	2475	broad.mit.edu	37	1	11217230	11217230	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	830e29e4-acf5-4247-b2d4-c19ad859820f	42a08dce-9507-40d4-80f8-9b0f18ddd0c4	g.chr1:11217230C>A	ENST00000361445.4	-	30	4524	c.4448G>T	c.(4447-4449)tGc>tTc	p.C1483F		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1483	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.C1483F(2)|p.C1483Y(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GGCCTCGAGGCAGCGCATGCG	0.527																																						.											3	Substitution - Missense(3)	kidney(3)											191.0	177.0	182.0					1																	11217230		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4448G>T	1.37:g.11217230C>A	ENSP00000354558:p.Cys1483Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600766	0.87055	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.69806	-0.43	5.32	5.32	0.75619	PIK-related kinase (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82047	0.4952	M	0.91920	3.255	0.80722	D	1	D	0.59357	0.985	P	0.52627	0.704	D	0.86849	0.2022	10	0.87932	D	0	-11.9694	19.0009	0.92834	0.0:1.0:0.0:0.0	.	1483	P42345	MTOR_HUMAN	F	1483	ENSP00000354558:C1483F	ENSP00000354558:C1483F	C	-	2	0	MTOR	11139817	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.414000	0.80117	2.486000	0.83907	0.655000	0.94253	TGC		0.527	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
