#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA10	10349	hgsc.bcm.edu;ucsc.edu	37	17	67212477	67212477	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr17:67212477T>C	ENST00000269081.4	-	8	1462	c.553A>G	c.(553-555)Att>Gtt	p.I185V	ABCA10_ENST00000416101.2_Missense_Mutation_p.I185V|ABCA10_ENST00000432313.2_Missense_Mutation_p.I185V	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	185					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ATGAAGCAAATGTATGTCAAT	0.373																																																	0													150.0	152.0	152.0					17																	67212477		2203	4300	6503	SO:0001583	missense	10349			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.553A>G	17.37:g.67212477T>C	ENSP00000269081:p.Ile185Val	Somatic		WXS	SOLID	Phase_I	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	T	1.129	-0.653018	0.03480	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.84298	-1.83;-1.83;-1.83	3.2	-0.183	0.13284	.	0.569876	0.12456	U	0.467360	T	0.61565	0.2357	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.53535	-0.8425	10	0.41790	T	0.15	.	6.5514	0.22436	0.0:0.5288:0.0:0.4712	.	185;185	E5RFP5;Q8WWZ4	.;ABCAA_HUMAN	V	185	ENSP00000269081:I185V;ENSP00000407772:I185V;ENSP00000387674:I185V	ENSP00000269081:I185V	I	-	1	0	ABCA10	64724072	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.495000	0.06443	0.091000	0.17302	-1.009000	0.02473	ATT		0.373	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4		NM_080282	
ACTR5	79913	hgsc.bcm.edu	37	20	37394094	37394094	+	Missense_Mutation	SNP	T	T	G	rs373486054		TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr20:37394094T>G	ENST00000243903.4	+	6	1263	c.1226T>G	c.(1225-1227)aTg>aGg	p.M409R		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	409					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GTGGAAAGCATGAATGATTTT	0.488																																																	0													146.0	144.0	145.0					20																	37394094		2203	4300	6503	SO:0001583	missense	79913			AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1226T>G	20.37:g.37394094T>G	ENSP00000243903:p.Met409Arg	Somatic		WXS	SOLID	Phase_I	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	37	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.575678	0.28092	.	.	ENSG00000101442	ENST00000243903	D	0.96104	-3.91	5.13	5.13	0.70059	.	0.507072	0.24169	N	0.040903	D	0.92987	0.7768	L	0.46157	1.445	0.30027	N	0.813811	B	0.28178	0.202	B	0.32090	0.14	D	0.89024	0.3437	10	0.27785	T	0.31	-4.7923	13.791	0.63140	0.0:0.0:0.0:1.0	.	409	Q9H9F9	ARP5_HUMAN	R	409	ENSP00000243903:M409R	ENSP00000243903:M409R	M	+	2	0	ACTR5	36827508	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.370000	0.66144	2.064000	0.61679	0.374000	0.22700	ATG		0.488	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2		NM_024855	
AQP7	364	hgsc.bcm.edu	37	9	33385667	33385667	+	Silent	SNP	A	A	G	rs79779983	byFrequency	TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr9:33385667A>G	ENST00000537089.1	-	6	765	c.447T>C	c.(445-447)ggT>ggC	p.G149G	AQP7_ENST00000377425.4_Silent_p.G184G|AQP7_ENST00000541274.1_Silent_p.L110L|AQP7_ENST00000539936.1_Silent_p.G241G			O14520	AQP7_HUMAN	aquaporin 7	241					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTTTGCCCCAACCAGCAATGA	0.592																																																	0													67.0	75.0	73.0					9																	33385667		2203	4300	6503	SO:0001819	synonymous_variant	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.447T>C	9.37:g.33385667A>G		Somatic		WXS	SOLID	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000537089.1	37																																																																																					0.592	AQP7-202	KNOWN	basic	protein_coding	protein_coding			NM_001170	
ATP1A1	476	hgsc.bcm.edu;ucsc.edu	37	1	116936278	116936278	+	Silent	SNP	T	T	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr1:116936278T>C	ENST00000295598.5	+	12	1845	c.1593T>C	c.(1591-1593)gaT>gaC	p.D531D	ATP1A1_ENST00000537345.1_Silent_p.D531D|ATP1A1_ENST00000369496.4_Silent_p.D500D	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	531					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	AGCCCCTGGATGAGGAGCTGA	0.582																																																	0													61.0	66.0	64.0					1																	116936278		2203	4300	6503	SO:0001819	synonymous_variant	476			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1593T>C	1.37:g.116936278T>C		Somatic		WXS	SOLID	Phase_I	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Silent	SNP	ENST00000295598.5	37	CCDS887.1																																																																																				0.582	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5		NM_001160233	
B4GALNT2	124872	hgsc.bcm.edu;ucsc.edu	37	17	47241500	47241500	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr17:47241500C>A	ENST00000300404.2	+	8	1056	c.997C>A	c.(997-999)Ccc>Acc	p.P333T	B4GALNT2_ENST00000504681.1_Missense_Mutation_p.P247T|B4GALNT2_ENST00000393354.2_Missense_Mutation_p.P273T	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	333					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			TTTCCTCCGCCCCCACAAGCT	0.502																																					GBM(124;244 1635 8663 18097 33175)												0													171.0	164.0	166.0					17																	47241500		2203	4300	6503	SO:0001583	missense	124872			AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.997C>A	17.37:g.47241500C>A	ENSP00000300404:p.Pro333Thr	Somatic		WXS	SOLID	Phase_I	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	ENST00000300404.2	37	CCDS11544.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839856	0.71488	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.62788	-0.0;-0.0;-0.0	5.58	4.61	0.57282	Glycosyl transferase, family 2 (1);	0.203527	0.37095	N	0.002244	T	0.70552	0.3237	M	0.65498	2.005	0.38892	D	0.957143	D;D	0.76494	0.997;0.999	P;D	0.69824	0.894;0.966	T	0.68969	-0.5269	10	0.25106	T	0.35	-24.3542	6.4709	0.22007	0.0:0.7607:0.0:0.2393	.	273;333	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	T	247;273;333	ENSP00000425510:P247T;ENSP00000377022:P273T;ENSP00000300404:P333T	ENSP00000300404:P333T	P	+	1	0	B4GALNT2	44596499	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.179000	0.58290	2.621000	0.88768	0.555000	0.69702	CCC		0.502	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1		NM_153446	
C12orf43	64897	hgsc.bcm.edu;ucsc.edu	37	12	121444125	121444125	+	Splice_Site	SNP	A	A	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr12:121444125A>G	ENST00000288757.3	-	4	382	c.360T>C	c.(358-360)gaT>gaC	p.D120D	C12orf43_ENST00000539736.1_Splice_Site_p.D120D|C12orf43_ENST00000537817.1_Splice_Site_p.D121D|C12orf43_ENST00000536407.2_Intron|C12orf43_ENST00000366211.2_Splice_Site_p.D78D|C12orf43_ENST00000445832.3_Splice_Site_p.D90D	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	120										cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACCACTCACCATCATCCTCCA	0.398																																																	0													173.0	140.0	151.0					12																	121444125		2203	4300	6503	SO:0001630	splice_region_variant	64897			AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.361+1T>C	12.37:g.121444125A>G		Somatic		WXS	SOLID	Phase_I	Q53HF0|Q9H9Z7	Silent	SNP	ENST00000288757.3	37	CCDS9210.1	.	.	.	.	.	.	.	.	.	.	A	0.590	-0.833302	0.02713	.	.	ENSG00000157895	ENST00000546272	.	.	.	5.32	-6.24	0.02046	.	.	.	.	.	T	0.61714	0.2369	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63839	-0.6546	4	.	.	.	-34.8215	13.9889	0.64353	0.4511:0.0:0.5489:0.0	.	.	.	.	T	73	.	.	M	-	2	0	C12orf43	119928508	0.507000	0.26146	0.325000	0.25375	0.115000	0.19883	-0.442000	0.06871	-1.301000	0.02338	-0.911000	0.02809	ATG		0.398	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_022895	Silent
FAM209A	200232	hgsc.bcm.edu;ucsc.edu	37	20	55100907	55100914	+	Frame_Shift_Del	DEL	AAAGAAAA	AAAGAAAA	-			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	AAAGAAAA	AAAGAAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr20:55100907_55100914delAAAGAAAA	ENST00000371328.3	+	2	620_627	c.297_304delAAAGAAAA	c.(295-306)ttaaagaaaaaafs	p.KKK100fs	FAM209A_ENST00000481560.1_3'UTR|GCNT7_ENST00000243913.4_5'UTR	NM_001012971.3	NP_001012989.2	Q5JX71	F209A_HUMAN	family with sequence similarity 209, member A	100						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.K101*(1)									ACTCTCCATTAAAGAAAAAAAGAAATGC	0.428																																																	1	Substitution - Nonsense(1)	lung(1)																																								SO:0001589	frameshift_variant	0			AL109806	CCDS33493.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000124103	ENSG00000124103			16100	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 106"""	C20orf106			Standard	NM_001012971		Approved	dJ1153D9.3		Q5JX71	OTTHUMG00000032799	ENST00000371328.3:c.297_304delAAAGAAAA	20.37:g.55100907_55100914delAAAGAAAA	ENSP00000360379:p.Lys100fs	Somatic		WXS	SOLID	Phase_I	Q05C43	Frame_Shift_Del	DEL	ENST00000371328.3	37	CCDS33493.1																																																																																				0.428	FAM209A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079815.2			
NPR3	4883	hgsc.bcm.edu;ucsc.edu	37	5	32789785	32789785	+	3'UTR	SNP	A	A	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr5:32789785A>G	ENST00000265074.8	+	0	5303				AC026703.1_ENST00000326958.1_Missense_Mutation_p.K93R	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	CTTTGCCCCAAATGCATCACT	0.408																																																	0													153.0	124.0	134.0					5																	32789785		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.*3334A>G	5.37:g.32789785A>G		Somatic		WXS	SOLID	Phase_I	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	A	11.38	1.620697	0.28889	.	.	ENSG00000181495	ENST00000326958	.	.	.	4.36	-3.03	0.05429	.	.	.	.	.	T	0.36663	0.0975	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45454	-0.9260	5	0.87932	D	0	.	5.5232	0.16943	0.346:0.4695:0.1846:0.0	.	.	.	.	R	93	.	ENSP00000318340:K93R	K	+	2	0	AC026703.1	32825542	0.000000	0.05858	0.000000	0.03702	0.498000	0.33706	0.504000	0.22626	-0.480000	0.06803	0.482000	0.46254	AAA		0.408	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3		NM_000908	
CAPZB	832	hgsc.bcm.edu	37	1	19683945	19683945	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr1:19683945A>C	ENST00000375142.1	-	5	488	c.442T>G	c.(442-444)Tgg>Ggg	p.W148G	CAPZB_ENST00000401084.2_Missense_Mutation_p.W148G|CAPZB_ENST00000264202.6_Missense_Mutation_p.W148G|CAPZB_ENST00000433834.1_Missense_Mutation_p.W177G|CAPZB_ENST00000375144.1_Missense_Mutation_p.W136G|CAPZB_ENST00000264203.3_Missense_Mutation_p.W174G	NM_001206540.1	NP_001193469.1	P47756	CAPZB_HUMAN	capping protein (actin filament) muscle Z-line, beta	148					actin cytoskeleton organization (GO:0030036)|barbed-end actin filament capping (GO:0051016)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|muscle fiber development (GO:0048747)|negative regulation of microtubule polymerization (GO:0031115)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)|regulation of protein kinase C signaling (GO:0090036)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|membrane (GO:0016020)|WASH complex (GO:0071203)|Z disc (GO:0030018)	actin binding (GO:0003779)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		ATGGAATCCCAGCAGCCTTTG	0.552																																																	0													107.0	100.0	102.0					1																	19683945		1934	4131	6065	SO:0001583	missense	832			U03271	CCDS41277.1, CCDS55579.1, CCDS72717.1, CCDS72718.1	1p36.1	2014-05-09			ENSG00000077549	ENSG00000077549			1491	protein-coding gene	gene with protein product		601572					Standard	NM_004930		Approved		uc021ohr.1	P47756	OTTHUMG00000002556	ENST00000375142.1:c.442T>G	1.37:g.19683945A>C	ENSP00000364284:p.Trp148Gly	Somatic		WXS	SOLID	Phase_I	Q32Q68|Q5U0L4|Q8TB49|Q9NUC4	Missense_Mutation	SNP	ENST00000375142.1	37	CCDS55579.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.454413	0.84209	.	.	ENSG00000077549	ENST00000401084;ENST00000264203;ENST00000375144;ENST00000375142;ENST00000433834;ENST00000375145;ENST00000264202;ENST00000413711;ENST00000457768	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.87450	0.6180	H	0.96048	3.76	0.80722	D	1	D;D;D;D	0.89917	1.0;0.987;1.0;1.0	D;D;D;D	0.97110	1.0;0.992;0.998;1.0	D	0.91247	0.5026	9	0.87932	D	0	-7.5595	15.014	0.71570	1.0:0.0:0.0:0.0	.	177;174;148;136	B1AK88;B1AK85;P47756-2;B1AK87	.;.;.;.	G	148;174;136;148;177;210;148;136;120	.	ENSP00000264202:W148G	W	-	1	0	CAPZB	19556532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.737000	0.91562	2.225000	0.72522	0.460000	0.39030	TGG		0.552	CAPZB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007260.1			
CATSPERB	79820	hgsc.bcm.edu;ucsc.edu	37	14	92126245	92126245	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr14:92126245A>T	ENST00000256343.3	-	15	1524	c.1368T>A	c.(1366-1368)caT>caA	p.H456Q		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	456					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TATAAAAACTATGAAAAGTCT	0.333																																																	0													73.0	74.0	74.0					14																	92126245		2203	4300	6503	SO:0001583	missense	79820			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1368T>A	14.37:g.92126245A>T	ENSP00000256343:p.His456Gln	Somatic		WXS	SOLID	Phase_I	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.976149	0.34848	.	.	ENSG00000133962	ENST00000256343	T	0.44083	0.93	4.76	0.986	0.19784	.	0.243738	0.29040	N	0.013336	T	0.51092	0.1654	L	0.53249	1.67	0.24410	N	0.994667	D	0.76494	0.999	D	0.72075	0.976	T	0.37220	-0.9715	10	0.41790	T	0.15	-16.9722	6.8326	0.23919	0.7111:0.0:0.2889:0.0	.	456	Q9H7T0	CTSRB_HUMAN	Q	456	ENSP00000256343:H456Q	ENSP00000256343:H456Q	H	-	3	2	CATSPERB	91195998	0.901000	0.30685	0.923000	0.36655	0.365000	0.29674	-0.068000	0.11561	-0.017000	0.14103	0.454000	0.30748	CAT		0.333	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1		NM_024764	
CDH3	1001	hgsc.bcm.edu	37	16	68721570	68721570	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr16:68721570A>C	ENST00000264012.4	+	12	2270	c.1726A>C	c.(1726-1728)Acc>Ccc	p.T576P	CDH3_ENST00000429102.2_Missense_Mutation_p.T576P|CDH3_ENST00000581171.1_Missense_Mutation_p.T521P	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	576	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		GTCTCCCCACACCTCCCCTTT	0.602																																																	2	Unknown(2)	breast(2)											144.0	110.0	122.0					16																	68721570		2198	4300	6498	SO:0001583	missense	1001			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1726A>C	16.37:g.68721570A>C	ENSP00000264012:p.Thr576Pro	Somatic		WXS	SOLID	Phase_I	B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.494102	0.26774	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.61274	0.12;0.12	5.29	2.97	0.34412	Cadherin (1);Cadherin-like (1);	0.176104	0.27206	N	0.020434	T	0.53578	0.1805	M	0.71206	2.165	0.37976	D	0.933447	B	0.10296	0.003	B	0.17433	0.018	T	0.51576	-0.8688	10	0.46703	T	0.11	.	8.3593	0.32348	0.5827:0.0:0.0:0.4173	.	576	P22223	CADH3_HUMAN	P	576;576;521	ENSP00000398485:T576P;ENSP00000264012:T576P	ENSP00000264012:T576P	T	+	1	0	CDH3	67279071	1.000000	0.71417	0.958000	0.39756	0.820000	0.46376	3.451000	0.52964	0.290000	0.22444	0.460000	0.39030	ACC		0.602	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2		NM_001793	
CHD2	1106	hgsc.bcm.edu	37	15	93492306	93492306	+	Splice_Site	SNP	A	A	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr15:93492306A>C	ENST00000394196.4	+	13	2570	c.1502A>C	c.(1501-1503)aAa>aCa	p.K501T	CHD2_ENST00000557381.1_Splice_Site_p.K501T|CHD2_ENST00000536619.1_Missense_Mutation_p.K514T|CHD2_ENST00000420239.2_Missense_Mutation_p.K501T	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	501	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TCCTGGTGCAAGTAGGTAGAA	0.358																																																	0													98.0	96.0	96.0					15																	93492306		2197	4298	6495	SO:0001630	splice_region_variant	1106			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1502+1A>C	15.37:g.93492306A>C		Somatic		WXS	SOLID	Phase_I	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	19.92	3.915684	0.73098	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000420239;ENST00000536619	D;D;T;T	0.93133	-3.17;-3.17;-0.56;-0.64	5.66	5.66	0.87406	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.35708	U	0.003034	D	0.94935	0.8362	L	0.39147	1.195	0.58432	D	0.999997	D;B;D	0.89917	1.0;0.237;0.993	D;B;D	0.79108	0.992;0.127;0.913	D	0.95616	0.8676	10	0.87932	D	0	-18.3927	15.9012	0.79377	1.0:0.0:0.0:0.0	.	514;501;501	B7Z3I4;O14647;O14647-2	.;CHD2_HUMAN;.	T	501;501;501;514	ENSP00000377747:K501T;ENSP00000451366:K501T;ENSP00000406581:K501T;ENSP00000443618:K514T	ENSP00000377747:K501T	K	+	2	0	CHD2	91293310	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.922000	0.70036	2.167000	0.68274	0.528000	0.53228	AAA;AAA;AAG;AAG		0.358	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3		NM_001271	Missense_Mutation
COL7A1	1294	hgsc.bcm.edu	37	3	48623284	48623284	+	Silent	SNP	C	C	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr3:48623284C>T	ENST00000328333.8	-	29	3872	c.3765G>A	c.(3763-3765)caG>caA	p.Q1255Q	COL7A1_ENST00000454817.1_Silent_p.Q1255Q	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1255	Interrupted collagenous region.|Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q1255H(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTTCCCCCTTCTGGCCCTGGG	0.582																																																	1	Substitution - Missense(1)	ovary(1)											147.0	156.0	153.0					3																	48623284		2203	4300	6503	SO:0001819	synonymous_variant	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.3765G>A	3.37:g.48623284C>T		Somatic		WXS	SOLID	Phase_I	Q14054|Q16507	Silent	SNP	ENST00000328333.8	37	CCDS2773.1																																																																																				0.582	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1		NM_000094	
CSMD2	114784	hgsc.bcm.edu	37	1	34312501	34312501	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr1:34312501G>T	ENST00000373381.4	-	6	1193	c.1017C>A	c.(1015-1017)ttC>ttA	p.F339L		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATTGGGCACTGAATCCGCGCT	0.607																																																	0													70.0	63.0	66.0					1																	34312501		2203	4300	6503	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1017C>A	1.37:g.34312501G>T	ENSP00000362479:p.Phe339Leu	Somatic		WXS	SOLID	Phase_I	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	18.24	3.581242	0.65992	.	.	ENSG00000121904	ENST00000373381	T	0.66638	-0.22	4.82	4.82	0.62117	CUB (5);	0.000000	0.85682	D	0.000000	D	0.86016	0.5832	H	0.98256	4.185	0.80722	D	1	B;D	0.71674	0.002;0.998	B;D	0.67548	0.02;0.952	D	0.88180	0.2870	10	0.48119	T	0.1	.	9.404	0.38451	0.0988:0.0:0.9012:0.0	.	299;339	Q7Z408;E7EUA6	CSMD2_HUMAN;.	L	339	ENSP00000362479:F339L	ENSP00000241312:F299L	F	-	3	2	CSMD2	34085088	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	3.140000	0.50585	2.378000	0.81104	0.561000	0.74099	TTC		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_052896	
CRB1	23418	hgsc.bcm.edu;ucsc.edu	37	1	197396821	197396821	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr1:197396821A>T	ENST00000367400.3	+	7	2501	c.2366A>T	c.(2365-2367)aAt>aTt	p.N789I	CRB1_ENST00000535699.1_Missense_Mutation_p.N720I|CRB1_ENST00000367397.1_Missense_Mutation_p.N170I|CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.N677I|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000544212.1_Missense_Mutation_p.N270I	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	789	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.		Missing (in early-onset retinal dystrophy; probable disease-associated mutation). {ECO:0000269|PubMed:22065545}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTTGTTCTTAATGATGGAAAT	0.373																																																	0													35.0	36.0	36.0					1																	197396821		2203	4298	6501	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2366A>T	1.37:g.197396821A>T	ENSP00000356370:p.Asn789Ile	Somatic		WXS	SOLID	Phase_I	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	A	13.24	2.178607	0.38511	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.46	2.07	0.26955	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.83308	0.5226	L	0.57536	1.79	0.43292	D	0.995274	D;D;P;P	0.55385	0.971;0.958;0.874;0.896	P;P;P;P	0.53861	0.736;0.563;0.592;0.522	T	0.80979	-0.1140	9	0.56958	D	0.05	.	7.0968	0.25315	0.4858:0.0:0.5142:0.0	.	720;677;438;789	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	I	720;789;677;270;170;438	ENSP00000438786:N720I;ENSP00000356370:N789I;ENSP00000356369:N677I;ENSP00000444556:N270I;ENSP00000356367:N170I	ENSP00000356367:N170I	N	+	2	0	CRB1	195663444	0.723000	0.28027	0.822000	0.32727	0.011000	0.07611	0.796000	0.26986	0.641000	0.30601	-0.248000	0.11899	AAT		0.373	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2		NM_201253	
DOCK10	55619	hgsc.bcm.edu	37	2	225684201	225684201	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr2:225684201T>A	ENST00000258390.7	-	29	3296	c.3229A>T	c.(3229-3231)Aac>Tac	p.N1077Y	DOCK10_ENST00000409592.3_Missense_Mutation_p.N1071Y	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1077					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATGTAATTGTTGACCATCTTA	0.333																																																	0													127.0	121.0	123.0					2																	225684201		1864	4099	5963	SO:0001583	missense	55619			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3229A>T	2.37:g.225684201T>A	ENSP00000258390:p.Asn1077Tyr	Somatic		WXS	SOLID	Phase_I	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779154	0.90195	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.68181	1.9;-0.31	6.15	6.15	0.99193	.	0.043240	0.85682	D	0.000000	T	0.74619	0.3740	L	0.49571	1.57	0.43740	D	0.996238	D;D	0.62365	0.991;0.984	P;P	0.56700	0.804;0.804	T	0.76940	-0.2773	10	0.87932	D	0	.	16.7886	0.85580	0.0:0.0:0.0:1.0	.	1077;1071	Q96BY6;B3FL70	DOC10_HUMAN;.	Y	1071;1077	ENSP00000386694:N1071Y;ENSP00000258390:N1077Y	ENSP00000258390:N1077Y	N	-	1	0	DOCK10	225392445	1.000000	0.71417	0.955000	0.39395	0.975000	0.68041	6.692000	0.74578	2.363000	0.80096	0.523000	0.50628	AAC		0.333	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			
FANCI	55215	hgsc.bcm.edu	37	15	89837146	89837146	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr15:89837146G>C	ENST00000310775.7	+	23	2460	c.2374G>C	c.(2374-2376)Gcc>Ccc	p.A792P	FANCI_ENST00000300027.8_Missense_Mutation_p.A792P	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	792					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					AGCGGGTAAAGCCAAAACTAA	0.353								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													117.0	109.0	112.0					15																	89837146		2200	4299	6499	SO:0001583	missense	55215	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.2374G>C	15.37:g.89837146G>C	ENSP00000310842:p.Ala792Pro	Somatic		WXS	SOLID	Phase_I	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809857	0.50421	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.69926	-0.39;-0.44;0.33	5.72	3.85	0.44370	.	0.366449	0.33772	N	0.004561	T	0.39436	0.1078	N	0.03608	-0.345	0.80722	D	1	B;P;P	0.35208	0.13;0.49;0.49	B;B;B	0.33750	0.124;0.169;0.169	T	0.39583	-0.9607	10	0.46703	T	0.11	-4.651	7.9865	0.30216	0.2656:0.0:0.7344:0.0	.	792;792;792	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	P	792	ENSP00000300027:A792P;ENSP00000310842:A792P;ENSP00000413249:A792P	ENSP00000300027:A792P	A	+	1	0	FANCI	87638150	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	4.064000	0.57506	1.438000	0.47492	0.655000	0.94253	GCC		0.353	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1		NM_018193	
FRYL	285527	hgsc.bcm.edu;ucsc.edu	37	4	48542918	48542918	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr4:48542918C>G	ENST00000503238.1	-	43	5746	c.5747G>C	c.(5746-5748)gGa>gCa	p.G1916A	FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.G1916A|FRYL_ENST00000358350.4_Missense_Mutation_p.G1916A			O94915	FRYL_HUMAN	FRY-like	1916					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ATTGAGTTGTCCAGTGCTTTT	0.353																																																	0													127.0	119.0	121.0					4																	48542918		1861	4103	5964	SO:0001583	missense	285527			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.5747G>C	4.37:g.48542918C>G	ENSP00000426064:p.Gly1916Ala	Somatic		WXS	SOLID	Phase_I	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.365308|4.365308	0.82463|0.82463	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810|ENST00000514617	T;T;T|.	0.23754|.	1.89;1.89;1.89|.	6.16|6.16	6.16|6.16	0.99307|0.99307	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78502|0.78502	0.4293|0.4293	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.96;0.976|.	D;P;P|.	0.83275|.	0.996;0.744;0.869|.	T|T	0.75317|0.75317	-0.3360|-0.3360	10|5	0.20519|.	T|.	0.43|.	.|.	20.8598|20.8598	0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	746;1916;1916|.	Q6ZR29;O94915;F5GX82|.	.;FRYL_HUMAN;.|.	A|C	1916|785	ENSP00000426064:G1916A;ENSP00000351113:G1916A;ENSP00000441114:G1916A|.	ENSP00000351113:G1916A|.	G|W	-|-	2|3	0|0	FRYL|FRYL	48237675|48237675	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	7.226000|7.226000	0.78060|0.78060	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GGA|TGG		0.353	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2			
GPR158	57512	hgsc.bcm.edu;ucsc.edu	37	10	25701402	25701402	+	Splice_Site	SNP	G	G	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr10:25701402G>T	ENST00000376351.3	+	4	1694	c.1335G>T	c.(1333-1335)aaG>aaT	p.K445N		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	445					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GCAAAGCAAAGGTAAACCCAG	0.433																																																	0													120.0	105.0	110.0					10																	25701402		2203	4300	6503	SO:0001630	splice_region_variant	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1335+1G>T	10.37:g.25701402G>T		Somatic		WXS	SOLID	Phase_I	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669054	0.88348	.	.	ENSG00000151025	ENST00000376351	D	0.88277	-2.36	6.16	6.16	0.99307	GPCR, family 3, C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.95648	0.8585	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95244	0.8354	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	445	Q5T848	GP158_HUMAN	N	445	ENSP00000365529:K445N	ENSP00000365529:K445N	K	+	3	2	GPR158	25741408	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.443000	0.80521	2.937000	0.99478	0.650000	0.86243	AAG		0.433	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2		XM_166110	Missense_Mutation
HEATR1	55127	hgsc.bcm.edu;ucsc.edu	37	1	236714231	236714231	+	Missense_Mutation	SNP	G	G	C	rs145439234		TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr1:236714231G>C	ENST00000366582.3	-	45	6520	c.6406C>G	c.(6406-6408)Ctg>Gtg	p.L2136V	LGALS8_ENST00000526589.1_3'UTR|HEATR1_ENST00000366581.2_Missense_Mutation_p.L2055V|RP11-385F5.4_ENST00000433131.1_RNA|LGALS8_ENST00000366584.4_3'UTR	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	2136					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGCTCTCCCAGGACAGTTTCC	0.338																																																	0													116.0	120.0	119.0					1																	236714231		2203	4300	6503	SO:0001583	missense	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.6406C>G	1.37:g.236714231G>C	ENSP00000355541:p.Leu2136Val	Somatic		WXS	SOLID	Phase_I	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299365	0.40694	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.10382	2.88;2.95	5.36	1.13	0.20643	Armadillo-like helical (1);	0.150982	0.44902	D	0.000412	T	0.36496	0.0969	M	0.90870	3.155	0.80722	D	1	P;D	0.89917	0.757;1.0	B;D	0.83275	0.336;0.996	T	0.34428	-0.9829	10	0.56958	D	0.05	.	10.8406	0.46712	0.3146:0.0:0.6854:0.0	.	2055;2136	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	V	2136;2055	ENSP00000355541:L2136V;ENSP00000355540:L2055V	ENSP00000355540:L2055V	L	-	1	2	HEATR1	234780854	0.850000	0.29656	0.378000	0.26068	0.443000	0.32047	0.993000	0.29680	0.349000	0.23975	0.655000	0.94253	CTG		0.338	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1		XM_375853	
HSPA4	3308	hgsc.bcm.edu	37	5	132424179	132424179	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr5:132424179T>A	ENST00000304858.2	+	9	1358	c.1069T>A	c.(1069-1071)Ttt>Att	p.F357I	HSPA4_ENST00000504328.1_3'UTR	NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	357					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GATCAGCAAATTTTTCGGTAA	0.353																																					Colon(114;1299 1588 6063 12302 48757)												0													120.0	111.0	114.0					5																	132424179		2203	4300	6503	SO:0001583	missense	3308			AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.1069T>A	5.37:g.132424179T>A	ENSP00000302961:p.Phe357Ile	Somatic		WXS	SOLID	Phase_I	O95756|Q2TAL4|Q9BUK9	Missense_Mutation	SNP	ENST00000304858.2	37	CCDS4166.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511070	0.85389	.	.	ENSG00000170606	ENST00000304858;ENST00000537974	T	0.01005	5.45	6.02	4.86	0.63082	.	0.043381	0.85682	D	0.000000	T	0.01592	0.0051	L	0.59967	1.855	0.80722	D	1	P	0.38300	0.626	B	0.37550	0.253	T	0.64385	-0.6420	10	0.48119	T	0.1	-12.9748	11.9655	0.53033	0.0:0.0672:0.0:0.9328	.	357	P34932	HSP74_HUMAN	I	357	ENSP00000302961:F357I	ENSP00000302961:F357I	F	+	1	0	HSPA4	132452078	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	1.104000	0.41587	0.528000	0.53228	TTT		0.353	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1		NM_002154, NM_198431	
KCTD16	57528	hgsc.bcm.edu	37	5	143586839	143586839	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr5:143586839A>G	ENST00000507359.3	+	2	1653	c.562A>G	c.(562-564)Aga>Gga	p.R188G	KCTD16_ENST00000512467.1_Missense_Mutation_p.R188G	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	188					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CAAGTTTCGGAGAGTTCCCCG	0.522																																																	0													61.0	64.0	63.0					5																	143586839		2203	4300	6503	SO:0001583	missense	57528			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.562A>G	5.37:g.143586839A>G	ENSP00000426548:p.Arg188Gly	Somatic		WXS	SOLID	Phase_I	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	A	12.20	1.865825	0.32977	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.55588	0.51;0.51	5.69	1.84	0.25277	.	0.000000	0.85682	D	0.000000	T	0.48003	0.1476	M	0.71036	2.16	0.52501	D	0.99995	B	0.06786	0.001	B	0.04013	0.001	T	0.41106	-0.9527	10	0.59425	D	0.04	.	8.0756	0.30714	0.6783:0.2555:0.0661:0.0	.	188	Q68DU8	KCD16_HUMAN	G	188	ENSP00000424151:R188G;ENSP00000426548:R188G	ENSP00000426548:R188G	R	+	1	2	KCTD16	143567032	1.000000	0.71417	0.762000	0.31397	0.997000	0.91878	4.003000	0.57061	0.079000	0.16929	0.459000	0.35465	AGA		0.522	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3		XM_098368	
KLK3	354	hgsc.bcm.edu;ucsc.edu	37	19	51363270	51363270	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr19:51363270G>C	ENST00000326003.2	+	5	714	c.673G>C	c.(673-675)Ggt>Cgt	p.G225R	KLK3_ENST00000360617.3_3'UTR|KLK3_ENST00000595952.1_Missense_Mutation_p.G182R	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	225	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		TGTGCTTCAAGGTATCACGTC	0.542																																					Colon(185;1767 2023 13025 30120 37630)												0													206.0	166.0	180.0					19																	51363270		2203	4300	6503	SO:0001583	missense	354			X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.673G>C	19.37:g.51363270G>C	ENSP00000314151:p.Gly225Arg	Somatic		WXS	SOLID	Phase_I	C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	ENST00000326003.2	37	CCDS12807.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663186	0.67700	.	.	ENSG00000142515	ENST00000326003;ENST00000422986;ENST00000326052	T	0.60171	0.21	3.41	3.41	0.39046	.	0.000000	0.38897	N	0.001537	T	0.81069	0.4746	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86464	0.1781	10	0.87932	D	0	.	13.0972	0.59200	0.0:0.0:1.0:0.0	.	184;182	Q8NCW4;G3V0H4	.;.	R	225;182;184	ENSP00000314151:G225R	ENSP00000314151:G225R	G	+	1	0	KLK3	56055082	1.000000	0.71417	0.019000	0.16419	0.157000	0.22087	5.950000	0.70265	1.833000	0.53350	0.400000	0.26472	GGT		0.542	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1		NM_145864	
FAN1	22909	hgsc.bcm.edu;ucsc.edu	37	15	31206244	31206244	+	Silent	SNP	C	C	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr15:31206244C>T	ENST00000362065.4	+	5	2052	c.1761C>T	c.(1759-1761)taC>taT	p.Y587Y		NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	587					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						TTCCTAGTTACACCATCAATC	0.438								Direct reversal of damage																																									0													130.0	123.0	125.0					15																	31206244		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.1761C>T	15.37:g.31206244C>T		Somatic		WXS	SOLID	Phase_I	A8K4M2|Q86WU8	Silent	SNP	ENST00000362065.4	37	CCDS32186.1																																																																																				0.438	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1		NM_014967	
MUC16	94025	hgsc.bcm.edu;ucsc.edu	37	19	9067458	9067458	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	C	T	C	C	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr19:9067458C>T	ENST00000397910.4	-	3	20191	c.19988G>A	c.(19987-19989)aGc>aAc	p.S6663N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6665	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGGGAGGTGCTGGTTCCCTT	0.517																																																	0													108.0	107.0	108.0					19																	9067458		2029	4181	6210	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19988G>A	19.37:g.9067458C>T	ENSP00000381008:p.Ser6663Asn	Somatic		WXS	SOLID	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	6.071	0.381347	0.11466	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	2.72	0.296	0.15757	.	.	.	.	.	T	0.02494	0.0076	L	0.38838	1.175	.	.	.	P	0.34587	0.458	B	0.33339	0.162	T	0.38908	-0.9639	8	0.87932	D	0	.	3.2661	0.06865	0.2517:0.5989:0.0:0.1493	.	6663	B5ME49	.	N	6663	ENSP00000381008:S6663N	ENSP00000381008:S6663N	S	-	2	0	MUC16	8928458	0.000000	0.05858	0.001000	0.08648	0.086000	0.17979	-0.200000	0.09478	0.165000	0.19558	0.163000	0.16589	AGC		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
NPRL2	10641	hgsc.bcm.edu	37	3	50387111	50387111	+	Silent	SNP	A	A	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr3:50387111A>G	ENST00000232501.3	-	3	762	c.324T>C	c.(322-324)taT>taC	p.Y108Y	NPRL2_ENST00000493465.1_5'Flank|CYB561D2_ENST00000232508.5_5'Flank|CYB561D2_ENST00000424512.1_5'Flank|ZMYND10_ENST00000231749.3_5'Flank|XXcos-LUCA11.5_ENST00000606589.1_5'Flank|CYB561D2_ENST00000418577.1_5'Flank|CYB561D2_ENST00000425346.1_5'Flank	NM_006545.4	NP_006536.3	Q8WTW4	NPRL2_HUMAN	nitrogen permease regulator-like 2 (S. cerevisiae)	108	Interaction with PDPK1.				negative regulation of kinase activity (GO:0033673)|protein phosphorylation (GO:0006468)		GTPase activator activity (GO:0005096)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	11						GTGTGGTCAGATAGCCAGCCA	0.557																																																	0													109.0	111.0	110.0					3																	50387111		2202	4300	6502	SO:0001819	synonymous_variant	10641			AF040708	CCDS2826.1	3p21.3	2010-03-30	2010-03-30	2010-03-30	ENSG00000114388	ENSG00000114388			24969	protein-coding gene	gene with protein product		607072	"""tumor suppressor candidate 4"""	TUSC4		11085536	Standard	NM_006545		Approved	NPR2L, NPR2	uc003daj.1	Q8WTW4	OTTHUMG00000156864	ENST00000232501.3:c.324T>C	3.37:g.50387111A>G		Somatic		WXS	SOLID	Phase_I	A8K831|Q6FGS2|Q9Y249|Q9Y497	Silent	SNP	ENST00000232501.3	37	CCDS2826.1																																																																																				0.557	NPRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346299.1		NM_006545	
OSGIN1	29948	hgsc.bcm.edu	37	16	83984776	83984776	+	Missense_Mutation	SNP	A	A	C	rs28555129|rs561380669	byFrequency	TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr16:83984776A>C	ENST00000343939.2	+	2	484	c.101A>C	c.(100-102)aAc>aCc	p.N34T	OSGIN1_ENST00000565123.1_5'Flank|RP11-505K9.4_ENST00000561562.1_3'UTR|OSGIN1_ENST00000393306.1_5'Flank|OSGIN1_ENST00000361711.3_Intron			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	34			N -> T (in dbSNP:rs28555129). {ECO:0000269|PubMed:14570898}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						TCTACCAGGAAccagccccag	0.597													C|||	3785	0.755791	0.7368	0.8156	5008	,	,		14824	0.8958		0.6839	False		,,,				2504	0.6687																0								C	,THR/ASN	2976,1018		1106,764,127	46.0	41.0	43.0		,101	0.8	0.0	16	dbSNP_125	43	5481,2487		1890,1701,393	yes	intron,missense	OSGIN1	NM_182980.2,NM_013370.3	,65	2996,2465,520	CC,CA,AA		31.2123,25.4882,29.3011	,benign	,34/561	83984776	8457,3505	1997	3984	5981	SO:0001583	missense	29948			AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.101A>C	16.37:g.83984776A>C	ENSP00000343376:p.Asn34Thr	Somatic		WXS	SOLID	Phase_I	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	37		1663	0.7614468864468864	359	0.7296747967479674	288	0.7955801104972375	497	0.8688811188811189	519	0.6846965699208444	C	3.933	-0.015772	0.07681	0.745118	0.687877	ENSG00000140961	ENST00000343939	T	0.10573	2.86	0.772	0.772	0.18510	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.32824	-0.9892	8	0.02654	T	1	.	3.908	0.09191	0.4182:0.5818:0.0:0.0	rs28555129	34	Q9UJX0	OSGI1_HUMAN	T	34	ENSP00000343376:N34T	ENSP00000343376:N34T	N	+	2	0	OSGIN1	82542277	0.015000	0.18098	0.002000	0.10522	0.002000	0.02628	-0.244000	0.08903	-0.076000	0.12775	-0.225000	0.12378	AAC		0.597	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1		NM_013370	
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52643504	52643504	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr3:52643504T>A	ENST00000296302.7	-	16	2393	c.2392A>T	c.(2392-2394)Aga>Tga	p.R798*	PBRM1_ENST00000394830.3_Nonsense_Mutation_p.R798*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R798*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R798*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R766*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R813*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.R798*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R813*			Q86U86	PB1_HUMAN	polybromo 1	798	Bromo 6. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTGTAGCATCTTCCCTCATCA	0.413			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													120.0	116.0	117.0					3																	52643504		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2392A>T	3.37:g.52643504T>A	ENSP00000296302:p.Arg798*	Somatic		WXS	SOLID	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	40	8.362139	0.98777	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	6.17	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.9432	12.3698	0.55248	0.0:0.0:0.2671:0.7329	.	.	.	.	X	766;798;798;798;798;798;813;813;798;757	.	ENSP00000296302:R798X	R	-	1	2	PBRM1	52618544	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.604000	0.54081	1.130000	0.42092	0.533000	0.62120	AGA		0.413	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PDE4C	5143	hgsc.bcm.edu	37	19	18322690	18322691	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr19:18322690_18322691insA	ENST00000355502.3	-	18	2540_2541	c.1669_1670insT	c.(1669-1671)tacfs	p.Y557fs	AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000262805.12_Frame_Shift_Ins_p.Y525fs|PDE4C_ENST00000594617.3_Frame_Shift_Ins_p.Y557fs|PDE4C_ENST00000447275.3_Frame_Shift_Ins_p.Y451fs|PDE4C_ENST00000539010.1_Frame_Shift_Ins_p.Y326fs|AC068499.10_ENST00000599416.2_RNA|PDE4C_ENST00000597297.1_Frame_Shift_Ins_p.Y327fs|PDE4C_ENST00000594465.3_Frame_Shift_Ins_p.Y557fs|PDE4C_ENST00000598111.2_Frame_Shift_Ins_p.Y272fs			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	557					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CCACTGGCGGTACAGGGGCAGC	0.629																																																	0																																										SO:0001589	frameshift_variant	5143				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1670dupT	19.37:g.18322691_18322691dupA	ENSP00000347689:p.Tyr557fs	Somatic		WXS	SOLID	Phase_I	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Frame_Shift_Ins	INS	ENST00000355502.3	37	CCDS12373.1																																																																																				0.629	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1			
PDZD2	23037	hgsc.bcm.edu;ucsc.edu	37	5	32061215	32061215	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr5:32061215T>C	ENST00000438447.1	+	14	2814	c.2426T>C	c.(2425-2427)gTc>gCc	p.V809A	PDZD2_ENST00000282493.3_Missense_Mutation_p.V809A			O15018	PDZD2_HUMAN	PDZ domain containing 2	809	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GTTCGCCTTGTCATCGGCCGG	0.517																																																	0													89.0	73.0	78.0					5																	32061215		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2426T>C	5.37:g.32061215T>C	ENSP00000402033:p.Val809Ala	Somatic		WXS	SOLID	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	T	31	5.072209	0.93950	.	.	ENSG00000133401	ENST00000438447;ENST00000282493	T;T	0.28255	1.62;1.62	5.76	5.76	0.90799	PDZ/DHR/GLGF (3);	0.000000	0.43110	D	0.000604	T	0.47210	0.1433	L	0.46741	1.465	0.45580	D	0.998521	D;D	0.71674	0.977;0.998	P;D	0.65573	0.846;0.936	T	0.44221	-0.9342	10	0.66056	D	0.02	.	14.0391	0.64663	0.0:0.0:0.0:1.0	.	635;809	B4E3P2;O15018	.;PDZD2_HUMAN	A	809	ENSP00000402033:V809A;ENSP00000282493:V809A	ENSP00000282493:V809A	V	+	2	0	PDZD2	32096972	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.521000	0.81832	2.202000	0.70862	0.533000	0.62120	GTC		0.517	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PGPEP1L	145814	hgsc.bcm.edu	37	15	99511807	99511808	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr15:99511807_99511808insT	ENST00000378919.6	-	5	695_696	c.490_491insA	c.(490-492)agafs	p.R164fs	PGPEP1L_ENST00000535714.1_Frame_Shift_Ins_p.R110fs|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	164							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						GATGATGACTCTCAAGGCTCTT	0.564																																																	0																																										SO:0001589	frameshift_variant	145814				CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.491dupA	15.37:g.99511808_99511808dupT	ENSP00000368199:p.Arg164fs	Somatic		WXS	SOLID	Phase_I	H0YF86	Frame_Shift_Ins	INS	ENST00000378919.6	37	CCDS53977.1																																																																																				0.564	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1		NM_001102612.2	
PICK1	9463	hgsc.bcm.edu;ucsc.edu	37	22	38467740	38467740	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr22:38467740A>T	ENST00000404072.3	+	8	892	c.545A>T	c.(544-546)cAg>cTg	p.Q182L	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000356976.3_Missense_Mutation_p.Q182L	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	182	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					GAGCTGTCGCAGACTCACCGG	0.617																																																	0													84.0	77.0	79.0					22																	38467740		2203	4300	6503	SO:0001583	missense	9463			AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.545A>T	22.37:g.38467740A>T	ENSP00000385205:p.Gln182Leu	Somatic		WXS	SOLID	Phase_I	B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	37	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386399	0.61956	.	.	ENSG00000100151	ENST00000404072;ENST00000424694;ENST00000356976	T;T;T	0.80033	-1.33;-1.33;-1.33	5.18	5.18	0.71444	Arfaptin-like (3);	0.215887	0.49916	D	0.000140	T	0.78916	0.4359	M	0.64404	1.975	0.80722	D	1	B	0.12630	0.006	B	0.13407	0.009	T	0.75961	-0.3133	10	0.49607	T	0.09	-29.9275	15.3491	0.74368	1.0:0.0:0.0:0.0	.	182	Q9NRD5	PICK1_HUMAN	L	182	ENSP00000385205:Q182L;ENSP00000398141:Q182L;ENSP00000349465:Q182L	ENSP00000349465:Q182L	Q	+	2	0	PICK1	36797686	1.000000	0.71417	0.953000	0.39169	0.990000	0.78478	7.530000	0.81962	2.104000	0.64026	0.533000	0.62120	CAG		0.617	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2		NM_012407	
PNPLA3	80339	hgsc.bcm.edu;ucsc.edu	37	22	44322980	44322980	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr22:44322980T>G	ENST00000216180.3	+	2	526	c.353T>G	c.(352-354)cTt>cGt	p.L118R	PNPLA3_ENST00000423180.2_Missense_Mutation_p.L114R|PNPLA3_ENST00000478713.1_3'UTR	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	118	Patatin.				acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				GGCATCTCTCTTACCAGAGTG	0.498																																																	0													86.0	77.0	80.0					22																	44322980		2203	4300	6503	SO:0001583	missense	80339				CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.353T>G	22.37:g.44322980T>G	ENSP00000216180:p.Leu118Arg	Somatic		WXS	SOLID	Phase_I	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Missense_Mutation	SNP	ENST00000216180.3	37	CCDS14054.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.672675	0.67928	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	T;T	0.77750	-1.12;-1.12	5.6	5.6	0.85130	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.000000	0.64402	D	0.000011	D	0.90219	0.6942	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92314	0.5860	10	0.87932	D	0	-45.8499	14.6283	0.68638	0.0:0.0:0.0:1.0	.	118	Q9NST1	PLPL3_HUMAN	R	118;114	ENSP00000216180:L118R;ENSP00000397987:L114R	ENSP00000216180:L118R	L	+	2	0	PNPLA3	42654313	1.000000	0.71417	0.969000	0.41365	0.288000	0.27193	7.322000	0.79097	2.122000	0.65172	0.523000	0.50628	CTT		0.498	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1		NM_025225	
PRX	57716	hgsc.bcm.edu	37	19	40902612	40902612	+	Silent	SNP	C	C	G	rs202113722		TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr19:40902612C>G	ENST00000324001.7	-	7	1917	c.1647G>C	c.(1645-1647)ccG>ccC	p.P549P	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	549	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.P549P(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGACACTTTCGGCAGCTGTA	0.577																																																	1	Substitution - coding silent(1)	ovary(1)											89.0	102.0	97.0					19																	40902612		2202	4297	6499	SO:0001819	synonymous_variant	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1647G>C	19.37:g.40902612C>G		Somatic		WXS	SOLID	Phase_I	Q9BXL9|Q9HCF2	Silent	SNP	ENST00000324001.7	37	CCDS33028.1																																																																																				0.577	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1		NM_020956	
PTEN	5728	hgsc.bcm.edu;ucsc.edu	37	10	89690806	89690806	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr10:89690806T>A	ENST00000371953.3	+	4	1570	c.213T>A	c.(211-213)tgT>tgA	p.C71*		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	71	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		C -> Y (in CWS1; loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(6)|p.R55fs*1(5)|p.L70fs*7(4)|p.C71fs*6(2)|p.Y27fs*1(2)|p.F56fs*2(1)|p.C71fs*28(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTTTTAGTTGTGCTGAAAGAC	0.299		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	58	Whole gene deletion(37)|Deletion - Frameshift(15)|Unknown(6)	prostate(16)|central_nervous_system(14)|breast(6)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|soft_tissue(1)|endometrium(1)|urinary_tract(1)											73.0	69.0	70.0					10																	89690806		2202	4293	6495	SO:0001587	stop_gained	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.213T>A	10.37:g.89690806T>A	ENSP00000361021:p.Cys71*	Somatic		WXS	SOLID	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	48	14.849772	0.99812	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.6451	16.1135	0.81278	0.0:0.0:0.0:1.0	.	.	.	.	X	71	.	.	C	+	3	2	PTEN	89680786	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.574000	0.67424	2.267000	0.75376	0.383000	0.25322	TGT		0.299	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1		NM_000314	
PTPN11	5781	hgsc.bcm.edu;ucsc.edu	37	12	112892409	112892409	+	Silent	SNP	T	T	C			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr12:112892409T>C	ENST00000351677.2	+	5	765	c.567T>C	c.(565-567)tcT>tcC	p.S189S	PTPN11_ENST00000392597.1_Silent_p.S189S	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	189	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTTTGATTCTTTGACAGATC	0.368			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0													110.0	104.0	106.0					12																	112892409		2203	4300	6503	SO:0001819	synonymous_variant	5781	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.567T>C	12.37:g.112892409T>C		Somatic		WXS	SOLID	Phase_I	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	T	10.71	1.427935	0.25726	.	.	ENSG00000179295	ENST00000530818	.	.	.	5.65	3.25	0.37280	.	.	.	.	.	T	0.54727	0.1876	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45498	-0.9257	4	.	.	.	.	6.2627	0.20910	0.0:0.1407:0.1357:0.7236	.	.	.	.	P	34	.	.	L	+	2	0	PTPN11	111376792	0.970000	0.33590	0.999000	0.59377	0.963000	0.63663	0.082000	0.14847	0.401000	0.25424	0.397000	0.26171	CTT		0.368	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2			
RPN2	6185	hgsc.bcm.edu;ucsc.edu	37	20	35842247	35842247	+	Silent	SNP	G	G	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr20:35842247G>A	ENST00000237530.6	+	9	1382	c.1071G>A	c.(1069-1071)cgG>cgA	p.R357R	RPN2_ENST00000373622.5_Silent_p.R325R	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	357					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GTGACAACCGGTATATTGCAA	0.363																																																	0													144.0	132.0	136.0					20																	35842247		2203	4300	6503	SO:0001819	synonymous_variant	6185			Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1071G>A	20.37:g.35842247G>A		Somatic		WXS	SOLID	Phase_I	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Silent	SNP	ENST00000237530.6	37	CCDS13291.1																																																																																				0.363	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2		NM_002951	
R3HDML	140902	hgsc.bcm.edu;ucsc.edu	37	20	42969922	42969922	+	Silent	SNP	C	C	T	rs571680930		TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr20:42969922C>T	ENST00000217043.2	+	2	520	c.348C>T	c.(346-348)taC>taT	p.Y116Y		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	116	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			TGATGAGATACGTGGGCCAGA	0.557																																																	0													68.0	63.0	65.0					20																	42969922		2203	4300	6503	SO:0001819	synonymous_variant	140902			BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.348C>T	20.37:g.42969922C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000217043.2	37	CCDS13329.1																																																																																				0.557	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1		NM_178491	
SEMA3A	10371	hgsc.bcm.edu	37	7	83764187	83764187	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr7:83764187C>T	ENST00000265362.4	-	2	507	c.193G>A	c.(193-195)Gaa>Aaa	p.E65K	SEMA3A_ENST00000436949.1_Missense_Mutation_p.E65K	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	65	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CTACTCCGTTCCTCATCCAAA	0.383																																																	0													114.0	107.0	109.0					7																	83764187		2203	4300	6503	SO:0001583	missense	10371			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.193G>A	7.37:g.83764187C>T	ENSP00000265362:p.Glu65Lys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	c	31	5.100831	0.94245	.	.	ENSG00000075213	ENST00000265362;ENST00000436949;ENST00000420047	T;T;T	0.10763	2.84;2.84;2.84	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.090555	0.85682	D	0.000000	T	0.28433	0.0703	L	0.46947	1.48	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.01169	-1.1430	10	0.62326	D	0.03	.	18.5015	0.90882	0.0:1.0:0.0:0.0	.	65	Q14563	SEM3A_HUMAN	K	65	ENSP00000265362:E65K;ENSP00000415260:E65K;ENSP00000391900:E65K	ENSP00000265362:E65K	E	-	1	0	SEMA3A	83602123	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.388000	0.79795	2.434000	0.82447	0.467000	0.42956	GAA		0.383	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2		NM_006080	
SH3BP4	23677	hgsc.bcm.edu	37	2	235950909	235950909	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr2:235950909G>T	ENST00000409212.1	+	4	2003	c.1496G>T	c.(1495-1497)tGt>tTt	p.C499F	SH3BP4_ENST00000392011.2_Missense_Mutation_p.C499F|SH3BP4_ENST00000344528.4_Missense_Mutation_p.C499F			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	499					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGGCATGACTGTGCCCCAAAG	0.567																																																	0													76.0	79.0	78.0					2																	235950909		2203	4300	6503	SO:0001583	missense	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1496G>T	2.37:g.235950909G>T	ENSP00000386862:p.Cys499Phe	Somatic		WXS	SOLID	Phase_I	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.161429	0.57368	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000409212;ENST00000344528	T;T;T	0.09445	2.98;2.98;2.98	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.28665	0.0710	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.04281	-1.0963	10	0.12766	T	0.61	-11.6078	17.259	0.87064	0.0:0.0:1.0:0.0	.	499;499	A8K594;Q9P0V3	.;SH3B4_HUMAN	F	499	ENSP00000375867:C499F;ENSP00000386862:C499F;ENSP00000340237:C499F	ENSP00000340237:C499F	C	+	2	0	SH3BP4	235615648	1.000000	0.71417	0.927000	0.36925	0.965000	0.64279	9.458000	0.97634	2.411000	0.81874	0.655000	0.94253	TGT		0.567	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1			
SLC9A8	23315	hgsc.bcm.edu	37	20	48429462	48429462	+	Start_Codon_SNP	SNP	G	G	T	rs76846045	byFrequency	TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr20:48429462G>T	ENST00000361573.2	+	1	45	c.3G>T	c.(1-3)atG>atT	p.M1I	SLC9A8_ENST00000417961.1_Start_Codon_SNP_p.M1I|SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000539601.1_5'UTR			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	1					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TCCGCAGGATGGGGGAGAAGA	0.736													G|||	40	0.00798722	0.0	0.0043	5008	,	,		10322	0.0		0.0249	False		,,,				2504	0.0123																0								G	ILE/MET	13,3199		0,13,1593	22.0	27.0	25.0		3	-4.6	0.5	20	dbSNP_131	25	84,5736		1,82,2827	no	missense	SLC9A8	NM_015266.1	10	1,95,4420	TT,TG,GG		1.4433,0.4047,1.074	benign	1/582	48429462	97,8935	1606	2910	4516	SO:0001582	initiator_codon_variant	23315			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.3G>T	20.37:g.48429462G>T	ENSP00000354966:p.Met1Ile	Somatic		WXS	SOLID	Phase_I	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	37	CCDS13421.1	21	0.009615384615384616	0	0.0	1	0.0027624309392265192	0	0.0	20	0.026385224274406333	G	16.36	3.101793	0.56183	0.004047	0.014433	ENSG00000197818	ENST00000417961;ENST00000361573	T;T	0.62232	0.04;0.04	5.78	-4.61	0.03380	.	1.040790	0.07547	N	0.914784	T	0.13200	0.0320	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41106	-0.9527	9	0.02654	T	1	.	8.6216	0.33864	0.1341:0.0:0.2058:0.66	.	1;1	Q9Y2E8-2;Q9Y2E8	.;SL9A8_HUMAN	I	1	ENSP00000416418:M1I;ENSP00000354966:M1I	ENSP00000354966:M1I	M	+	3	0	SLC9A8	47862869	0.956000	0.32656	0.530000	0.27963	0.995000	0.86356	-0.138000	0.10374	-1.188000	0.02705	0.549000	0.68633	ATG		0.736	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3		XM_030524	Missense_Mutation
SNAI2	6591	hgsc.bcm.edu;ucsc.edu	37	8	49833764	49833764	+	Missense_Mutation	SNP	C	C	T	rs560825840		TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr8:49833764C>T	ENST00000396822.1	-	2	418	c.61G>A	c.(61-63)Gaa>Aaa	p.E21K	SNAI2_ENST00000020945.1_Missense_Mutation_p.E21K			O43623	SNAI2_HUMAN	snail family zinc finger 2	21					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GTGTCCAGTTCGCTGTAGTTT	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17776	0.0		0.0	False		,,,				2504	0.0																0													153.0	152.0	153.0					8																	49833764		2203	4300	6503	SO:0001583	missense	6591			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.61G>A	8.37:g.49833764C>T	ENSP00000380034:p.Glu21Lys	Somatic		WXS	SOLID	Phase_I	B2R6P6|Q53FC1	Missense_Mutation	SNP	ENST00000396822.1	37	CCDS6146.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.734422	0.69189	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.12039	2.72;2.72	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.34774	0.0909	M	0.84326	2.69	0.80722	D	1	D	0.69078	0.997	P	0.53450	0.726	T	0.24154	-1.0168	9	.	.	.	-13.8947	18.7632	0.91862	0.0:1.0:0.0:0.0	.	21	O43623	SNAI2_HUMAN	K	21	ENSP00000020945:E21K;ENSP00000380034:E21K	.	E	-	1	0	SNAI2	49996317	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.541000	0.60670	2.425000	0.82216	0.313000	0.20887	GAA		0.473	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2		NM_003068	
SON	6651	hgsc.bcm.edu;ucsc.edu	37	21	34922635	34922635	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr21:34922635G>T	ENST00000356577.4	+	3	1573	c.1098G>T	c.(1096-1098)aaG>aaT	p.K366N	SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.K366N|SON_ENST00000381679.4_Missense_Mutation_p.K366N|SON_ENST00000290239.6_Missense_Mutation_p.K366N	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	366					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AGCTGCCTAAGACCACAGCGT	0.602																																																	0													96.0	104.0	101.0					21																	34922635		2203	4300	6503	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1098G>T	21.37:g.34922635G>T	ENSP00000348984:p.Lys366Asn	Somatic		WXS	SOLID	Phase_I	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552726	0.86127	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.13538	2.76;2.76;2.76;2.58	5.28	5.28	0.74379	.	0.330606	0.26317	N	0.025073	T	0.22360	0.0539	L	0.29908	0.895	0.35597	D	0.807527	D;D;D	0.69078	0.984;0.991;0.997	P;P;P	0.59221	0.632;0.798;0.854	T	0.07947	-1.0746	10	0.72032	D	0.01	.	14.7582	0.69583	0.0:0.0:1.0:0.0	.	366;366;366	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	N	366	ENSP00000348984:K366N;ENSP00000290239:K366N;ENSP00000300278:K366N;ENSP00000371095:K366N	ENSP00000290239:K366N	K	+	3	2	SON	33844505	0.944000	0.32072	1.000000	0.80357	0.988000	0.76386	6.014000	0.70784	2.633000	0.89246	0.561000	0.74099	AAG		0.602	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2		NM_138927	
STK11IP	114790	hgsc.bcm.edu	37	2	220467482	220467482	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr2:220467482G>T	ENST00000456909.1	+	7	692	c.602G>T	c.(601-603)tGt>tTt	p.C201F	STK11IP_ENST00000295641.10_Missense_Mutation_p.C212F|STK11IP_ENST00000459692.1_3'UTR			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	212					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCCAGGACTGTCAGGGATTC	0.512																																																	0													111.0	116.0	114.0					2																	220467482		2082	4204	6286	SO:0001583	missense	114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.602G>T	2.37:g.220467482G>T	ENSP00000389383:p.Cys201Phe	Somatic		WXS	SOLID	Phase_I	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37		.	.	.	.	.	.	.	.	.	.	G	22.0	4.227901	0.79576	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.20332	2.08;2.08	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.33000	0.0848	N	0.20530	0.585	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.91635	0.999;0.957;0.999;0.998	T	0.28522	-1.0041	10	0.87932	D	0	-13.4032	17.1754	0.86840	0.0:0.0:1.0:0.0	.	212;212;212;212	B4DUE4;B4DII2;Q8N1F8-2;Q8N1F8	.;.;.;S11IP_HUMAN	F	201;212;212	ENSP00000389383:C201F;ENSP00000295641:C212F	ENSP00000295641:C212F	C	+	2	0	STK11IP	220175726	1.000000	0.71417	0.965000	0.40720	0.970000	0.65996	8.148000	0.89630	2.383000	0.81215	0.650000	0.86243	TGT		0.512	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1		NM_052902	
USP15	9958	hgsc.bcm.edu;ucsc.edu	37	12	62777931	62777931	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr12:62777931C>A	ENST00000280377.5	+	11	1379	c.1321C>A	c.(1321-1323)Ctt>Att	p.L441I	USP15_ENST00000353364.3_Missense_Mutation_p.L412I|USP15_ENST00000393654.3_Missense_Mutation_p.L416I	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	441	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATTTCATGGCCTTTTCAAATC	0.348																																					Melanoma(181;615 2041 39364 49691 50001)												0													114.0	110.0	111.0					12																	62777931		2203	4300	6503	SO:0001583	missense	9958			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.1321C>A	12.37:g.62777931C>A	ENSP00000280377:p.Leu441Ile	Somatic		WXS	SOLID	Phase_I	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	ENST00000280377.5	37	CCDS58251.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115859	0.77323	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.30981	1.51;1.51;1.51	5.16	5.16	0.70880	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.065924	0.64402	D	0.000014	T	0.46288	0.1385	L	0.45744	1.44	0.52501	D	0.999956	D;D	0.76494	0.999;0.999	D;D	0.97110	0.998;1.0	T	0.18398	-1.0338	9	.	.	.	-13.3837	12.1983	0.54311	0.0:0.9227:0.0:0.0773	.	441;412	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	I	412;441;416	ENSP00000258123:L412I;ENSP00000280377:L441I;ENSP00000377264:L416I	.	L	+	1	0	USP15	61064198	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.799000	0.62517	2.690000	0.91761	0.655000	0.94253	CTT		0.348	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2		NM_006313	
ZMYM2	7750	hgsc.bcm.edu;ucsc.edu	37	13	20656244	20656244	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr13:20656244G>A	ENST00000382874.2	+	23	3732	c.3542G>A	c.(3541-3543)aGc>aAc	p.S1181N	ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382869.3_Missense_Mutation_p.S1181N|ZMYM2_ENST00000382871.2_Missense_Mutation_p.S1181N	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		ATACTGCGAAGCTGGCAACCA	0.313																																																	0													46.0	44.0	45.0					13																	20656244		1818	4079	5897	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3542G>A	13.37:g.20656244G>A	ENSP00000372327:p.Ser1181Asn	Somatic		WXS	SOLID	Phase_I	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204093	0.38905	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.18016	2.24	5.44	5.44	0.79542	.	0.123175	0.85682	D	0.000000	T	0.06962	0.0177	N	0.03608	-0.345	0.80722	D	1	P	0.34662	0.462	B	0.24541	0.054	T	0.44019	-0.9355	10	0.17369	T	0.5	-21.4624	15.1519	0.72706	0.0:0.1407:0.8592:0.0	.	1181	Q9UBW7	ZMYM2_HUMAN	N	1181;1181;1179;1179;559	ENSP00000372322:S1181N	ENSP00000372322:S1181N	S	+	2	0	ZMYM2	19554244	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.636000	0.61339	2.723000	0.93209	0.591000	0.81541	AGC		0.313	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2		NM_003453	
ZNF483	158399	hgsc.bcm.edu;ucsc.edu	37	9	114304001	114304001	+	Silent	SNP	A	A	G			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr9:114304001A>G	ENST00000309235.5	+	6	944	c.786A>G	c.(784-786)gaA>gaG	p.E262E	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						GCTTGATGGAAGAATCCCAGC	0.393																																																	0													65.0	68.0	67.0					9																	114304001		2203	4300	6503	SO:0001819	synonymous_variant	158399			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.786A>G	9.37:g.114304001A>G		Somatic		WXS	SOLID	Phase_I	Q5VZN2|Q8NAE1	Silent	SNP	ENST00000309235.5	37	CCDS35106.1																																																																																				0.393	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1		XM_088567	
ZSWIM5	57643	hgsc.bcm.edu;ucsc.edu	37	1	45484291	45484291	+	Silent	SNP	G	G	A			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chr1:45484291G>A	ENST00000359600.5	-	14	3598	c.3393C>T	c.(3391-3393)agC>agT	p.S1131S		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	1131						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					AGTGGCGAGGGCTGATGTGTG	0.527											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													196.0	191.0	192.0					1																	45484291		2127	4252	6379	SO:0001819	synonymous_variant	57643			AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.3393C>T	1.37:g.45484291G>A		Somatic	932	WXS	SOLID	Phase_I	Q5SXQ9	Silent	SNP	ENST00000359600.5	37	CCDS41319.1																																																																																				0.527	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2		XM_046581	
KDM5C	8242	ucsc.edu	37	X	53250081	53250082	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-CJ-4871-01A-01D-1373-10	TCGA-CJ-4871-11A-01D-1373-10	AA	AA	AA	-	AA	AA	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	2fa24cc6-b7f4-4e68-987d-5338af3c9b35	249b12b1-3996-487f-8785-f4e3d64db9ba	g.chrX:53250081_53250082delAA	ENST00000375401.3	-	2	699_700	c.167_168delTT	c.(166-168)tttfs	p.F56fs	KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000375383.3_Frame_Shift_Del_p.F56fs|KDM5C_ENST00000404049.3_Frame_Shift_Del_p.F56fs|KDM5C_ENST00000375379.3_Frame_Shift_Del_p.F56fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	56					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTTCCACAGCAAAGGGTGGCTG	0.535			"""N, F, S"""		clear cell renal carcinoma																																	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										SO:0001589	frameshift_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.167_168delTT	X.37:g.53250081_53250082delAA	ENSP00000364550:p.Phe56fs	Somatic		WXS	SOLID	.	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Del	DEL	ENST00000375401.3	37	CCDS14351.1																																																																																				0.535	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
