#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACSS1	84532	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	25011448	25011448	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr20:25011448G>A	ENST00000323482.4	-	3	657	c.578C>T	c.(577-579)aCa>aTa	p.T193I	ACSS1_ENST00000537502.1_Missense_Mutation_p.T110I|ACSS1_ENST00000432802.2_Missense_Mutation_p.T193I|ACSS1_ENST00000542618.1_Missense_Mutation_p.T72I	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	193					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.T193I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AAAGATGACTGTGTGGACAGC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											111.0	89.0	97.0					20																	25011448		2203	4300	6503	SO:0001583	missense	84532				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.578C>T	20.37:g.25011448G>A	ENSP00000316924:p.Thr193Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Missense_Mutation	SNP	ENST00000323482.4	37	CCDS13167.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543470	0.65198	.	.	ENSG00000154930	ENST00000323482;ENST00000376727;ENST00000537502;ENST00000432802;ENST00000542618	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.95	2.85	0.33270	AMP-dependent synthetase/ligase (1);	0.336722	0.33854	N	0.004488	T	0.54615	0.1869	L	0.43152	1.355	0.58432	D	0.999996	D;P;P;P	0.76494	0.999;0.839;0.867;0.843	D;P;P;P	0.71184	0.972;0.642;0.756;0.702	T	0.56032	-0.8046	10	0.87932	D	0	-38.6297	14.2405	0.65954	0.0:0.0:0.6103:0.3897	.	193;193;193;110	E9PC79;Q9NUB1-2;Q9NUB1;Q6ZV30	.;.;ACS2L_HUMAN;.	I	193;193;110;193;72	ENSP00000316924:T193I;ENSP00000439304:T110I;ENSP00000388793:T193I;ENSP00000437657:T72I	ENSP00000316924:T193I	T	-	2	0	ACSS1	24959448	0.971000	0.33674	0.394000	0.26270	0.918000	0.54935	1.648000	0.37271	0.364000	0.24374	0.655000	0.94253	ACA		0.597	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078386.2		NM_032501	
ANKRD6	22881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	90338835	90338835	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr6:90338835delC	ENST00000522441.1	+	15	2131	c.1490delC	c.(1489-1491)tccfs	p.S497fs	ANKRD6_ENST00000369408.5_Frame_Shift_Del_p.S462fs|ANKRD6_ENST00000447838.2_Frame_Shift_Del_p.S497fs|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000520793.1_Frame_Shift_Del_p.S438fs|ANKRD6_ENST00000339746.4_Frame_Shift_Del_p.S497fs	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	497					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		TTTAAGATATCCTTGGTGGAT	0.358																																																	0													55.0	54.0	55.0					6																	90338835		1803	4072	5875	SO:0001589	frameshift_variant	22881			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1490delC	6.37:g.90338835delC	ENSP00000430985:p.Ser497fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Frame_Shift_Del	DEL	ENST00000522441.1	37	CCDS56441.1																																																																																				0.358	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1			
BRD1	23774	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	50187702	50187702	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr22:50187702C>A	ENST00000216267.8	-	6	2825	c.2339G>T	c.(2338-2340)gGg>gTg	p.G780V	BRD1_ENST00000342989.5_Missense_Mutation_p.G375V|BRD1_ENST00000404034.1_Missense_Mutation_p.G780V|BRD1_ENST00000542442.1_Missense_Mutation_p.G468V|BRD1_ENST00000404760.1_Missense_Mutation_p.G780V|BRD1_ENST00000457780.2_Missense_Mutation_p.G780V	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	780					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.G780V(1)|p.G375V(1)		endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGCCTCCGGCCCCAGCGCAGC	0.662																																																	2	Substitution - Missense(2)	kidney(2)											32.0	36.0	34.0					22																	50187702		2203	4300	6503	SO:0001583	missense	23774			AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2339G>T	22.37:g.50187702C>A	ENSP00000216267:p.Gly780Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	37	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	C	9.582	1.123765	0.20959	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780;ENST00000542442;ENST00000342989;ENST00000419212	T;T;T;T;T;T	0.29397	2.55;2.55;2.62;2.4;1.57;2.04	5.4	1.76	0.24704	.	0.904569	0.09766	N	0.758684	T	0.20373	0.0490	L	0.32530	0.975	0.09310	N	0.999998	B;B;B;B	0.18610	0.012;0.029;0.02;0.02	B;B;B;B	0.12837	0.006;0.006;0.006;0.008	T	0.27400	-1.0075	10	0.35671	T	0.21	.	3.9573	0.09395	0.0:0.1847:0.4516:0.3637	.	780;375;780;780	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	V	780;780;780;780;468;375;240	ENSP00000216267:G780V;ENSP00000384076:G780V;ENSP00000385858:G780V;ENSP00000410042:G780V;ENSP00000437514:G468V;ENSP00000345886:G375V	ENSP00000216267:G780V	G	-	2	0	BRD1	48573706	0.805000	0.28982	0.435000	0.26784	0.374000	0.29953	1.078000	0.30754	0.180000	0.19960	0.655000	0.94253	GGG		0.662	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1		NM_014577	
BRD9	65980	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	864640	864640	+	Silent	SNP	G	G	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr5:864640G>T	ENST00000467963.1	-	16	1903	c.1737C>A	c.(1735-1737)acC>acA	p.T579T	BRD9_ENST00000483173.1_Silent_p.T526T|BRD9_ENST00000323510.4_Silent_p.T483T|BRD9_ENST00000388890.4_Silent_p.T463T	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	579					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)	p.T483T(1)|p.T579T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			AGGGGTCGTGGGTGACGTCTG	0.512																																																	2	Substitution - coding silent(2)	kidney(2)											74.0	77.0	76.0					5																	864640		2203	4300	6503	SO:0001819	synonymous_variant	65980			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1737C>A	5.37:g.864640G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Silent	SNP	ENST00000467963.1	37	CCDS34127.2																																																																																				0.512	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1		NM_023924	
C2orf49	79074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	105959481	105959481	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr2:105959481G>A	ENST00000258457.2	+	3	672	c.443G>A	c.(442-444)aGt>aAt	p.S148N	C2orf49_ENST00000410049.1_Intron|C2orf49_ENST00000437250.2_Intron			Q9BVC5	ASHWN_HUMAN	chromosome 2 open reading frame 49	148					embryonic morphogenesis (GO:0048598)	tRNA-splicing ligase complex (GO:0072669)		p.S148N(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6						TCCTCTTCGAGTGTTTCACCC	0.393																																																	1	Substitution - Missense(1)	kidney(1)											115.0	113.0	114.0					2																	105959481		2203	4300	6503	SO:0001583	missense	79074			BC001310	CCDS2068.1, CCDS74550.1	2q12.2	2009-04-22			ENSG00000135974	ENSG00000135974			28772	protein-coding gene	gene with protein product	"""ashwin"""					12477932	Standard	NM_001286537		Approved	MGC5509, asw	uc002tcs.1	Q9BVC5	OTTHUMG00000130808	ENST00000258457.2:c.443G>A	2.37:g.105959481G>A	ENSP00000258457:p.Ser148Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXN3|B4E2G9	Missense_Mutation	SNP	ENST00000258457.2	37	CCDS2068.1	.	.	.	.	.	.	.	.	.	.	G	5.842	0.339498	0.11069	.	.	ENSG00000135974	ENST00000258457	T	0.48836	0.8	4.6	-2.37	0.06643	.	1.437920	0.03884	N	0.277570	T	0.26919	0.0659	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11891	-1.0569	10	0.02654	T	1	0.9307	0.7941	0.01063	0.4283:0.1363:0.1607:0.2748	.	148	Q9BVC5	ASHWN_HUMAN	N	148	ENSP00000258457:S148N	ENSP00000258457:S148N	S	+	2	0	C2orf49	105325913	0.861000	0.29849	0.153000	0.22517	0.985000	0.73830	0.532000	0.23067	-0.351000	0.08249	0.650000	0.86243	AGT		0.393	C2orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253353.2		NM_024093	
CACNG5	27091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	64880873	64880873	+	Intron	SNP	A	A	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr17:64880873A>G	ENST00000533854.1	+	5	807				CACNG5_ENST00000307139.3_Intron|CACNG5_ENST00000169565.3_Missense_Mutation_p.Q222R			Q9UF02	CCG5_HUMAN	calcium channel, voltage-dependent, gamma subunit 5						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ion transmembrane transporter activity (GO:0015075)|voltage-gated calcium channel activity (GO:0005245)	p.Q222R(1)		NS(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	24			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GACATTCCACAACCATTTTGG	0.592																																																	1	Substitution - Missense(1)	kidney(1)											112.0	100.0	104.0					17																	64880873		2203	4300	6503	SO:0001627	intron_variant	27091			AF148220	CCDS11665.1	17q24	2004-02-16				ENSG00000075429		"""Calcium channel subunits"""	1409	protein-coding gene	gene with protein product		606405				10613843	Standard	NM_145811		Approved		uc010wqj.2	Q9UF02		ENST00000533854.1:c.570+95A>G	17.37:g.64880873A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K2A6|Q547R3|Q8WXS7|Q9UHM3	Missense_Mutation	SNP	ENST00000533854.1	37	CCDS11665.1	.	.	.	.	.	.	.	.	.	.	A	8.861	0.946981	0.18356	.	.	ENSG00000075429	ENST00000169565	T	0.50548	0.74	2.49	-1.39	0.08997	.	0.593291	0.17569	N	0.169547	T	0.28896	0.0717	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.15037	-1.0451	6	.	.	.	.	2.9214	0.05770	0.4482:0.2455:0.3062:0.0	.	.	.	.	R	222	ENSP00000169565:Q222R	.	Q	+	2	0	CACNG5	62311335	0.288000	0.24324	0.000000	0.03702	0.004000	0.04260	0.940000	0.28992	-0.353000	0.08224	-0.487000	0.04747	CAA		0.592	CACNG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389882.1		NM_014404, NM_145811	
CDH12	1010	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	21783501	21783501	+	Silent	SNP	C	C	T	rs371565243		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr5:21783501C>T	ENST00000382254.1	-	11	2445	c.1359G>A	c.(1357-1359)gcG>gcA	p.A453A	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Silent_p.A413A|CDH12_ENST00000504376.2_Silent_p.A453A	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	453	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A453A(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AATTATACTGCGCAGTGCTTT	0.373										HNSCC(59;0.17)																																							1	Substitution - coding silent(1)	kidney(1)						C		0,4406		0,0,2203	183.0	179.0	181.0		1359	-10.9	0.0	5		181	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CDH12	NM_004061.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		453/795	21783501	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1010			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1359G>A	5.37:g.21783501C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	CCDS3890.1																																																																																				0.373	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1		NM_004061	
CLEC16A	23274	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	11217730	11217730	+	Silent	SNP	C	C	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr16:11217730C>G	ENST00000409790.1	+	21	2630	c.2400C>G	c.(2398-2400)cgC>cgG	p.R800R	CLEC16A_ENST00000409552.3_Silent_p.R782R|CLEC16A_ENST00000465491.1_3'UTR|CLEC16A_ENST00000381822.2_5'Flank	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)|p.R800R(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						ACCACATCCGCTGCATCATCG	0.612																																																	2	Whole gene deletion(1)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)|kidney(1)											49.0	54.0	52.0					16																	11217730		2110	4237	6347	SO:0001819	synonymous_variant	23274			AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.2400C>G	16.37:g.11217730C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000409790.1	37	CCDS45409.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.515943	0.27123	.	.	ENSG00000038532	ENST00000428742	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.74642	0.3743	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72903	-0.4151	4	.	.	.	-23.0326	18.5026	0.90887	0.0:1.0:0.0:0.0	.	.	.	.	G	44	.	.	A	+	2	0	CLEC16A	11125231	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.933000	0.56545	2.618000	0.88619	0.655000	0.94253	GCT		0.612	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2		NM_015226	
COL24A1	255631	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	86453338	86453338	+	Splice_Site	SNP	C	C	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr1:86453338C>A	ENST00000370571.2	-	20	2677		c.e20-1		COL24A1_ENST00000436319.1_Splice_Site	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1						extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.?(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGGAAAACCCTAGGGAATAT	0.358																																																	1	Unknown(1)	kidney(1)											57.0	56.0	56.0					1																	86453338		1805	4070	5875	SO:0001630	splice_region_variant	255631			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2311-1G>T	1.37:g.86453338C>A		Somatic		WXS	Illumina HiSeq	Phase_I	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Splice_Site	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.842102	0.71488	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8327	0.70159	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL24A1	86225926	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	4.104000	0.57790	2.561000	0.86390	0.591000	0.81541	.		0.358	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4		NM_152890	Intron
CUL3	8452	hgsc.bcm.edu;ucsc.edu	37	2	225370726	225370727	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr2:225370726_225370727delGA	ENST00000264414.4	-	8	1490_1491	c.1152_1153delTC	c.(1150-1155)tctcctfs	p.P385fs	CUL3_ENST00000344951.4_Frame_Shift_Del_p.P319fs|CUL3_ENST00000409096.1_Frame_Shift_Del_p.P361fs|CUL3_ENST00000409777.1_Frame_Shift_Del_p.P361fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	385					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		AGGTATTCAGGAGACCTGGAGT	0.356																																																	0																																										SO:0001589	frameshift_variant	8452			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1152_1153delTC	2.37:g.225370728_225370729delGA	ENSP00000264414:p.Pro385fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	37	CCDS2462.1																																																																																				0.356	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2			
DEDD	9191	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	161093979	161093979	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr1:161093979T>A	ENST00000368006.3	-	3	488	c.274A>T	c.(274-276)Atc>Ttc	p.I92F	DEDD_ENST00000368005.1_Missense_Mutation_p.I92F|DEDD_ENST00000490843.2_Missense_Mutation_p.I92F|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000458050.2_Missense_Mutation_p.I92F|DEDD_ENST00000392188.1_Missense_Mutation_p.I92F|NIT1_ENST00000368008.1_3'UTR|DEDD_ENST00000545495.1_Missense_Mutation_p.I92F	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	92	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)	p.I92F(1)		cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGGCGAGTGATGATGCGCAGC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											82.0	75.0	77.0					1																	161093979		2203	4300	6503	SO:0001583	missense	9191			AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.274A>T	1.37:g.161093979T>A	ENSP00000356985:p.Ile92Phe	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVF5|O60737	Missense_Mutation	SNP	ENST00000368006.3	37	CCDS1219.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.148729	0.78001	.	.	ENSG00000158796	ENST00000368006;ENST00000392188;ENST00000545495;ENST00000458050;ENST00000541906;ENST00000368005;ENST00000535389	.	.	.	5.66	3.21	0.36854	DEATH-like (2);Death effector (3);	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	L	0.46157	1.445	0.80722	D	1	P;D;D	0.69078	0.926;0.997;0.986	B;D;P	0.64321	0.423;0.924;0.757	T	0.57388	-0.7820	9	0.72032	D	0.01	.	6.6393	0.22901	0.0:0.082:0.1546:0.7633	.	49;92;92	B4DKM1;B1AQP5;O75618	.;.;DEDD_HUMAN	F	92;92;92;92;92;92;49	.	ENSP00000356984:I92F	I	-	1	0	DEDD	159360603	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.589000	0.67523	0.980000	0.38523	-0.256000	0.11100	ATC		0.577	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080582.1		NM_004216	
EDN3	1908	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	57876745	57876745	+	Silent	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr20:57876745C>T	ENST00000337938.2	+	2	719	c.333C>T	c.(331-333)tgC>tgT	p.C111C	EDN3_ENST00000395654.3_Silent_p.C111C|EDN3_ENST00000371028.2_Silent_p.C111C|EDN3_ENST00000311585.7_Silent_p.C111C|EDN3_ENST00000371025.3_Silent_p.C111C	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	111					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.C111C(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					TCTACTATTGCCACCTGGACA	0.607																																																	2	Substitution - coding silent(2)	kidney(2)											163.0	126.0	138.0					20																	57876745		2203	4300	6503	SO:0001819	synonymous_variant	1908			X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.333C>T	20.37:g.57876745C>T		Somatic		WXS	Illumina HiSeq	Phase_I	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Silent	SNP	ENST00000337938.2	37	CCDS13477.1																																																																																				0.607	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2		NM_000114	
FBXO40	51725	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	121340772	121340772	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr3:121340772G>T	ENST00000338040.4	+	3	910	c.496G>T	c.(496-498)Gtg>Ttg	p.V166L		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	166					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V166L(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		TGAAACCAGTGTGGAGGAAAT	0.483																																																	1	Substitution - Missense(1)	kidney(1)											115.0	123.0	121.0					3																	121340772		2203	4300	6503	SO:0001583	missense	51725			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.496G>T	3.37:g.121340772G>T	ENSP00000337510:p.Val166Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.740529	0.00675	.	.	ENSG00000163833	ENST00000338040	T	0.40225	1.04	4.93	1.18	0.20946	.	0.806546	0.11880	N	0.520569	T	0.12817	0.0311	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32134	-0.9918	10	0.10377	T	0.69	-0.6131	5.6164	0.17434	0.0:0.0917:0.3473:0.561	.	166	Q9UH90	FBX40_HUMAN	L	166	ENSP00000337510:V166L	ENSP00000337510:V166L	V	+	1	0	FBXO40	122823462	0.631000	0.27164	0.124000	0.21820	0.000000	0.00434	1.358000	0.34102	0.056000	0.16144	-1.036000	0.02392	GTG		0.483	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1		NM_016298	
GPATCH4	54865	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	156565621	156565621	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr1:156565621G>T	ENST00000438976.2	-	8	542	c.512C>A	c.(511-513)aCa>aAa	p.T171K	GPATCH4_ENST00000368232.4_Missense_Mutation_p.T166K|GPATCH4_ENST00000497287.1_5'UTR			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	166							poly(A) RNA binding (GO:0044822)	p.T166K(1)		autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCCTTCATTGTGATCCCAAG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											21.0	22.0	22.0					1																	156565621		2171	4257	6428	SO:0001583	missense	54865			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.512C>A	1.37:g.156565621G>T	ENSP00000396441:p.Thr171Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Missense_Mutation	SNP	ENST00000438976.2	37	CCDS44245.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584118	0.65992	.	.	ENSG00000160818	ENST00000368232;ENST00000368229;ENST00000438976;ENST00000415314	T;T;T	0.42513	0.97;0.97;0.97	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.47266	0.1436	L	0.35542	1.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.29792	-1.0000	10	0.38643	T	0.18	-20.5267	18.6835	0.91556	0.0:0.0:1.0:0.0	.	171;166	E9PAV9;Q5T3I0	.;GPTC4_HUMAN	K	166;166;171;137	ENSP00000357215:T166K;ENSP00000396441:T171K;ENSP00000412620:T137K	ENSP00000357212:T166K	T	-	2	0	GPATCH4	154832245	1.000000	0.71417	0.840000	0.33206	0.779000	0.44077	5.900000	0.69853	2.757000	0.94681	0.655000	0.94253	ACA		0.597	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386947.1		NM_017725	
GPR78	27201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	8584302	8584302	+	Missense_Mutation	SNP	G	G	A	rs202089891		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr4:8584302G>A	ENST00000382487.4	+	2	1130	c.713G>A	c.(712-714)cGc>cAc	p.R238H	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	238					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R238H(1)		central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						CGCCGCCACCGCGCCACCAGG	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18078	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											124.0	104.0	111.0					4																	8584302		2203	4300	6503	SO:0001583	missense	27201			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.713G>A	4.37:g.8584302G>A	ENSP00000371927:p.Arg238His	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NGV3	Missense_Mutation	SNP	ENST00000382487.4	37	CCDS3403.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.69	2.909159	0.52439	.	.	ENSG00000155269	ENST00000382487	T	0.43688	0.94	2.33	-0.039	0.13878	GPCR, rhodopsin-like superfamily (1);	0.075120	0.46758	U	0.000269	T	0.48370	0.1496	L	0.54323	1.7	0.09310	N	1	D	0.64830	0.994	P	0.60541	0.876	T	0.42481	-0.9449	10	0.87932	D	0	.	6.6738	0.23083	0.2798:0.0:0.7202:0.0	.	238	Q96P69	GPR78_HUMAN	H	238	ENSP00000371927:R238H	ENSP00000371927:R238H	R	+	2	0	GPR78	8635202	0.098000	0.21812	0.000000	0.03702	0.001000	0.01503	1.431000	0.34925	-0.451000	0.07097	-0.253000	0.11424	CGC		0.627	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1			
HMHA1	23526	hgsc.bcm.edu	37	19	1067422	1067422	+	Silent	SNP	A	A	G	rs76139012	byFrequency	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr19:1067422A>G	ENST00000313093.2	+	1	249	c.18A>G	c.(16-18)aaA>aaG	p.K6K	HMHA1_ENST00000590214.1_Silent_p.K6K|HMHA1_ENST00000539243.2_Intron|HMHA1_ENST00000536472.1_5'UTR|HMHA1_ENST00000586866.1_5'Flank	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	6					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGGAAGAAACGAGAGCTCA	0.697													A|||	71	0.0141773	0.0023	0.0274	5008	,	,		10370	0.0		0.0378	False		,,,				2504	0.0112																0								A		30,4338		0,30,2154	12.0	13.0	13.0		18	-0.1	1.0	19	dbSNP_131	13	348,8198		6,336,3931	no	coding-synonymous	HMHA1	NM_012292.2		6,366,6085	GG,GA,AA		4.0721,0.6868,2.9271		6/1137	1067422	378,12536	2184	4273	6457	SO:0001819	synonymous_variant	23526			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.18A>G	19.37:g.1067422A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Silent	SNP	ENST00000313093.2	37	CCDS32863.1																																																																																				0.697	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1			
KIDINS220	57498	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	8953448	8953448	+	Silent	SNP	A	A	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr2:8953448A>C	ENST00000256707.3	-	5	505	c.324T>G	c.(322-324)ctT>ctG	p.L108L	KIDINS220_ENST00000427284.1_Silent_p.L108L|KIDINS220_ENST00000473731.1_Silent_p.L108L|KIDINS220_ENST00000319688.5_Silent_p.L108L|KIDINS220_ENST00000418530.1_Silent_p.L66L	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	108					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.L108L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGCCCACATAAGAGCTGTCC	0.378																																																	1	Substitution - coding silent(1)	kidney(1)											146.0	134.0	138.0					2																	8953448		1888	4127	6015	SO:0001819	synonymous_variant	57498			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.324T>G	2.37:g.8953448A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	ENST00000256707.3	37	CCDS42650.1																																																																																				0.378	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2		NM_020738	
KNDC1	85442	broad.mit.edu;hgsc.bcm.edu	37	10	135012532	135012532	+	Silent	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr10:135012532G>A	ENST00000304613.3	+	14	2541	c.2520G>A	c.(2518-2520)ccG>ccA	p.P840P	KNDC1_ENST00000368571.2_Silent_p.P775P|KNDC1_ENST00000368572.2_Silent_p.P840P			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	840	Pro-rich.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.P840P(1)		NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCGAGCGCCCGGGCCAGGAGC	0.766																																																	1	Substitution - coding silent(1)	kidney(1)											4.0	6.0	5.0					10																	135012532		1953	3892	5845	SO:0001819	synonymous_variant	85442			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2520G>A	10.37:g.135012532G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																				0.766	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3		NM_152643	
MAPK8IP1	9479	broad.mit.edu;hgsc.bcm.edu	37	11	45925587	45925587	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:45925587C>A	ENST00000241014.2	+	7	1711	c.1541C>A	c.(1540-1542)cCt>cAt	p.P514H	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.P504H	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	514	Interaction with VRK2.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.P514H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GTGGATGACCCTCTGCTAGTG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											126.0	112.0	117.0					11																	45925587		2203	4299	6502	SO:0001583	missense	9479				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1541C>A	11.37:g.45925587C>A	ENSP00000241014:p.Pro514His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQP4|O43407	Missense_Mutation	SNP	ENST00000241014.2	37	CCDS7916.1	.	.	.	.	.	.	.	.	.	.	C	32	5.146342	0.94603	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.49139	0.79;0.79	5.25	5.25	0.73442	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.67363	0.2885	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69525	-0.5122	10	0.87932	D	0	-17.4084	19.2152	0.93774	0.0:1.0:0.0:0.0	.	514	Q9UQF2	JIP1_HUMAN	H	514;504	ENSP00000241014:P514H;ENSP00000378991:P504H	ENSP00000241014:P514H	P	+	2	0	MAPK8IP1	45882163	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	7.776000	0.85560	2.616000	0.88540	0.561000	0.74099	CCT		0.577	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259405.1		NM_005456	
MRPS18A	55168	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43642986	43642986	+	Silent	SNP	A	A	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr6:43642986A>T	ENST00000372133.3	-	5	410	c.399T>A	c.(397-399)ccT>ccA	p.P133P	MRPS18A_ENST00000372116.1_Intron	NM_018135.3	NP_060605.1	Q9NVS2	RT18A_HUMAN	mitochondrial ribosomal protein S18A	133					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)	p.P133P(1)		kidney(3)|large_intestine(1)	4	all_cancers(18;6.56e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000479)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0102)|OV - Ovarian serous cystadenocarcinoma(102;0.137)			CAGGAAGCCGAGGCCTGTGAT	0.562																																																	1	Substitution - coding silent(1)	kidney(1)											112.0	106.0	108.0					6																	43642986		2203	4300	6503	SO:0001819	synonymous_variant	55168			AB049952	CCDS4906.1, CCDS55006.1	6p21.3	2012-09-13			ENSG00000096080	ENSG00000096080		"""Mitochondrial ribosomal proteins / small subunits"""	14515	protein-coding gene	gene with protein product		611981				11279123, 11543634	Standard	NM_018135		Approved	FLJ10548, MRPS18-3	uc003ovy.2	Q9NVS2	OTTHUMG00000014750	ENST00000372133.3:c.399T>A	6.37:g.43642986A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6XND3|Q5QPA4	Silent	SNP	ENST00000372133.3	37	CCDS4906.1																																																																																				0.562	MRPS18A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040697.1		NM_018135	
MS4A10	341116	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	60561455	60561455	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:60561455G>A	ENST00000308287.1	+	5	467	c.371G>A	c.(370-372)tGc>tAc	p.C124Y		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	124						integral component of membrane (GO:0016021)		p.C124Y(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						AAGATGTTGTGCCTGATGACA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											144.0	128.0	133.0					11																	60561455		2203	4299	6502	SO:0001583	missense	341116			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.371G>A	11.37:g.60561455G>A	ENSP00000311862:p.Cys124Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP45|Q96PG3	Missense_Mutation	SNP	ENST00000308287.1	37	CCDS7992.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.209239	0.39003	.	.	ENSG00000172689	ENST00000308287	T	0.02280	4.36	4.87	3.9	0.45041	.	0.000000	0.41938	D	0.000784	T	0.08179	0.0204	L	0.51422	1.61	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03268	-1.1054	10	0.54805	T	0.06	-13.3821	11.9582	0.52993	0.0:0.1922:0.8078:0.0	.	124	Q96PG2	M4A10_HUMAN	Y	124	ENSP00000311862:C124Y	ENSP00000311862:C124Y	C	+	2	0	MS4A10	60318031	0.006000	0.16342	0.284000	0.24805	0.004000	0.04260	1.324000	0.33712	2.246000	0.74042	0.655000	0.94253	TGC		0.512	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1		NM_206893	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11217299	11217299	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr1:11217299A>G	ENST00000361445.4	-	30	4455	c.4379T>C	c.(4378-4380)cTt>cCt	p.L1460P		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1460	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.L1460P(2)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ATAGGCCACAAGGGCATCCTC	0.547																																																	2	Substitution - Missense(2)	kidney(2)											165.0	135.0	145.0					1																	11217299		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4379T>C	1.37:g.11217299A>G	ENSP00000354558:p.Leu1460Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.926312	0.73327	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	D	0.81659	-1.52	5.69	4.55	0.56014	PIK-related kinase (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	D	0.83862	0.5346	M	0.91406	3.205	0.80722	D	1	P	0.48407	0.91	B	0.41271	0.352	D	0.85851	0.1404	10	0.87932	D	0	.	12.0845	0.53690	0.8709:0.0:0.0:0.1291	.	1460	P42345	MTOR_HUMAN	P	1460	ENSP00000354558:L1460P	ENSP00000354558:L1460P	L	-	2	0	MTOR	11139886	1.000000	0.71417	0.028000	0.17463	0.806000	0.45545	8.871000	0.92346	0.955000	0.37878	0.533000	0.62120	CTT		0.547	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MUC2	4583	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1078457	1078457	+	Splice_Site	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:1078457G>A	ENST00000441003.2	+	6	692	c.665G>A	c.(664-666)cGc>cAc	p.R222H	MUC2_ENST00000359061.5_Splice_Site_p.R222H	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	222	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.R222H(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGTCCCCAGCGCGCCGAGTGT	0.697																																																	2	Substitution - Missense(2)	kidney(2)											15.0	21.0	19.0					11																	1078457		2021	4166	6187	SO:0001630	splice_region_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.664-1G>A	11.37:g.1078457G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	12.89	2.072269	0.36566	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.77098	-1.07;-1.07	3.7	2.72	0.32119	.	1.098560	0.07055	N	0.832595	T	0.78953	0.4365	L	0.52759	1.655	0.25922	N	0.983105	P	0.44816	0.844	P	0.48738	0.588	T	0.66948	-0.5794	10	0.29301	T	0.29	.	12.3647	0.55222	0.0:0.0:0.8311:0.1689	.	222	E7EUV1	.	H	222	ENSP00000415183:R222H;ENSP00000351956:R222H	ENSP00000351956:R222H	R	+	2	0	MUC2	1068457	0.958000	0.32768	0.980000	0.43619	0.483000	0.33249	1.698000	0.37794	1.908000	0.55244	0.561000	0.74099	CGC		0.697	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	Missense_Mutation
MYH7	4625	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	23894068	23894068	+	Silent	SNP	T	T	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr14:23894068T>C	ENST00000355349.3	-	22	2751	c.2589A>G	c.(2587-2589)ctA>ctG	p.L863L		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	863					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.L863L(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGGACTTCTCTAGCGCCTCTT	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	84.0	86.0					14																	23894068		2203	4300	6503	SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2589A>G	14.37:g.23894068T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																				0.567	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3		NM_000257	
MYH7B	57644	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	33575921	33575921	+	Silent	SNP	C	C	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr20:33575921C>A	ENST00000262873.7	+	17	1661	c.1569C>A	c.(1567-1569)atC>atA	p.I523I	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	481	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.I523M(1)|p.I523I(1)		NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AGCTGTGCATCAACTTCACCA	0.562																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	breast(1)|kidney(1)											84.0	85.0	85.0					20																	33575921		2203	4300	6503	SO:0001819	synonymous_variant	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1569C>A	20.37:g.33575921C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	ENST00000262873.7	37	CCDS42869.1																																																																																				0.562	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2		NM_020884	
NDST4	64579	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	115858556	115858556	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr4:115858556C>T	ENST00000264363.2	-	5	2003	c.1325G>A	c.(1324-1326)gGt>gAt	p.G442D		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	442	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.G442D(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GACTTGAATACCCCAGACCTT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											177.0	164.0	169.0					4																	115858556		2203	4300	6503	SO:0001583	missense	64579			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1325G>A	4.37:g.115858556C>T	ENSP00000264363:p.Gly442Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.904959	0.33628	.	.	ENSG00000138653	ENST00000264363	T	0.35789	1.29	5.77	3.98	0.46160	.	0.548102	0.21526	N	0.073127	T	0.25195	0.0612	L	0.34521	1.04	0.33592	D	0.601162	B	0.06786	0.001	B	0.15052	0.012	T	0.20405	-1.0276	10	0.37606	T	0.19	.	6.6905	0.23169	0.0:0.5641:0.0:0.4359	.	442	Q9H3R1	NDST4_HUMAN	D	442	ENSP00000264363:G442D	ENSP00000264363:G442D	G	-	2	0	NDST4	116078005	0.945000	0.32115	1.000000	0.80357	0.993000	0.82548	0.595000	0.24029	0.699000	0.31761	-0.140000	0.14226	GGT		0.498	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1		NM_022569	
NKD1	85407	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	50583388	50583388	+	Silent	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr16:50583388C>T	ENST00000268459.3	+	3	338	c.114C>T	c.(112-114)atC>atT	p.I38I	NKD1_ENST00000564336.1_3'UTR|RP11-401P9.1_ENST00000569940.2_RNA	NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	38					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I38I(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		AGGAGTGGATCGGGAGACAGC	0.692																																																	1	Substitution - coding silent(1)	kidney(1)											29.0	31.0	30.0					16																	50583388		2198	4300	6498	SO:0001819	synonymous_variant	85407			AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.114C>T	16.37:g.50583388C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RC39|Q8WZ08	Silent	SNP	ENST00000268459.3	37	CCDS10743.1																																																																																				0.692	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1			
OR5AU1	390445	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	21623848	21623848	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr14:21623848G>A	ENST00000304418.3	-	1	374	c.337C>T	c.(337-339)Ctc>Ttc	p.L113F		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L113F(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		CTCTTCAGGAGGGAGTACATG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											95.0	77.0	83.0					14																	21623848		2203	4300	6503	SO:0001583	missense	390445			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.337C>T	14.37:g.21623848G>A	ENSP00000302057:p.Leu113Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	ENST00000304418.3	37	CCDS32042.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.082496	0.00371	.	.	ENSG00000169327	ENST00000304418	T	0.00848	5.62	4.34	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00412	0.0013	N	0.01482	-0.84	0.27768	N	0.943596	B	0.15719	0.014	B	0.10450	0.005	T	0.42085	-0.9472	9	0.02654	T	1	.	4.8526	0.13543	0.3594:0.0:0.6405:0.0	.	113	Q8NGC0	O5AU1_HUMAN	F	113	ENSP00000302057:L113F	ENSP00000302057:L113F	L	-	1	0	OR5AU1	20693688	0.648000	0.27313	1.000000	0.80357	0.257000	0.26127	1.056000	0.30480	1.064000	0.40671	-0.339000	0.08088	CTC		0.542	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1			
OR6C3	254786	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	55725604	55725604	+	Silent	SNP	G	G	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr12:55725604G>T	ENST00000379667.1	+	1	120	c.120G>T	c.(118-120)ctG>ctT	p.L40L		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	40					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L40L(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						CTGGAAACCTGACTATCATCA	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											154.0	168.0	163.0					12																	55725604		2203	4300	6503	SO:0001819	synonymous_variant	254786			AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.120G>T	12.37:g.55725604G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000379667.1	37	CCDS31819.1																																																																																				0.393	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406309.1			
OXSR1	9943	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	38287677	38287677	+	Missense_Mutation	SNP	C	C	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr3:38287677C>G	ENST00000446845.1	+	13	1594	c.1222C>G	c.(1222-1224)Ctc>Gtc	p.L408V	OXSR1_ENST00000311806.3_Missense_Mutation_p.L408V					oxidative stress responsive 1									p.L408V(1)		skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TCAAGTCTCTCTCCCACCCAC	0.493																																																	1	Substitution - Missense(1)	kidney(1)											117.0	108.0	111.0					3																	38287677		2203	4300	6503	SO:0001583	missense	9943			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.1222C>G	3.37:g.38287677C>G	ENSP00000415851:p.Leu408Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000446845.1	37		.	.	.	.	.	.	.	.	.	.	C	11.26	1.587511	0.28268	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.71698	-0.59;-0.57	5.72	-0.076	0.13724	.	0.711400	0.14848	N	0.294896	T	0.39733	0.1089	N	0.02539	-0.55	0.22199	N	0.999295	B	0.02656	0.0	B	0.01281	0.0	T	0.27088	-1.0084	10	0.27082	T	0.32	-1.4678	8.0484	0.30564	0.1002:0.386:0.4455:0.0683	.	408	O95747	OXSR1_HUMAN	V	408	ENSP00000415851:L408V;ENSP00000311713:L408V	ENSP00000311713:L408V	L	+	1	0	OXSR1	38262681	0.899000	0.30636	0.743000	0.31040	0.975000	0.68041	0.727000	0.25999	0.102000	0.17638	-0.156000	0.13503	CTC		0.493	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000342708.1		NM_005109	
PCNXL3	399909	broad.mit.edu;hgsc.bcm.edu	37	11	65402821	65402821	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:65402821C>T	ENST00000355703.3	+	31	5625	c.5086C>T	c.(5086-5088)Ccc>Tcc	p.P1696S	MIR4690_ENST00000578459.1_RNA|SIPA1_ENST00000534313.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1696						integral component of membrane (GO:0016021)		p.P1696S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CAGCAACACGCCCTCCCTGCT	0.617																																																	1	Substitution - Missense(1)	kidney(1)											23.0	24.0	23.0					11																	65402821		2082	4195	6277	SO:0001583	missense	399909			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.5086C>T	11.37:g.65402821C>T	ENSP00000347931:p.Pro1696Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946359	0.73672	.	.	ENSG00000197136	ENST00000355703	T	0.51817	0.69	4.03	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.68805	0.3041	M	0.90252	3.1	0.49130	D	0.999751	P;D	0.58268	0.754;0.982	P;P	0.57720	0.493;0.826	T	0.77112	-0.2708	10	0.66056	D	0.02	.	13.7058	0.62639	0.0:1.0:0.0:0.0	.	583;1696	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	S	1696	ENSP00000347931:P1696S	ENSP00000347931:P1696S	P	+	1	0	PCNXL3	65159397	1.000000	0.71417	0.972000	0.41901	0.738000	0.42128	5.388000	0.66249	2.097000	0.63578	0.462000	0.41574	CCC		0.617	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1		NM_032223	
PCP4L1	654790	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	161254256	161254256	+	Frame_Shift_Del	DEL	G	G	-	rs116246087	byFrequency	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr1:161254256delG	ENST00000504449.1	+	3	440	c.192delG	c.(190-192)aagfs	p.K64fs		NM_001102566.1	NP_001096036.1	A6NKN8	PC4L1_HUMAN	Purkinje cell protein 4 like 1	64	IQ.									endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AAAGGAAAAAGGATCCCAGCT	0.517																																																	0													56.0	59.0	58.0					1																	161254256		1947	4142	6089	SO:0001589	frameshift_variant	654790			BC028905	CCDS53412.1	1q23.3	2006-02-27	2006-02-27		ENSG00000248485	ENSG00000248485			20448	protein-coding gene	gene with protein product			"""purkinje cell protein 4 like 1"""				Standard	NM_001102566		Approved	IQM1	uc001gad.3	A6NKN8	OTTHUMG00000034340	ENST00000504449.1:c.192delG	1.37:g.161254256delG	ENSP00000426296:p.Lys64fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RV24|B9EJG4	Frame_Shift_Del	DEL	ENST00000504449.1	37	CCDS53412.1																																																																																				0.517	PCP4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082986.2			
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu	37	5	32088233	32088233	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr5:32088233C>T	ENST00000438447.1	+	20	5067	c.4679C>T	c.(4678-4680)tCt>tTt	p.S1560F	PDZD2_ENST00000282493.3_Missense_Mutation_p.S1560F			O15018	PDZD2_HUMAN	PDZ domain containing 2	1560					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.S1560F(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GATTCTTCTTCTGACCCTGAG	0.557																																																	1	Substitution - Missense(1)	kidney(1)											72.0	71.0	71.0					5																	32088233		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.4679C>T	5.37:g.32088233C>T	ENSP00000402033:p.Ser1560Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452175	0.63290	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.31510	1.49;1.49	5.36	5.36	0.76844	.	0.000000	0.51477	D	0.000095	T	0.55178	0.1904	M	0.65498	2.005	0.36437	D	0.865251	D	0.76494	0.999	D	0.83275	0.996	T	0.64533	-0.6385	10	0.87932	D	0	.	16.5934	0.84781	0.0:1.0:0.0:0.0	.	1560	O15018	PDZD2_HUMAN	F	1560;1361;1560	ENSP00000402033:S1560F;ENSP00000282493:S1560F	ENSP00000282493:S1560F	S	+	2	0	PDZD2	32123990	0.998000	0.40836	0.084000	0.20598	0.498000	0.33706	5.359000	0.66074	2.520000	0.84964	0.655000	0.94253	TCT		0.557	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu	37	5	32088238	32088238	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr5:32088238C>T	ENST00000438447.1	+	20	5072	c.4684C>T	c.(4684-4686)Cct>Tct	p.P1562S	PDZD2_ENST00000282493.3_Missense_Mutation_p.P1562S			O15018	PDZD2_HUMAN	PDZ domain containing 2	1562					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.P1562S(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TTCTTCTGACCCTGAGTCACT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											73.0	72.0	72.0					5																	32088238		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.4684C>T	5.37:g.32088238C>T	ENSP00000402033:p.Pro1562Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494425	0.44352	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.34472	1.36;1.36	5.36	2.57	0.30868	.	0.246858	0.29342	N	0.012430	T	0.33265	0.0857	L	0.49350	1.555	0.32878	D	0.510142	P	0.48503	0.911	P	0.46940	0.532	T	0.47749	-0.9093	10	0.66056	D	0.02	.	4.4746	0.11729	0.1569:0.5956:0.0:0.2475	.	1562	O15018	PDZD2_HUMAN	S	1562;1363;1562	ENSP00000402033:P1562S;ENSP00000282493:P1562S	ENSP00000282493:P1562S	P	+	1	0	PDZD2	32123995	0.575000	0.26692	0.998000	0.56505	0.448000	0.32197	0.055000	0.14229	0.641000	0.30601	-0.181000	0.13052	CCT		0.562	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu	37	5	32090571	32090571	+	Silent	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr5:32090571C>T	ENST00000438447.1	+	20	7405	c.7017C>T	c.(7015-7017)atC>atT	p.I2339I	PDZD2_ENST00000282493.3_Silent_p.I2339I			O15018	PDZD2_HUMAN	PDZ domain containing 2	2339					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.I2339I(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGCAGCGGATCAAGTCTTTTG	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											55.0	54.0	54.0					5																	32090571		2203	4300	6503	SO:0001819	synonymous_variant	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7017C>T	5.37:g.32090571C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Silent	SNP	ENST00000438447.1	37	CCDS34137.1																																																																																				0.527	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PDE6A	5145	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	149240511	149240511	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr5:149240511C>A	ENST00000255266.5	-	22	2649	c.2530G>T	c.(2530-2532)Gga>Tga	p.G844*		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	844					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.G844*(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	CTGGGGTTTCCCCCCGGCTGA	0.572																																																	1	Substitution - Nonsense(1)	kidney(1)											59.0	54.0	56.0					5																	149240511		2203	4300	6503	SO:0001587	stop_gained	5145				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2530G>T	5.37:g.149240511C>A	ENSP00000255266:p.Gly844*	Somatic		WXS	Illumina HiSeq	Phase_I	Q0P638	Nonsense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	C	37	6.052914	0.97241	.	.	ENSG00000132915	ENST00000255266	.	.	.	4.78	3.92	0.45320	.	1.992370	0.02207	N	0.062844	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	9.3187	0.37950	0.0:0.8995:0.0:0.1005	.	.	.	.	X	844	.	ENSP00000255266:G844X	G	-	1	0	PDE6A	149220704	0.127000	0.22367	0.006000	0.13384	0.019000	0.09904	1.860000	0.39428	1.137000	0.42214	0.561000	0.74099	GGA		0.572	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2			
PLXNB2	23654	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	50724518	50724518	+	Silent	SNP	G	G	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr22:50724518G>T	ENST00000449103.1	-	10	2027	c.1887C>A	c.(1885-1887)tcC>tcA	p.S629S	PLXNB2_ENST00000359337.4_Silent_p.S629S|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	629					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.S672S(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGCTCACGCAGGAGATGCACC	0.667																																																	1	Substitution - coding silent(1)	kidney(1)											43.0	52.0	49.0					22																	50724518		2104	4191	6295	SO:0001819	synonymous_variant	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1887C>A	22.37:g.50724518G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																				0.667	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3		NM_012401	
PTGER2	5732	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	52782081	52782081	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr14:52782081C>T	ENST00000245457.5	+	1	969	c.815C>T	c.(814-816)aCc>aTc	p.T272I	PTGER2_ENST00000557436.1_Missense_Mutation_p.T17I	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	272					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)	p.T272I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	ATGACCATCACCTTCGCCGTC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											45.0	51.0	49.0					14																	52782081		2202	4298	6500	SO:0001583	missense	5732				CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.815C>T	14.37:g.52782081C>T	ENSP00000245457:p.Thr272Ile	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSC0|Q52LG8	Missense_Mutation	SNP	ENST00000245457.5	37	CCDS9708.1	.	.	.	.	.	.	.	.	.	.	C	4.006	-0.001538	0.07819	.	.	ENSG00000125384	ENST00000557436;ENST00000245457	T;T	0.72051	-0.62;-0.62	5.05	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.051159	0.85682	D	0.000000	T	0.46852	0.1414	N	0.13098	0.295	0.35334	D	0.785857	B	0.26147	0.143	B	0.28849	0.095	T	0.48917	-0.8992	10	0.02654	T	1	-31.36	8.073	0.30699	0.0:0.8151:0.0:0.1849	.	272	P43116	PE2R2_HUMAN	I	17;272	ENSP00000450933:T17I;ENSP00000245457:T272I	ENSP00000245457:T272I	T	+	2	0	PTGER2	51851831	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.086000	0.30853	1.276000	0.44395	0.511000	0.50034	ACC		0.647	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1			
RUNX1T1	862	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	92982925	92982925	+	Silent	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr8:92982925G>A	ENST00000523629.1	-	11	1954	c.1500C>T	c.(1498-1500)gaC>gaT	p.D500D	RUNX1T1_ENST00000436581.2_Silent_p.D511D|RUNX1T1_ENST00000520724.1_Silent_p.D463D|RUNX1T1_ENST00000396218.1_Silent_p.D473D|RUNX1T1_ENST00000518844.1_Silent_p.D473D|RUNX1T1_ENST00000265814.3_Silent_p.D500D|RUNX1T1_ENST00000422361.2_Silent_p.D463D|RUNX1T1_ENST00000360348.2_Silent_p.D463D	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	500					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D511D(1)|p.D500D(1)|p.D463D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CTGCCAGTGCGTCCTCCGCCG	0.547																																																	3	Substitution - coding silent(3)	kidney(3)											66.0	59.0	61.0					8																	92982925		2203	4300	6503	SO:0001819	synonymous_variant	862			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1500C>T	8.37:g.92982925G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	37	CCDS6256.1																																																																																				0.547	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3		NM_004349, NM_175635	
SLC22A8	9376	hgsc.bcm.edu;ucsc.edu	37	11	62782211	62782211	+	Frame_Shift_Del	DEL	G	G	-	rs370233107		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:62782211delG	ENST00000336232.2	-	2	355	c.220delC	c.(220-222)ctcfs	p.L74fs	SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000545207.1_Intron|SLC22A8_ENST00000430500.2_Frame_Shift_Del_p.L74fs|SLC22A8_ENST00000311438.8_Frame_Shift_Del_p.L74fs	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	74					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ACAAAACGGAGGCACCTCTCA	0.637																																																	0													175.0	181.0	179.0					11																	62782211		2201	4298	6499	SO:0001589	frameshift_variant	9376			AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.220delC	11.37:g.62782211delG	ENSP00000337335:p.Leu74fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Frame_Shift_Del	DEL	ENST00000336232.2	37	CCDS8042.1																																																																																				0.637	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1		NM_004254	
SSRP1	6749	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	57099909	57099909	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:57099909T>G	ENST00000278412.2	-	7	1086	c.820A>C	c.(820-822)Atc>Ctc	p.I274L		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	274					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.I274L(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						AAGAGGAGGATCAGGAAGTGG	0.488																																					Colon(89;1000 1340 6884 23013 41819)												1	Substitution - Missense(1)	kidney(1)											221.0	180.0	193.0					11																	57099909		2201	4296	6497	SO:0001583	missense	6749			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.820A>C	11.37:g.57099909T>G	ENSP00000278412:p.Ile274Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BJG8	Missense_Mutation	SNP	ENST00000278412.2	37	CCDS7952.1	.	.	.	.	.	.	.	.	.	.	T	31	5.058241	0.93846	.	.	ENSG00000149136	ENST00000278412;ENST00000526696	T;T	0.42900	0.96;0.96	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.53110	0.1776	L	0.46157	1.445	0.58432	D	0.999998	P	0.44946	0.846	P	0.55667	0.781	T	0.51140	-0.8743	10	0.49607	T	0.09	-21.3708	15.4767	0.75485	0.0:0.0:0.0:1.0	.	274	Q08945	SSRP1_HUMAN	L	274;177	ENSP00000278412:I274L;ENSP00000431154:I177L	ENSP00000278412:I274L	I	-	1	0	SSRP1	56856485	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.396000	0.79891	2.319000	0.78375	0.533000	0.62120	ATC		0.488	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1		NM_003146	
SYNRG	11276	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	35946642	35946642	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr17:35946642C>T	ENST00000339208.6	-	4	396	c.256G>A	c.(256-258)Gga>Aga	p.G86R	SYNRG_ENST00000345615.4_Missense_Mutation_p.G86R|SYNRG_ENST00000585472.1_Missense_Mutation_p.G85R|SYNRG_ENST00000346661.4_Missense_Mutation_p.G86R|SYNRG_ENST00000502449.2_Missense_Mutation_p.G86R|SYNRG_ENST00000394378.2_Missense_Mutation_p.G86R|SYNRG_ENST00000591288.1_Missense_Mutation_p.G86R	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	86					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)	p.G86R(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GGCATTGGTCCCATTGGTATT	0.453																																																	1	Substitution - Missense(1)	kidney(1)											131.0	131.0	131.0					17																	35946642		2203	4300	6503	SO:0001583	missense	11276			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.256G>A	17.37:g.35946642C>T	ENSP00000343610:p.Gly86Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732900	0.89482	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378;ENST00000394379	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	4.74	4.74	0.60224	.	0.112402	0.64402	D	0.000012	T	0.53948	0.1828	M	0.63843	1.955	0.80722	D	1	D;P;P;P;P;D;D	0.89917	1.0;0.846;0.933;0.933;0.933;1.0;1.0	D;P;P;P;P;D;D	0.97110	0.999;0.563;0.563;0.68;0.563;1.0;1.0	T	0.53906	-0.8372	10	0.45353	T	0.12	-1.2399	18.0705	0.89404	0.0:1.0:0.0:0.0	.	86;86;86;86;86;86;86	A8MYE0;B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;.;SYNRG_HUMAN	R	86	ENSP00000005279:G86R;ENSP00000343610:G86R;ENSP00000315722:G86R;ENSP00000424893:G86R;ENSP00000377903:G86R	ENSP00000343610:G86R	G	-	1	0	SYNRG	33020755	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.382000	0.79729	2.316000	0.78162	0.591000	0.81541	GGA		0.453	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2		NM_007247	
SYT15	83849	broad.mit.edu;hgsc.bcm.edu	37	10	46968694	46968694	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr10:46968694G>A	ENST00000374321.4	-	3	308	c.242C>T	c.(241-243)cCa>cTa	p.P81L	SYT15_ENST00000374325.3_Missense_Mutation_p.P81L|SYT15_ENST00000374323.4_Missense_Mutation_p.P134L|SYT15_ENST00000503753.1_Missense_Mutation_p.P81L|RP11-38L15.3_ENST00000506914.1_RNA	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P81L(2)|p.P133L(1)		cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						TTGAAGGGTTGGGGGCACCAC	0.632																																					Ovarian(57;1152 1428 19651 37745)												3	Substitution - Missense(3)	kidney(3)											66.0	78.0	74.0					10																	46968694		2157	4258	6415	SO:0001583	missense	83849			AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.242C>T	10.37:g.46968694G>A	ENSP00000363441:p.Pro81Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.134169	0.77662	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321	T;T;T;T	0.21191	2.02;2.02;2.39;2.37	4.38	4.38	0.52667	.	0.068413	0.64402	D	0.000020	T	0.34745	0.0908	M	0.74258	2.255	0.58432	D	0.999999	P;D	0.58620	0.926;0.983	P;P	0.54544	0.454;0.755	T	0.18085	-1.0348	10	0.08837	T	0.75	.	14.8135	0.70013	0.0:0.0:1.0:0.0	.	81;81	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	L	81;81;81;134;81	ENSP00000363445:P81L;ENSP00000427607:P81L;ENSP00000363443:P134L;ENSP00000363441:P81L	ENSP00000363441:P81L	P	-	2	0	SYT15	46388700	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	2.691000	0.47010	2.456000	0.83038	0.561000	0.74099	CCA		0.632	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1		NM_031912	
TNXB	7148	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	32065169	32065169	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr6:32065169C>T	ENST00000479795.1	-	3	601	c.461G>A	c.(460-462)tGc>tAc	p.C154Y	TNXB_ENST00000375247.2_Missense_Mutation_p.C154Y|TNXB_ENST00000375244.3_Missense_Mutation_p.C154Y			P22105	TENX_HUMAN	tenascin XB	154					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.C154Y(2)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGAACAGGTGCAGCGGCTCAG	0.627																																																	2	Substitution - Missense(2)	kidney(2)											43.0	46.0	45.0					6																	32065169		2096	4225	6321	SO:0001583	missense	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.461G>A	6.37:g.32065169C>T	ENSP00000418248:p.Cys154Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000479795.1	37		.	.	.	.	.	.	.	.	.	.	C	17.86	3.492603	0.64074	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;T	0.66099	4.02;4.02;-0.19	4.41	4.41	0.53225	.	0.000000	0.52532	D	0.000069	T	0.75729	0.3889	M	0.84082	2.675	0.39383	D	0.96628	D	0.76494	0.999	D	0.85130	0.997	T	0.80500	-0.1355	10	0.87932	D	0	.	14.0336	0.64632	0.0:1.0:0.0:0.0	.	154	P22105-3	.	Y	154	ENSP00000364393:C154Y;ENSP00000364396:C154Y;ENSP00000418248:C154Y	ENSP00000364393:C154Y	C	-	2	0	TNXB	32173147	.	.	0.997000	0.53966	0.920000	0.55202	.	.	2.254000	0.74563	0.655000	0.94253	TGC		0.627	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1		NM_019105	
UBA6	55236	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	68514833	68514833	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr4:68514833C>T	ENST00000322244.5	-	14	1260	c.1201G>A	c.(1201-1203)Gaa>Aaa	p.E401K		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	401					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)	p.E401K(1)		central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTCAATACTTCTTGGCTGGCA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											92.0	99.0	97.0					4																	68514833		2203	4300	6503	SO:0001583	missense	55236			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1201G>A	4.37:g.68514833C>T	ENSP00000313454:p.Glu401Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	C	34	5.398995	0.96030	.	.	ENSG00000033178	ENST00000322244	T	0.71934	-0.61	5.22	5.22	0.72569	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.89399	0.6704	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92357	0.5894	10	0.87932	D	0	-19.2896	19.1348	0.93422	0.0:1.0:0.0:0.0	.	401	A0AVT1	UBA6_HUMAN	K	401	ENSP00000313454:E401K	ENSP00000313454:E401K	E	-	1	0	UBA6	68197428	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.002000	0.76304	2.594000	0.87642	0.585000	0.79938	GAA		0.418	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2		NM_018227	
UBR4	23352	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	19455528	19455528	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr1:19455528G>A	ENST00000375254.3	-	61	8974	c.8947C>T	c.(8947-8949)Cag>Tag	p.Q2983*	UBR4_ENST00000375217.2_Nonsense_Mutation_p.Q2976*|UBR4_ENST00000375267.2_Nonsense_Mutation_p.Q2983*|UBR4_ENST00000375226.2_Nonsense_Mutation_p.Q2959*	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2983					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q2983*(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGCAGGGTCTGCAGTAATCTC	0.493																																																	1	Substitution - Nonsense(1)	kidney(1)											139.0	115.0	123.0					1																	19455528		2203	4300	6503	SO:0001587	stop_gained	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8947C>T	1.37:g.19455528G>A	ENSP00000364403:p.Gln2983*	Somatic		WXS	Illumina HiSeq	Phase_I	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Nonsense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	44	10.935574	0.99491	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.115	0.93334	0.0:0.0:1.0:0.0	.	.	.	.	X	2983;2983;2976;2959;591;1669	.	ENSP00000364365:Q2976X	Q	-	1	0	UBR4	19328115	1.000000	0.71417	0.994000	0.49952	0.926000	0.56050	9.093000	0.94163	2.607000	0.88179	0.563000	0.77884	CAG		0.493	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1		NM_020765	
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10183752	10183752	+	Missense_Mutation	SNP	T	T	A	rs5030803		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Illumina Miseq			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr3:10183752T>A	ENST00000256474.2	+	1	1061	c.221T>A	c.(220-222)gTc>gAc	p.V74D	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.V74D	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	74			V -> G (in VHLD; type I-II; dbSNP:rs5030803). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.V74D(8)|p.V74A(1)|p.S72_V87>L(1)|p.P71fs*84(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.P71fs*56(1)|p.V74>?(1)|p.V74fs*77(1)|p.V74fs*82(1)|p.V74fs*51(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCTCCCAGGTCATCTTCTGC	0.721		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	18	Substitution - Missense(9)|Deletion - Frameshift(6)|Complex - deletion inframe(1)|Deletion - In frame(1)|Complex(1)	kidney(17)|soft_tissue(1)	GRCh37	CM961417	VHL	M	rs5030803						10.0	14.0	12.0					3																	10183752		2163	4233	6396	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.221T>A	3.37:g.10183752T>A	ENSP00000256474:p.Val74Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.947597	0.92593	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99842	-7.1;-7.1	5.34	4.16	0.48862	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.120953	0.56097	D	0.000027	D	0.99697	0.9885	M	0.73962	2.25	0.53688	D	0.999978	D;D	0.76494	0.998;0.999	D;D	0.70935	0.944;0.971	D	0.97903	1.0304	10	0.87932	D	0	-6.556	10.613	0.45434	0.0:0.0:0.1618:0.8382	.	74;74	P40337-2;P40337	.;VHL_HUMAN	D	74	ENSP00000256474:V74D;ENSP00000344757:V74D	ENSP00000256474:V74D	V	+	2	0	VHL	10158752	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.431000	0.52814	0.851000	0.35264	0.450000	0.29827	GTC		0.721	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WT1	7490	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	32417899	32417899	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr11:32417899T>A	ENST00000379079.2	-	7	790	c.517A>T	c.(517-519)Acc>Tcc	p.T173S	WT1_ENST00000448076.3_Missense_Mutation_p.T385S|WT1_ENST00000530998.1_Missense_Mutation_p.T156S|WT1_ENST00000332351.3_Missense_Mutation_p.T385S	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	317					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L310fs*63(1)|p.T173S(1)|p.P308fs*67(1)|p.T317S(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TTCTCACTGGTCTCAGATGCC	0.522			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	4	Substitution - Missense(2)|Complex - frameshift(2)	kidney(3)|haematopoietic_and_lymphoid_tissue(1)											129.0	111.0	117.0					11																	32417899		2202	4299	6501	SO:0001583	missense	7490	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.517A>T	11.37:g.32417899T>A	ENSP00000368370:p.Thr173Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	CCDS55751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.24|14.24	2.475648|2.475648	0.44044|0.44044	.|.	.|.	ENSG00000184937|ENSG00000184937	ENST00000527882|ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	.|D;D;D;D;D	.|0.83673	.|-1.75;-1.75;-1.75;-1.75;-1.75	6.17|6.17	6.17|6.17	0.99709|0.99709	.|Wilm&apos (1);s tumour protein, N-terminal (1);	.|0.075116	.|0.50627	.|U	.|0.000101	T|T	0.70979|0.70979	0.3286|0.3286	N|N	0.26042|0.26042	0.785|0.785	0.40926|0.40926	D|D	0.984359|0.984359	.|B;B;B;B;B	.|0.13145	.|0.004;0.003;0.007;0.002;0.002	.|B;B;B;B;B	.|0.19148	.|0.019;0.023;0.024;0.01;0.012	T|T	0.65393|0.65393	-0.6179|-0.6179	5|10	.|0.18710	.|T	.|0.47	.|.	8.9722|8.9722	0.35912|0.35912	0.0:0.1365:0.0:0.8635|0.0:0.1365:0.0:0.8635	.|.	.|373;317;390;156;173	.|P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.|.;WT1_HUMAN;.;.;.	V|S	75|173;385;156;368;385	.|ENSP00000368370:T173S;ENSP00000331327:T385S;ENSP00000435307:T156S;ENSP00000415516:T368S;ENSP00000413452:T385S	.|ENSP00000331327:T385S	D|T	-|-	2|1	0|0	WT1|WT1	32374475|32374475	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.170000|2.170000	0.42443|0.42443	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAC|ACC		0.522	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1		NM_000378	
ZNF347	84671	broad.mit.edu;ucsc.edu	37	19	53656986	53656986	+	Splice_Site	SNP	C	C	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr19:53656986C>G	ENST00000334197.7	-	2	83	c.15G>C	c.(13-15)caG>caC	p.Q5H	ZNF347_ENST00000601804.1_5'UTR|ZNF347_ENST00000452676.2_Splice_Site_p.Q5H|ZNF347_ENST00000601469.2_Splice_Site_p.Q5H	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q5H(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		ATTACCTTACCTGGGTGAGAG	0.408																																					Melanoma(64;205 1597 17324 45721)												1	Substitution - Missense(1)	kidney(1)											203.0	182.0	189.0					19																	53656986		2203	4300	6503	SO:0001630	splice_region_variant	84671			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.15+1G>C	19.37:g.53656986C>G		Somatic		WXS	Illumina GAIIx	Phase_I	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	C	9.524	1.109169	0.20714	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.01059	5.39;5.39	1.83	1.83	0.25207	Krueppel-associated box (1);	.	.	.	.	T	0.04003	0.0112	M	0.79258	2.445	0.09310	N	1	D;P	0.65815	0.995;0.939	P;B	0.57204	0.815;0.36	T	0.31724	-0.9933	8	.	.	.	.	7.1562	0.25639	0.0:1.0:0.0:0.0	.	5;5	G5E9N4;Q96SE7	.;ZN347_HUMAN	H	5	ENSP00000334146:Q5H;ENSP00000405218:Q5H	.	Q	-	3	2	ZNF347	58348798	0.271000	0.24162	0.188000	0.23233	0.020000	0.10135	2.184000	0.42575	1.357000	0.45904	0.491000	0.48974	CAG		0.408	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1		NM_032584	Missense_Mutation
ZNF804A	91752	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	185802977	185802977	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr2:185802977T>C	ENST00000302277.6	+	4	3448	c.2854T>C	c.(2854-2856)Ttt>Ctt	p.F952L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	952							metal ion binding (GO:0046872)	p.F952L(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GCAAATTCCTTTTCAGGTGCC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											75.0	74.0	74.0					2																	185802977		2203	4300	6503	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2854T>C	2.37:g.185802977T>C	ENSP00000303252:p.Phe952Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	T	2.974	-0.211832	0.06140	.	.	ENSG00000170396	ENST00000302277	T	0.05513	3.43	5.26	-0.313	0.12754	.	0.648512	0.14267	N	0.330415	T	0.02970	0.0088	N	0.13043	0.29	0.22521	N	0.999023	B	0.02656	0.0	B	0.01281	0.0	T	0.48375	-0.9041	10	0.07990	T	0.79	-0.5286	6.8567	0.24044	0.0:0.2767:0.1159:0.6075	.	952	Q7Z570	Z804A_HUMAN	L	952	ENSP00000303252:F952L	ENSP00000303252:F952L	F	+	1	0	ZNF804A	185511222	0.970000	0.33590	0.970000	0.41538	0.335000	0.28730	0.089000	0.15002	-0.661000	0.05345	-1.773000	0.00660	TTT		0.388	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1		NM_194250	
CCNB2	9133	broad.mit.edu	37	15	59417125	59417125	+	3'UTR	SNP	T	T	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr15:59417125T>C	ENST00000288207.2	+	0	1437				CCNB2_ENST00000559622.1_3'UTR|RP11-59H7.3_ENST00000559026.1_RNA	NM_004701.3	NP_004692.1	O95067	CCNB2_HUMAN	cyclin B2						G2/M transition of mitotic cell cycle (GO:0000086)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				kidney(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9						CTTTTTCTTATTGGTTTAGAA	0.443																																																	0													31.0	26.0	28.0					15																	59417125		2191	4291	6482	SO:0001624	3_prime_UTR_variant	9133			AF002822	CCDS10170.1	15q21.3	2004-01-19			ENSG00000157456	ENSG00000157456			1580	protein-coding gene	gene with protein product		602755					Standard	NM_004701		Approved	HsT17299	uc002afz.3	O95067	OTTHUMG00000132715	ENST00000288207.2:c.*49T>C	15.37:g.59417125T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B3KM93|Q6FI99	3'UTR	SNP	ENST00000288207.2	37	CCDS10170.1																																																																																				0.443	CCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256016.1		NM_004701	
GPR17	2840	broad.mit.edu	37	2	128407597	128407597	+	Missense_Mutation	SNP	G	G	A	rs200450704	byFrequency	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr2:128407597G>A	ENST00000272644.3	+	2	85	c.11G>A	c.(10-12)cGg>cAg	p.R4Q	LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409254.1_Intron|LIMS2_ENST00000410038.1_5'Flank|LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000545738.2_Intron|GPR17_ENST00000393018.3_Missense_Mutation_p.R4Q|GPR17_ENST00000486700.1_Intron|GPR17_ENST00000544369.1_Missense_Mutation_p.R4Q|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000355119.4_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	4					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)	p.R4Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		ATGTCCAAACGGAGTTGGTGG	0.547											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	3	0.000599042	0.0	0.0	5008	,	,		19487	0.0		0.0	False		,,,				2504	0.0031																1	Substitution - Missense(1)	kidney(1)											49.0	44.0	46.0					2																	128407597		2203	4299	6502	SO:0001583	missense	2840				CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.11G>A	2.37:g.128407597G>A	ENSP00000272644:p.Arg4Gln	Somatic	1564	WXS	Illumina GAIIx	Phase_I	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	ENST00000272644.3	37	CCDS2148.1	.	.	.	.	.	.	.	.	.	.	g	2.933	-0.220651	0.06061	.	.	ENSG00000144230	ENST00000544369;ENST00000272644;ENST00000423019;ENST00000393018	T;T;T;T	0.66280	-0.2;-0.2;0.21;-0.2	2.5	-5.01	0.02991	.	7.205300	0.01126	U	0.005883	T	0.42653	0.1212	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41197	-0.9522	10	0.49607	T	0.09	.	11.0809	0.48059	0.7823:0.0:0.2177:0.0	.	4	Q13304	GPR17_HUMAN	Q	4	ENSP00000442982:R4Q;ENSP00000272644:R4Q;ENSP00000387970:R4Q;ENSP00000376741:R4Q	ENSP00000272644:R4Q	R	+	2	0	GPR17	128124067	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.117000	0.03283	-1.899000	0.01098	-0.948000	0.02665	CGG		0.547	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1			
ITGA3	3675	broad.mit.edu	37	17	48148756	48148756	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr17:48148756T>C	ENST00000320031.8	+	6	1163	c.833T>C	c.(832-834)aTg>aCg	p.M278T	ITGA3_ENST00000007722.7_Missense_Mutation_p.M278T|ITGA3_ENST00000544892.1_Missense_Mutation_p.M53T	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	278					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)	p.M278T(2)		endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						CACCGACATATGGGCGCGGTG	0.612																																																	2	Substitution - Missense(2)	kidney(2)											51.0	49.0	50.0					17																	48148756		2203	4300	6503	SO:0001583	missense	3675			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.833T>C	17.37:g.48148756T>C	ENSP00000315190:p.Met278Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	.	.	.	.	.	.	.	.	.	.	T	3.229	-0.157785	0.06544	.	.	ENSG00000005884	ENST00000544892;ENST00000007722;ENST00000538917;ENST00000320031	T;T;T	0.10573	2.86;2.86;2.86	5.59	3.24	0.37175	.	0.821148	0.11530	N	0.554752	T	0.02380	0.0073	N	0.00637	-1.305	0.26866	N	0.96784	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42699	-0.9436	10	0.17369	T	0.5	.	0.3521	0.00351	0.2225:0.1478:0.2315:0.3982	.	278;278	P26006-1;P26006	.;ITA3_HUMAN	T	53;278;264;278	ENSP00000446133:M53T;ENSP00000007722:M278T;ENSP00000315190:M278T	ENSP00000007722:M278T	M	+	2	0	ITGA3	45503755	0.037000	0.19845	0.911000	0.35937	0.540000	0.34992	0.708000	0.25719	0.921000	0.36994	0.533000	0.62120	ATG		0.612	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1		NM_005501	
LAMA5	3911	broad.mit.edu	37	20	60895706	60895706	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr20:60895706A>C	ENST00000252999.3	-	50	6734	c.6668T>G	c.(6667-6669)cTg>cGg	p.L2223R		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2223	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.L2223R(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCGGGGGCCCAGGGGGCTCCG	0.706																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6668T>G	20.37:g.60895706A>C	ENSP00000252999:p.Leu2223Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	1.825	-0.471240	0.04445	.	.	ENSG00000130702	ENST00000252999	T	0.10860	2.83	4.01	-3.35	0.04928	Laminin I (1);	1.233460	0.05846	U	0.620293	T	0.06781	0.0173	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.43278	-0.9401	10	0.13470	T	0.59	.	6.2822	0.21013	0.5127:0.1317:0.3557:0.0	.	2223	O15230	LAMA5_HUMAN	R	2223	ENSP00000252999:L2223R	ENSP00000252999:L2223R	L	-	2	0	LAMA5	60329101	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-2.320000	0.01119	-0.781000	0.04548	-0.402000	0.06365	CTG		0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2		NM_005560	
MED15	51586	broad.mit.edu	37	22	20920819	20920819	+	Silent	SNP	G	G	A	rs535773989|rs368721341	byFrequency	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr22:20920819G>A	ENST00000263205.7	+	7	825	c.756G>A	c.(754-756)caG>caA	p.Q252Q	MED15_ENST00000292733.7_Silent_p.Q252Q|MED15_ENST00000382974.2_Silent_p.Q181Q|MED15_ENST00000406969.1_Silent_p.Q226Q|MED15_ENST00000542773.1_Silent_p.Q57Q|MED15_ENST00000541476.1_Silent_p.Q226Q|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000425759.2_Silent_p.Q141Q	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	252	Poly-Gln.			Missing (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q252Q(2)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			agcaacagcagcagcagcagc	0.597																																																	2	Substitution - coding silent(2)	kidney(2)						-	,	0,4240		0,0,2120	20.0	26.0	24.0		756,756	0.4	0.9	22		24	1,8273		0,1,4136	no	coding-synonymous,coding-synonymous	MED15	NM_001003891.1,NM_015889.3	,	0,1,6256	AA,AG,GG		0.0121,0.0,0.0080	,	252/789,252/749	20920819	1,12513	2120	4137	6257	SO:0001819	synonymous_variant	51586			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.756G>A	22.37:g.20920819G>A		Somatic		WXS	Illumina GAIIx	Phase_I	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Silent	SNP	ENST00000263205.7	37	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	G	4.642	0.119392	0.08881	0.0	1.21E-4	ENSG00000099917	ENST00000423862	.	.	.	1.57	0.371	0.16168	.	.	.	.	.	T	0.45558	0.1348	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23511	-1.0186	4	.	.	.	.	4.2386	0.10637	0.2665:0.0:0.7335:0.0	.	.	.	.	T	193	.	.	A	+	1	0	MED15	19250819	0.943000	0.32029	0.949000	0.38748	0.705000	0.40729	0.021000	0.13489	-0.062000	0.13088	0.550000	0.68814	GCA		0.597	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2		NM_015889	
ANKRD36C	400986	broad.mit.edu	37	2	96521777	96521777	+	Missense_Mutation	SNP	T	T	C	rs77768218		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	30e58a1e-e7db-43ce-a7e8-a1fd21f4438e	7859fd3d-1bb7-4c19-ae09-58763723a5b9	g.chr2:96521777T>C	ENST00000456556.1	-	63	4316	c.4232A>G	c.(4231-4233)cAt>cGt	p.H1411R	ANKRD36C_ENST00000420871.2_Missense_Mutation_p.H662R|ANKRD36C_ENST00000419039.2_Missense_Mutation_p.H438R			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1411							ion channel inhibitor activity (GO:0008200)	p.H662R(6)|p.H1411R(3)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						AAGGTCTTCATGCTTTCTTTT	0.383																																																	9	Substitution - Missense(9)	kidney(6)|lung(3)																																								SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.4232A>G	2.37:g.96521777T>C	ENSP00000403302:p.His1411Arg	Somatic		WXS	Illumina GAIIx	Phase_I	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	1.211	-0.629664	0.03610	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.13196	2.61;2.61;2.61	1.87	0.665	0.17896	.	.	.	.	.	T	0.05731	0.0150	N	0.14661	0.345	0.09310	N	1	B	0.21071	0.051	B	0.15870	0.014	T	0.42666	-0.9438	9	0.15952	T	0.53	.	1.8453	0.03158	0.2739:0.1735:0.0:0.5526	.	1411	Q5JPF3	AN36C_HUMAN	R	662;1411;438	ENSP00000415231:H662R;ENSP00000403302:H1411R;ENSP00000407838:H438R	ENSP00000407838:H438R	H	-	2	0	AC073995.2	95885504	1.000000	0.71417	0.011000	0.14972	0.003000	0.03518	1.050000	0.30404	0.187000	0.20147	-0.818000	0.03119	CAT		0.383	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000338799.2		NM_001010914	
