#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACE	1636	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	61559982	61559982	+	Missense_Mutation	SNP	C	C	T	rs372626836		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr17:61559982C>T	ENST00000290866.4	+	8	1298	c.1274C>T	c.(1273-1275)gCg>gTg	p.A425V	ACE_ENST00000584529.1_3'UTR|ACE_ENST00000428043.1_Missense_Mutation_p.A425V|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000490216.2_5'Flank|ACE_ENST00000577647.1_5'Flank|ACE_ENST00000538928.1_Missense_Mutation_p.A425V|ACE_ENST00000421982.2_5'Flank|ACE_ENST00000413513.3_5'Flank	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	425	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.A425V(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GACGTGCTGGCGCTCTCGGTC	0.622																																																	1	Substitution - Missense(1)	kidney(1)						C	VAL/ALA	0,4406		0,0,2203	100.0	95.0	97.0		1274	3.7	0.7	17		97	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACE	NM_000789.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	425/1307	61559982	1,13005	2203	4300	6503	SO:0001583	missense	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1274C>T	17.37:g.61559982C>T	ENSP00000290866:p.Ala425Val	Somatic		WXS	Illumina HiSeq	Phase_I	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302734	0.60195	0.0	1.16E-4	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	T;T;T	0.45668	0.89;0.89;0.89	4.69	3.71	0.42584	.	0.184234	0.47852	D	0.000202	T	0.62744	0.2453	M	0.81179	2.53	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.992	D;P;P	0.63703	0.917;0.803;0.811	T	0.67321	-0.5700	10	0.48119	T	0.1	-12.1021	14.2193	0.65815	0.0:0.7158:0.2842:0.0	.	425;425;425	F5H1K1;P12821-2;P12821	.;.;ACE_HUMAN	V	425	ENSP00000439591:A425V;ENSP00000290866:A425V;ENSP00000397593:A425V	ENSP00000290866:A425V	A	+	2	0	ACE	58913714	0.998000	0.40836	0.741000	0.31004	0.327000	0.28475	3.854000	0.55949	1.178000	0.42870	-0.305000	0.09177	GCG		0.622	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			
ACP6	51205	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	147124277	147124277	+	Silent	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:147124277A>G	ENST00000369238.6	-	7	1303	c.856T>C	c.(856-858)Ttg>Ctg	p.L286L	ACP6_ENST00000460583.1_5'Flank	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	286					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)	p.L286L(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					AGTATGTACAAGGATGTGTCC	0.512																																																	1	Substitution - coding silent(1)	kidney(1)											133.0	115.0	121.0					1																	147124277		2203	4300	6503	SO:0001819	synonymous_variant	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.856T>C	1.37:g.147124277A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Silent	SNP	ENST00000369238.6	37	CCDS928.1																																																																																				0.512	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2		NM_016361	
ACSS3	79611	broad.mit.edu;ucsc.edu	37	12	81647354	81647354	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr12:81647354C>T	ENST00000548058.1	+	15	2810	c.1900C>T	c.(1900-1902)Cga>Tga	p.R634*	ACSS3_ENST00000548324.1_Nonsense_Mutation_p.R316*|ACSS3_ENST00000261206.3_Nonsense_Mutation_p.R633*			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	634						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.R634*(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						GGCTGCTTTTCGAAATGCAGT	0.428																																																	2	Substitution - Nonsense(2)	large_intestine(1)|kidney(1)											96.0	97.0	97.0					12																	81647354		2203	4300	6503	SO:0001587	stop_gained	79611				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1900C>T	12.37:g.81647354C>T	ENSP00000449535:p.Arg634*	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NC66	Nonsense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	C	38	7.002967	0.97994	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	.	.	.	6.03	5.13	0.70059	.	0.120311	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-5.1243	16.523	0.84322	0.1319:0.8681:0.0:0.0	.	.	.	.	X	634;633;316	.	ENSP00000261206:R633X	R	+	1	2	ACSS3	80171485	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.744000	0.55112	1.521000	0.48983	0.557000	0.71058	CGA		0.428	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1		NM_024560	
AKR7L	246181	hgsc.bcm.edu	37	1	19597275	19597275	+	RNA	DEL	C	C	-	rs140586925	byFrequency	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:19597275delC	ENST00000429712.1	-	0	488				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						CACGCAGTGTCTCTTCCACCG	0.607													|||unknown(NO_COVERAGE)	155	0.0309505	0.0	0.0202	5008	,	,		18026	0.0476		0.0288	False		,,,				2504	0.0654																0										44,4222		0,44,2089	41.0	37.0	39.0			4.2	1.0	1	dbSNP_134	39	323,7931		9,305,3813	no	intergenic				9,349,5902	A1A1,A1R,RR		3.9133,1.0314,2.9313			19597275	367,12153	2203	4293	6496			246181					1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19597275delC		Somatic		WXS	Illumina HiSeq	Phase_I	Q5U614	Frame_Shift_Del	DEL	ENST00000429712.1	37																																																																																					0.607	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3		NM_201252	
AGT	183	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	230839961	230839961	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:230839961T>C	ENST00000366667.4	-	4	1461	c.1247A>G	c.(1246-1248)aAt>aGt	p.N416S		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	416					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)	p.N416S(1)		endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATGCGGTCATTGCTCAATTT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											168.0	130.0	143.0					1																	230839961		2203	4300	6503	SO:0001583	missense	183			K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1247A>G	1.37:g.230839961T>C	ENSP00000355627:p.Asn416Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	37	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	T	4.656	0.122029	0.08931	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.87256	-2.23	5.33	4.19	0.49359	Serpin domain (3);	0.381500	0.31685	N	0.007225	T	0.77465	0.4134	N	0.19112	0.55	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.08055	0.003;0.003	T	0.65352	-0.6189	10	0.41790	T	0.15	.	11.451	0.50154	0.0:0.0:0.1512:0.8488	.	416;416	B0ZBE2;P01019	.;ANGT_HUMAN	S	416;334	ENSP00000355627:N416S	ENSP00000355627:N416S	N	-	2	0	AGT	228906584	0.063000	0.20901	0.006000	0.13384	0.000000	0.00434	2.959000	0.49153	0.848000	0.35191	-0.313000	0.08912	AAT		0.577	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1		NM_000029	
APOL5	80831	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	36123236	36123236	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr22:36123236C>G	ENST00000249044.2	+	3	1121	c.1121C>G	c.(1120-1122)cCa>cGa	p.P374R		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	374					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)	p.P374R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						GTGGTTAAACCAGAAGGTAGG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											42.0	46.0	45.0					22																	36123236		2194	4287	6481	SO:0001583	missense	80831			AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.1121C>G	22.37:g.36123236C>G	ENSP00000249044:p.Pro374Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TFL9|Q9UGW5	Missense_Mutation	SNP	ENST00000249044.2	37	CCDS13920.1	.	.	.	.	.	.	.	.	.	.	C	5.947	0.358791	0.11239	.	.	ENSG00000128313	ENST00000249044	T	0.06371	3.31	1.94	-0.296	0.12824	.	3.921800	0.02219	N	0.063822	T	0.06735	0.0172	N	0.08118	0	0.09310	N	1	P	0.52842	0.956	P	0.53360	0.724	T	0.14008	-1.0488	10	0.87932	D	0	.	3.1134	0.06366	0.0:0.5307:0.2874:0.1819	.	374	Q9BWW9	APOL5_HUMAN	R	374	ENSP00000249044:P374R	ENSP00000249044:P374R	P	+	2	0	APOL5	34453182	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-1.089000	0.03376	0.001000	0.14605	0.462000	0.41574	CCA		0.597	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1		NM_030642	
ARSG	22901	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	66303656	66303656	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr17:66303656G>C	ENST00000448504.2	+	2	818	c.22G>C	c.(22-24)Gtt>Ctt	p.V8L	ARSG_ENST00000452479.2_Intron	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	8					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V8L(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTTCTAAAGGTTTTGTTGGC	0.458																																																	1	Substitution - Missense(1)	kidney(1)											92.0	103.0	99.0					17																	66303656		2203	4300	6503	SO:0001583	missense	22901			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.22G>C	17.37:g.66303656G>C	ENSP00000407193:p.Val8Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900397	0.33535	.	.	ENSG00000141337	ENST00000452479	.	.	.	5.46	4.49	0.54785	.	0.417330	0.21520	N	0.073234	T	0.34135	0.0887	L	0.29908	0.895	0.80722	D	1	B	0.28055	0.199	B	0.27380	0.079	T	0.08994	-1.0695	9	0.10902	T	0.67	.	6.7911	0.23699	0.0869:0.0:0.7383:0.1749	.	8	Q96EG1	ARSG_HUMAN	L	8	.	ENSP00000413953:V8L	V	+	1	0	ARSG	63815251	1.000000	0.71417	0.990000	0.47175	0.922000	0.55478	2.192000	0.42649	1.533000	0.49186	0.655000	0.94253	GTT		0.458	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1		NM_014960	
ATP2C2	9914	hgsc.bcm.edu	37	16	84497252	84497252	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr16:84497252G>A	ENST00000262429.4	+	27	2844	c.2755G>A	c.(2755-2757)Gtc>Atc	p.V919I	ATP2C2_ENST00000420010.2_3'UTR|RP11-517C16.2_ENST00000565700.1_RNA|ATP2C2_ENST00000416219.2_Missense_Mutation_p.V948I	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	919					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.V919I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GGCCTCATCCGTCTTCATTTT	0.507																																																	1	Substitution - Missense(1)	kidney(1)											109.0	115.0	113.0					16																	84497252		1925	4137	6062	SO:0001583	missense	9914			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.2755G>A	16.37:g.84497252G>A	ENSP00000262429:p.Val919Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471946	0.63737	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.95821	-3.82;-3.82	5.25	5.25	0.73442	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.56097	D	0.000035	D	0.97374	0.9141	M	0.73598	2.24	0.53688	D	0.99997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;1.0	D	0.96634	0.9469	10	0.31617	T	0.26	.	17.8246	0.88661	0.0:0.0:1.0:0.0	.	948;768;768;936;919	E7ES94;B3KR57;F8WAA5;O75185-2;O75185	.;.;.;.;AT2C2_HUMAN	I	948;919;768	ENSP00000397925:V948I;ENSP00000262429:V919I	ENSP00000262429:V919I	V	+	1	0	ATP2C2	83054753	1.000000	0.71417	0.877000	0.34402	0.051000	0.14879	7.924000	0.87555	2.460000	0.83146	0.655000	0.94253	GTC		0.507	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1		NM_014861	
DDX39B	7919	hgsc.bcm.edu	37	6	31504445	31504446	+	Frame_Shift_Ins	INS	-	-	A	rs75750725		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr6:31504445_31504446insA	ENST00000396172.1	-	5	1077_1078	c.447_448insT	c.(445-450)tttggtfs	p.G150fs	DDX39B_ENST00000453105.2_Frame_Shift_Ins_p.G103fs|DDX39B_ENST00000458640.1_Frame_Shift_Ins_p.G150fs|ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR|DDX39B_ENST00000376177.2_Frame_Shift_Ins_p.G150fs|DDX39B_ENST00000417556.2_Frame_Shift_Ins_p.G165fs|DDX39B_ENST00000415382.2_Frame_Shift_Ins_p.G72fs|DDX39B_ENST00000449074.2_3'UTR|SNORD117_ENST00000364915.1_RNA	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	150	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						GACAGACCACCAAAAAAAACAG	0.51																																																	0																																										SO:0001589	frameshift_variant	0			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.448dupT	6.37:g.31504453_31504453dupA	ENSP00000379475:p.Gly150fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Frame_Shift_Ins	INS	ENST00000396172.1	37	CCDS4697.1																																																																																				0.510	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1		NM_004640	
BNIP1	662	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	172578593	172578593	+	Intron	SNP	A	A	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr5:172578593A>T	ENST00000351486.5	+	3	208				BNIP1_ENST00000231668.9_Missense_Mutation_p.I68F|BNIP1_ENST00000393770.4_Intron|BNIP1_ENST00000352523.6_Missense_Mutation_p.I68F	NM_001205.2	NP_001196.2	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 1						apoptotic process (GO:0006915)|autophagy (GO:0006914)|endoplasmic reticulum membrane fusion (GO:0016320)|endoplasmic reticulum organization (GO:0007029)|execution phase of apoptosis (GO:0097194)|negative regulation of apoptotic process (GO:0043066)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.I68F(1)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	11	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AAGGGCATTTATTTGGACTGC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											107.0	102.0	104.0					5																	172578593		2203	4300	6503	SO:0001627	intron_variant	662			AF083957	CCDS4384.1, CCDS4385.1, CCDS4386.1, CCDS43400.1	5q33-q34	2008-02-05	2002-08-29		ENSG00000113734	ENSG00000113734			1082	protein-coding gene	gene with protein product		603291	"""BCL2/adenovirus E1B 19kD-interacting protein 1"""			7954800, 15272311	Standard	NM_013979		Approved	Nip1, SEC20	uc003mcj.4	Q12981	OTTHUMG00000130521	ENST00000351486.5:c.178-2732A>T	5.37:g.172578593A>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DQM3|D3DQM4|D3DQM5|D3DQM6|O75622|O75623|O75624|Q6K044|Q96FG4	Missense_Mutation	SNP	ENST00000351486.5	37	CCDS4384.1	.	.	.	.	.	.	.	.	.	.	A	6.905	0.536575	0.13188	.	.	ENSG00000113734	ENST00000231668;ENST00000352523	T;T	0.47177	0.85;0.94	2.39	1.14	0.20703	.	.	.	.	.	T	0.31199	0.0789	.	.	.	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.21759	-1.0236	8	0.48119	T	0.1	.	4.4747	0.11729	0.7077:0.0:0.0:0.2923	.	68;68	Q12981-3;Q12981-1	.;.	F	68	ENSP00000231668:I68F;ENSP00000239214:I68F	ENSP00000231668:I68F	I	+	1	0	BNIP1	172511199	0.033000	0.19621	0.004000	0.12327	0.002000	0.02628	1.230000	0.32612	0.319000	0.23209	0.421000	0.28195	ATT		0.373	BNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252939.1		NM_013979	
CEACAM3	1084	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	42301589	42301589	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr19:42301589G>A	ENST00000357396.3	+	2	374	c.133G>A	c.(133-135)Gtc>Atc	p.V45I	CEACAM3_ENST00000221999.4_Missense_Mutation_p.V45I|CEACAM3_ENST00000595255.1_3'UTR|CEACAM3_ENST00000344550.4_Missense_Mutation_p.V45I	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	45	Ig-like V-type.					integral component of membrane (GO:0016021)		p.V45I(1)		endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						GCCGCTCAGTGTCGCAGAGGG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											165.0	152.0	156.0					19																	42301589		2203	4300	6503	SO:0001583	missense	1084			E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.133G>A	19.37:g.42301589G>A	ENSP00000349971:p.Val45Ile	Somatic		WXS	Illumina HiSeq	Phase_I	G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	37	CCDS12586.2	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301532	0.40694	.	.	ENSG00000170956	ENST00000357396;ENST00000389667;ENST00000221999;ENST00000344550	T;T;T	0.70986	-0.53;-0.53;-0.53	3.44	2.39	0.29439	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80127	0.4566	M	0.76328	2.33	0.09310	N	1	P;P	0.46457	0.878;0.858	P;D	0.64042	0.832;0.921	T	0.66748	-0.5845	9	0.59425	D	0.04	.	6.8405	0.23961	0.1381:0.0:0.8619:0.0	.	45;45	G5E978;P40198	.;CEAM3_HUMAN	I	45	ENSP00000349971:V45I;ENSP00000221999:V45I;ENSP00000341725:V45I	ENSP00000221999:V45I	V	+	1	0	CEACAM3	46993429	0.025000	0.19082	0.001000	0.08648	0.005000	0.04900	1.637000	0.37155	0.566000	0.29273	0.514000	0.50259	GTC		0.517	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2		NM_001815	
CENPF	1063	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	214818566	214818566	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:214818566A>T	ENST00000366955.3	+	13	5821	c.5653A>T	c.(5653-5655)Aat>Tat	p.N1885Y		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1981					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.N1885Y(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TATTGGAGATAATGTGGCCAA	0.423																																					Colon(80;575 1284 11000 14801 43496)												1	Substitution - Missense(1)	kidney(1)											59.0	58.0	59.0					1																	214818566		2203	4300	6503	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5653A>T	1.37:g.214818566A>T	ENSP00000355922:p.Asn1885Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.526008	0.27299	.	.	ENSG00000117724	ENST00000366955	T	0.23348	1.91	5.26	-2.41	0.06562	.	0.694656	0.11848	N	0.523632	T	0.22551	0.0544	L	0.40543	1.245	0.09310	N	1	P	0.51653	0.947	P	0.44561	0.453	T	0.29305	-1.0016	10	0.72032	D	0.01	.	12.1798	0.54206	0.418:0.0:0.582:0.0	.	1981	P49454	CENPF_HUMAN	Y	1885	ENSP00000355922:N1885Y	ENSP00000355922:N1885Y	N	+	1	0	CENPF	212885189	0.110000	0.22057	0.000000	0.03702	0.013000	0.08279	0.341000	0.19909	-0.221000	0.09973	0.496000	0.49642	AAT		0.423	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1		NM_016343	
CHSY3	337876	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	129520719	129520719	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr5:129520719C>G	ENST00000305031.4	+	3	2242	c.1884C>G	c.(1882-1884)atC>atG	p.I628M		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	628					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.I628M(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TTCCTCTCATCGGAAGGTATG	0.358																																																	1	Substitution - Missense(1)	kidney(1)											73.0	74.0	73.0					5																	129520719		2203	4300	6503	SO:0001583	missense	337876			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1884C>G	5.37:g.129520719C>G	ENSP00000302629:p.Ile628Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	C	4.592	0.110020	0.08780	.	.	ENSG00000198108	ENST00000305031	T	0.34472	1.36	4.12	-4.49	0.03504	.	0.819771	0.10522	N	0.664801	T	0.15349	0.0370	N	0.22421	0.69	0.18873	N	0.999985	B	0.27853	0.191	B	0.24848	0.056	T	0.23154	-1.0196	9	.	.	.	-0.3774	0.2357	0.00185	0.2252:0.2401:0.1825:0.3522	.	628	Q70JA7	CHSS3_HUMAN	M	628	ENSP00000302629:I628M	.	I	+	3	3	CHSY3	129548618	0.018000	0.18449	0.023000	0.16930	0.916000	0.54674	-0.579000	0.05834	-0.668000	0.05296	-0.300000	0.09419	ATC		0.358	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1		NM_175856	
COL24A1	255631	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	86289366	86289366	+	Splice_Site	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:86289366A>G	ENST00000370571.2	-	44	4102		c.e44+1		COL24A1_ENST00000436319.1_Splice_Site	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1						extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.?(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCAAAACATACTGGGGGTCC	0.353																																																	1	Unknown(1)	kidney(1)											127.0	127.0	127.0					1																	86289366		1832	4085	5917	SO:0001630	splice_region_variant	255631			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.3735+1T>C	1.37:g.86289366A>G		Somatic		WXS	Illumina HiSeq	Phase_I	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Splice_Site	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.201246	0.79015	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3454	0.66658	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL24A1	86061954	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.847000	0.69451	2.371000	0.80710	0.533000	0.62120	.		0.353	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4		NM_152890	Intron
DCC	1630	broad.mit.edu;ucsc.edu	37	18	50994332	50994332	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr18:50994332C>A	ENST00000442544.2	+	25	4304	c.3688C>A	c.(3688-3690)Ccc>Acc	p.P1230T	DCC_ENST00000581580.1_Missense_Mutation_p.P865T	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1230					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.P1230T(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACGCCGAGCCCCCCGGGCCAA	0.507																																																	1	Substitution - Missense(1)	kidney(1)											84.0	81.0	82.0					18																	50994332		2203	4300	6503	SO:0001583	missense	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3688C>A	18.37:g.50994332C>A	ENSP00000389140:p.Pro1230Thr	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592197	0.28357	.	.	ENSG00000187323	ENST00000442544	T	0.38722	1.12	4.95	2.52	0.30459	Neogenin, C-terminal (1);	0.069622	0.56097	N	0.000036	T	0.12008	0.0292	N	0.00347	-1.61	0.42602	D	0.993288	B	0.02656	0.0	B	0.01281	0.0	T	0.06917	-1.0800	10	0.23302	T	0.38	.	11.2533	0.49039	0.6943:0.3057:0.0:0.0	.	1230	P43146	DCC_HUMAN	T	1230	ENSP00000389140:P1230T	ENSP00000389140:P1230T	P	+	1	0	DCC	49248330	1.000000	0.71417	0.984000	0.44739	0.968000	0.65278	4.422000	0.59854	0.304000	0.22809	-0.271000	0.10264	CCC		0.507	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3		NM_005215	
DLD	1738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	107556003	107556003	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr7:107556003G>C	ENST00000205402.5	+	9	1018	c.737G>C	c.(736-738)gGt>gCt	p.G246A	DLD_ENST00000437604.2_Missense_Mutation_p.G198A|DLD_ENST00000537148.1_Missense_Mutation_p.G147A|DLD_ENST00000440410.1_Missense_Mutation_p.G223A	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	246					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)	p.G246A(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GAATTTTTAGGTCATGTAGGT	0.328																																																	2	Substitution - Missense(2)	kidney(2)											111.0	113.0	113.0					7																	107556003		2203	4300	6503	SO:0001583	missense	1738			AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.737G>C	7.37:g.107556003G>C	ENSP00000205402:p.Gly246Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	37	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490944	0.64074	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000537148;ENST00000440410;ENST00000437604;ENST00000539590	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	5.98	5.1	0.69264	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.044381	0.85682	D	0.000000	T	0.56659	0.2000	L	0.51853	1.615	0.80722	D	1	B;B;B	0.34264	0.277;0.01;0.446	B;B;B	0.43194	0.411;0.014;0.214	T	0.59542	-0.7435	10	0.59425	D	0.04	-12.35	15.3127	0.74048	0.067:0.0:0.933:0.0	.	223;198;246	E9PEX6;B4DT69;P09622	.;.;DLDH_HUMAN	A	246;246;147;223;198;196	ENSP00000205402:G246A;ENSP00000390667:G246A;ENSP00000442399:G147A;ENSP00000417016:G223A;ENSP00000387542:G198A	ENSP00000205402:G246A	G	+	2	0	DLD	107343239	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	1.540000	0.49301	0.591000	0.81541	GGT		0.328	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3		NM_000108	
DNAJC25	548645	broad.mit.edu;hgsc.bcm.edu	37	9	114411754	114411754	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr9:114411754T>C	ENST00000313525.3	+	3	567	c.511T>C	c.(511-513)Tac>Cac	p.Y171H	DNAJC25_ENST00000556107.1_Intron|DNAJC25-GNG10_ENST00000374294.3_Intron	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	171						integral component of membrane (GO:0016021)		p.Y171H(1)		kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						GTGGAATAGCTACAATAAGGC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											37.0	36.0	36.0					9																	114411754		1868	4099	5967	SO:0001583	missense	548645				CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.511T>C	9.37:g.114411754T>C	ENSP00000320650:p.Tyr171His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5QTD8|Q96BN9	Missense_Mutation	SNP	ENST00000313525.3	37	CCDS43862.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472357	0.84533	.	.	ENSG00000059769	ENST00000313525	T	0.52983	0.64	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.68897	0.3051	M	0.76328	2.33	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.71234	-0.4653	10	0.56958	D	0.05	-6.2681	15.1366	0.72572	0.0:0.0:0.0:1.0	.	171	Q9H1X3	DJC25_HUMAN	H	171	ENSP00000320650:Y171H	ENSP00000320650:Y171H	Y	+	1	0	DNAJC25	113451575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.637000	0.83313	2.302000	0.77476	0.533000	0.62120	TAC		0.398	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156218.3		NM_001015882	
DOCK11	139818	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	117700143	117700143	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:117700143A>T	ENST00000276202.7	+	8	932	c.869A>T	c.(868-870)cAa>cTa	p.Q290L	DOCK11_ENST00000276204.6_Missense_Mutation_p.Q290L	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	290					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q290L(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GAAACAGCACAAGGTCAGAAT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											69.0	68.0	68.0					X																	117700143		2203	4300	6503	SO:0001583	missense	139818			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.869A>T	X.37:g.117700143A>T	ENSP00000276202:p.Gln290Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	A	8.255	0.809969	0.16537	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.03124	4.04;4.04	5.48	5.48	0.80851	.	0.259259	0.38548	N	0.001645	T	0.03136	0.0092	N	0.25286	0.73	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.52290	-0.8595	10	0.21014	T	0.42	-30.9266	10.9523	0.47336	0.8457:0.1543:0.0:0.0	.	290;290	A6NIW2;Q5JSL3	.;DOC11_HUMAN	L	290	ENSP00000276204:Q290L;ENSP00000276202:Q290L	ENSP00000276202:Q290L	Q	+	2	0	DOCK11	117584171	1.000000	0.71417	0.996000	0.52242	0.741000	0.42261	2.749000	0.47492	1.837000	0.53436	0.345000	0.21793	CAA		0.368	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1		NM_144658	
DOCK11	139818	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	117819736	117819736	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:117819736G>A	ENST00000276202.7	+	53	6251	c.6188G>A	c.(6187-6189)cGa>cAa	p.R2063Q	DOCK11_ENST00000276204.6_Missense_Mutation_p.R2067Q	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	2063					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R2063Q(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TCAAGTGACCGAGGTTATGGT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											205.0	173.0	184.0					X																	117819736		2203	4300	6503	SO:0001583	missense	139818			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.6188G>A	X.37:g.117819736G>A	ENSP00000276202:p.Arg2063Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429736	0.43122	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.17213	2.29;2.29	6.17	5.31	0.75309	.	0.075295	0.56097	D	0.000029	T	0.10551	0.0258	N	0.08118	0	0.25675	N	0.985856	B;B	0.24882	0.113;0.113	B;B	0.20184	0.028;0.028	T	0.18116	-1.0347	10	0.39692	T	0.17	-13.8559	15.6202	0.76799	0.0:0.1336:0.8664:0.0	.	2067;2063	A6NIW2;Q5JSL3	.;DOC11_HUMAN	Q	2067;2063	ENSP00000276204:R2067Q;ENSP00000276202:R2063Q	ENSP00000276202:R2063Q	R	+	2	0	DOCK11	117703764	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.581000	0.53914	1.340000	0.45581	0.600000	0.82982	CGA		0.403	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1		NM_144658	
DSCAML1	57453	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	117647629	117647629	+	Silent	SNP	G	G	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr11:117647629G>T	ENST00000321322.6	-	3	569	c.568C>A	c.(568-570)Cgg>Agg	p.R190R	DSCAML1_ENST00000527706.1_Intron	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	130	Ig-like C2-type 2.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R190R(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TCCTCCACCCGGACGGTGTAG	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											117.0	96.0	103.0					11																	117647629		2201	4296	6497	SO:0001819	synonymous_variant	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.568C>A	11.37:g.117647629G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	CCDS8384.1																																																																																				0.532	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2		NM_020693	
DUOXA2	405753	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	45408398	45408398	+	Silent	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr15:45408398C>T	ENST00000323030.5	+	3	567	c.282C>T	c.(280-282)cgC>cgT	p.R94R	DUOX2_ENST00000389039.6_5'Flank|DUOX2_ENST00000603300.1_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	94					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.R94R(1)					all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCGCAGCGCGCGTTACAGCCC	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											134.0	126.0	129.0					15																	45408398		2002	4148	6150	SO:0001819	synonymous_variant	405753			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.282C>T	15.37:g.45408398C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RPI9|H0YNQ6	Silent	SNP	ENST00000323030.5	37	CCDS10118.2																																																																																				0.567	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1		NM_207581	
DUSP21	63904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	44703517	44703517	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:44703517C>T	ENST00000339042.4	+	1	269	c.139C>T	c.(139-141)Cgc>Tgc	p.R47C		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	47	Sufficient for mitochondrial localization. {ECO:0000250}.|Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R47C(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						GTCCAGCAATCGCATCACCGC	0.522																																																	2	Substitution - Missense(2)	breast(1)|kidney(1)											152.0	116.0	128.0					X																	44703517		2203	4300	6503	SO:0001583	missense	63904			AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.139C>T	X.37:g.44703517C>T	ENSP00000343244:p.Arg47Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VDA6|Q6IAJ6|Q6YDQ8	Missense_Mutation	SNP	ENST00000339042.4	37	CCDS14264.1	.	.	.	.	.	.	.	.	.	.	c	10.70	1.423115	0.25639	.	.	ENSG00000189037	ENST00000339042;ENST00000537377	T	0.60797	0.16	3.82	0.892	0.19230	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.845136	0.11219	N	0.586866	T	0.61813	0.2377	L	0.41573	1.285	0.09310	N	1	D	0.76494	0.999	P	0.59703	0.862	T	0.53961	-0.8364	10	0.62326	D	0.03	.	10.4008	0.44229	0.6877:0.3122:0.0:0.0	.	47	Q9H596	DUS21_HUMAN	C	47	ENSP00000343244:R47C	ENSP00000343244:R47C	R	+	1	0	DUSP21	44588461	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.784000	0.26816	0.057000	0.16193	-0.227000	0.12334	CGC		0.522	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056323.1		NM_022076	
EPPK1	83481	broad.mit.edu;hgsc.bcm.edu	37	8	144941623	144941623	+	Silent	SNP	C	C	A	rs369842241		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr8:144941623C>A	ENST00000525985.1	-	2	5870	c.5799G>T	c.(5797-5799)gcG>gcT	p.A1933A				P58107	EPIPL_HUMAN	epiplakin 1	1933						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.A1933A(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGCGGCCTGCGCCTCCAGCA	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											26.0	33.0	31.0					8																	144941623		2040	4154	6194	SO:0001819	synonymous_variant	83481			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5799G>T	8.37:g.144941623C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																					0.662	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1		NM_031308	
FAT1	2195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	187538911	187538911	+	Silent	SNP	C	C	A	rs566222095		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr4:187538911C>A	ENST00000441802.2	-	10	9038	c.8829G>T	c.(8827-8829)acG>acT	p.T2943T		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2943	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T2946T(2)|p.T2943T(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AATCAGCATCCGTGGTACTTA	0.388										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												4	Substitution - coding silent(4)	endometrium(2)|kidney(2)											108.0	106.0	107.0					4																	187538911		1897	4100	5997	SO:0001819	synonymous_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8829G>T	4.37:g.187538911C>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																				0.388	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3		NM_005245	
FNDC3B	64778	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	172060897	172060897	+	Missense_Mutation	SNP	T	T	G	rs557648244		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:172060897T>G	ENST00000336824.4	+	18	2167	c.2068T>G	c.(2068-2070)Tta>Gta	p.L690V	FNDC3B_ENST00000416957.1_Missense_Mutation_p.L690V|FNDC3B_ENST00000415807.2_Missense_Mutation_p.L690V	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	690	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.L690V(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AGAAGTCCACTTAGAGTGGGG	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		20479	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)											124.0	107.0	113.0					3																	172060897		2203	4300	6503	SO:0001583	missense	64778			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.2068T>G	3.37:g.172060897T>G	ENSP00000338523:p.Leu690Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808310	0.70797	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.59364	0.27;0.27;0.27	6.02	3.33	0.38152	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.61776	0.2374	L	0.58428	1.81	0.80722	D	1	P	0.46578	0.88	P	0.55345	0.774	T	0.57481	-0.7804	10	0.28530	T	0.3	-11.1969	8.1404	0.31080	0.0:0.2384:0.0:0.7616	.	690	Q53EP0	FND3B_HUMAN	V	690	ENSP00000411242:L690V;ENSP00000338523:L690V;ENSP00000389094:L690V	ENSP00000338523:L690V	L	+	1	2	FNDC3B	173543591	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.830000	0.39131	1.096000	0.41439	0.528000	0.53228	TTA		0.438	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2		NM_022763	
FRMPD2	143162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	49459680	49459680	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr10:49459680G>C	ENST00000374201.3	-	2	382	c.80C>G	c.(79-81)gCt>gGt	p.A27G	FRMPD2_ENST00000407470.4_Missense_Mutation_p.A18G|FRMPD2_ENST00000305531.3_Missense_Mutation_p.A25G	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	27	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.A27G(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTCAGACAGAGCTTCACCCCT	0.572																																																	1	Substitution - Missense(1)	kidney(1)											83.0	71.0	75.0					10																	49459680		2203	4300	6503	SO:0001583	missense	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.80C>G	10.37:g.49459680G>C	ENSP00000363317:p.Ala27Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754414	0.89843	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.29917	1.55;1.55;1.55	5.55	5.55	0.83447	KIND (2);	.	.	.	.	T	0.51975	0.1706	M	0.67953	2.075	0.29112	N	0.880826	D;D;D	0.69078	0.997;0.984;0.993	D;P;P	0.64042	0.921;0.784;0.879	T	0.49051	-0.8979	9	0.46703	T	0.11	.	15.0119	0.71555	0.0:0.0:1.0:0.0	.	25;27;18	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	G	27;25;18	ENSP00000363317:A27G;ENSP00000307079:A25G;ENSP00000384339:A18G	ENSP00000307079:A25G	A	-	2	0	FRMPD2	49129686	1.000000	0.71417	0.992000	0.48379	0.966000	0.64601	4.841000	0.62824	2.634000	0.89283	0.563000	0.77884	GCT		0.572	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3		NM_152428	
GALNT13	114805	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	155295210	155295210	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr2:155295210G>C	ENST00000392825.3	+	12	2069	c.1502G>C	c.(1501-1503)gGa>gCa	p.G501A	AC009227.2_ENST00000434635.1_RNA|GALNT13_ENST00000409237.1_Missense_Mutation_p.G501A	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	501	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.G501A(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CATATGAGAGGAAATCAGTTA	0.333																																																	1	Substitution - Missense(1)	kidney(1)											129.0	132.0	131.0					2																	155295210		2203	4300	6503	SO:0001583	missense	114805			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1502G>C	2.37:g.155295210G>C	ENSP00000376570:p.Gly501Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.3|29.3	4.996821|4.996821	0.93167|0.93167	.|.	.|.	ENSG00000144278|ENSG00000144278	ENST00000392825;ENST00000409237;ENST00000453715|ENST00000450838;ENST00000422126	T;T;T|T	0.76709|0.24723	-1.04;-1.04;1.74|1.84	5.76|5.76	5.76|5.76	0.90799|0.90799	Ricin B-related lectin (1);Ricin B lectin (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.32585|0.32585	0.0834|0.0834	M|M	0.66378|0.66378	2.025|2.025	0.80722|0.80722	D|D	1|1	P;P|B	0.42871|0.18741	0.592;0.792|0.03	B;B|B	0.41135|0.16289	0.348;0.173|0.015	T|T	0.07443|0.07443	-1.0772|-1.0772	10|9	0.54805|0.87932	T|D	0.06|0	.|.	17.4509|17.4509	0.87592|0.87592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	501;501|480	Q08ER7;Q8IUC8|Q8IUC8-2	.;GLT13_HUMAN|.	A|S	501;501;36|86;39	ENSP00000376570:G501A;ENSP00000387239:G501A;ENSP00000396612:G36A|ENSP00000406237:R86S	ENSP00000376570:G501A|ENSP00000391469:R39S	G|R	+|+	2|3	0|2	GALNT13|GALNT13	155003456|155003456	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.676000|9.676000	0.98643|0.98643	2.721000|2.721000	0.93114|0.93114	0.655000|0.655000	0.94253|0.94253	GGA|AGG		0.333	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2		NM_052917	
GALT	2592	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	34649524	34649524	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr9:34649524T>C	ENST00000378842.3	+	10	1064	c.1022T>C	c.(1021-1023)aTg>aCg	p.M341T	IL11RA_ENST00000555003.1_5'Flank|IL11RA_ENST00000441545.2_5'Flank|GALT_ENST00000450095.2_Missense_Mutation_p.M232T|GALT_ENST00000488412.2_3'UTR|GALT_ENST00000556278.1_Intron	NM_000155.3	NP_000146.2	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	341					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)|UDP-glucose catabolic process (GO:0006258)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	UDP-glucose:hexose-1-phosphate uridylyltransferase activity (GO:0008108)|zinc ion binding (GO:0008270)	p.M341T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(2)|lung(5)|upper_aerodigestive_tract(1)	16	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GGCTACGAAATGCTTGCTCAG	0.577									Galactosemia																																								1	Substitution - Missense(1)	kidney(1)											108.0	102.0	104.0					9																	34649524		2203	4300	6503	SO:0001583	missense	2592	Familial Cancer Database	Galactose-1-Phosphate Uridyltransferase Deficiency	M60091	CCDS6565.1, CCDS59122.1	9p13	2013-01-08			ENSG00000213930	ENSG00000213930	2.7.7.12		4135	protein-coding gene	gene with protein product		606999					Standard	NM_000155		Approved		uc003zve.4	P07902	OTTHUMG00000019836	ENST00000378842.3:c.1022T>C	9.37:g.34649524T>C	ENSP00000368119:p.Met341Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B4E097|E7ET32|Q14355|Q14356|Q14357|Q14358|Q14359|Q14360|Q14361|Q14363|Q14364|Q14365|Q14369|Q14370|Q14371|Q14372|Q14373|Q14374|Q14375|Q14377|Q14378|Q14380|Q14381|Q14382|Q14383|Q14384|Q14385|Q14386|Q14387|Q14389|Q16766|Q53XK1|Q5VZ81|Q96BY1	Missense_Mutation	SNP	ENST00000378842.3	37	CCDS6565.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.282057	0.80692	.	.	ENSG00000213930	ENST00000450095;ENST00000378842	D;D	0.99232	-5.6;-5.6	5.21	5.21	0.72293	Histidine triad motif (1);Galactose-1-phosphate uridyl transferase, C-terminal (1);Histidine triad-like motif (1);	0.046664	0.85682	U	0.000000	D	0.99266	0.9744	M	0.76433	2.335	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.75484	0.986;0.984	D	0.99222	1.0879	10	0.87932	D	0	-10.6696	13.9041	0.63823	0.0:0.0:0.0:1.0	.	232;341	E7ET32;P07902	.;GALT_HUMAN	T	232;341	ENSP00000401956:M232T;ENSP00000368119:M341T	ENSP00000368119:M341T	M	+	2	0	GALT	34639524	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.562000	0.82300	1.970000	0.57323	0.459000	0.35465	ATG		0.577	GALT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052231.1		NM_000155	
GPR78	27201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	8588871	8588871	+	Silent	SNP	G	G	A	rs148589120		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr4:8588871G>A	ENST00000382487.4	+	3	1290	c.873G>A	c.(871-873)ccG>ccA	p.P291P	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	291					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P291P(1)		central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						TGGCCGACCCGTTCACGTACT	0.667																																																	1	Substitution - coding silent(1)	kidney(1)						G		1,4405	2.1+/-5.4	0,1,2202	44.0	45.0	44.0		873	-2.7	0.0	4	dbSNP_134	44	0,8600		0,0,4300	no	coding-synonymous	GPR78	NM_080819.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		291/364	8588871	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	27201			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.873G>A	4.37:g.8588871G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NGV3	Silent	SNP	ENST00000382487.4	37	CCDS3403.1																																																																																				0.667	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1			
HIF1A	3091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	62187224	62187224	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr14:62187224C>A	ENST00000337138.4	+	2	425	c.160C>A	c.(160-162)Ctt>Att	p.L54I	HIF1A_ENST00000557538.1_De_novo_Start_OutOfFrame|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000539097.1_Missense_Mutation_p.L78I|HIF1A_ENST00000394997.1_Missense_Mutation_p.L55I|HIF1A_ENST00000557206.1_3'UTR|HIF1A_ENST00000323441.6_Missense_Mutation_p.L54I	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	54	Interaction with TSGA10. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.L54I(1)		breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	GAGTTCGCATCTTGATAAGGC	0.433																																																	1	Substitution - Missense(1)	kidney(1)											115.0	106.0	109.0					14																	62187224		2203	4300	6503	SO:0001583	missense	3091			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.160C>A	14.37:g.62187224C>A	ENSP00000338018:p.Leu54Ile	Somatic		WXS	Illumina HiSeq	Phase_I	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	37	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	C	31	5.093759	0.94149	.	.	ENSG00000100644	ENST00000337138;ENST00000394997;ENST00000323441;ENST00000539097	T;T;T;T	0.67171	-0.13;-0.15;-0.25;1.91	5.75	5.75	0.90469	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	D	0.88518	0.6458	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.91456	0.5185	10	0.87932	D	0	.	19.9462	0.97183	0.0:1.0:0.0:0.0	.	55;54;54	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	I	54;55;54;78	ENSP00000338018:L54I;ENSP00000378446:L55I;ENSP00000323326:L54I;ENSP00000437955:L78I	ENSP00000323326:L54I	L	+	1	0	HIF1A	61256977	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	6.030000	0.70903	2.717000	0.92951	0.585000	0.79938	CTT		0.433	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2		NM_001530	
IFIT2	3433	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	91066668	91066668	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr10:91066668G>T	ENST00000371826.3	+	2	1124	c.955G>T	c.(955-957)Gct>Tct	p.A319S	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	319					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)	p.A319S(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				AATAGGACACGCTGTGGCTCA	0.433																																																	1	Substitution - Missense(1)	kidney(1)											75.0	73.0	73.0					10																	91066668		1906	4119	6025	SO:0001583	missense	3433			M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.955G>T	10.37:g.91066668G>T	ENSP00000360891:p.Ala319Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T767	Missense_Mutation	SNP	ENST00000371826.3	37	CCDS41548.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217781	0.79352	.	.	ENSG00000119922	ENST00000371826	T	0.58940	0.3	4.58	3.67	0.42095	Tetratricopeptide-like helical (1);	0.415483	0.20775	U	0.085909	T	0.61489	0.2351	M	0.79926	2.475	0.09310	N	1	P	0.47762	0.9	P	0.45538	0.484	T	0.59075	-0.7522	10	0.56958	D	0.05	-1.4886	9.5759	0.39457	0.0781:0.0:0.7805:0.1414	.	319	P09913	IFIT2_HUMAN	S	319	ENSP00000360891:A319S	ENSP00000360891:A319S	A	+	1	0	IFIT2	91056648	0.000000	0.05858	0.004000	0.12327	0.831000	0.47069	0.311000	0.19380	1.533000	0.49186	0.655000	0.94253	GCT		0.433	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049293.1		NM_001547	
IFNA14	3448	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	21239700	21239700	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr9:21239700C>A	ENST00000380222.2	-	1	278	c.235G>T	c.(235-237)Gtc>Ttc	p.V79F		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	79					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)	p.V79F(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCATGGAGGACAGAGATGGCT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											113.0	111.0	111.0					9																	21239700		2203	4300	6503	SO:0001583	missense	3448				CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.235G>T	9.37:g.21239700C>A	ENSP00000369571:p.Val79Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VZ56|Q7M4S1	Missense_Mutation	SNP	ENST00000380222.2	37	CCDS6501.1	.	.	.	.	.	.	.	.	.	.	-	13.48	2.249574	0.39797	.	.	ENSG00000228083	ENST00000380222	T	0.05649	3.41	3.38	-1.11	0.09840	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.622896	0.15896	N	0.239316	T	0.17959	0.0431	M	0.79805	2.47	0.09310	N	1	P	0.42123	0.771	P	0.59012	0.85	T	0.05550	-1.0878	10	0.72032	D	0.01	.	5.5833	0.17262	0.0:0.4956:0.3031:0.2013	.	79	P01570	IFN14_HUMAN	F	79	ENSP00000369571:V79F	ENSP00000369571:V79F	V	-	1	0	IFNA14	21229700	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	-0.185000	0.09684	-0.093000	0.12396	-1.389000	0.01157	GTC		0.458	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051894.1		NM_002172	
ISCU	23479	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	108960983	108960983	+	Silent	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr12:108960983T>C	ENST00000311893.9	+	4	379	c.357T>C	c.(355-357)acT>acC	p.T119T	ISCU_ENST00000392807.4_Silent_p.T94T|ISCU_ENST00000547005.1_Silent_p.T119T|ISCU_ENST00000535729.1_Silent_p.T119T|ISCU_ENST00000539593.1_Silent_p.T119T|ISCU_ENST00000338291.4_Silent_p.T94T|ISCU_ENST00000431221.2_Silent_p.T119T	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	119					iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)	p.T94T(1)		kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						AAGCCTTGACTATCAAAAACA	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											146.0	127.0	134.0					12																	108960983		2203	4300	6503	SO:0001819	synonymous_variant	23479			U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.357T>C	12.37:g.108960983T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6P713|Q99617|Q9H1K2	Silent	SNP	ENST00000311893.9	37	CCDS44966.1																																																																																				0.483	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1		NM_014301	
ISL1	3670	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	50685733	50685733	+	Silent	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr5:50685733G>A	ENST00000230658.7	+	4	1317	c.732G>A	c.(730-732)aaG>aaA	p.K244K	ISL1_ENST00000511384.1_Silent_p.K244K|ISL1_ENST00000505475.2_3'UTR	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	244	Gln-rich.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.K244K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				TCATGATGAAGCAACTCCAGC	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											57.0	66.0	63.0					5																	50685733		2202	4300	6502	SO:0001819	synonymous_variant	3670			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.732G>A	5.37:g.50685733G>A		Somatic		WXS	Illumina HiSeq	Phase_I	P20663|P47894	Silent	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	G	4.381	0.070205	0.08436	.	.	ENSG00000016082	ENST00000505475	.	.	.	5.63	1.23	0.21249	.	.	.	.	.	T	0.59702	0.2213	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58487	-0.7628	5	0.87932	D	0	.	5.4407	0.16507	0.3275:0.0:0.5371:0.1354	.	.	.	.	T	191	.	ENSP00000421737:A191T	A	+	1	0	ISL1	50721490	1.000000	0.71417	1.000000	0.80357	0.497000	0.33675	2.090000	0.41682	0.302000	0.22762	-0.188000	0.12872	GCA		0.587	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3		NM_002202	
KDM2A	22992	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	67017906	67017906	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr11:67017906C>T	ENST00000529006.2	+	17	2851	c.2405C>T	c.(2404-2406)aCg>aTg	p.T802M	KDM2A_ENST00000308783.5_Missense_Mutation_p.T260M|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000530342.1_Missense_Mutation_p.T363M|KDM2A_ENST00000398645.2_Intron	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	802					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.T802M(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CTCACTGTCACGCTACAGAGG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											68.0	76.0	74.0					11																	67017906		2113	4230	6343	SO:0001583	missense	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2405C>T	11.37:g.67017906C>T	ENSP00000432786:p.Thr802Met	Somatic		WXS	Illumina HiSeq	Phase_I	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885950	0.51908	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000446134;ENST00000308783	T;T;T	0.27256	2.05;1.68;1.75	5.91	5.91	0.95273	.	0.050176	0.85682	D	0.000000	T	0.38026	0.1025	N	0.22421	0.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.971;0.985	T	0.04333	-1.0959	9	.	.	.	-10.1062	18.4788	0.90804	0.0:1.0:0.0:0.0	.	260;802	D4QA03;Q9Y2K7	.;KDM2A_HUMAN	M	802;363;363;260	ENSP00000432786:T802M;ENSP00000435776:T363M;ENSP00000309302:T260M	.	T	+	2	0	KDM2A	66774482	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.269000	0.58890	2.802000	0.96397	0.655000	0.94253	ACG		0.582	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2		NM_012308	
RIC1	57589	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	5763502	5763502	+	Silent	SNP	G	G	A	rs149258225		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr9:5763502G>A	ENST00000414202.2	+	19	2666	c.2475G>A	c.(2473-2475)caG>caA	p.Q825Q	KIAA1432_ENST00000449720.2_Silent_p.Q709Q|KIAA1432_ENST00000381532.2_Silent_p.Q746Q|KIAA1432_ENST00000251879.6_Silent_p.Q825Q|KIAA1432_ENST00000418622.3_Silent_p.Q746Q	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.Q746Q(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GAACCTCTCAGATCTACCTCC	0.478																																																	1	Substitution - coding silent(1)	kidney(1)						G	,,	2,4404	4.2+/-10.8	0,2,2201	119.0	108.0	112.0		2475,2364,2475	5.8	1.0	9	dbSNP_134	112	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	KIAA1432	NM_001135920.2,NM_001206557.1,NM_020829.3	,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,	825/1166,788/1387,825/1424	5763502	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	57589																														ENST00000414202.2:c.2475G>A	9.37:g.5763502G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000414202.2	37	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	G	6.866	0.529104	0.13127	4.54E-4	0.0	ENSG00000107036	ENST00000545641	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	T	0.76709	0.4025	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74300	-0.3710	4	.	.	.	-13.9523	20.0079	0.97439	0.0:0.0:1.0:0.0	.	.	.	.	N	717	.	.	D	+	1	0	KIAA1432	5753502	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.484000	0.60271	2.726000	0.93360	0.561000	0.74099	GAT		0.478	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3			
KIAA2022	340533	broad.mit.edu;ucsc.edu	37	X	73961521	73961521	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:73961521T>A	ENST00000055682.6	-	3	3482	c.2871A>T	c.(2869-2871)caA>caT	p.Q957H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	957					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.Q957H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CAGATGGGAGTTGGGTATCTT	0.433																																																	1	Substitution - Missense(1)	kidney(1)											168.0	146.0	154.0					X																	73961521		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2871A>T	X.37:g.73961521T>A	ENSP00000055682:p.Gln957His	Somatic		WXS	Illumina GAIIx	Phase_I	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	T	4.614	0.114168	0.08831	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.32272	1.46;1.46	5.58	-2.87	0.05700	.	0.519884	0.22332	N	0.061457	T	0.12944	0.0314	N	0.16478	0.41	0.28777	N	0.900037	B	0.16166	0.016	B	0.14023	0.01	T	0.30327	-0.9982	10	0.13853	T	0.58	-0.29	6.8323	0.23917	0.1976:0.5071:0.0:0.2953	.	957	Q5QGS0	K2022_HUMAN	H	957	ENSP00000362567:Q957H;ENSP00000055682:Q957H	ENSP00000055682:Q957H	Q	-	3	2	KIAA2022	73878246	0.056000	0.20664	0.065000	0.19835	0.296000	0.27459	-0.629000	0.05508	-1.314000	0.02300	0.486000	0.48141	CAA		0.433	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2		NM_001008537	
LLGL1	3996	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	18135884	18135884	+	Silent	SNP	C	C	T	rs551770657		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr17:18135884C>T	ENST00000316843.4	+	3	351	c.255C>T	c.(253-255)acC>acT	p.T85T		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	85					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)	p.T85T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					ACTTCTTGACCGGCCAGGTGA	0.592																																																	1	Substitution - coding silent(1)	kidney(1)											86.0	70.0	75.0					17																	18135884		2203	4300	6503	SO:0001819	synonymous_variant	3996				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.255C>T	17.37:g.18135884C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7MBM7|O00188|Q58F11|Q86UK6	Silent	SNP	ENST00000316843.4	37	CCDS32586.1																																																																																				0.592	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132067.3			
MED18	54797	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	28661233	28661233	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:28661233C>G	ENST00000373842.4	+	3	588	c.379C>G	c.(379-381)Cat>Gat	p.H127D	MED18_ENST00000479574.1_3'UTR|MED18_ENST00000398997.2_Missense_Mutation_p.H127D	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	127						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.H127D(2)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCATGGACCATGAGTTTGT	0.512																																																	2	Substitution - Missense(2)	kidney(2)											146.0	138.0	141.0					1																	28661233		2203	4300	6503	SO:0001583	missense	54797			BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.379C>G	1.37:g.28661233C>G	ENSP00000362948:p.His127Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPM1|Q9NXU9	Missense_Mutation	SNP	ENST00000373842.4	37	CCDS322.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153719	0.78114	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.99	5.07	0.68467	Mediator complex, subunit Med18, metazoa/fungi (1);	0.092728	0.85682	D	0.000000	T	0.53238	0.1784	L	0.47716	1.5	0.31895	N	0.61671	D	0.53619	0.961	P	0.51701	0.677	T	0.63747	-0.6567	9	0.51188	T	0.08	-14.8997	15.4926	0.75619	0.1399:0.8601:0.0:0.0	.	127	Q9BUE0	MED18_HUMAN	D	127	.	ENSP00000362948:H127D	H	+	1	0	MED18	28533820	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.713000	0.84693	1.510000	0.48803	0.655000	0.94253	CAT		0.512	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009856.1		NM_017638	
MACF1	23499	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	39715714	39715714	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:39715714A>G	ENST00000372915.3	+	3	398	c.311A>G	c.(310-312)gAa>gGa	p.E104G	MACF1_ENST00000545844.1_Missense_Mutation_p.E104G|MACF1_ENST00000317713.7_Missense_Mutation_p.E104G|MACF1_ENST00000564288.1_Missense_Mutation_p.E67G|RP11-420K8.1_ENST00000289890.7_RNA|MACF1_ENST00000361689.2_Missense_Mutation_p.E104G|MACF1_ENST00000567887.1_Missense_Mutation_p.E104G|MACF1_ENST00000536367.1_Missense_Mutation_p.E67G|MACF1_ENST00000539005.1_Missense_Mutation_p.E104G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	104	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.E104G(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATCTTTATGAAGATCTGCGG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											189.0	174.0	179.0					1																	39715714		2203	4300	6503	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.311A>G	1.37:g.39715714A>G	ENSP00000362006:p.Glu104Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	32	5.166447	0.94768	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000404645;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000494012;ENST00000536367	D;D;D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	5.56	5.56	0.83823	.	.	.	.	.	D	0.97476	0.9174	M	0.80746	2.51	0.58432	D	0.999999	D;P;D	0.76494	0.999;0.833;0.999	D;B;D	0.73380	0.98;0.426;0.973	D	0.98048	1.0386	9	0.72032	D	0.01	.	14.2476	0.65999	1.0:0.0:0.0:0.0	.	67;104;69	B4E2T3;F8W8Q1;Q9UPN3-3	.;.;.	G	104;104;104;120;104;104;62;67;67	ENSP00000439537:E104G;ENSP00000362006:E104G;ENSP00000354573:E104G;ENSP00000313438:E104G;ENSP00000444364:E104G;ENSP00000435070:E62G;ENSP00000435892:E67G;ENSP00000440369:E67G	ENSP00000313438:E104G	E	+	2	0	MACF1	39488301	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.970000	0.93415	2.241000	0.73720	0.482000	0.46254	GAA		0.413	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1		NM_033044	
MMGT1	93380	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	135047254	135047254	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:135047254A>T	ENST00000305963.2	-	4	712	c.325T>A	c.(325-327)Tct>Act	p.S109T	MMGT1_ENST00000433339.2_Missense_Mutation_p.S174T	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	109					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)	p.S109T(1)		cervix(1)|endometrium(1)|kidney(1)	3						TGGTTTGAAGAATTTGCTGTA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											204.0	188.0	193.0					X																	135047254		2203	4300	6503	SO:0001583	missense	93380			AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.325T>A	X.37:g.135047254A>T	ENSP00000306220:p.Ser109Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R625|B4DIY3|D3DWG7|Q5JPP7	Missense_Mutation	SNP	ENST00000305963.2	37	CCDS14653.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.632510	0.46944	.	.	ENSG00000169446	ENST00000305963;ENST00000433339	.	.	.	5.67	1.67	0.24075	.	0.272970	0.43416	N	0.000570	T	0.18257	0.0438	L	0.27053	0.805	0.28785	N	0.89962	B;B	0.29037	0.01;0.231	B;B	0.19946	0.011;0.027	T	0.09574	-1.0668	9	0.28530	T	0.3	.	3.996	0.09558	0.6681:0.1243:0.0738:0.1338	.	174;109	Q8N4V1-2;Q8N4V1	.;MMGT1_HUMAN	T	109;174	.	ENSP00000306220:S109T	S	-	1	0	MMGT1	134874920	1.000000	0.71417	0.920000	0.36463	0.961000	0.63080	2.117000	0.41939	0.271000	0.22005	0.486000	0.48141	TCT		0.363	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058453.3		NM_173470	
MRE11A	4361	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	94169018	94169018	+	Silent	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr11:94169018G>A	ENST00000323929.3	-	18	2196	c.1974C>T	c.(1972-1974)acC>acT	p.T658T	MRE11A_ENST00000393241.4_Silent_p.T657T|MRE11A_ENST00000323977.3_Silent_p.T630T|MRE11A_ENST00000407439.3_Silent_p.T661T	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	658					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.T658T(1)|p.T630T(1)		breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				TCTTTGAAGTGGTAGGAAAAA	0.338								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																																								2	Substitution - coding silent(2)	kidney(2)											130.0	121.0	124.0					11																	94169018		2201	4298	6499	SO:0001819	synonymous_variant	4361	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.1974C>T	11.37:g.94169018G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O43475	Silent	SNP	ENST00000323929.3	37	CCDS8299.1																																																																																				0.338	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3		NM_005591	
MSH4	4438	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	76269428	76269428	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:76269428G>T	ENST00000263187.3	+	2	361	c.257G>T	c.(256-258)gGa>gTa	p.G86V		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	86					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.G86V(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						TCATACTTTGGAAACAAAAGA	0.289								Mismatch excision repair (MMR)																																									1	Substitution - Missense(1)	kidney(1)											44.0	47.0	46.0					1																	76269428		2202	4298	6500	SO:0001583	missense	4438			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.257G>T	1.37:g.76269428G>T	ENSP00000263187:p.Gly86Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	37	CCDS670.1	.	.	.	.	.	.	.	.	.	.	G	6.164	0.398529	0.11696	.	.	ENSG00000057468	ENST00000263187	D	0.88431	-2.38	4.73	2.83	0.33086	.	0.382752	0.26016	N	0.026845	T	0.68888	0.3050	L	0.32530	0.975	0.51233	D	0.999915	P	0.34462	0.454	B	0.29077	0.098	T	0.64441	-0.6407	10	0.33940	T	0.23	-1.2597	8.8351	0.35107	0.0773:0.2828:0.6398:0.0	.	86	O15457	MSH4_HUMAN	V	86	ENSP00000263187:G86V	ENSP00000263187:G86V	G	+	2	0	MSH4	76042016	0.998000	0.40836	0.888000	0.34837	0.106000	0.19336	0.506000	0.22658	0.417000	0.25871	0.555000	0.69702	GGA		0.289	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1		NM_002440	
MYLK2	85366	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	30418677	30418677	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr20:30418677T>G	ENST00000375994.2	+	8	1553	c.1280T>G	c.(1279-1281)tTt>tGt	p.F427C	MYLK2_ENST00000375985.4_Missense_Mutation_p.F427C|MYLK2_ENST00000468730.1_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	427	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.F427C(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ATCATTGACTTTGGCCTGGCA	0.617																																																	1	Substitution - Missense(1)	kidney(1)											134.0	131.0	132.0					20																	30418677		2203	4300	6503	SO:0001583	missense	85366			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1280T>G	20.37:g.30418677T>G	ENSP00000365162:p.Phe427Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.460963	0.63513	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.74002	-0.8;-0.8	3.76	3.76	0.43208	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.91030	0.7178	H	0.98818	4.34	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.93493	0.6837	9	0.87932	D	0	.	12.0947	0.53748	0.0:0.0:0.0:1.0	.	427	Q9H1R3	MYLK2_HUMAN	C	427	ENSP00000365162:F427C;ENSP00000365152:F427C	ENSP00000365152:F427C	F	+	2	0	MYLK2	29882338	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	6.006000	0.70724	1.678000	0.50952	0.459000	0.35465	TTT		0.617	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2		NM_033118	
NDST1	3340	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	149932854	149932854	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr5:149932854T>C	ENST00000261797.6	+	15	3111	c.2609T>C	c.(2608-2610)cTt>cCt	p.L870P	NDST1_ENST00000521752.1_3'UTR|NDST1_ENST00000523767.1_Missense_Mutation_p.L813P	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	870	Heparan sulfate N-sulfotransferase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.L870P(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCAGACACTTCCCACTTGG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											247.0	241.0	243.0					5																	149932854		2203	4300	6503	SO:0001583	missense	3340			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.2609T>C	5.37:g.149932854T>C	ENSP00000261797:p.Leu870Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792050	0.50102	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.56275	0.47;0.47	4.65	4.65	0.58169	.	0.074038	0.56097	D	0.000033	T	0.50463	0.1617	L	0.58810	1.83	0.80722	D	1	P;B	0.40619	0.724;0.342	B;B	0.38755	0.281;0.243	T	0.57341	-0.7828	10	0.56958	D	0.05	.	14.3753	0.66869	0.0:0.0:0.0:1.0	.	813;870	E7EVJ3;P52848	.;NDST1_HUMAN	P	813;870	ENSP00000428604:L813P;ENSP00000261797:L870P	ENSP00000261797:L870P	L	+	2	0	NDST1	149913047	1.000000	0.71417	0.998000	0.56505	0.444000	0.32077	7.649000	0.83500	1.853000	0.53794	0.402000	0.26972	CTT		0.562	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2		NM_001543	
NEU1	4758	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	31828358	31828358	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr6:31828358C>T	ENST00000375631.4	-	4	785	c.656G>A	c.(655-657)gGc>gAc	p.G219D		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	219			G -> A (in SIALIDOSIS; type 1; unable to reach the lysosomes). {ECO:0000269|PubMed:11063730}.		glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.G219D(1)		kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	CGTCCCATGGCCACACACGAT	0.627																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CM004862	NEU1	M							97.0	95.0	96.0					6																	31828358		2203	4300	6503	SO:0001583	missense	4758			AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.656G>A	6.37:g.31828358C>T	ENSP00000364782:p.Gly219Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000375631.4	37	CCDS4723.1	.	.	.	.	.	.	.	.	.	.	C	33	5.205792	0.95033	.	.	ENSG00000204386	ENST00000375631	D	0.84223	-1.82	5.84	5.84	0.93424	Neuraminidase (2);	0.102003	0.64402	D	0.000002	D	0.89955	0.6865	M	0.65320	2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.987	D	0.89243	0.3585	10	0.51188	T	0.08	-20.7269	17.6331	0.88114	0.0:1.0:0.0:0.0	.	219;219	E9PIF4;Q99519	.;NEUR1_HUMAN	D	219	ENSP00000364782:G219D	ENSP00000364782:G219D	G	-	2	0	NEU1	31936337	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.173000	0.77612	2.775000	0.95449	0.655000	0.94253	GGC		0.627	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076616.2			
NGB	58157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	77733013	77733013	+	Splice_Site	SNP	T	T	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr14:77733013T>A	ENST00000298352.4	-	4	696	c.322A>T	c.(322-324)Aca>Tca	p.T108S	MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	108	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.T108S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		TCACCCACTGTCTGCAGAGGC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											52.0	45.0	48.0					14																	77733013		2203	4300	6503	SO:0001630	splice_region_variant	58157			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.322-1A>T	14.37:g.77733013T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000298352.4	37	CCDS9856.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628924	0.67015	.	.	ENSG00000165553	ENST00000298352	D	0.92805	-3.11	4.61	3.45	0.39498	Globin-like (1);Globin, structural domain (1);	0.332441	0.32258	N	0.006353	D	0.90731	0.7091	M	0.74881	2.28	0.49687	D	0.999817	P	0.52842	0.956	P	0.46076	0.503	D	0.86618	0.1877	10	0.22109	T	0.4	.	9.2154	0.37344	0.0:0.0889:0.0:0.9111	.	108	Q9NPG2	NGB_HUMAN	S	108	ENSP00000298352:T108S	ENSP00000298352:T108S	T	-	1	0	NGB	76802766	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	0.582000	0.23834	0.620000	0.30215	0.459000	0.35465	ACA		0.582	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414194.1		NM_021257	Missense_Mutation
NNT	23530	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	43615986	43615986	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr5:43615986C>T	ENST00000264663.5	+	4	639	c.418C>T	c.(418-420)Cat>Tat	p.H140Y	NNT_ENST00000512996.2_Missense_Mutation_p.H9Y|NNT_ENST00000344920.4_Missense_Mutation_p.H140Y	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	140					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.H140Y(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					ATTAGGTGTTCATGAAGCTGA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											77.0	79.0	79.0					5																	43615986		2203	4300	6503	SO:0001583	missense	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.418C>T	5.37:g.43615986C>T	ENSP00000264663:p.His140Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714906	0.89112	.	.	ENSG00000112992	ENST00000505678;ENST00000512422;ENST00000264663;ENST00000344920;ENST00000512996;ENST00000515208	T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	5.89	5.89	0.94794	Alanine dehydrogenase/PNT, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87204	0.6119	M	0.66939	2.045	0.49389	D	0.999787	D	0.76494	0.999	D	0.68039	0.955	D	0.85935	0.1454	10	0.48119	T	0.1	-15.1525	20.2576	0.98430	0.0:1.0:0.0:0.0	.	140	Q13423	NNTM_HUMAN	Y	140;140;140;140;9;9	ENSP00000427670:H140Y;ENSP00000421886:H140Y;ENSP00000264663:H140Y;ENSP00000343873:H140Y;ENSP00000426343:H9Y;ENSP00000425542:H9Y	ENSP00000264663:H140Y	H	+	1	0	NNT	43651743	0.999000	0.42202	0.999000	0.59377	0.995000	0.86356	4.352000	0.59404	2.783000	0.95769	0.655000	0.94253	CAT		0.343	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1		NM_182977	
NPPB	4879	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11918768	11918768	+	Silent	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:11918768G>A	ENST00000376468.3	-	1	220	c.123C>T	c.(121-123)tcC>tcT	p.S41S		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	41					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.S41S(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	CCTGTAACCCGGACGTTTCCA	0.622																																																	1	Substitution - coding silent(1)	kidney(1)											65.0	76.0	73.0					1																	11918768		2203	4300	6503	SO:0001819	synonymous_variant	4879			BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.123C>T	1.37:g.11918768G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B0ZBE9|Q6FGY0|Q9P2Q7	Silent	SNP	ENST00000376468.3	37	CCDS140.1																																																																																				0.622	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006854.1		NM_002521	
OSGIN2	734	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	90937536	90937536	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr8:90937536A>G	ENST00000297438.2	+	6	1649	c.1294A>G	c.(1294-1296)Aag>Gag	p.K432E	OSGIN2_ENST00000451899.2_Missense_Mutation_p.K476E	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	432					meiotic nuclear division (GO:0007126)			p.K432E(1)|p.K476E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			CCTAGGCCATAAGTCAAGCCA	0.388																																																	2	Substitution - Missense(2)	kidney(2)											118.0	119.0	118.0					8																	90937536		2203	4300	6503	SO:0001583	missense	734			AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.1294A>G	8.37:g.90937536A>G	ENSP00000297438:p.Lys432Glu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000297438.2	37	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.468047	0.26335	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.27890	1.64;1.64	5.79	4.64	0.57946	.	0.236445	0.50627	D	0.000101	T	0.14399	0.0348	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.08953	-1.0697	10	0.23302	T	0.38	-3.5996	7.8339	0.29360	0.6848:0.2427:0.0724:0.0	.	476;432	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	E	432;476	ENSP00000297438:K432E;ENSP00000396445:K476E	ENSP00000297438:K432E	K	+	1	0	OSGIN2	91006711	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	2.194000	0.42668	1.029000	0.39812	0.460000	0.39030	AAG		0.388	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1		NM_004337	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu	37	3	52610715	52610715	+	Splice_Site	SNP	C	C	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:52610715C>G	ENST00000296302.7	-	22	3535		c.e22-1		PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(6)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTTTCAATTCTTGGGGAGGA	0.343			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	6	Unknown(6)	kidney(6)											52.0	51.0	52.0					3																	52610715		2199	4300	6499	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3534-1G>C	3.37:g.52610715C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	23.7	4.444995	0.83993	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3907	0.94581	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52585755	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.720000	0.84759	2.664000	0.90586	0.591000	0.81541	.		0.343	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Intron
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu	37	5	32000300	32000300	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr5:32000300G>A	ENST00000438447.1	+	5	1565	c.1177G>A	c.(1177-1179)Gtc>Atc	p.V393I	PDZD2_ENST00000282493.3_Missense_Mutation_p.V393I			O15018	PDZD2_HUMAN	PDZ domain containing 2	393	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.V393I(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCATTTACTGGTCGGGCTCTC	0.527																																																	1	Substitution - Missense(1)	kidney(1)											119.0	110.0	113.0					5																	32000300		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1177G>A	5.37:g.32000300G>A	ENSP00000402033:p.Val393Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210458	0.58343	.	.	ENSG00000133401	ENST00000438447;ENST00000282493	T;T	0.28255	1.62;1.62	5.55	2.82	0.32997	PDZ/DHR/GLGF (4);	0.579854	0.14553	N	0.312556	T	0.21468	0.0517	N	0.11106	0.095	0.35852	D	0.826852	P;P	0.48503	0.911;0.619	P;B	0.49085	0.6;0.323	T	0.12630	-1.0540	10	0.24483	T	0.36	.	9.3236	0.37980	0.2355:0.0:0.7645:0.0	.	219;393	B4E3P2;O15018	.;PDZD2_HUMAN	I	393	ENSP00000402033:V393I;ENSP00000282493:V393I	ENSP00000282493:V393I	V	+	1	0	PDZD2	32036057	1.000000	0.71417	0.588000	0.28705	0.995000	0.86356	4.813000	0.62620	0.313000	0.23062	0.555000	0.69702	GTC		0.527	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PLXND1	23129	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	129276046	129276046	+	Silent	SNP	G	G	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:129276046G>T	ENST00000324093.4	-	34	5644	c.5466C>A	c.(5464-5466)ctC>ctA	p.L1822L	PLXND1_ENST00000393239.1_3'UTR|PLXND1_ENST00000504689.1_5'UTR	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1822					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.L1822L(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TGGCGTAGAGGAGCTTGTTGG	0.557																																					Ovarian(97;366 1484 3738 22084 39045)												1	Substitution - coding silent(1)	kidney(1)											126.0	95.0	106.0					3																	129276046		2203	4300	6503	SO:0001819	synonymous_variant	23129			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5466C>A	3.37:g.129276046G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	1.337	-0.595290	0.03771	.	.	ENSG00000004399	ENST00000506979	.	.	.	5.35	-2.27	0.06846	.	.	.	.	.	T	0.51856	0.1699	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47058	-0.9146	4	.	.	.	.	7.8086	0.29217	0.1658:0.609:0.1281:0.0971	.	.	.	.	T	166	.	.	P	-	1	0	PLXND1	130758736	0.444000	0.25649	0.991000	0.47740	0.060000	0.15804	-0.302000	0.08221	-0.285000	0.09089	-0.304000	0.09214	CCT		0.557	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4		NM_015103	
PLOD2	5352	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	145799589	145799589	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:145799589A>T	ENST00000360060.3	-	12	1471	c.1294T>A	c.(1294-1296)Ttg>Atg	p.L432M	RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000461497.1_Missense_Mutation_p.L92M|PLOD2_ENST00000282903.5_Missense_Mutation_p.L432M|PLOD2_ENST00000494950.1_Missense_Mutation_p.L377M	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	432					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.L432M(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TCAGGACTCAATGCTCCCCAG	0.388																																																	1	Substitution - Missense(1)	kidney(1)											87.0	82.0	84.0					3																	145799589		2203	4300	6503	SO:0001583	missense	5352			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1294T>A	3.37:g.145799589A>T	ENSP00000353170:p.Leu432Met	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	37	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.581203	0.65992	.	.	ENSG00000152952	ENST00000461497;ENST00000282903;ENST00000360060;ENST00000494950	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.53	-2.91	0.05631	.	0.000000	0.64402	D	0.000001	D	0.89822	0.6826	L	0.56124	1.755	0.40202	D	0.977525	D;D;P;P	0.89917	0.999;1.0;0.939;0.949	D;D;P;P	0.87578	0.998;0.99;0.612;0.607	D	0.87282	0.2293	10	0.39692	T	0.17	-37.1527	15.4318	0.75105	0.3574:0.0:0.6426:0.0	.	377;432;432;92	E7ETU9;O00469;O00469-2;B3KWS3	.;PLOD2_HUMAN;.;.	M	92;432;432;377	ENSP00000419354:L92M;ENSP00000282903:L432M;ENSP00000353170:L432M;ENSP00000420094:L377M	ENSP00000282903:L432M	L	-	1	2	PLOD2	147282279	0.000000	0.05858	0.058000	0.19502	0.998000	0.95712	-0.042000	0.12063	-0.434000	0.07275	0.482000	0.46254	TTG		0.388	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1		NM_000935	
PIK3CA	5290	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			
POP7	10248	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	100304462	100304462	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr7:100304462A>C	ENST00000303151.4	+	2	271	c.9A>C	c.(7-9)gaA>gaC	p.E3D		NM_005837.2	NP_005828.2	O75817	POP7_HUMAN	processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)	3					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)	p.E3D(1)		endometrium(2)|kidney(1)|ovary(1)	4	Lung NSC(181;0.041)|all_lung(186;0.0581)					GCATGGCAGAAAACCGAGAGC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											62.0	70.0	67.0					7																	100304462		2203	4300	6503	SO:0001583	missense	10248			U94316	CCDS5704.1	7q22	2012-05-21	2007-06-26		ENSG00000172336	ENSG00000172336			19949	protein-coding gene	gene with protein product	"""ribonuclease P protein subunit p20"""	606113	"""processing of precursor 7, ribonuclease P subunit (S. cerevisiae)"""			9630247	Standard	NM_005837		Approved	RPP20, RPP2	uc003uwh.4	O75817	OTTHUMG00000044311	ENST00000303151.4:c.9A>C	7.37:g.100304462A>C	ENSP00000304353:p.Glu3Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2E0|Q9BV74	Missense_Mutation	SNP	ENST00000303151.4	37	CCDS5704.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.832262	0.50845	.	.	ENSG00000172336	ENST00000303151;ENST00000457480	.	.	.	5.49	3.15	0.36227	.	0.000000	0.85682	D	0.000000	T	0.19046	0.0457	N	0.08118	0	0.29740	N	0.837171	B	0.21147	0.052	B	0.12837	0.008	T	0.07139	-1.0788	9	0.37606	T	0.19	-11.124	4.8218	0.13394	0.7147:0.0:0.2853:0.0	.	3	O75817	POP7_HUMAN	D	3	.	ENSP00000304353:E3D	E	+	3	2	POP7	100142398	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.480000	0.35464	0.925000	0.37094	0.459000	0.35465	GAA		0.597	POP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103070.1		NM_005837	
PTK2	5747	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	141712777	141712777	+	Silent	SNP	G	G	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr8:141712777G>T	ENST00000522684.1	-	25	2488	c.2259C>A	c.(2257-2259)atC>atA	p.I753I	PTK2_ENST00000430260.2_Silent_p.I63I|PTK2_ENST00000538769.1_Silent_p.I421I|PTK2_ENST00000517887.1_Silent_p.I797I|PTK2_ENST00000395218.2_Silent_p.I753I|PTK2_ENST00000519465.1_Silent_p.I381I|PTK2_ENST00000519419.1_Silent_p.I797I|PTK2_ENST00000535192.1_Intron|PTK2_ENST00000340930.3_Silent_p.I753I|PTK2_ENST00000521059.1_Silent_p.I753I	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	753	Interaction with TGFB1I1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.I775I(1)|p.I753I(1)|p.I705I(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CCATGGCTGTGATTCCATGTG	0.473																																																	3	Substitution - coding silent(3)	kidney(3)											95.0	83.0	88.0					8																	141712777		2203	4300	6503	SO:0001819	synonymous_variant	5747			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2259C>A	8.37:g.141712777G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	ENST00000522684.1	37	CCDS6381.1																																																																																				0.473	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5		NM_005607	
PTPDC1	138639	broad.mit.edu;ucsc.edu	37	9	96859671	96859671	+	Missense_Mutation	SNP	C	C	T	rs547059455		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr9:96859671C>T	ENST00000375360.3	+	7	1001	c.661C>T	c.(661-663)Cgg>Tgg	p.R221W	PTPDC1_ENST00000288976.3_Missense_Mutation_p.R273W	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	221	Tyrosine-protein phosphatase.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R273W(1)|p.R221W(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						TATATTTGTGCGGGCAAAGCG	0.418													.|||	1	0.000199681	0.0	0.0	5008	,	,		18703	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)											71.0	69.0	70.0					9																	96859671		2203	4300	6503	SO:0001583	missense	138639			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.661C>T	9.37:g.96859671C>T	ENSP00000364509:p.Arg221Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	19.44	3.827852	0.71143	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.36520	1.25;1.25	5.55	5.55	0.83447	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	H	0.98089	4.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.83289	-0.0034	10	0.87932	D	0	-22.0637	14.0246	0.64577	0.1607:0.8393:0.0:0.0	.	275;273;275;221	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	W	221;273	ENSP00000364509:R221W;ENSP00000288976:R273W	ENSP00000288976:R273W	R	+	1	2	PTPDC1	95899492	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.596000	0.54024	2.610000	0.88304	0.591000	0.81541	CGG		0.418	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1		NM_177995, NM_152422	
RBM46	166863	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	155719349	155719349	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr4:155719349A>G	ENST00000281722.3	+	3	773	c.538A>G	c.(538-540)Aag>Gag	p.K180E	RBM46_ENST00000514866.1_Missense_Mutation_p.K180E|RBM46_ENST00000510397.1_Missense_Mutation_p.K180E	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	180	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.K180E(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				TGCAACTGATAAGACCAAAAA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											64.0	63.0	64.0					4																	155719349		2203	4296	6499	SO:0001583	missense	166863			BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.538A>G	4.37:g.155719349A>G	ENSP00000281722:p.Lys180Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWU8|B4DZ27	Missense_Mutation	SNP	ENST00000281722.3	37	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100841	0.76983	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397	T;T;T	0.16073	2.37;2.37;2.37	5.64	5.64	0.86602	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.091774	0.64402	D	0.000001	T	0.34745	0.0908	M	0.71581	2.175	0.58432	D	0.999996	P;P;P	0.42456	0.741;0.78;0.755	B;P;P	0.51516	0.405;0.672;0.67	T	0.04320	-1.0960	10	0.54805	T	0.06	-17.1739	15.8535	0.78956	1.0:0.0:0.0:0.0	.	180;180;180	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	E	180	ENSP00000424500:K180E;ENSP00000281722:K180E;ENSP00000422813:K180E	ENSP00000281722:K180E	K	+	1	0	RBM46	155938799	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.142000	0.94618	2.148000	0.66965	0.460000	0.39030	AAG		0.363	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1		NM_144979	
RLBP1	6017	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	89760467	89760467	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr15:89760467C>T	ENST00000268125.5	-	5	669	c.230G>A	c.(229-231)gGg>gAg	p.G77E		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	77					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)	p.G77E(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	CAGCTCCTCCCCCGAGGCCGC	0.662																																																	1	Substitution - Missense(1)	kidney(1)											58.0	59.0	59.0					15																	89760467		2200	4299	6499	SO:0001583	missense	6017			BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.230G>A	15.37:g.89760467C>T	ENSP00000268125:p.Gly77Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R667	Missense_Mutation	SNP	ENST00000268125.5	37	CCDS32324.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551990	0.86127	.	.	ENSG00000140522	ENST00000268125	T	0.78707	-1.2	5.03	4.1	0.47936	Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.049184	0.85682	D	0.000000	T	0.81851	0.4910	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.78324	-0.2248	10	0.02654	T	1	-21.5075	12.8229	0.57704	0.0:0.921:0.0:0.079	.	77	P12271	RLBP1_HUMAN	E	77	ENSP00000268125:G77E	ENSP00000268125:G77E	G	-	2	0	RLBP1	87561471	0.999000	0.42202	0.983000	0.44433	0.829000	0.46940	5.498000	0.66931	2.341000	0.79615	0.561000	0.74099	GGG		0.662	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421135.1		NM_000326	
SAMD9	54809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	92734661	92734661	+	Silent	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr7:92734661G>A	ENST00000379958.2	-	3	1019	c.750C>T	c.(748-750)atC>atT	p.I250I		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	250						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.I250I(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGGTGACTTTGATGCCAACAA	0.388																																																	1	Substitution - coding silent(1)	kidney(1)											145.0	139.0	142.0					7																	92734661		2203	4300	6503	SO:0001819	synonymous_variant	54809			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.750C>T	7.37:g.92734661G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Silent	SNP	ENST00000379958.2	37	CCDS34680.1																																																																																				0.388	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1		NM_017654	
SH3BP4	23677	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	235950115	235950115	+	Silent	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr2:235950115G>A	ENST00000409212.1	+	4	1209	c.702G>A	c.(700-702)cgG>cgA	p.R234R	SH3BP4_ENST00000392011.2_Silent_p.R234R|SH3BP4_ENST00000344528.4_Silent_p.R234R			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	234					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.R234R(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CGGTCAGGCGGGACAACCCCT	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											105.0	120.0	115.0					2																	235950115		2203	4300	6503	SO:0001819	synonymous_variant	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.702G>A	2.37:g.235950115G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	ENST00000409212.1	37	CCDS2513.1																																																																																				0.577	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1			
SLC12A6	9990	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	34547536	34547536	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr15:34547536A>G	ENST00000354181.3	-	8	1295	c.803T>C	c.(802-804)gTt>gCt	p.V268A	SLC12A6_ENST00000458406.2_Missense_Mutation_p.V209A|SLC12A6_ENST00000451844.2_Missense_Mutation_p.V80A|SLC12A6_ENST00000560164.1_Missense_Mutation_p.V80A|SLC12A6_ENST00000558667.1_Missense_Mutation_p.V268A|SLC12A6_ENST00000560611.1_Missense_Mutation_p.V268A|SLC12A6_ENST00000397702.2_Missense_Mutation_p.V209A|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000290209.5_Missense_Mutation_p.V217A|SLC12A6_ENST00000397707.2_Missense_Mutation_p.V253A|SLC12A6_ENST00000558589.1_Missense_Mutation_p.V259A			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	268					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.V259A(1)|p.V217A(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	GCAGAGGCCAACAGCCCCACC	0.448																																																	2	Substitution - Missense(2)	kidney(2)											78.0	80.0	80.0					15																	34547536		2201	4298	6499	SO:0001583	missense	9990			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.803T>C	15.37:g.34547536A>G	ENSP00000346112:p.Val268Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.905849	0.92107	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08;-5.08	5.43	5.43	0.79202	Amino acid permease domain (1);	0.000000	0.64402	D	0.000002	D	0.99324	0.9763	M	0.93594	3.435	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.992;0.996;0.999	D	0.98874	1.0767	10	0.87932	D	0	.	14.5986	0.68424	1.0:0.0:0.0:0.0	.	253;268;217;80	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	A	217;253;259;209;209;80	ENSP00000290209:V217A;ENSP00000380819:V253A;ENSP00000380814:V209A;ENSP00000387725:V209A;ENSP00000390199:V80A	ENSP00000290209:V217A	V	-	2	0	SLC12A6	32334828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.279000	0.76181	0.533000	0.62120	GTT		0.448	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1		NM_005135	
SLC14A2	8170	hgsc.bcm.edu;ucsc.edu	37	18	43246949	43246949	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr18:43246949delT	ENST00000255226.6	+	13	2423	c.1607delT	c.(1606-1608)attfs	p.I536fs	SLC14A2_ENST00000586448.1_Frame_Shift_Del_p.I536fs|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Frame_Shift_Del_p.I13fs	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	536					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GAAACAAACATTTCCAAGACA	0.502																																																	0													115.0	105.0	108.0					18																	43246949		2203	4300	6503	SO:0001589	frameshift_variant	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1607delT	18.37:g.43246949delT	ENSP00000255226:p.Ile536fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q7|Q2TBD6|Q96PH5	Frame_Shift_Del	DEL	ENST00000255226.6	37	CCDS11924.1																																																																																				0.502	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			
SLC14A2	8170	hgsc.bcm.edu	37	18	43246952	43246952	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr18:43246952C>A	ENST00000255226.6	+	13	2426	c.1610C>A	c.(1609-1611)tCc>tAc	p.S537Y	SLC14A2_ENST00000586448.1_Missense_Mutation_p.S537Y|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.S14Y	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	537					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACAAACATTTCCAAGACATCC	0.507																																																	0													112.0	102.0	105.0					18																	43246952		2203	4300	6503	SO:0001583	missense	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1610C>A	18.37:g.43246952C>A	ENSP00000255226:p.Ser537Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	ENST00000255226.6	37	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.438882	0.25900	.	.	ENSG00000132874	ENST00000255226	T	0.35789	1.29	4.24	4.24	0.50183	.	0.597682	0.14974	N	0.287656	T	0.36717	0.0977	L	0.56769	1.78	0.26454	N	0.975557	P	0.40875	0.731	B	0.39738	0.308	T	0.34750	-0.9816	10	0.66056	D	0.02	-16.6145	11.443	0.50107	0.1807:0.8193:0.0:0.0	.	537	Q15849	UT2_HUMAN	Y	537	ENSP00000255226:S537Y	ENSP00000255226:S537Y	S	+	2	0	SLC14A2	41500950	0.010000	0.17322	0.201000	0.23476	0.187000	0.23431	2.088000	0.41663	2.180000	0.69256	0.561000	0.74099	TCC		0.507	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			
SLC8A3	6547	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	70633462	70633462	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr14:70633462C>T	ENST00000381269.2	-	2	2431	c.1678G>A	c.(1678-1680)Ggt>Agt	p.G560S	SLC8A3_ENST00000528359.1_Missense_Mutation_p.G560S|SLC8A3_ENST00000357887.3_Missense_Mutation_p.G560S|SLC8A3_ENST00000534137.1_Missense_Mutation_p.G560S|SLC8A3_ENST00000356921.2_Missense_Mutation_p.G560S	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	560	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.G560S(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATGACTGTACCCCGGGCACCT	0.483																																																	2	Substitution - Missense(2)	kidney(2)											100.0	97.0	98.0					14																	70633462		2203	4300	6503	SO:0001583	missense	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1678G>A	14.37:g.70633462C>T	ENSP00000370669:p.Gly560Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196407	0.78902	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.69	5.69	0.88448	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.63022	0.2476	M	0.85373	2.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.994;0.996	T	0.66404	-0.5932	10	0.59425	D	0.04	.	19.8067	0.96534	0.0:1.0:0.0:0.0	.	560;560;560;560	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	S	560	ENSP00000349392:G560S;ENSP00000370669:G560S;ENSP00000350560:G560S;ENSP00000436688:G560S;ENSP00000433531:G560S	ENSP00000349392:G560S	G	-	1	0	SLC8A3	69703215	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.672000	0.90937	0.650000	0.86243	GGT		0.483	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			
SMCR8	140775	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	18220787	18220787	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr17:18220787A>C	ENST00000406438.3	+	1	2164	c.1684A>C	c.(1684-1686)Agt>Cgt	p.S562R	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	562						nucleus (GO:0005634)		p.S562R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GGCAAGCATCAGTCCTCCAGA	0.493																																																	1	Substitution - Missense(1)	kidney(1)											120.0	128.0	125.0					17																	18220787		2203	4300	6503	SO:0001583	missense	140775			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1684A>C	17.37:g.18220787A>C	ENSP00000385025:p.Ser562Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	37	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.906457	0.00512	.	.	ENSG00000176994	ENST00000406438	T	0.32988	1.43	6.03	-0.456	0.12190	.	0.629731	0.17760	N	0.162921	T	0.16041	0.0386	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22208	-1.0223	10	0.21540	T	0.41	-25.527	5.6322	0.17516	0.5626:0.2426:0.1947:0.0	.	562	Q8TEV9	SMCR8_HUMAN	R	562	ENSP00000385025:S562R	ENSP00000385025:S562R	S	+	1	0	SMCR8	18161512	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	1.008000	0.29872	-0.385000	0.07833	-0.250000	0.11733	AGT		0.493	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2		NM_144775	
SOX4	6659	broad.mit.edu;hgsc.bcm.edu	37	6	21595027	21595027	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr6:21595027G>A	ENST00000244745.1	+	1	1056	c.262G>A	c.(262-264)Gag>Aag	p.E88K	SOX4_ENST00000543472.1_Missense_Mutation_p.E88K	NM_003107.2	NP_003098.1	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	88					ascending aorta morphogenesis (GO:0035910)|atrial septum primum morphogenesis (GO:0003289)|canonical Wnt signaling pathway (GO:0060070)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle formation (GO:0003211)|cellular response to glucose stimulus (GO:0071333)|DNA damage response, detection of DNA damage (GO:0042769)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endocrine pancreas development (GO:0031018)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|kidney morphogenesis (GO:0060993)|limb bud formation (GO:0060174)|mitral valve morphogenesis (GO:0003183)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|noradrenergic neuron differentiation (GO:0003357)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin secretion (GO:0032024)|positive regulation of N-terminal peptidyl-lysine acetylation (GO:2000761)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of Wnt signaling pathway (GO:0030177)|pro-B cell differentiation (GO:0002328)|protein stabilization (GO:0050821)|regulation of protein stability (GO:0031647)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spinal cord development (GO:0021510)|spinal cord motor neuron differentiation (GO:0021522)|sympathetic nervous system development (GO:0048485)|T cell differentiation (GO:0030217)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E88K(1)		kidney(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	6	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GCACAACGCCGAGATCTCCAA	0.607																																																	1	Substitution - Missense(1)	kidney(1)											37.0	34.0	35.0					6																	21595027		2203	4300	6503	SO:0001583	missense	6659			AF070669	CCDS4547.1	6p22.3	2008-02-05			ENSG00000124766	ENSG00000124766		"""SRY (sex determining region Y)-boxes"""	11200	protein-coding gene	gene with protein product		184430				8268656, 9730625	Standard	NM_003107		Approved		uc003ndi.3	Q06945	OTTHUMG00000016101	ENST00000244745.1:c.262G>A	6.37:g.21595027G>A	ENSP00000244745:p.Glu88Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000244745.1	37	CCDS4547.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113345	0.94339	.	.	ENSG00000124766	ENST00000244745;ENST00000543472	D;D	0.95554	-3.74;-3.74	5.12	5.12	0.69794	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	U	0.000001	D	0.98251	0.9421	M	0.93808	3.46	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.99541	1.0963	10	0.87932	D	0	.	17.3307	0.87262	0.0:0.0:1.0:0.0	.	88	Q06945	SOX4_HUMAN	K	88	ENSP00000244745:E88K;ENSP00000438412:E88K	ENSP00000244745:E88K	E	+	1	0	SOX4	21703006	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.237000	0.95368	2.365000	0.80145	0.555000	0.69702	GAG		0.607	SOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043301.1		NM_003107	
SPIN3	169981	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	57020876	57020876	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:57020876C>G	ENST00000374919.3	-	2	827	c.505G>C	c.(505-507)Gat>Cat	p.D169H		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	169					gamete generation (GO:0007276)			p.D169H(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						AATACAGGATCTTTCTCATAG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											95.0	94.0	94.0					X																	57020876		2162	4247	6409	SO:0001583	missense	169981			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.505G>C	X.37:g.57020876C>G	ENSP00000364054:p.Asp169His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	ENST00000374919.3	37	CCDS43963.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233384	0.58886	.	.	ENSG00000204271	ENST00000374919	T	0.55588	0.51	2.72	2.72	0.32119	.	0.000000	0.64402	U	0.000008	T	0.67050	0.2852	M	0.66297	2.02	0.41200	D	0.986367	D	0.89917	1.0	D	0.87578	0.998	T	0.71111	-0.4687	10	0.87932	D	0	-5.3815	10.7756	0.46348	0.0:1.0:0.0:0.0	.	169	Q5JUX0	SPIN3_HUMAN	H	169	ENSP00000364054:D169H	ENSP00000364054:D169H	D	-	1	0	SPIN3	57037601	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.503000	0.60407	1.659000	0.50751	0.600000	0.82982	GAT		0.423	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056908.1		XM_093024	
SS18	6760	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	23619298	23619298	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr18:23619298T>C	ENST00000415083.2	-	6	785	c.730A>G	c.(730-732)Atg>Gtg	p.M244V	SS18_ENST00000269137.7_Missense_Mutation_p.M244V|SS18_ENST00000585241.1_5'Flank|SS18_ENST00000539849.1_Missense_Mutation_p.M162V|SS18_ENST00000542743.1_Missense_Mutation_p.M192V|SS18_ENST00000542420.2_Missense_Mutation_p.M221V|SS18_ENST00000545952.1_Missense_Mutation_p.M192V	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	244	Gln-rich.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.M244V(1)	SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					TGACCCATCATATGATTGCCT	0.428			T	"""SSX1,  SSX2"""	synovial sarcoma																																			Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	1	Substitution - Missense(1)	kidney(1)											246.0	216.0	226.0					18																	23619298		2203	4300	6503	SO:0001583	missense	6760			X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.730A>G	18.37:g.23619298T>C	ENSP00000414516:p.Met244Val	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Missense_Mutation	SNP	ENST00000415083.2	37	CCDS32807.1	.	.	.	.	.	.	.	.	.	.	T	13.00	2.107737	0.37242	.	.	ENSG00000141380	ENST00000415083;ENST00000269138;ENST00000269137;ENST00000542420;ENST00000542743;ENST00000539849;ENST00000545952	T;T;T;T;T	0.29655	1.59;1.59;1.56;1.57;1.56	5.55	5.55	0.83447	.	0.039832	0.85682	D	0.000000	T	0.22282	0.0537	N	0.20685	0.6	0.49213	D	0.99976	B;B;B	0.22909	0.0;0.0;0.077	B;B;B	0.15052	0.0;0.0;0.012	T	0.02991	-1.1085	10	0.36615	T	0.2	-2.6705	15.9896	0.80193	0.0:0.0:0.0:1.0	.	192;244;244	B4E2J6;Q4VAX0;Q15532	.;.;SSXT_HUMAN	V	247;244;244;221;192;162;192	ENSP00000269137:M244V;ENSP00000438066:M221V;ENSP00000444551:M192V;ENSP00000444647:M162V;ENSP00000443097:M192V	ENSP00000269137:M244V	M	-	1	0	SS18	21873296	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.763000	0.55257	2.238000	0.73509	0.533000	0.62120	ATG		0.428	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000446226.1			
STRN	6801	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	37088370	37088370	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr2:37088370C>T	ENST00000263918.4	-	13	1582	c.1574G>A	c.(1573-1575)aGc>aAc	p.S525N	STRN_ENST00000379213.2_Missense_Mutation_p.S476N	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	525					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.S525N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				ACCATTGCTGCTCATTACCAC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											158.0	128.0	138.0					2																	37088370		2203	4300	6503	SO:0001583	missense	6801			AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1574G>A	2.37:g.37088370C>T	ENSP00000263918:p.Ser525Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615793	0.87359	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.64803	-0.12;-0.12	5.16	5.16	0.70880	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70237	0.3201	L	0.45581	1.43	0.80722	D	1	P;P	0.39665	0.682;0.562	P;P	0.51742	0.628;0.678	T	0.70684	-0.4804	10	0.51188	T	0.08	-11.9576	18.6282	0.91349	0.0:1.0:0.0:0.0	.	476;525	O43815-2;O43815	.;STRN_HUMAN	N	525;500;476	ENSP00000263918:S525N;ENSP00000368513:S476N	ENSP00000263918:S525N	S	-	2	0	STRN	36941874	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.984000	0.56923	2.400000	0.81607	0.591000	0.81541	AGC		0.408	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1			
TMEM31	203562	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	102968576	102968576	+	Nonsense_Mutation	SNP	C	C	T	rs369865427		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chrX:102968576C>T	ENST00000319560.6	+	3	348	c.157C>T	c.(157-159)Cga>Tga	p.R53*	GLRA4_ENST00000372617.4_Missense_Mutation_p.D319N	NM_182541.2	NP_872347.2	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	53						integral component of membrane (GO:0016021)		p.R53*(1)|p.D319N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						ATCCAGATGTCGATTGCCTTC	0.473																																																	2	Substitution - Missense(1)|Substitution - Nonsense(1)	kidney(2)						C	ASN/ASP,stop/ARG	0,3835		0,0,0,1632,571	220.0	157.0	178.0		955,157	5.5	1.0	X		178	1,6727		0,0,1,2428,1871	no	missense,stop-gained	TMEM31,GLRA4	NM_001024452.2,NM_182541.2	23,	0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	probably-damaging,	319/418,53/169	102968576	1,10562	2203	4300	6503	SO:0001587	stop_gained	203562			BC029575	CCDS35359.1	Xq22.2	2008-02-05			ENSG00000179363	ENSG00000179363			28601	protein-coding gene	gene with protein product						12477932	Standard	NM_182541		Approved	MGC39655	uc004elh.3	Q5JXX7	OTTHUMG00000022109	ENST00000319560.6:c.157C>T	X.37:g.102968576C>T	ENSP00000316940:p.Arg53*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHR4	Nonsense_Mutation	SNP	ENST00000319560.6	37	CCDS35359.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.766014|6.766014	0.97821|0.97821	0.0|0.0	1.49E-4|1.49E-4	ENSG00000188828|ENSG00000179363	ENST00000372617|ENST00000319560	D|.	0.88124|.	-2.34|.	5.5|5.5	5.5|5.5	0.81552|0.81552	Neurotransmitter-gated ion-channel transmembrane domain (2);|.	0.047005|.	0.85682|.	D|.	0.000000|.	T|.	0.43299|.	0.1241|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|.	0.34825|.	-0.9813|.	9|.	0.87932|0.02654	D|T	0|1	0.8713|0.8713	15.6855|15.6855	0.77405|0.77405	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	319|.	Q5JXX5|.	GLRA4_HUMAN|.	N|X	319|53	ENSP00000361700:D319N|.	ENSP00000361700:D319N|ENSP00000316940:R53X	D|R	-|+	1|1	0|2	GLRA4|TMEM31	102855232|102855232	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.299000|2.299000	0.77371|0.77371	0.523000|0.523000	0.50628|0.50628	GAC|CGA		0.473	TMEM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057741.1		NM_182541	
TRANK1	9881	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	36899166	36899166	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:36899166C>T	ENST00000429976.2	-	12	2162	c.1915G>A	c.(1915-1917)Ggt>Agt	p.G639S	TRANK1_ENST00000301807.6_Missense_Mutation_p.G89S|TRANK1_ENST00000428977.2_Missense_Mutation_p.G89S	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	639							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)	p.G89S(2)|p.G639S(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TTGAATGAACCCTGGGACTTG	0.592																																																	3	Substitution - Missense(3)	kidney(3)											107.0	108.0	108.0					3																	36899166		2028	4191	6219	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.1915G>A	3.37:g.36899166C>T	ENSP00000416168:p.Gly639Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	8.897	0.955509	0.18507	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.29655	1.56;1.99;1.56	5.59	2.78	0.32641	.	0.692532	0.12798	N	0.438221	T	0.22513	0.0543	L	0.29908	0.895	0.09310	N	1	B	0.16396	0.017	B	0.12156	0.007	T	0.19095	-1.0316	10	0.46703	T	0.11	.	9.3701	0.38248	0.0:0.7728:0.0:0.2272	.	639	O15050	TRNK1_HUMAN	S	89;639;89	ENSP00000416826:G89S;ENSP00000416168:G639S;ENSP00000301807:G89S	ENSP00000301807:G89S	G	-	1	0	TRANK1	36874170	0.001000	0.12720	0.075000	0.20258	0.084000	0.17831	0.159000	0.16442	0.388000	0.25054	-0.145000	0.13849	GGT		0.592	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_014831	
USP40	55230	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	234429716	234429716	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr2:234429716A>C	ENST00000427112.2	-	16	2278	c.2243T>G	c.(2242-2244)aTt>aGt	p.I748S	USP40_ENST00000251722.6_Missense_Mutation_p.I748S|USP40_ENST00000450966.1_Missense_Mutation_p.I760S			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	748					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.I760S(2)		breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GAGCCAGTCAATCTCATTCAT	0.348																																																	2	Substitution - Missense(2)	kidney(2)											106.0	97.0	99.0					2																	234429716		1832	4073	5905	SO:0001583	missense	55230			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2243T>G	2.37:g.234429716A>C	ENSP00000387898:p.Ile748Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201687	0.38905	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000452724	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.43	-3.88	0.04205	.	2.752600	0.00735	N	0.000974	T	0.34542	0.0901	L	0.31664	0.95	0.09310	N	1	B;B	0.16166	0.009;0.016	B;B	0.15870	0.014;0.012	T	0.35525	-0.9785	10	0.66056	D	0.02	.	5.7772	0.18285	0.3429:0.4008:0.2563:0.0	.	748;760	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	S	760;748;748;43	ENSP00000415434:I760S;ENSP00000251722:I748S;ENSP00000387898:I748S;ENSP00000408853:I43S	ENSP00000251722:I748S	I	-	2	0	USP40	234094455	0.000000	0.05858	0.000000	0.03702	0.664000	0.39144	-0.106000	0.10890	-0.492000	0.06687	0.477000	0.44152	ATT		0.348	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1		XM_114294	
VCPIP1	80124	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	67546928	67546928	+	Silent	SNP	T	T	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr8:67546928T>C	ENST00000310421.4	-	3	3735	c.3477A>G	c.(3475-3477)gaA>gaG	p.E1159E		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1159					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)	p.E1159E(1)		breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AAGGAAAAGATTCAGGCAAAC	0.433																																					NSCLC(179;265 2915 6144 43644)												1	Substitution - coding silent(1)	kidney(1)											100.0	99.0	99.0					8																	67546928		2203	4300	6503	SO:0001819	synonymous_variant	80124			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3477A>G	8.37:g.67546928T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Silent	SNP	ENST00000310421.4	37	CCDS6192.1																																																																																				0.433	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1			
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10188290	10188290	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:10188290C>T	ENST00000256474.2	+	2	1273	c.433C>T	c.(433-435)Cag>Tag	p.Q145*	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	145	Involved in binding to CCT complex.		Q -> H (in VHLD).		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.Q145*(2)|p.Q145fs*12(1)|p.G144fs*14(1)|p.S139fs*12(1)|p.G144fs*19(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGTTGACGGACAGCCTATTTT	0.418		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	6	Deletion - Frameshift(4)|Substitution - Nonsense(2)	kidney(6)	GRCh37	CM994243	VHL	M							217.0	201.0	206.0					3																	10188290		2203	4300	6503	SO:0001587	stop_gained	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.433C>T	3.37:g.10188290C>T	ENSP00000256474:p.Gln145*	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	43	10.345298	0.99388	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	.	.	.	5.07	5.07	0.68467	.	0.262110	0.33591	N	0.004751	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-29.4808	16.3181	0.82935	0.0:1.0:0.0:0.0	.	.	.	.	X	145;63	.	ENSP00000256474:Q145X	Q	+	1	0	VHL	10163290	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	1.592000	0.36676	2.530000	0.85305	0.563000	0.77884	CAG		0.418	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
VEPH1	79674	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	157031465	157031465	+	Missense_Mutation	SNP	C	C	T	rs201853660		TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:157031465C>T	ENST00000362010.2	-	11	2262	c.1955G>A	c.(1954-1956)gGg>gAg	p.G652E	RP11-550I24.2_ENST00000475102.1_RNA|RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.G652E|RP11-550I24.2_ENST00000494885.1_RNA|VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000543418.1_Intron	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	652						plasma membrane (GO:0005886)		p.G652E(1)		autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTGAGCACCCCCTGCCTGGGT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											73.0	75.0	74.0					3																	157031465		2203	4300	6503	SO:0001583	missense	79674			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1955G>A	3.37:g.157031465C>T	ENSP00000354919:p.Gly652Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	C	0.099	-1.155233	0.01700	.	.	ENSG00000197415	ENST00000362010;ENST00000392832	T;T	0.06294	3.32;3.32	5.01	-1.53	0.08611	.	0.368712	0.28653	N	0.014587	T	0.01558	0.0050	N	0.01874	-0.695	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.43653	-0.9378	10	0.02654	T	1	-0.1681	5.7749	0.18273	0.0:0.4074:0.1521:0.4405	.	652	Q14D04	MELT_HUMAN	E	652	ENSP00000354919:G652E;ENSP00000376577:G652E	ENSP00000354919:G652E	G	-	2	0	VEPH1	158514159	0.749000	0.28305	0.000000	0.03702	0.584000	0.36387	1.185000	0.32065	-0.438000	0.07232	0.484000	0.47621	GGG		0.488	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3		NM_024621	
WDR91	29062	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	134889161	134889161	+	Silent	SNP	A	A	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr7:134889161A>G	ENST00000354475.4	-	6	781	c.750T>C	c.(748-750)aaT>aaC	p.N250N	WDR91_ENST00000344400.5_Silent_p.N250N|AC009542.2_ENST00000595902.1_RNA|WDR91_ENST00000423565.1_Silent_p.N215N|WDR91_ENST00000485942.1_5'UTR	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	250								p.N250N(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						AGAGGGAGGCATTCCTTTGGC	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											74.0	57.0	63.0					7																	134889161		2203	4300	6503	SO:0001819	synonymous_variant	29062			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.750T>C	7.37:g.134889161A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Silent	SNP	ENST00000354475.4	37	CCDS34758.1																																																																																				0.587	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1		NM_014149	
XIRP2	129446	hgsc.bcm.edu;ucsc.edu	37	2	168101553	168101553	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr2:168101553G>C	ENST00000409195.1	+	9	3740	c.3651G>C	c.(3649-3651)gaG>gaC	p.E1217D	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.E1217D|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.E995D	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1042					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTAGTTCAGAGGAAGTTTTGA	0.318																																																	0													47.0	45.0	46.0					2																	168101553		1809	4071	5880	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3651G>C	2.37:g.168101553G>C	ENSP00000386840:p.Glu1217Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	9.561	1.118413	0.20877	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03181	4.02;4.02;4.02	5.76	0.883	0.19177	.	0.051788	0.85682	D	0.000000	T	0.06050	0.0157	M	0.71581	2.175	0.46774	D	0.999195	P;P;P	0.52316	0.952;0.801;0.801	B;B;B	0.43194	0.411;0.314;0.314	T	0.27536	-1.0071	10	0.56958	D	0.05	-8.1846	9.2897	0.37780	0.4346:0.0:0.5654:0.0	.	1042;1042;995	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	D	1217;1217;995	ENSP00000386840:E1217D;ENSP00000295237:E1217D;ENSP00000387255:E995D	ENSP00000295237:E1217D	E	+	3	2	XIRP2	167809799	0.992000	0.36948	0.990000	0.47175	0.791000	0.44710	0.228000	0.17814	-0.110000	0.12022	-0.140000	0.14226	GAG		0.318	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1		NM_152381	
YTHDF2	51441	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	29069170	29069170	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:29069170G>A	ENST00000373812.3	+	4	750	c.388G>A	c.(388-390)Gac>Aac	p.D130N	YTHDF2_ENST00000541996.1_Missense_Mutation_p.D80N|YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000542507.1_Missense_Mutation_p.D130N	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	130	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.D130N(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CAGTGGGATTGACTTCTCAGC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											168.0	156.0	160.0					1																	29069170		1895	4132	6027	SO:0001583	missense	51441			AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.388G>A	1.37:g.29069170G>A	ENSP00000362918:p.Asp130Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Missense_Mutation	SNP	ENST00000373812.3	37	CCDS41296.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124810	0.56613	.	.	ENSG00000198492	ENST00000542507;ENST00000373812;ENST00000541996;ENST00000396232	T;T;T	0.41065	1.01;1.01;1.01	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.49270	0.1547	M	0.66939	2.045	0.80722	D	1	P;P	0.49358	0.857;0.923	P;P	0.44811	0.461;0.461	T	0.56353	-0.7993	10	0.66056	D	0.02	-11.7442	17.9052	0.88916	0.0:0.0:1.0:0.0	.	130;130	B5BU99;Q9Y5A9	.;YTHD2_HUMAN	N	130;130;80;130	ENSP00000444660:D130N;ENSP00000362918:D130N;ENSP00000439394:D80N	ENSP00000362918:D130N	D	+	1	0	YTHDF2	28941757	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.714000	0.98744	2.594000	0.87642	0.585000	0.79938	GAC		0.478	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1		NM_016258	
ZC3H3	23144	hgsc.bcm.edu	37	8	144522386	144522387	+	In_Frame_Ins	INS	-	-	GAG	rs35759992|rs2272754	byFrequency	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr8:144522386_144522387insGAG	ENST00000262577.5	-	11	2670_2671	c.2639_2640insCTC	c.(2638-2640)tca>tcCTCa	p.880_880S>SS		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	880	Poly-Ser.				mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CGggaggggatgaggaggagga	0.649																																																	0																																										SO:0001652	inframe_insertion	23144			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2637_2639dupCTC	8.37:g.144522393_144522395dupGAG	ENSP00000262577:p.Ser881dup	Somatic		WXS	Illumina HiSeq	Phase_I	Q14163|Q8N4E2|Q9BUS4	In_Frame_Ins	INS	ENST00000262577.5	37	CCDS6402.1																																																																																				0.649	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2		NM_015117	
ZNF883	169834	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	115759684	115759684	+	lincRNA	SNP	T	T	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr9:115759684T>G	ENST00000427548.1	-	0	2129							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CAAGAATGAATTTTTAGATGT	0.378																																																	0													184.0	200.0	194.0					9																	115759684		2104	4247	6351			169834			AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115759684T>G		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000427548.1	37																																																																																					0.378	ZNF883-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000053704.1		NM_001101338	
CREB5	9586	broad.mit.edu	37	7	28610069	28610069	+	Silent	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr7:28610069C>T	ENST00000357727.2	+	5	768	c.378C>T	c.(376-378)gaC>gaT	p.D126D	CREB5_ENST00000409603.1_Silent_p.D93D|CREB5_ENST00000396299.2_Silent_p.D93D|CREB5_ENST00000396300.2_Silent_p.D119D	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	126					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D126D(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						CCAACCATGACACCAACGTTG	0.587																																																	1	Substitution - coding silent(1)	kidney(1)											112.0	98.0	102.0					7																	28610069		2203	4300	6503	SO:0001819	synonymous_variant	9586			L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.378C>T	7.37:g.28610069C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Silent	SNP	ENST00000357727.2	37	CCDS5417.1																																																																																				0.587	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4		NM_004904	
GOLGA6L17P	642402	broad.mit.edu	37	15	85053142	85053142	+	RNA	SNP	C	C	T	rs184555335	byFrequency	TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr15:85053142C>T	ENST00000414190.2	-	0	310					NR_003246.2																						TTTTTCAATTCCTTGACCCGC	0.413													.|||	2313	0.461861	0.4849	0.4121	5008	,	,		9054	0.4554		0.4632	False		,,,				2504	0.4714																0																																												374650																															15.37:g.85053142C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000414190.2	37																																																																																					0.413	GOLGA6L5-003	KNOWN	mRNA_end_NF|basic	processed_transcript	pseudogene	OTTHUMT00000418579.1			
LILRB4	11006	broad.mit.edu	37	19	55176277	55176277	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr19:55176277C>T	ENST00000391736.1	+	7	998	c.683C>T	c.(682-684)cCc>cTc	p.P228L	LILRB4_ENST00000430952.2_Missense_Mutation_p.P228L|LILRB4_ENST00000391734.3_Missense_Mutation_p.P228L|LILRB4_ENST00000270452.2_Missense_Mutation_p.P228L|LILRB4_ENST00000391733.3_Missense_Mutation_p.P228L	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	228					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.P228L(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		AGGCCCTCACCCACAAGGTCC	0.557																																																	1	Substitution - Missense(1)	kidney(1)											74.0	63.0	67.0					19																	55176277		2203	4300	6503	SO:0001583	missense	11006			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.683C>T	19.37:g.55176277C>T	ENSP00000375616:p.Pro228Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	C	6.955	0.546146	0.13312	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00512	6.96;6.96;6.95;6.89;6.97;7.03	2.47	-1.16	0.09678	.	.	.	.	.	T	0.00468	0.0015	L	0.55017	1.72	0.09310	N	1	B;P;B;P;P	0.45715	0.006;0.63;0.057;0.583;0.865	B;B;B;B;B	0.42188	0.014;0.334;0.032;0.312;0.379	T	0.46205	-0.9208	9	0.62326	D	0.03	.	2.1281	0.03743	0.2532:0.43:0.0:0.3168	.	228;228;228;228;228	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	L	228	ENSP00000375616:P228L;ENSP00000270452:P228L;ENSP00000408995:P228L;ENSP00000375614:P228L;ENSP00000375613:P228L;ENSP00000401962:P228L	ENSP00000270452:P228L	P	+	2	0	LILRB4	59868089	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.284000	0.02793	-0.191000	0.10448	-0.192000	0.12808	CCC		0.557	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			
Unknown	0	broad.mit.edu	37	4	8951518	8951518	+	IGR	SNP	G	G	T			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr4:8951518G>T								HMX1 (77975 upstream) : AC073648.1 (73540 downstream)																							TCAGTATCCTGGCTGTCAGCT	0.582																																																	0													22.0	41.0	35.0					4																	8951518		686	1591	2277	SO:0001628	intergenic_variant	650293																															4.37:g.8951518G>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.582									
MXRA8	54587	broad.mit.edu	37	1	1289294	1289294	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr1:1289294T>A	ENST00000309212.6	-	9	1267	c.1237A>T	c.(1237-1239)Atc>Ttc	p.I413F	MXRA8_ENST00000342753.4_Missense_Mutation_p.I312F|MXRA8_ENST00000477278.2_Missense_Mutation_p.I404F|MXRA8_ENST00000445648.2_Missense_Mutation_p.I419F	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	413					establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.I413F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCCTTCAGGATGTTGTTTTTG	0.642																																																	1	Substitution - Missense(1)	kidney(1)											36.0	35.0	35.0					1																	1289294		2199	4296	6495	SO:0001583	missense	54587			BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.1237A>T	1.37:g.1289294T>A	ENSP00000307887:p.Ile413Phe	Somatic		WXS	Illumina GAIIx	Phase_I	B3KTR6|B4DE34|Q5TA39|Q96KC3	Missense_Mutation	SNP	ENST00000309212.6	37	CCDS24.1	.	.	.	.	.	.	.	.	.	.	.	14.91	2.677617	0.47886	.	.	ENSG00000162576	ENST00000309212;ENST00000378864;ENST00000342753;ENST00000445648	T;T;T	0.21361	2.03;2.09;2.01	3.85	2.68	0.31781	.	0.216427	0.37955	U	0.001862	T	0.41858	0.1177	M	0.72118	2.19	0.49687	D	0.999818	P;D;P;P	0.76494	0.845;0.999;0.944;0.906	B;D;P;B	0.83275	0.348;0.996;0.646;0.444	T	0.20940	-1.0260	10	0.72032	D	0.01	-13.3487	9.8531	0.41068	0.0:0.0:0.1723:0.8277	.	404;312;419;413	B3KTR6;B4DE34;Q9BRK3-2;Q9BRK3	.;.;.;MXRA8_HUMAN	F	413;404;312;419	ENSP00000307887:I413F;ENSP00000344998:I312F;ENSP00000399229:I419F	ENSP00000307887:I413F	I	-	1	0	MXRA8	1279157	1.000000	0.71417	0.995000	0.50966	0.502000	0.33828	3.884000	0.56175	0.459000	0.27016	0.459000	0.35465	ATC		0.642	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008282.2		NM_032348	
MYLK	4638	broad.mit.edu	37	3	123376191	123376191	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:123376191T>A	ENST00000475616.1	-	21	4069	c.4070A>T	c.(4069-4071)tAt>tTt	p.Y1357F	MYLK_ENST00000354792.5_Missense_Mutation_p.Y157F|MYLK_ENST00000360772.3_Missense_Mutation_p.Y1357F|MYLK_ENST00000346322.5_Missense_Mutation_p.Y1288F|MYLK_ENST00000360304.3_Missense_Mutation_p.Y1357F|MYLK_ENST00000359169.1_Missense_Mutation_p.Y1357F			Q15746	MYLK_HUMAN	myosin light chain kinase	1357	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.Y1357F(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GCCCCCATCATATGAGGAGCC	0.557																																																	1	Substitution - Missense(1)	kidney(1)											91.0	82.0	85.0					3																	123376191		2203	4300	6503	SO:0001583	missense	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4070A>T	3.37:g.123376191T>A	ENSP00000418335:p.Tyr1357Phe	Somatic		WXS	Illumina GAIIx	Phase_I	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463000	0.84425	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000354792;ENST00000475616;ENST00000508240	T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.16	5.65	5.65	0.86999	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60612	0.2282	L	0.56769	1.78	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.997;0.998;0.998;0.999	T	0.56553	-0.7960	9	0.31617	T	0.26	.	16.1587	0.81683	0.0:0.0:0.0:1.0	.	1357;1288;1357;1288;1357	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	F	1357;1357;1357;1288;157;1357;157	ENSP00000354004:Y1357F;ENSP00000353452:Y1357F;ENSP00000352088:Y1357F;ENSP00000320622:Y1288F;ENSP00000346846:Y157F;ENSP00000418335:Y1357F;ENSP00000422984:Y157F	ENSP00000320622:Y1288F	Y	-	2	0	MYLK	124858881	1.000000	0.71417	0.073000	0.20177	0.543000	0.35085	7.997000	0.88414	2.277000	0.76020	0.533000	0.62120	TAT		0.557	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1		NM_053025	
PLXNA1	5361	broad.mit.edu	37	3	126707544	126707544	+	Silent	SNP	T	T	G			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr3:126707544T>G	ENST00000393409.2	+	1	108	c.108T>G	c.(106-108)ggT>ggG	p.G36G	PLXNA1_ENST00000251772.4_Silent_p.G13G	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	36	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.G13G(4)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CAGGCGGGGGTTCACAGCCCC	0.682																																																	4	Substitution - coding silent(4)	lung(2)|kidney(2)											26.0	27.0	27.0					3																	126707544		2203	4300	6503	SO:0001819	synonymous_variant	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.108T>G	3.37:g.126707544T>G		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																				0.682	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1		NM_032242	
RP11-478B9.1	0	broad.mit.edu	37	12	45458035	45458035	+	RNA	SNP	C	C	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr12:45458035C>A	ENST00000548424.1	+	0	448																											ATCTCATTTACACAATGCACA	0.473																																																	0																																												83956																															12.37:g.45458035C>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000548424.1	37																																																																																					0.473	RP11-478B9.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000404811.1			
SMAP1	60682	broad.mit.edu	37	6	71508370	71508370	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr6:71508370delA	ENST00000370455.3	+	6	754	c.506delA	c.(505-507)gaafs	p.E169fs	SMAP1_ENST00000370452.3_Frame_Shift_Del_p.E142fs|SMAP1_ENST00000316999.5_Frame_Shift_Del_p.E142fs	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	169					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.K145fs*48(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						aaagaaaaggaaaaaaaaaag	0.289																																																	1	Deletion - Frameshift(1)	prostate(1)											23.0	28.0	26.0					6																	71508370		2184	4254	6438	SO:0001589	frameshift_variant	60682			AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.506delA	6.37:g.71508370delA	ENSP00000359484:p.Glu169fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Frame_Shift_Del	DEL	ENST00000370455.3	37	CCDS43478.1																																																																																				0.289	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1		NM_001044305	
ZNF793	390927	broad.mit.edu	37	19	38027920	38027920	+	Silent	SNP	G	G	A			TCGA-CJ-6033-01A-11D-1669-08	TCGA-CJ-6033-11A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7ce9042-f63c-4a93-a82d-f21977bd9bcb	6ddcf971-b6b2-4ea9-a14e-22451f4b519e	g.chr19:38027920G>A	ENST00000587143.1	+	6	595	c.360G>A	c.(358-360)ggG>ggA	p.G120G	ZNF793_ENST00000589319.1_Silent_p.G120G|ZNF793_ENST00000445217.1_Silent_p.G120G|ZNF793_ENST00000542455.1_Silent_p.G120G|ZNF793_ENST00000588578.1_3'UTR			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G120G(1)		kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATAAGTTTGGGAAAATATCAC	0.408																																					Melanoma(44;400 1431 1499 19093)												1	Substitution - coding silent(1)	kidney(1)											58.0	60.0	59.0					19																	38027920		1833	4095	5928	SO:0001819	synonymous_variant	390927			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.360G>A	19.37:g.38027920G>A		Somatic		WXS	Illumina GAIIx	Phase_I	E9PGN4|Q7Z3Q9	Silent	SNP	ENST00000587143.1	37	CCDS46062.1																																																																																				0.408	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1		NM_001013659	
