#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA12	26154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	215876834	215876834	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:215876834delT	ENST00000272895.7	-	16	2201	c.1982delA	c.(1981-1983)aagfs	p.K661fs	ABCA12_ENST00000389661.4_Frame_Shift_Del_p.K343fs	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	661					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTCTACTGGCTTTTGATCTTT	0.383																																					Ovarian(66;664 1488 5121 34295)												0													161.0	158.0	159.0					2																	215876834		2203	4300	6503	SO:0001589	frameshift_variant	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1982delA	2.37:g.215876834delT	ENSP00000272895:p.Lys661fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Frame_Shift_Del	DEL	ENST00000272895.7	37	CCDS33372.1																																																																																				0.383	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1		NM_173076	
ABCA7	10347	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	1044699	1044699	+	Missense_Mutation	SNP	G	G	A	rs35732553		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr19:1044699G>A	ENST00000263094.6	+	11	1402	c.1171G>A	c.(1171-1173)Gct>Act	p.A391T	ABCA7_ENST00000433129.1_Missense_Mutation_p.A391T|ABCA7_ENST00000435683.2_Missense_Mutation_p.A253T	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	391					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)	p.A391T(1)		NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACGCACACGCTGATGTGGG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											41.0	41.0	41.0					19																	1044699		2199	4299	6498	SO:0001583	missense	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1171G>A	19.37:g.1044699G>A	ENSP00000263094:p.Ala391Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724424	0.48728	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.86297	-2.1;-2.1	3.93	2.74	0.32292	.	.	.	.	.	D	0.85720	0.5762	L	0.57536	1.79	0.09310	N	1	P;P	0.51653	0.938;0.947	P;B	0.48654	0.585;0.256	T	0.75147	-0.3420	9	0.42905	T	0.14	.	6.9982	0.24795	0.1602:0.0:0.8398:0.0	.	253;391	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	T	391	ENSP00000263094:A391T;ENSP00000414062:A391T	ENSP00000263094:A391T	A	+	1	0	ABCA7	995699	0.000000	0.05858	0.003000	0.11579	0.180000	0.23129	0.380000	0.20602	0.826000	0.34661	0.455000	0.32223	GCT		0.672	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1		NM_019112	
ADAM11	4185	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	42854119	42854119	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:42854119C>G	ENST00000200557.6	+	19	1742	c.1573C>G	c.(1573-1575)Cct>Gct	p.P525A	ADAM11_ENST00000535346.1_Missense_Mutation_p.P325A	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	525	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P525A(2)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				ACAGTGCCCGCCTAACCTGCA	0.622																																																	2	Substitution - Missense(2)	kidney(2)											99.0	85.0	90.0					17																	42854119		2203	4300	6503	SO:0001583	missense	4185			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1573C>G	17.37:g.42854119C>G	ENSP00000200557:p.Pro525Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	C	8.264	0.811885	0.16537	.	.	ENSG00000073670	ENST00000200557;ENST00000535346;ENST00000355638	T;T	0.10477	2.87;2.87	4.45	4.45	0.53987	Blood coagulation inhibitor, Disintegrin (6);	0.135636	0.49916	D	0.000127	T	0.05914	0.0154	N	0.20328	0.56	0.41469	D	0.988097	B;B	0.23591	0.043;0.088	B;B	0.21917	0.037;0.021	T	0.36383	-0.9750	10	0.15066	T	0.55	.	6.244	0.20807	0.0:0.71:0.1906:0.0994	.	325;525	B4DKD2;O75078	.;ADA11_HUMAN	A	525;325;425	ENSP00000200557:P525A;ENSP00000443773:P325A	ENSP00000200557:P525A	P	+	1	0	ADAM11	40209645	0.683000	0.27633	1.000000	0.80357	0.300000	0.27592	3.139000	0.50577	2.313000	0.78055	0.297000	0.19635	CCT		0.622	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1		NM_002390	
AEBP1	165	hgsc.bcm.edu	37	7	44153693	44153693	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:44153693A>G	ENST00000223357.3	+	21	3615	c.3310A>G	c.(3310-3312)Aag>Gag	p.K1104E	AEBP1_ENST00000450684.2_Missense_Mutation_p.K679E	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1104	Glu-rich.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GTTTGGGACCAAGGTGGAGCC	0.587																																																	0													134.0	127.0	129.0					7																	44153693		2203	4300	6503	SO:0001583	missense	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3310A>G	7.37:g.44153693A>G	ENSP00000223357:p.Lys1104Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	A	0.468	-0.885879	0.02511	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	D;D	0.94576	-3.46;-2.91	4.15	-1.59	0.08453	.	4.702480	0.00644	N	0.000525	D	0.83069	0.5174	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.80645	-0.1290	10	0.02654	T	1	.	6.134	0.20221	0.2195:0.3911:0.3894:0.0	.	679;1104	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	E	1104;679	ENSP00000223357:K1104E;ENSP00000398878:K679E	ENSP00000223357:K1104E	K	+	1	0	AEBP1	44120218	0.002000	0.14202	0.000000	0.03702	0.013000	0.08279	-0.322000	0.08007	-0.626000	0.05596	-1.366000	0.01203	AAG		0.587	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2		NM_001129	
AEBP1	165	hgsc.bcm.edu;ucsc.edu	37	7	44153688	44153688	+	Missense_Mutation	SNP	G	G	A	rs567662804	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:44153688G>A	ENST00000223357.3	+	21	3610	c.3305G>A	c.(3304-3306)gGg>gAg	p.G1102E	AEBP1_ENST00000450684.2_Missense_Mutation_p.G677E	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1102	Glu-rich.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCCGAGTTTGGGACCAAGGTG	0.597													G|||	3	0.000599042	0.0	0.0	5008	,	,		14060	0.001		0.001	False		,,,				2504	0.001																0													132.0	125.0	128.0					7																	44153688		2203	4300	6503	SO:0001583	missense	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3305G>A	7.37:g.44153688G>A	ENSP00000223357:p.Gly1102Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	0.721	-0.783629	0.02907	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	D;D	0.98192	-4.78;-3.39	4.84	-1.8	0.07907	.	3.955080	0.00633	N	0.000488	D	0.93609	0.7959	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	D	0.89512	0.3772	10	0.02654	T	1	.	2.3648	0.04316	0.2024:0.3185:0.3433:0.1358	.	677;1102	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	E	1102;677	ENSP00000223357:G1102E;ENSP00000398878:G677E	ENSP00000223357:G1102E	G	+	2	0	AEBP1	44120213	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	-1.228000	0.02948	-0.145000	0.11294	-0.244000	0.11960	GGG		0.597	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2		NM_001129	
AEBP1	165	hgsc.bcm.edu;ucsc.edu	37	7	44153696	44153696	+	Missense_Mutation	SNP	G	G	T	rs538374901	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:44153696G>T	ENST00000223357.3	+	21	3618	c.3313G>T	c.(3313-3315)Gtg>Ttg	p.V1105L	AEBP1_ENST00000450684.2_Missense_Mutation_p.V680L	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1105	Glu-rich.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						TGGGACCAAGGTGGAGCCCGA	0.592													G|||	3	0.000599042	0.0	0.0	5008	,	,		14512	0.001		0.001	False		,,,				2504	0.001																0													137.0	128.0	131.0					7																	44153696		2203	4300	6503	SO:0001583	missense	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3313G>T	7.37:g.44153696G>T	ENSP00000223357:p.Val1105Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	3.756	-0.050585	0.07407	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	D;D	0.94613	-3.47;-2.95	4.15	-8.3	0.01005	.	21.479700	0.00166	N	0.000000	D	0.84924	0.5580	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.74281	-0.3716	10	0.38643	T	0.18	.	2.8348	0.05510	0.1361:0.3645:0.2487:0.2507	.	680;1105	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	L	1105;680	ENSP00000223357:V1105L;ENSP00000398878:V680L	ENSP00000223357:V1105L	V	+	1	0	AEBP1	44120221	0.001000	0.12720	0.006000	0.13384	0.061000	0.15899	-2.257000	0.01180	-1.153000	0.02829	-0.261000	0.10672	GTG		0.592	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2		NM_001129	
AEBP1	165	hgsc.bcm.edu	37	7	44153704	44153704	+	Silent	SNP	C	C	T	rs556336163	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:44153704C>T	ENST00000223357.3	+	21	3626	c.3321C>T	c.(3319-3321)ccC>ccT	p.P1107P	AEBP1_ENST00000450684.2_Silent_p.P682P	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1107	Glu-rich.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						AGGTGGAGCCCGAGTTTGAGA	0.597													C|||	3	0.000599042	0.0	0.0	5008	,	,		14756	0.001		0.0	False		,,,				2504	0.002																0													135.0	126.0	129.0					7																	44153704		2203	4300	6503	SO:0001819	synonymous_variant	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3321C>T	7.37:g.44153704C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	37	CCDS5476.1																																																																																				0.597	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2		NM_001129	
ALDOB	229	hgsc.bcm.edu;ucsc.edu	37	9	104192206	104192207	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:104192206_104192207insTT	ENST00000374855.4	-	3	278_279	c.154_155insAA	c.(154-156)actfs	p.T52fs	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	52					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				GTTCTCTTCAGTGTTTTCCACC	0.559																																																	0																																										SO:0001589	frameshift_variant	229			X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.154_155insAA	9.37:g.104192206_104192207insTT	ENSP00000363988:p.Thr52fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q13741|Q13742|Q5T7D6	Frame_Shift_Ins	INS	ENST00000374855.4	37	CCDS6756.1																																																																																				0.559	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2			
ANAPC1	64682	broad.mit.edu;hgsc.bcm.edu	37	2	112539971	112539971	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:112539971C>G	ENST00000341068.3	-	43	5949	c.5177G>C	c.(5176-5178)aGg>aCg	p.R1726T		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1726					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.R1726T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						TTCAGAGTTCCTGTTAGCAAC	0.433																																																	1	Substitution - Missense(1)	kidney(1)											13.0	14.0	14.0					2																	112539971		2172	4272	6444	SO:0001583	missense	64682			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.5177G>C	2.37:g.112539971C>G	ENSP00000339109:p.Arg1726Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	ENST00000341068.3	37	CCDS2093.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.72|14.72	2.619735|2.619735	0.46736|0.46736	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000427997|ENST00000341068	.|.	.|.	.|.	4.24|4.24	4.24|4.24	0.50183|0.50183	.|.	.|0.000000	.|0.52532	.|D	.|0.000065	T|T	0.50582|0.50582	0.1624|0.1624	L|L	0.53249|0.53249	1.67|1.67	0.41203|0.41203	D|D	0.986383|0.986383	.|B	.|0.34214	.|0.442	.|B	.|0.30029	.|0.11	T|T	0.51228|0.51228	-0.8732|-0.8732	5|9	.|0.17832	.|T	.|0.49	-14.0217|-14.0217	17.0094|17.0094	0.86401|0.86401	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1726	.|Q9H1A4	.|APC1_HUMAN	H|T	1260|1726	.|.	.|ENSP00000339109:R1726T	Q|R	-|-	3|2	2|0	ANAPC1|ANAPC1	112256442|112256442	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	3.084000|3.084000	0.50143|0.50143	2.060000|2.060000	0.61445|0.61445	0.484000|0.484000	0.47621|0.47621	CAG|AGG		0.433	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2		NM_022662	
ANKRD34C	390616	hgsc.bcm.edu;ucsc.edu	37	15	79587076	79587085	+	Frame_Shift_Del	DEL	TCTTGCTCTC	TCTTGCTCTC	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	TCTTGCTCTC	TCTTGCTCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr15:79587076_79587085delTCTTGCTCTC	ENST00000558647.2	+	1	1450_1459	c.1450_1459delTCTTGCTCTC	c.(1450-1461)tcttgctctcttfs	p.SCSL484fs	ANKRD34C_ENST00000421388.2_Frame_Shift_Del_p.SCSL484fs			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	484										endometrium(3)|kidney(1)|skin(1)	5						CAGCAAACCTTCTTGCTCTCTTGCTAGTGG	0.443																																																	0																																										SO:0001589	frameshift_variant	390616				CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1450_1459delTCTTGCTCTC	15.37:g.79587076_79587085delTCTTGCTCTC	ENSP00000454921:p.Ser484fs	Somatic		WXS	Illumina HiSeq	Phase_I	H3BNM1	Frame_Shift_Del	DEL	ENST00000558647.2	37	CCDS53965.1																																																																																				0.443	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2		NM_001146341	
AP3B2	8120	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	83349701	83349701	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr15:83349701delT	ENST00000261722.3	-	7	866	c.659delA	c.(658-660)aacfs	p.N220fs	AP3B2_ENST00000535348.1_Frame_Shift_Del_p.N188fs|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Frame_Shift_Del_p.N220fs	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	220					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			TTTCCGGTAGTTTTTGTGAAT	0.587																																																	0													51.0	58.0	56.0					15																	83349701		2100	4209	6309	SO:0001589	frameshift_variant	8120			U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.659delA	15.37:g.83349701delT	ENSP00000261722:p.Asn220fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Frame_Shift_Del	DEL	ENST00000261722.3	37	CCDS45331.1																																																																																				0.587	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1			
ATXN2L	11273	broad.mit.edu;ucsc.edu	37	16	28847500	28847500	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr16:28847500G>A	ENST00000336783.4	+	22	3309	c.3142G>A	c.(3142-3144)Gag>Aag	p.E1048K	ATXN2L_ENST00000382686.4_Intron|ATXN2L_ENST00000570200.1_Intron|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000564304.1_Intron|ATXN2L_ENST00000325215.6_Intron|ATXN2L_ENST00000395547.2_Intron|ATXN2L_ENST00000340394.8_Intron	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	1048					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)	p.E1048K(1)|p.?(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CAGGATTCGTGAGTTCTCATT	0.617																																																	2	Substitution - Missense(1)|Unknown(1)	kidney(2)											69.0	79.0	76.0					16																	28847500		2196	4300	6496	SO:0001583	missense	11273				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.3142G>A	16.37:g.28847500G>A	ENSP00000338718:p.Glu1048Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	37	CCDS10641.1	.	.	.	.	.	.	.	.	.	.	.	14.39	2.521920	0.44866	.	.	ENSG00000168488	ENST00000336783	T	0.47869	0.83	5.95	3.99	0.46301	.	.	.	.	.	T	0.23965	0.0580	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06625	-1.0816	8	.	.	.	.	8.281	0.31900	0.1742:0.0:0.8258:0.0	.	1048	Q8WWM7	ATX2L_HUMAN	K	1048	ENSP00000338718:E1048K	.	E	+	1	0	ATXN2L	28755001	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.711000	0.61881	1.523000	0.49018	0.563000	0.77884	GAG		0.617	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1		NM_007245	
ATXN3	4287	hgsc.bcm.edu;ucsc.edu	37	14	92537387	92537388	+	Missense_Mutation	DNP	TT	TT	GC	rs12896588|rs12896589|rs141993435		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr14:92537387_92537388TT>GC	ENST00000532032.1	-	10	891_892	c.882_883AA>GC	c.(880-885)caAAag>caGCag	p.K295Q	ATXN3_ENST00000429774.2_Missense_Mutation_p.K288Q|ATXN3_ENST00000503767.1_Missense_Mutation_p.K280Q|ATXN3_ENST00000545170.1_Missense_Mutation_p.K304Q|ATXN3_ENST00000393287.5_Missense_Mutation_p.K295Q|ATXN3_ENST00000340660.6_Missense_Mutation_p.K240Q|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000502250.1_Missense_Mutation_p.K116Q			P54252	ATX3_HUMAN	ataxin 3	295	Poly-Gln.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		tgttgctgcttttgctgctgTC	0.411																																					Esophageal Squamous(190;752 2094 29897 44875 49530)												0																																										SO:0001583	missense	4287			U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.882_883delinsGC	14.37:g.92537387_92537388delinsGC	ENSP00000437157:p.Lys295Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	Missense_Mutation	SNP	ENST00000532032.1	37																																																																																					0.411	ATXN3-015	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388065.1		NM_004993	
BIRC6	57448	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	32605236	32605236	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:32605236T>C	ENST00000421745.2	+	3	657	c.523T>C	c.(523-525)Tca>Cca	p.S175P	BIRC6-AS1_ENST00000455572.1_RNA	NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	175					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.S147P(1)|p.S175P(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCAGCTCTTATCAGCATGTTT	0.299																																					Pancreas(94;175 1509 16028 18060 45422)												2	Substitution - Missense(2)	kidney(2)											31.0	28.0	29.0					2																	32605236		2200	4294	6494	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.523T>C	2.37:g.32605236T>C	ENSP00000393596:p.Ser175Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	15.60	2.881229	0.51801	.	.	ENSG00000115760	ENST00000421745	T	0.75050	-0.9	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000002	T	0.68412	0.2998	L	0.36672	1.1	0.51767	D	0.999932	D	0.55385	0.971	B	0.44315	0.446	T	0.71241	-0.4651	10	0.46703	T	0.11	.	14.9192	0.70822	0.0:0.0:0.0:1.0	.	175	Q9NR09	BIRC6_HUMAN	P	175	ENSP00000393596:S175P	ENSP00000393596:S175P	S	+	1	0	BIRC6	32458740	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.991000	0.88244	1.914000	0.55421	0.460000	0.39030	TCA		0.299	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3		NM_016252	
BCL11A	53335	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	60780394	60780394	+	Silent	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:60780394G>A	ENST00000335712.6	-	1	239	c.12C>T	c.(10-12)cgC>cgT	p.R4R	BCL11A_ENST00000537768.1_5'UTR|BCL11A_ENST00000356842.4_Silent_p.R4R|BCL11A_ENST00000538214.1_Silent_p.R4R|BCL11A_ENST00000359629.5_Silent_p.R4R|BCL11A_ENST00000358510.4_Silent_p.R4R	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	4	Required for nuclear body formation and for SUMO1 recruitment. {ECO:0000250}.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.R4R(3)		NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGCCTTGCTTGCGGCGAGACA	0.597			T	IGH@	B-CLL																																			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	3	Substitution - coding silent(3)	kidney(3)											26.0	27.0	27.0					2																	60780394		2202	4299	6501	SO:0001819	synonymous_variant	53335			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.12C>T	2.37:g.60780394G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Silent	SNP	ENST00000335712.6	37	CCDS1862.1																																																																																				0.597	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2		NM_022893	
BMS1	9790	broad.mit.edu;hgsc.bcm.edu	37	10	43318590	43318590	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr10:43318590G>C	ENST00000374518.5	+	20	3220	c.3157G>C	c.(3157-3159)Gtg>Ctg	p.V1053L		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1053					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.V1053L(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGCCTTGGAAGTGGCCAAATT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											77.0	83.0	81.0					10																	43318590		2203	4300	6503	SO:0001583	missense	9790			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3157G>C	10.37:g.43318590G>C	ENSP00000363642:p.Val1053Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705026	0.88924	.	.	ENSG00000165733	ENST00000374518	T	0.28895	1.59	4.54	4.54	0.55810	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.53318	0.1789	M	0.92317	3.295	0.80722	D	1	P	0.41710	0.76	P	0.45538	0.484	T	0.68938	-0.5277	10	0.87932	D	0	.	17.7203	0.88349	0.0:0.0:1.0:0.0	.	1053	Q14692	BMS1_HUMAN	L	1053	ENSP00000363642:V1053L	ENSP00000363642:V1053L	V	+	1	0	BMS1	42638596	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.443000	0.97568	2.250000	0.74265	0.454000	0.30748	GTG		0.423	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2		NM_014753	
BRIP1	83990	broad.mit.edu;hgsc.bcm.edu	37	17	59820468	59820468	+	Missense_Mutation	SNP	C	C	T	rs200960251		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:59820468C>T	ENST00000259008.2	-	16	2552	c.2285G>A	c.(2284-2286)cGt>cAt	p.R762H	BRIP1_ENST00000577598.1_Missense_Mutation_p.R762H	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	762					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R762H(2)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						CACTTTACCACGACAAACTGC	0.388			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks					C|||	1	0.000199681	0.0	0.0	5008	,	,		17133	0.0		0.001	False		,,,				2504	0.0						yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	2	Substitution - Missense(2)	kidney(2)											97.0	88.0	91.0					17																	59820468		2203	4300	6503	SO:0001583	missense	83990			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.2285G>A	17.37:g.59820468C>T	ENSP00000259008:p.Arg762His	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	CCDS11631.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.93	2.977898	0.53720	.	.	ENSG00000136492	ENST00000259008	T	0.70986	-0.53	5.08	5.08	0.68730	Helicase, ATP-dependent, c2 type (1);	0.000000	0.85682	D	0.000000	D	0.89705	0.6792	H	0.96805	3.885	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93274	0.6654	9	.	.	.	-13.1256	17.4652	0.87630	0.0:1.0:0.0:0.0	.	762;762	C9JGZ0;Q9BX63	.;FANCJ_HUMAN	H	762	ENSP00000259008:R762H	.	R	-	2	0	BRIP1	57175250	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.162000	0.77515	2.360000	0.80028	0.557000	0.71058	CGT		0.388	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1		NM_032043	
C16orf62	57020	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	19641134	19641134	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr16:19641134C>G	ENST00000251143.5	+	18	1558	c.1546C>G	c.(1546-1548)Cat>Gat	p.H516D	C16orf62_ENST00000448695.1_Missense_Mutation_p.H366D|C16orf62_ENST00000543152.1_Missense_Mutation_p.H265D|C16orf62_ENST00000542263.1_Missense_Mutation_p.H538D|C16orf62_ENST00000438132.3_Missense_Mutation_p.H605D|C16orf62_ENST00000417362.2_Missense_Mutation_p.H449D			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	516						integral component of membrane (GO:0016021)		p.H516D(1)|p.H605D(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CACCTGCAAGCATTTCACGGT	0.338																																																	2	Substitution - Missense(2)	kidney(2)											247.0	208.0	221.0					16																	19641134		2197	4300	6497	SO:0001583	missense	57020				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1546C>G	16.37:g.19641134C>G	ENSP00000251143:p.His516Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	37		.	.	.	.	.	.	.	.	.	.	C	24.1	4.491948	0.84962	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.72277	0.3440	M	0.82323	2.585	0.80722	D	1	D;D	0.67145	0.989;0.996	D;D	0.77557	0.985;0.99	T	0.74337	-0.3698	9	.	.	.	-15.6406	18.8611	0.92271	0.0:1.0:0.0:0.0	.	538;516	F5H7K1;Q7Z3J2	.;CP062_HUMAN	D	605;538;516;449;366	ENSP00000400815:H605D;ENSP00000442468:H538D;ENSP00000251143:H516D;ENSP00000395973:H449D;ENSP00000398009:H366D	.	H	+	1	0	C16orf62	19548635	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.779000	0.75057	2.549000	0.85964	0.557000	0.71058	CAT		0.338	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_020314	
URI1	8725	hgsc.bcm.edu	37	19	30500143	30500143	+	Silent	SNP	T	T	C	rs1127493	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr19:30500143T>C	ENST00000542441.2	+	8	1215	c.918T>C	c.(916-918)gaT>gaC	p.D306D	URI1_ENST00000360605.4_Silent_p.D288D|URI1_ENST00000392271.1_Silent_p.D230D|URI1_ENST00000312051.6_Silent_p.D266D			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	306	Poly-Asp.				cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										atgatgatgatgacgacgacg	0.403													t|||	18	0.00359425	0.0091	0.0014	5008	,	,		19444	0.0		0.005	False		,,,				2504	0.0																0													110.0	87.0	95.0					19																	30500143		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.918T>C	19.37:g.30500143T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	37	CCDS12420.1																																																																																				0.403	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1		NM_134447	
C1orf101	257044	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	244715945	244715945	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:244715945T>A	ENST00000366534.4	+	9	912	c.858T>A	c.(856-858)agT>agA	p.S286R	C1orf101_ENST00000366533.4_Missense_Mutation_p.S286R|C1orf101_ENST00000473875.1_Intron|C1orf101_ENST00000366531.3_Missense_Mutation_p.S135R	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	286						CatSper complex (GO:0036128)		p.S286R(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AAAGACGGAGTGTGGCTCATG	0.408																																																	2	Substitution - Missense(2)	kidney(2)											175.0	162.0	167.0					1																	244715945		2203	4300	6503	SO:0001583	missense	257044			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.858T>A	1.37:g.244715945T>A	ENSP00000355492:p.Ser286Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	ENST00000366534.4	37	CCDS44340.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.452861	0.63290	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T	0.34472	1.37;1.37;1.36	5.6	-5.12	0.02893	.	0.672139	0.14932	N	0.290003	T	0.25044	0.0608	L	0.50333	1.59	0.09310	N	1	P;P;P	0.40431	0.717;0.634;0.634	B;B;B	0.40066	0.318;0.232;0.232	T	0.13872	-1.0493	10	0.72032	D	0.01	.	4.0676	0.09868	0.3384:0.3034:0.0:0.3582	.	206;286;286	B1AQM6;Q5SY80;Q5SY80-2	.;CA101_HUMAN;.	R	286;286;286;206;135	ENSP00000355492:S286R;ENSP00000355491:S286R;ENSP00000395796:S206R	ENSP00000355489:S135R	S	+	3	2	C1orf101	242782568	0.001000	0.12720	0.000000	0.03702	0.038000	0.13279	-0.754000	0.04787	-0.680000	0.05211	0.533000	0.62120	AGT		0.408	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1		NM_173807	
C2orf27A	29798	broad.mit.edu;hgsc.bcm.edu	37	2	132509139	132509139	+	Silent	SNP	C	C	T	rs374086974		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:132509139C>T	ENST00000355171.4	+	3	530	c.9C>T	c.(7-9)gtC>gtT	p.V3V		NM_013310.3	NP_037442.3	Q580R0	CB027_HUMAN	chromosome 2 open reading frame 27A	3								p.V3V(1)		kidney(1)	1						CAATGACAGTCAAGTGGAAAC	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											133.0	119.0	124.0					2																	132509139		2203	4300	6503	SO:0001819	synonymous_variant	29798			AF038169	CCDS2168.1	2q21.2	2010-05-11	2009-04-02	2009-04-02	ENSG00000197927	ENSG00000197927			25077	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 27"""	C2orf27		9110174, 8619474	Standard	NM_013310		Approved		uc002ttf.1	Q580R0	OTTHUMG00000131666	ENST00000355171.4:c.9C>T	2.37:g.132509139C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O43575|Q2M1X0|Q52M10|Q86XG2	Silent	SNP	ENST00000355171.4	37	CCDS2168.1																																																																																				0.373	C2orf27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254569.4		NM_013310	
TIMMDC1	51300	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	119217644	119217644	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:119217644G>C	ENST00000494664.1	+	1	266	c.64G>C	c.(64-66)Gtc>Ctc	p.V22L	TIMMDC1_ENST00000493694.1_Missense_Mutation_p.V22L|RP11-190C22.8_ENST00000609598.1_lincRNA	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	22						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.V22L(1)		autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						ATTTCCCCGAGTCTTTGCTGC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											126.0	135.0	132.0					3																	119217644		2203	4300	6503	SO:0001583	missense	0			AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.64G>C	3.37:g.119217644G>C	ENSP00000418803:p.Val22Leu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	ENST00000494664.1	37	CCDS33831.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741933	0.89573	.	.	ENSG00000113845	ENST00000494664;ENST00000493694;ENST00000466984	T;T;T	0.60797	1.03;0.33;0.16	5.12	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.54382	0.1855	M	0.68317	2.08	0.24208	N	0.995487	B	0.28880	0.226	B	0.31101	0.124	T	0.53443	-0.8438	10	0.51188	T	0.08	-13.7228	9.785	0.40670	0.0936:0.0:0.9064:0.0	.	22	Q9NPL8	TIDC1_HUMAN	L	22	ENSP00000418803:V22L;ENSP00000419510:V22L;ENSP00000420122:V22L	ENSP00000264244:V22L	V	+	1	0	TIMMDC1	120700334	0.981000	0.34729	0.710000	0.30468	0.621000	0.37620	2.762000	0.47597	1.521000	0.48983	0.650000	0.86243	GTC		0.582	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355077.3		NM_016589	
C5	727	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	123719562	123719562	+	Splice_Site	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:123719562C>T	ENST00000223642.1	-	39	4792		c.e39+1			NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5						activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.?(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	tgaatTCTCACCAGTTTTGTA	0.358																																																	1	Unknown(1)	kidney(1)											191.0	189.0	190.0					9																	123719562		2203	4300	6503	SO:0001630	splice_region_variant	727			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4762+1G>A	9.37:g.123719562C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q14CJ0|Q27I61	Splice_Site	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092920	0.76756	.	.	ENSG00000106804	ENST00000223642	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6803	0.77364	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C5	122759383	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	4.611000	0.61162	2.777000	0.95525	0.655000	0.94253	.		0.358	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1		NM_001735	Intron
CADM1	23705	hgsc.bcm.edu	37	11	115375030	115375035	+	In_Frame_Del	DEL	AGCCGG	AGCCGG	-	rs147879356	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	AGCCGG	AGCCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:115375030_115375035delAGCCGG	ENST00000452722.3	-	1	98_103	c.78_83delCCGGCT	c.(76-84)ctccggctt>ctt	p.26_28LRL>L	CADM1_ENST00000537058.1_In_Frame_Del_p.26_28LRL>L|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000542447.2_In_Frame_Del_p.26_28LRL>L|CADM1_ENST00000536727.1_In_Frame_Del_p.26_28LRL>L|CADM1_ENST00000331581.6_In_Frame_Del_p.26_28LRL>L	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CAACAGCAGAAGCCGGAGCCGGAGCC	0.694														28	0.00559105	0.0008	0.0101	5008	,	,		12001	0.0		0.0169	False		,,,				2504	0.0031																0									,	10,3820		3,4,1908					,	1.3	1.0		dbSNP_134	11	123,7449		13,97,3676	no	coding,coding	CADM1	NM_014333.3,NM_001098517.1	,	16,101,5584	A1A1,A1R,RR		1.6244,0.2611,1.1665	,	,		133,11269				SO:0001651	inframe_deletion	23705			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.78_83delCCGGCT	11.37:g.115375036_115375041delAGCCGG	ENSP00000395359:p.Leu26_Arg27del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000452722.3	37	CCDS8373.1																																																																																				0.694	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2		NM_014333	
CATSPER4	378807	broad.mit.edu;ucsc.edu	37	1	26524568	26524568	+	Splice_Site	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:26524568G>A	ENST00000456354.2	+	5	745	c.678G>A	c.(676-678)ctG>ctA	p.L226L		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	226					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.L226L(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		TCTTCATGCTGGTCAGTGCCT	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											182.0	166.0	171.0					1																	26524568		2203	4300	6503	SO:0001630	splice_region_variant	378807			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.678+1G>A	1.37:g.26524568G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A1A4W6|Q5VY71	Silent	SNP	ENST00000456354.2	37	CCDS30645.1																																																																																				0.602	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2		NM_198137	Silent
CCND2	894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	4385304	4385304	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:4385304C>G	ENST00000261254.3	+	2	598	c.329C>G	c.(328-330)tCc>tGc	p.S110C	RP11-264F23.3_ENST00000539135.1_RNA|RP11-264F23.4_ENST00000537370.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	110	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.S110C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			TTCCTGGCCTCCAAACTCAAA	0.577			T	IGL@	"""NHL,CLL"""																																			Dom	yes		12	12p13	894	cyclin D2		L	1	Substitution - Missense(1)	kidney(1)											75.0	66.0	69.0					12																	4385304		2203	4300	6503	SO:0001583	missense	894			AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.329C>G	12.37:g.4385304C>G	ENSP00000261254:p.Ser110Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	37	CCDS8524.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787179	0.90367	.	.	ENSG00000118971	ENST00000261254	T	0.13420	2.59	5.25	5.25	0.73442	Cyclin, N-terminal (1);Cyclin-like (3);	0.051151	0.85682	D	0.000000	T	0.40322	0.1112	M	0.78285	2.405	0.80722	D	1	D	0.55385	0.971	D	0.68353	0.957	T	0.29549	-1.0008	10	0.87932	D	0	.	17.8887	0.88865	0.0:1.0:0.0:0.0	.	110	P30279	CCND2_HUMAN	C	110	ENSP00000261254:S110C	ENSP00000261254:S110C	S	+	2	0	CCND2	4255565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.741000	0.84997	2.479000	0.83701	0.555000	0.69702	TCC		0.577	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1		NM_001759	
CCNJ	54619	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	97810064	97810064	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr10:97810064C>T	ENST00000265992.5	+	3	488	c.121C>T	c.(121-123)Cgg>Tgg	p.R41W	CCNJ_ENST00000403870.3_Missense_Mutation_p.R41W|ENTPD1-AS1_ENST00000451364.1_RNA|CCNJ_ENST00000465148.2_Missense_Mutation_p.R41W|CCNJ_ENST00000534974.1_Missense_Mutation_p.R41W|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000427846.1_RNA|ENTPD1-AS1_ENST00000458228.1_RNA	NM_001134375.1|NM_001134376.1|NM_019084.4	NP_001127847.1|NP_001127848.1|NP_061957.2	Q5T5M9	CCNJ_HUMAN	cyclin J	41	Cyclin N-terminal.					nucleus (GO:0005634)		p.R41W(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	11				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		AAGTCTCAGACGGTATTTTGC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											167.0	135.0	146.0					10																	97810064		2203	4300	6503	SO:0001583	missense	54619			AK001757	CCDS7445.1, CCDS44462.1, CCDS44463.1	10q23.33	2008-05-14			ENSG00000107443	ENSG00000107443			23434	protein-coding gene	gene with protein product						12477932	Standard	NM_019084		Approved	FLJ10895, bA690P14.1	uc010qoq.2	Q5T5M9	OTTHUMG00000018823	ENST00000265992.5:c.121C>T	10.37:g.97810064C>T	ENSP00000265992:p.Arg41Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z4E7|Q86XL1|Q9NV69	Missense_Mutation	SNP	ENST00000265992.5	37	CCDS7445.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.851763	0.71719	.	.	ENSG00000107443	ENST00000265992;ENST00000419934;ENST00000403870;ENST00000534974	T;T;T	0.12465	2.68;2.68;2.68	5.26	2.05	0.26809	Cyclin, N-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.37625	0.1010	M	0.85945	2.785	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;P;D	0.64687	0.917;0.882;0.928	T	0.36841	-0.9731	10	0.66056	D	0.02	-17.0914	13.7225	0.62737	0.6642:0.3358:0.0:0.0	.	41;41;41	Q5T5M9-3;Q5T5M9-2;Q5T5M9	.;.;CCNJ_HUMAN	W	41	ENSP00000265992:R41W;ENSP00000384498:R41W;ENSP00000441415:R41W	ENSP00000265992:R41W	R	+	1	2	CCNJ	97800054	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.345000	0.33953	0.170000	0.19704	0.644000	0.83932	CGG		0.478	CCNJ-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090166.3		NM_019084	
CCPG1	9236	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	55669238	55669238	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr15:55669238T>G	ENST00000310958.6	-	5	661	c.363A>C	c.(361-363)gaA>gaC	p.E121D	DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000569205.1_Missense_Mutation_p.E121D|CCPG1_ENST00000442196.3_Missense_Mutation_p.E121D|CCPG1_ENST00000425574.3_Missense_Mutation_p.E121D	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	121	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)		p.E121D(1)		autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		CAATGACAACTTCTTGATTTC	0.393																																																	1	Substitution - Missense(1)	kidney(1)											132.0	123.0	126.0					15																	55669238		1836	4089	5925	SO:0001583	missense	9236			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.363A>C	15.37:g.55669238T>G	ENSP00000311656:p.Glu121Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	ENST00000310958.6	37	CCDS42039.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399692	0.42512	.	.	ENSG00000256061	ENST00000310958;ENST00000442196;ENST00000425574	T;T;T	0.23950	3.34;3.34;1.88	5.31	2.94	0.34122	.	0.069103	0.56097	U	0.000031	T	0.37100	0.0991	L	0.57536	1.79	0.35268	D	0.780184	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.63488	0.915;0.915;0.915	T	0.45731	-0.9241	10	0.59425	D	0.04	.	3.9588	0.09401	0.0:0.2583:0.178:0.5638	.	121;121;121	A8K9T0;Q9ULG6-3;Q9ULG6	.;.;CCPG1_HUMAN	D	121	ENSP00000311656:E121D;ENSP00000403400:E121D;ENSP00000415128:E121D	ENSP00000311656:E121D	E	-	3	2	DYX1C1	53456530	0.995000	0.38212	0.274000	0.24659	0.272000	0.26649	0.388000	0.20735	0.311000	0.23014	0.528000	0.53228	GAA		0.393	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1		NM_004748	
CD101	9398	broad.mit.edu;ucsc.edu	37	1	117561137	117561137	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:117561137G>T	ENST00000256652.4	+	6	2030	c.1972G>T	c.(1972-1974)Gct>Tct	p.A658S	CD101_ENST00000369470.1_Missense_Mutation_p.A658S	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	658	Ig-like C2-type 6.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.A658S(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCCCCCGAGGGCTTCTGCCAT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											53.0	56.0	55.0					1																	117561137		2203	4300	6503	SO:0001583	missense	9398			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1972G>T	1.37:g.117561137G>T	ENSP00000256652:p.Ala658Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q15856	Missense_Mutation	SNP	ENST00000256652.4	37	CCDS891.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655672	0.47467	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.05447	3.44;3.44	5.02	5.02	0.67125	Immunoglobulin subtype (1);	0.305300	0.23610	N	0.046360	T	0.06781	0.0173	M	0.63428	1.95	0.24673	N	0.993402	P	0.51537	0.946	P	0.48952	0.596	T	0.06320	-1.0833	10	0.49607	T	0.09	-5.9469	13.716	0.62697	0.0:0.0:1.0:0.0	.	658	Q93033	IGSF2_HUMAN	S	658	ENSP00000256652:A658S;ENSP00000358482:A658S	ENSP00000256652:A658S	A	+	1	0	CD101	117362660	0.975000	0.34042	0.975000	0.42487	0.172000	0.22775	6.171000	0.71926	2.618000	0.88619	0.655000	0.94253	GCT		0.448	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1		NM_004258	
CENPL	91687	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	173780412	173780412	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:173780412G>C	ENST00000345664.6	-	2	239	c.26C>G	c.(25-27)tCa>tGa	p.S9*	Y_RNA_ENST00000516548.1_RNA|CENPL_ENST00000356198.2_Nonsense_Mutation_p.S9*|CENPL_ENST00000367710.3_Nonsense_Mutation_p.S9*	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	9					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.S9*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						ACTAGGAGTTGACTCTGGTGC	0.408																																																	1	Substitution - Nonsense(1)	kidney(1)											120.0	126.0	124.0					1																	173780412		2203	4300	6503	SO:0001587	stop_gained	91687			BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.26C>G	1.37:g.173780412G>C	ENSP00000323543:p.Ser9*	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TEL5|Q96ND4	Nonsense_Mutation	SNP	ENST00000345664.6	37	CCDS30938.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079473	0.36662	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	.	.	.	5.21	0.834	0.18880	.	1.825180	0.02817	N	0.125027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	8.7025	0.34334	0.3773:0.0:0.6227:0.0	.	.	.	.	X	9	.	ENSP00000323543:S9X	S	-	2	0	CENPL	172047035	0.003000	0.15002	0.000000	0.03702	0.138000	0.21146	0.565000	0.23578	0.218000	0.20820	0.561000	0.74099	TCA		0.408	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1		NM_033319	
CFHR3	10878	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	196749100	196749100	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:196749100G>T	ENST00000367425.4	+	3	519	c.427G>T	c.(427-429)Gtc>Ttc	p.V143F	CFHR3_ENST00000471440.2_Missense_Mutation_p.V143F|CFHR3_ENST00000391985.3_Missense_Mutation_p.V143F	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	143				V -> D (in Ref. 1; CAA48639). {ECO:0000305}.		blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.V143F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						ATGCATCCGTGTCAGTAAGTA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											80.0	79.0	80.0					1																	196749100		1904	4139	6043	SO:0001583	missense	10878			X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.427G>T	1.37:g.196749100G>T	ENSP00000356395:p.Val143Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPR0|Q9UJ16	Missense_Mutation	SNP	ENST00000367425.4	37	CCDS30958.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923466	0.33908	.	.	ENSG00000116785	ENST00000367425;ENST00000471440;ENST00000391985;ENST00000542253	T;T;T	0.74947	0.6;0.6;-0.89	3.67	-4.29	0.03721	Complement control module (1);	.	.	.	.	T	0.64897	0.2640	N	0.24115	0.695	0.09310	N	1	P;D;D	0.69078	0.617;0.997;0.996	B;D;P	0.65987	0.423;0.94;0.7	T	0.57740	-0.7759	9	0.15952	T	0.53	.	0.9706	0.01415	0.4591:0.1648:0.2095:0.1666	.	143;143;143	B4DPR0;Q02985;Q6NSD3	.;FHR3_HUMAN;.	F	143	ENSP00000356395:V143F;ENSP00000436258:V143F;ENSP00000375845:V143F	ENSP00000356395:V143F	V	+	1	0	CFHR3	195015723	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.756000	0.04777	-0.317000	0.08677	0.398000	0.26397	GTC		0.478	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087505.2		NM_021023	
CHRNA9	55584	hgsc.bcm.edu	37	4	40356041	40356041	+	Missense_Mutation	SNP	C	C	T	rs55633891	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr4:40356041C>T	ENST00000310169.2	+	5	1083	c.944C>T	c.(943-945)gCg>gTg	p.A315V		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	315			A -> V (in dbSNP:rs55633891).		detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	GCCTCCACTGCGTTGACCATC	0.502													C|||	710	0.141773	0.1241	0.1124	5008	,	,		21268	0.1468		0.164	False		,,,				2504	0.1585				Esophageal Squamous(115;1297 1602 22235 25158 43327)												0								C	VAL/ALA	630,3776	271.3+/-270.1	48,534,1621	129.0	132.0	131.0		944	4.9	1.0	4	dbSNP_129	131	1127,7473	233.6+/-266.8	77,973,3250	yes	missense	CHRNA9	NM_017581.2	64	125,1507,4871	TT,TC,CC		13.1047,14.2987,13.5091	benign	315/480	40356041	1757,11249	2203	4300	6503	SO:0001583	missense	55584			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.944C>T	4.37:g.40356041C>T	ENSP00000312663:p.Ala315Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	CCDS3459.1	314	0.14377289377289376	63	0.12804878048780488	33	0.09116022099447514	94	0.16433566433566432	124	0.16358839050131926	C	11.56	1.674234	0.29693	0.142987	0.131047	ENSG00000174343	ENST00000310169	D	0.83673	-1.75	5.72	4.87	0.63330	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.155728	0.64402	D	0.000019	T	0.00496	0.0016	N	0.05031	-0.125	0.09310	P	0.999999809154	P	0.44659	0.84	P	0.45343	0.477	T	0.48547	-0.9026	9	0.02654	T	1	.	14.1356	0.65287	0.0:0.9283:0.0:0.0717	rs55633891	315	Q9UGM1	ACHA9_HUMAN	V	315	ENSP00000312663:A315V	ENSP00000312663:A315V	A	+	2	0	CHRNA9	40050798	1.000000	0.71417	0.999000	0.59377	0.870000	0.49936	5.772000	0.68889	2.709000	0.92574	0.561000	0.74099	GCG		0.502	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1			
CLASP1	23332	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	122206531	122206531	+	Silent	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:122206531T>C	ENST00000263710.4	-	17	2078	c.1689A>G	c.(1687-1689)ctA>ctG	p.L563L	CLASP1_ENST00000541859.1_Silent_p.L332L|CLASP1_ENST00000455322.2_Silent_p.L563L|CLASP1_ENST00000397587.3_Silent_p.L563L|CLASP1_ENST00000541377.1_Silent_p.L563L|CLASP1_ENST00000409078.3_Silent_p.L563L|CLASP1_ENST00000545861.1_Silent_p.L331L	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	563	Ser-rich.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)	p.L563L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					TCTCTTACTTTAGACTCTCTT	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											72.0	71.0	72.0					2																	122206531		1911	4129	6040	SO:0001819	synonymous_variant	23332			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1689A>G	2.37:g.122206531T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Silent	SNP	ENST00000263710.4	37																																																																																					0.418	CLASP1-201	KNOWN	basic	protein_coding	protein_coding			NM_015282	
CNOT2	4848	hgsc.bcm.edu	37	12	70747694	70747694	+	Stop_Codon_Del	DEL	A	A	-	rs139438633		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:70747694delA	ENST00000418359.3	+	0	2073				CNOT2_ENST00000229195.3_Stop_Codon_Del|CNOT2_ENST00000551483.1_Stop_Codon_Del	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			CAAGCCTTCTaaaaaaaaaaa	0.398																																																	0													37.0	42.0	40.0					12																	70747694		2202	4299	6501	SO:0001567	stop_retained_variant	4848			AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		Exception_encountered	12.37:g.70747694delA		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Frame_Shift_Del	DEL	ENST00000418359.3	37	CCDS31857.1																																																																																				0.398	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1			
COASY	80347	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	40715086	40715086	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:40715086C>T	ENST00000393818.2	+	1	902	c.446C>T	c.(445-447)tCg>tTg	p.S149L	COASY_ENST00000590958.1_Missense_Mutation_p.S178L|COASY_ENST00000449624.1_5'UTR|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000421097.2_Missense_Mutation_p.S149L|COASY_ENST00000420359.1_Missense_Mutation_p.S149L	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	149					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)	p.S149L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CGACTGGCCTCGGTGCTGCTA	0.597																																																	1	Substitution - Missense(1)	kidney(1)											122.0	115.0	117.0					17																	40715086		2203	4300	6503	SO:0001583	missense	80347			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.446C>T	17.37:g.40715086C>T	ENSP00000377406:p.Ser149Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	37	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865259	0.91511	.	.	ENSG00000068120	ENST00000421097;ENST00000420359;ENST00000393818	T;T;T	0.35421	1.46;1.31;1.31	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.50429	0.1615	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.72338	0.977;0.645	T	0.51252	-0.8729	10	0.87932	D	0	-12.5587	17.0344	0.86470	0.0:1.0:0.0:0.0	.	178;149	Q13057-2;Q13057	.;COASY_HUMAN	L	178;149;149	ENSP00000393564:S178L;ENSP00000413338:S149L;ENSP00000377406:S149L	ENSP00000377406:S149L	S	+	2	0	COASY	37968612	1.000000	0.71417	0.123000	0.21794	0.514000	0.34195	5.641000	0.67881	2.630000	0.89119	0.561000	0.74099	TCG		0.597	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1		NM_025233	
COL9A2	1298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	40777201	40777201	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:40777201delG	ENST00000372748.3	-	10	586	c.490delC	c.(490-492)cagfs	p.Q164fs		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	164	Nonhelical region 4 (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TCCAGACCCTGGATGGTTCCC	0.652																																																	0													71.0	74.0	73.0					1																	40777201		2203	4300	6503	SO:0001589	frameshift_variant	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.490delC	1.37:g.40777201delG	ENSP00000361834:p.Gln164fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMP9	Frame_Shift_Del	DEL	ENST00000372748.3	37	CCDS450.1																																																																																				0.652	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3		NM_001852	
CSF2RA	1438	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	1413322	1413322	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:1413322G>T	ENST00000381524.3	+	8	934	c.748G>T	c.(748-750)Gac>Tac	p.D250Y	CSF2RA_ENST00000494969.2_Intron|BX649553.2_ENST00000578699.1_RNA|CSF2RA_ENST00000501036.2_Missense_Mutation_p.D117Y|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000498153.1_3'UTR|BX649553.1_ENST00000583047.1_RNA|CSF2RA_ENST00000417535.2_Missense_Mutation_p.D250Y|CSF2RA_ENST00000361536.3_Missense_Mutation_p.D250Y|CSF2RA_ENST00000381529.3_Missense_Mutation_p.D250Y|CSF2RA_ENST00000432318.2_Missense_Mutation_p.D250Y|CSF2RA_ENST00000381509.3_Missense_Mutation_p.D250Y|CSF2RA_ENST00000381500.1_Missense_Mutation_p.D250Y|MIR3690_ENST00000580266.1_RNA|BX649553.4_ENST00000580687.1_RNA|CSF2RA_ENST00000355432.3_Missense_Mutation_p.D250Y|CSF2RA_ENST00000355805.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	250	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.D250Y(3)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GTCGTACCTGGACTTTCAGTA	0.612																																					Esophageal Squamous(131;723 1707 25334 40494 41806)												3	Substitution - Missense(3)	kidney(3)											269.0	216.0	234.0					X																	1413322		2203	4296	6499	SO:0001583	missense	1438			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.748G>T	X.37:g.1413322G>T	ENSP00000370935:p.Asp250Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	ENST00000381524.3	37	CCDS35191.1	.	.	.	.	.	.	.	.	.	.	.	12.16	1.853760	0.32791	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000381507;ENST00000501036;ENST00000381524;ENST00000381509;ENST00000355432;ENST00000417535;ENST00000381500	D;D;D;D;D;D;D;D;D	0.95918	-3.85;-3.85;-2.06;-2.06;-3.85;-3.85;-2.06;-3.85;-2.06	1.54	1.54	0.23209	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.829873	0.09880	U	0.743750	D	0.96119	0.8735	.	.	.	0.09310	N	1	D;D;D;D;D	0.67145	0.996;0.99;0.993;0.991;0.984	P;P;P;P;P	0.62560	0.904;0.527;0.78;0.718;0.527	D	0.88373	0.2996	9	0.62326	D	0.03	.	6.3374	0.21304	0.0:0.0:1.0:0.0	.	250;250;250;250;250	P15509-2;A7J003;P15509-3;P15509-5;P15509	.;.;.;.;CSF2R_HUMAN	Y	250;250;250;250;117;250;250;250;250;250	ENSP00000370940:D250Y;ENSP00000416437:D250Y;ENSP00000354836:D250Y;ENSP00000440491:D117Y;ENSP00000370935:D250Y;ENSP00000370920:D250Y;ENSP00000347606:D250Y;ENSP00000394227:D250Y;ENSP00000370911:D250Y	ENSP00000347606:D250Y	D	+	1	0	CSF2RA	1373322	0.020000	0.18652	0.054000	0.19295	0.259000	0.26198	1.450000	0.35134	0.818000	0.34468	0.100000	0.15512	GAC		0.612	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2			
DNAH2	146754	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7727491	7727491	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:7727491G>C	ENST00000572933.1	+	76	12991	c.11531G>C	c.(11530-11532)gGt>gCt	p.G3844A	DNAH2_ENST00000389173.2_Missense_Mutation_p.G3844A			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3844	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G3844A(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGTCCCCTGGTGTGGACCCC	0.637																																																	1	Substitution - Missense(1)	kidney(1)											83.0	73.0	77.0					17																	7727491		2203	4300	6503	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11531G>C	17.37:g.7727491G>C	ENSP00000458355:p.Gly3844Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.393868	0.83011	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.50277	0.75	4.9	4.9	0.64082	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.81456	0.4826	H	0.99026	4.405	0.80722	D	1	D;D	0.69078	0.993;0.997	D;D	0.74348	0.971;0.983	D	0.89629	0.3854	10	0.87932	D	0	.	16.833	0.85949	0.0:0.0:1.0:0.0	.	3805;3844	Q9P225-2;Q9P225	.;DYH2_HUMAN	A	3805;3844	ENSP00000373825:G3844A	ENSP00000353818:G3805A	G	+	2	0	DNAH2	7668216	1.000000	0.71417	0.372000	0.25991	0.940000	0.58332	8.994000	0.93529	2.281000	0.76405	0.407000	0.27541	GGT		0.637	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1		NM_020877	
DRD3	1814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	113858457	113858457	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:113858457C>G	ENST00000460779.1	-	6	902	c.613G>C	c.(613-615)Gtc>Ctc	p.V205L	DRD3_ENST00000383673.2_Missense_Mutation_p.V205L|DRD3_ENST00000467632.1_Missense_Mutation_p.V205L|DRD3_ENST00000295881.7_Missense_Mutation_p.V205L	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	205					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)	p.V205L(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TAGACAAGGACAGTCACTCCA	0.507																																																	1	Substitution - Missense(1)	kidney(1)											189.0	177.0	181.0					3																	113858457		2203	4300	6503	SO:0001583	missense	1814				CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.613G>C	3.37:g.113858457C>G	ENSP00000419402:p.Val205Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	C	4.023	0.001802	0.07819	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42	5.12	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.066861	0.64402	D	0.000009	T	0.32585	0.0834	N	0.01535	-0.81	0.54753	D	0.999984	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.40942	-0.9536	10	0.02654	T	1	.	11.7225	0.51691	0.0:0.7174:0.2826:0.0	.	205;205;205;205	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	L	205	ENSP00000419402:V205L;ENSP00000420662:V205L;ENSP00000373169:V205L;ENSP00000295881:V205L	ENSP00000281274:V205L	V	-	1	0	DRD3	115341147	1.000000	0.71417	0.920000	0.36463	0.515000	0.34225	4.464000	0.60134	2.658000	0.90341	0.655000	0.94253	GTC		0.507	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1		NM_000796.3	
EFEMP2	30008	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	65635794	65635794	+	Missense_Mutation	SNP	C	C	T	rs113167523	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:65635794C>T	ENST00000307998.6	-	9	1176	c.946G>A	c.(946-948)Gtg>Atg	p.V316M	EFEMP2_ENST00000532648.1_5'Flank|EFEMP2_ENST00000528176.1_Missense_Mutation_p.V316M	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	316	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)	p.V316M(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		TAGGGCTCCACGCAGCGGTTG	0.587																																																	1	Substitution - Missense(1)	kidney(1)											45.0	41.0	42.0					11																	65635794		2201	4296	6497	SO:0001583	missense	30008			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.946G>A	11.37:g.65635794C>T	ENSP00000309953:p.Val316Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	37	CCDS8116.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823357	0.32237	.	.	ENSG00000172638	ENST00000531645;ENST00000528176;ENST00000307998	D;D;D	0.91792	-2.91;-2.91;-2.91	4.98	1.78	0.24846	Epidermal growth factor-like (1);EGF-like calcium-binding (1);	0.534318	0.15382	N	0.265264	D	0.83358	0.5237	N	0.12853	0.265	0.26681	N	0.971538	D;P	0.59767	0.986;0.881	P;B	0.45794	0.493;0.163	T	0.76440	-0.2958	10	0.52906	T	0.07	.	6.5407	0.22378	0.3363:0.3832:0.2805:0.0	.	316;316	E9PRU1;O95967	.;FBLN4_HUMAN	M	32;316;316	ENSP00000436521:V32M;ENSP00000434151:V316M;ENSP00000309953:V316M	ENSP00000309953:V316M	V	-	1	0	EFEMP2	65392370	0.995000	0.38212	0.996000	0.52242	0.023000	0.10783	1.698000	0.37794	1.071000	0.40834	0.455000	0.32223	GTG		0.587	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4		NM_016938	
EIF2AK2	5610	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	37347219	37347219	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:37347219C>G	ENST00000233057.4	-	13	1453	c.1131G>C	c.(1129-1131)tgG>tgC	p.W377C	EIF2AK2_ENST00000395127.2_Missense_Mutation_p.W377C|EIF2AK2_ENST00000405334.1_Missense_Mutation_p.W336C	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	377	Interaction with TRAF5.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)	p.W377C(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				TTTTTTCAATCCATTGTTCCA	0.328																																																	1	Substitution - Missense(1)	kidney(1)											84.0	82.0	83.0					2																	37347219		2203	4300	6503	SO:0001583	missense	5610			BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.1131G>C	2.37:g.37347219C>G	ENSP00000233057:p.Trp377Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Missense_Mutation	SNP	ENST00000233057.4	37	CCDS1786.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244241	0.39697	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334;ENST00000379156	T;T;T	0.64991	-0.13;-0.13;-0.13	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.136878	0.34362	N	0.004040	T	0.74160	0.3680	L	0.43646	1.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.76005	-0.3117	10	0.72032	D	0.01	-9.9498	18.0447	0.89328	0.0:1.0:0.0:0.0	.	377;377;377;336	Q8IW76;B7ZKK7;P19525;E9PC80	.;.;E2AK2_HUMAN;.	C	377;377;336;324	ENSP00000233057:W377C;ENSP00000378559:W377C;ENSP00000385014:W336C	ENSP00000233057:W377C	W	-	3	0	EIF2AK2	37200723	1.000000	0.71417	0.895000	0.35142	0.013000	0.08279	4.923000	0.63412	2.636000	0.89361	0.650000	0.86243	TGG		0.328	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2		NM_002759	
ENPP3	5169	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	131971248	131971248	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:131971248G>C	ENST00000414305.1	+	4	564	c.236G>C	c.(235-237)gGt>gCt	p.G79A	ENPP3_ENST00000358229.5_Missense_Mutation_p.G79A|ENPP3_ENST00000543135.1_Missense_Mutation_p.G45A|ENPP3_ENST00000427148.2_Missense_Mutation_p.G45A|ENPP3_ENST00000357639.3_Missense_Mutation_p.G79A|ENPP3_ENST00000470930.1_3'UTR			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	79	SMB 1. {ECO:0000255|PROSITE- ProRule:PRU00350}.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.G79A(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AAAGACCGAGGTGATTGCTGC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											221.0	215.0	217.0					6																	131971248		2203	4300	6503	SO:0001583	missense	5169			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.236G>C	6.37:g.131971248G>C	ENSP00000406261:p.Gly79Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	37	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881299	0.33255	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.7	3.65	0.41850	Somatomedin B domain (4);	0.652062	0.14829	N	0.296019	T	0.46580	0.1400	M	0.85373	2.75	0.09310	N	0.999991	D	0.53619	0.961	P	0.56216	0.794	T	0.50541	-0.8816	10	0.62326	D	0.03	-2.9857	3.1244	0.06402	0.1692:0.0:0.5672:0.2636	.	79	O14638	ENPP3_HUMAN	A	79;79;45;45;79	ENSP00000406261:G79A;ENSP00000350265:G79A;ENSP00000440810:G45A;ENSP00000399269:G45A;ENSP00000350964:G79A	ENSP00000350265:G79A	G	+	2	0	ENPP3	132012941	0.269000	0.24143	0.766000	0.31476	0.362000	0.29581	2.315000	0.43752	1.378000	0.46305	0.557000	0.71058	GGT		0.413	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2			
ERBB4	2066	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	212587123	212587123	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:212587123C>A	ENST00000342788.4	-	7	1188	c.878G>T	c.(877-879)tGt>tTt	p.C293F	ERBB4_ENST00000484474.1_5'Flank|ERBB4_ENST00000436443.1_Missense_Mutation_p.C293F|ERBB4_ENST00000402597.1_Missense_Mutation_p.C293F	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	293	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.C293F(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CTTACGTGGACATTTCTTGAC	0.323										TSP Lung(8;0.080)																																							1	Substitution - Missense(1)	kidney(1)											157.0	143.0	147.0					2																	212587123		2203	4300	6503	SO:0001583	missense	2066			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.878G>T	2.37:g.212587123C>A	ENSP00000342235:p.Cys293Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.563384|4.563384	0.86335|0.86335	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.70399|.	-0.48;-0.48;-0.48|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88463|0.88463	0.6443|0.6443	H|H	0.96111|0.96111	3.77|3.77	0.80722|0.80722	D|D	1|1	D;D;P;D;D|.	0.89917|.	1.0;0.999;0.916;1.0;1.0|.	D;D;P;D;D|.	0.97110|.	0.999;0.99;0.785;0.999;1.0|.	D|D	0.91549|0.91549	0.5255|0.5255	9|5	.|.	.|.	.|.	.|.	19.7763|19.7763	0.96395|0.96395	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	293;293;152;293;293|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	F|F	293|293	ENSP00000342235:C293F;ENSP00000403204:C293F;ENSP00000385565:C293F|.	.|.	C|V	-|-	2|1	0|0	ERBB4|ERBB4	212295368|212295368	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	7.756000|7.756000	0.85195|0.85195	2.684000|2.684000	0.91462|0.91462	0.650000|0.650000	0.86243|0.86243	TGT|GTC		0.323	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1		NM_001042599	
FCGR3A	2214	broad.mit.edu;hgsc.bcm.edu	37	1	161599725	161599725	+	Intron	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:161599725C>T	ENST00000540048.1	-	2	94				FCGR3B_ENST00000367964.2_Silent_p.E54E|FCGR2B_ENST00000428605.2_Intron|FCGR3B_ENST00000294800.3_Silent_p.E54E|FCGR2B_ENST00000403078.3_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR3B_ENST00000531221.1_Silent_p.E90E|FCGR2B_ENST00000367962.4_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E54E(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGGAATTGTCCTCAGGGGAGT	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											66.0	70.0	68.0					1																	161599725		2162	4296	6458	SO:0001627	intron_variant	2215			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+432G>A	1.37:g.161599725C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Silent	SNP	ENST00000540048.1	37		.	.	.	.	.	.	.	.	.	.	C	1.939	-0.443986	0.04604	.	.	ENSG00000162747	ENST00000421702	.	.	.	2.79	-0.634	0.11516	.	.	.	.	.	T	0.09774	0.0240	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35101	-0.9802	4	.	.	.	.	5.2065	0.15293	0.0:0.4136:0.0:0.5864	.	.	.	.	R	75	.	.	G	-	1	0	FCGR3B	159866349	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.997000	0.03705	0.018000	0.15052	-0.529000	0.04317	GGA		0.527	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_000569	
FER1L6	654463	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	125052244	125052244	+	Silent	SNP	A	A	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr8:125052244A>T	ENST00000522917.1	+	20	2792	c.2586A>T	c.(2584-2586)acA>acT	p.T862T	FER1L6-AS1_ENST00000518567.1_RNA|RP11-959I15.4_ENST00000522005.1_RNA|FER1L6_ENST00000399018.1_Silent_p.T862T	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	862	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)		p.T862T(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GCCAGACAACAAAGGTAACCA	0.527																																																	1	Substitution - coding silent(1)	kidney(1)											81.0	81.0	81.0					8																	125052244		2006	4175	6181	SO:0001819	synonymous_variant	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2586A>T	8.37:g.125052244A>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																				0.527	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1		NM_001039112	
FERMT1	55612	broad.mit.edu;ucsc.edu	37	20	6069695	6069695	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr20:6069695A>C	ENST00000217289.4	-	10	1969	c.1181T>G	c.(1180-1182)tTt>tGt	p.F394C	FERMT1_ENST00000536936.1_Missense_Mutation_p.F137C|FERMT1_ENST00000478194.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	394	FERM.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)		p.F394C(2)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						TTTAAAGATAAACCAATATTG	0.353																																																	2	Substitution - Missense(2)	kidney(2)											140.0	150.0	147.0					20																	6069695		2203	4300	6503	SO:0001583	missense	55612			AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1181T>G	20.37:g.6069695A>C	ENSP00000217289:p.Phe394Cys	Somatic		WXS	Illumina GAIIx	Phase_I	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	37	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	a	7.167	0.586815	0.13749	.	.	ENSG00000101311	ENST00000217289;ENST00000536936;ENST00000339538	D;D	0.97665	-4.48;-4.48	5.75	5.75	0.90469	Band 4.1 domain (1);FERM central domain (2);Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.95990	0.8694	L	0.49778	1.585	0.80722	D	1	B;B	0.33044	0.343;0.395	B;B	0.40009	0.25;0.316	D	0.95078	0.8210	10	0.34782	T	0.22	-22.3035	16.0768	0.80974	1.0:0.0:0.0:0.0	.	394;394	Q9BQL6-4;Q9BQL6	.;FERM1_HUMAN	C	394;137;394	ENSP00000217289:F394C;ENSP00000441063:F137C	ENSP00000217289:F394C	F	-	2	0	FERMT1	6017695	1.000000	0.71417	0.954000	0.39281	0.209000	0.24338	5.881000	0.69706	2.205000	0.71048	0.449000	0.29647	TTT		0.353	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2		NM_017671	
MROH5	389690	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	142444934	142444934	+	RNA	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr8:142444934T>C	ENST00000606664.1	+	0	290				MROH5_ENST00000430863.1_RNA																							CTATGAAGAGTGTCACCCAGG	0.627																																																	0													74.0	82.0	79.0					8																	142444934		2079	4191	6270			0																															8.37:g.142444934T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000606664.1	37																																																																																					0.627	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000470872.1			
FSD1L	83856	broad.mit.edu;ucsc.edu	37	9	108223895	108223895	+	Splice_Site	SNP	A	A	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:108223895A>G	ENST00000481272.1	+	2	229	c.110A>G	c.(109-111)cAg>cGg	p.Q37R	FSD1L_ENST00000539376.1_Intron|FSD1L_ENST00000374710.3_Intron|FSD1L_ENST00000480279.1_Intron|FSD1L_ENST00000374716.4_Intron|FSD1L_ENST00000495708.1_Splice_Site_p.Q37R|FSD1L_ENST00000484973.1_Intron|FSD1L_ENST00000394926.3_Intron	NM_001145313.1	NP_001138785.1	Q9BXM9	FSD1L_HUMAN	fibronectin type III and SPRY domain containing 1-like	37								p.Q37R(1)		NS(1)|endometrium(1)	2						AACTTGCAGCAGGTTGGTAGC	0.363																																																	1	Substitution - Missense(1)	kidney(1)											162.0	141.0	147.0					9																	108223895		692	1591	2283	SO:0001630	splice_region_variant	83856			AF316830	CCDS6765.2, CCDS47999.1, CCDS6765.3, CCDS75870.1	9q31	2013-02-11	2006-03-10	2006-03-10	ENSG00000106701	ENSG00000106701		"""Fibronectin type III domain containing"""	13753	protein-coding gene	gene with protein product		609829	"""cystatin and DUF19 domain containing 1"", ""coiled-coil domain containing 10"""	CSDUFD1, CCDC10, FSD1NL, FSD1CL		11267680	Standard	XM_005252254		Approved		uc004bcq.2	Q9BXM9	OTTHUMG00000020426	ENST00000481272.1:c.111+1A>G	9.37:g.108223895A>G		Somatic		WXS	Illumina GAIIx	Phase_I	A2A338|A6NKH7|B7Z5S6|B7Z5W3|Q5T879|Q5T880	Missense_Mutation	SNP	ENST00000481272.1	37	CCDS47999.1	.	.	.	.	.	.	.	.	.	.	A	7.661	0.684904	0.14973	.	.	ENSG00000106701	ENST00000495708;ENST00000481272	T;T	0.45668	0.89;0.89	2.61	2.61	0.31194	.	.	.	.	.	T	0.17874	0.0429	N	0.02539	-0.55	0.20703	N	0.999863	B	0.02656	0.0	B	0.04013	0.001	T	0.12116	-1.0560	9	0.42905	T	0.14	.	7.0571	0.25106	1.0:0.0:0.0:0.0	.	37	Q9BXM9	FSD1L_HUMAN	R	37	ENSP00000420624:Q37R;ENSP00000417492:Q37R	ENSP00000417492:Q37R	Q	+	2	0	FSD1L	107263716	0.000000	0.05858	0.006000	0.13384	0.149000	0.21700	0.507000	0.22675	1.428000	0.47296	0.460000	0.39030	CAG		0.363	FSD1L-007	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349935.1		NM_207647	Missense_Mutation
GAP43	2596	broad.mit.edu;hgsc.bcm.edu	37	3	115395305	115395305	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:115395305C>T	ENST00000305124.6	+	2	842	c.476C>T	c.(475-477)gCc>gTc	p.A159V	GAP43_ENST00000393780.3_Missense_Mutation_p.A195V	NM_002045.3	NP_002036.1	P17677	NEUM_HUMAN	growth associated protein 43	159					axon choice point recognition (GO:0016198)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of filopodium assembly (GO:0051489)|regulation of growth (GO:0040008)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.A195V(1)|p.A159V(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)		GCTGAAGATGCCCCAGCCAAG	0.597																																																	2	Substitution - Missense(2)	kidney(2)											34.0	36.0	35.0					3																	115395305		2203	4297	6500	SO:0001583	missense	2596				CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020			4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060				3272162, 8231732	Standard	NM_002045		Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000305124.6:c.476C>T	3.37:g.115395305C>T	ENSP00000305010:p.Ala159Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0Y4	Missense_Mutation	SNP	ENST00000305124.6	37	CCDS33830.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716928	0.68844	.	.	ENSG00000172020	ENST00000305124;ENST00000393780	T;T	0.54071	0.59;0.59	5.75	-0.89	0.10577	Neuromodulin (GAP-43), C-terminal (1);	0.555420	0.20068	N	0.099932	T	0.46288	0.1385	L	0.53249	1.67	0.22112	N	0.999357	B;B	0.24768	0.111;0.016	B;B	0.23275	0.045;0.012	T	0.43540	-0.9385	10	0.62326	D	0.03	2.1681	14.2174	0.65802	0.0:0.3972:0.5416:0.0612	.	195;159	A8K0Y4;P17677	.;NEUM_HUMAN	V	159;195	ENSP00000305010:A159V;ENSP00000377372:A195V	ENSP00000305010:A159V	A	+	2	0	GAP43	116877995	1.000000	0.71417	0.193000	0.23327	0.990000	0.78478	1.030000	0.30153	-0.495000	0.06659	-0.165000	0.13383	GCC		0.597	GAP43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258216.2		NM_002045	
IGSF10	285313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	151161389	151161389	+	Silent	SNP	T	T	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:151161389T>A	ENST00000282466.3	-	5	5345	c.5346A>T	c.(5344-5346)gcA>gcT	p.A1782A	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1782	Ig-like C2-type 4.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.A1782A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGTTTGGTTTGCAAGAATCC	0.493																																																	1	Substitution - coding silent(1)	kidney(1)											125.0	111.0	116.0					3																	151161389		2203	4300	6503	SO:0001819	synonymous_variant	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5346A>T	3.37:g.151161389T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																				0.493	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1		NM_178822	
IL25	64806	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	23842465	23842465	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr14:23842465C>A	ENST00000329715.2	+	1	396	c.138C>A	c.(136-138)gaC>gaA	p.D46E	IL25_ENST00000397242.2_Missense_Mutation_p.D30E	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	46					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)	p.D46E(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		AAGGGCAGGACACCTCTGAGG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											87.0	74.0	78.0					14																	23842465		2203	4300	6503	SO:0001583	missense	64806			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.138C>A	14.37:g.23842465C>A	ENSP00000328111:p.Asp46Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3F0|Q8IZV3|Q8WXB0	Missense_Mutation	SNP	ENST00000329715.2	37	CCDS9597.1	.	.	.	.	.	.	.	.	.	.	C	9.153	1.016746	0.19355	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	T;T	0.54279	0.58;0.58	5.35	0.405	0.16361	.	1.219730	0.05595	N	0.575224	T	0.31888	0.0811	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.002	T	0.14980	-1.0453	10	0.28530	T	0.3	-13.6474	3.6062	0.08043	0.4039:0.3724:0.0:0.2236	.	46;30	Q9H293;Q9H293-2	IL25_HUMAN;.	E	30;46	ENSP00000380417:D30E;ENSP00000328111:D46E	ENSP00000328111:D46E	D	+	3	2	IL25	22912305	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.182000	0.03082	-0.113000	0.11958	0.655000	0.94253	GAC		0.597	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2			
IQUB	154865	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	123119948	123119948	+	Silent	SNP	A	A	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:123119948A>C	ENST00000466202.1	-	8	1887	c.1311T>G	c.(1309-1311)ctT>ctG	p.L437L	IQUB_ENST00000434450.1_Silent_p.L437L|IQUB_ENST00000324698.6_Silent_p.L437L	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	437					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)		p.L437L(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						CTTTTTCCAGAAGTTCACACA	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											113.0	104.0	107.0					7																	123119948		2203	4299	6502	SO:0001819	synonymous_variant	154865			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1311T>G	7.37:g.123119948A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Silent	SNP	ENST00000466202.1	37	CCDS5787.1																																																																																				0.398	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1		NM_178827	
KDM6A	7403	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	44879876	44879878	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	GGT	GGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:44879876_44879878delGGT	ENST00000377967.4	+	6	506_508	c.465_467delGGT	c.(463-468)gaggtg>gag	p.V156del	KDM6A_ENST00000536777.1_In_Frame_Del_p.V156del|KDM6A_ENST00000543216.1_In_Frame_Del_p.V156del|KDM6A_ENST00000382899.4_In_Frame_Del_p.V156del	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	156	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(14)|p.0?(6)|p.?(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CATTTCAGGAGGTGCTTTATGTT	0.36			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	21	No detectable mRNA/protein(14)|Whole gene deletion(6)|Unknown(1)	haematopoietic_and_lymphoid_tissue(11)|oesophagus(4)|breast(4)|pancreas(2)																																								SO:0001651	inframe_deletion	7403			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.465_467delGGT	X.37:g.44879876_44879878delGGT	ENSP00000367203:p.Val156del	Somatic		WXS	Illumina HiSeq	Phase_I	Q52LL9|Q5JVQ7	In_Frame_Del	DEL	ENST00000377967.4	37	CCDS14265.1																																																																																				0.360	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1		NM_021140	
CCDC183	84960	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	139697161	139697161	+	Missense_Mutation	SNP	G	G	A	rs373655990		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:139697161G>A	ENST00000338005.6	+	6	624	c.589G>A	c.(589-591)Gtg>Atg	p.V197M	KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA|KIAA1984-AS1_ENST00000414656.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		197								p.V197M(1)		biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GCAGAACCTCGTGGTCAACTA	0.567																																																	1	Substitution - Missense(1)	kidney(1)						G	MET/VAL	1,4055		0,1,2027	119.0	128.0	125.0		589	4.8	0.1	9		125	0,8376		0,0,4188	no	missense	KIAA1984	NM_001039374.4	21	0,1,6215	AA,AG,GG		0.0,0.0247,0.0080	probably-damaging	197/535	139697161	1,12431	2028	4188	6216	SO:0001583	missense	84960																														ENST00000338005.6:c.589G>A	9.37:g.139697161G>A	ENSP00000338013:p.Val197Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	37	CCDS43906.1	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621841	0.28889	2.47E-4	0.0	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.18338	2.22	4.83	4.83	0.62350	.	0.194822	0.24265	U	0.040041	T	0.38214	0.1032	M	0.61703	1.905	0.35048	D	0.760357	D	0.89917	1.0	D	0.77004	0.989	T	0.49735	-0.8908	10	0.56958	D	0.05	-31.9201	13.7823	0.63089	0.0:0.0:1.0:0.0	.	197	Q5T5S1	K1984_HUMAN	M	197	ENSP00000338013:V197M	ENSP00000338013:V197M	V	+	1	0	KIAA1984	138816982	0.844000	0.29557	0.052000	0.19188	0.039000	0.13416	2.985000	0.49362	2.384000	0.81235	0.561000	0.74099	GTG		0.567	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1			
KRTAP5-10	387273	hgsc.bcm.edu	37	11	71276939	71276939	+	Silent	SNP	G	G	A	rs111317671	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:71276939G>A	ENST00000398531.1	+	1	331	c.306G>A	c.(304-306)ggG>ggA	p.G102G	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	102	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GCTCCAAGGGGGGCTGTGGTT	0.682																																																	0													37.0	57.0	50.0					11																	71276939		2137	4258	6395	SO:0001819	synonymous_variant	387273			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.306G>A	11.37:g.71276939G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																				0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2			
LETMD1	25875	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	51449970	51449970	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:51449970T>G	ENST00000262055.4	+	6	743	c.704T>G	c.(703-705)cTg>cGg	p.L235R	LETMD1_ENST00000380123.2_3'UTR|LETMD1_ENST00000552739.1_Missense_Mutation_p.L118R|LETMD1_ENST00000547008.1_Intron|LETMD1_ENST00000548516.1_Intron|LETMD1_ENST00000550929.1_Missense_Mutation_p.L179R|LETMD1_ENST00000418425.2_Missense_Mutation_p.L248R	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	235	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)		p.L235R(1)		central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						ATCTTGGCTCTGAGAGAGTGT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											172.0	150.0	157.0					12																	51449970		2203	4300	6503	SO:0001583	missense	25875			AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.704T>G	12.37:g.51449970T>G	ENSP00000262055:p.Leu235Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	ENST00000262055.4	37	CCDS8806.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.332440	0.41297	.	.	ENSG00000050426	ENST00000551477;ENST00000550929;ENST00000262055;ENST00000549340;ENST00000548209;ENST00000548251;ENST00000550814;ENST00000418425;ENST00000448283;ENST00000552739	T;T;T;T;T;T;T;T	0.52754	0.71;0.71;0.71;0.71;0.65;0.71;0.71;0.71	4.78	4.78	0.61160	LETM1-like (1);	0.317942	0.30869	N	0.008718	T	0.58119	0.2100	L	0.44542	1.39	0.80722	D	1	D;D;P;D	0.76494	0.999;0.998;0.829;0.998	D;D;B;D	0.74674	0.984;0.972;0.251;0.972	T	0.60667	-0.7218	10	0.72032	D	0.01	-7.1557	10.9106	0.47106	0.0:0.0:0.0:1.0	.	185;248;118;235	F8VVQ3;B3KXK7;F8VP71;Q6P1Q0	.;.;.;LTMD1_HUMAN	R	202;179;235;185;134;118;43;248;185;118	ENSP00000446862:L202R;ENSP00000450163:L179R;ENSP00000262055:L235R;ENSP00000449896:L185R;ENSP00000450275:L134R;ENSP00000447166:L118R;ENSP00000389903:L248R;ENSP00000450333:L118R	ENSP00000262055:L235R	L	+	2	0	LETMD1	49736237	1.000000	0.71417	0.994000	0.49952	0.019000	0.09904	4.595000	0.61048	2.144000	0.66660	0.533000	0.62120	CTG		0.473	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1		NM_015416	
LPHN3	23284	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	62813877	62813877	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr4:62813877G>A	ENST00000514591.1	+	16	2813	c.2484G>A	c.(2482-2484)atG>atA	p.M828I	LPHN3_ENST00000506720.1_Missense_Mutation_p.M896I|LPHN3_ENST00000514157.1_Missense_Mutation_p.M828I|LPHN3_ENST00000506700.1_Missense_Mutation_p.M828I|LPHN3_ENST00000514996.1_Missense_Mutation_p.M828I|LPHN3_ENST00000512091.2_Missense_Mutation_p.M828I|LPHN3_ENST00000507625.1_Missense_Mutation_p.M896I|LPHN3_ENST00000507164.1_Missense_Mutation_p.M896I|LPHN3_ENST00000545650.1_Missense_Mutation_p.M828I|LPHN3_ENST00000508946.1_Missense_Mutation_p.M828I|LPHN3_ENST00000504896.1_Missense_Mutation_p.M828I|LPHN3_ENST00000506746.1_Missense_Mutation_p.M896I|LPHN3_ENST00000511324.1_Missense_Mutation_p.M896I|LPHN3_ENST00000509896.1_Missense_Mutation_p.M896I|LPHN3_ENST00000508693.1_Missense_Mutation_p.M896I			Q9HAR2	LPHN3_HUMAN	latrophilin 3	815	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.M828I(3)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AGCGTACAATGACAGGTTATT	0.393																																																	3	Substitution - Missense(3)	kidney(3)											90.0	80.0	83.0					4																	62813877		1884	4112	5996	SO:0001583	missense	23284			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2484G>A	4.37:g.62813877G>A	ENSP00000422533:p.Met828Ile	Somatic		WXS	Illumina HiSeq	Phase_I	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.070123|5.070123	0.93950|0.93950	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.68479	.|-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.98|5.98	5.98|5.98	0.97165|0.97165	.|GPS domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80248|0.80248	0.4588|0.4588	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.54964	.|0.969;0.969;0.962	.|D;D;D	.|0.70227	.|0.968;0.968;0.946	T|T	0.76083|0.76083	-0.3089|-0.3089	5|10	.|0.38643	.|T	.|0.18	.|.	20.5212|20.5212	0.99222|0.99222	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|828;815;828	.|E9PE04;Q9HAR2;Q9HAR2-2	.|.;LPHN3_HUMAN;.	N|I	286|828;828;896;896;828;828;815;828;896;896;896;828;828;828;896;896;828	.|ENSP00000423388:M828I;ENSP00000422533:M828I;ENSP00000423787:M896I;ENSP00000425033:M896I;ENSP00000424120:M828I;ENSP00000439831:M828I;ENSP00000421476:M896I;ENSP00000424030:M896I;ENSP00000421372:M896I;ENSP00000425201:M828I;ENSP00000423434:M828I;ENSP00000421627:M828I;ENSP00000420931:M896I;ENSP00000425884:M896I;ENSP00000424258:M828I	.|ENSP00000280009:M828I	D|M	+|+	1|3	0|0	LPHN3|LPHN3	62496472|62496472	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	9.865000|9.865000	0.99609|0.99609	2.861000|2.861000	0.98227|0.98227	0.650000|0.650000	0.86243|0.86243	GAC|ATG		0.393	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			
LRPPRC	10128	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	44209499	44209499	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:44209499G>T	ENST00000260665.7	-	2	281	c.224C>A	c.(223-225)tCt>tAt	p.S75Y	LRPPRC_ENST00000409946.1_Missense_Mutation_p.S75Y|LRPPRC_ENST00000409659.1_Missense_Mutation_p.S75Y	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	75					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.S75Y(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTTCCTAGAAGAAAAAGTGGA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											54.0	59.0	57.0					2																	44209499		2202	4300	6502	SO:0001583	missense	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.224C>A	2.37:g.44209499G>T	ENSP00000260665:p.Ser75Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	37	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165095	0.38217	.	.	ENSG00000138095	ENST00000260665;ENST00000409946;ENST00000409659;ENST00000447246	T;T;T;T	0.64803	0.49;0.48;0.48;-0.12	4.76	1.25	0.21368	.	1.273000	0.05459	N	0.550907	T	0.56702	0.2003	M	0.62723	1.935	0.09310	N	1	P;P	0.51653	0.9;0.947	B;B	0.43536	0.423;0.271	T	0.45498	-0.9257	10	0.28530	T	0.3	-14.6462	2.815	0.05453	0.214:0.1293:0.5084:0.1483	.	49;75	C9JCA9;P42704	.;LPPRC_HUMAN	Y	75;75;75;49	ENSP00000260665:S75Y;ENSP00000386234:S75Y;ENSP00000386562:S75Y;ENSP00000403637:S49Y	ENSP00000260665:S75Y	S	-	2	0	LRPPRC	44063003	0.000000	0.05858	0.003000	0.11579	0.097000	0.18754	0.181000	0.16880	0.461000	0.27071	0.655000	0.94253	TCT		0.383	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1		NM_133259	
LRRC43	254050	hgsc.bcm.edu	37	12	122685163	122685164	+	Missense_Mutation	DNP	AA	AA	GG	rs199718757|rs200955000	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:122685163_122685164AA>GG	ENST00000339777.4	+	9	1604_1605	c.1576_1577AA>GG	c.(1576-1578)AAg>GGg	p.K526G	LRRC43_ENST00000425921.1_Missense_Mutation_p.K341G|LRRC43_ENST00000537733.1_3'UTR|B3GNT4_ENST00000324189.4_5'Flank	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	526	Lys-rich.									NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		caagaaagggaaggagaaagac	0.579																																																	0																																										SO:0001583	missense	254050			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	Exception_encountered	12.37:g.122685163_122685164delinsGG	ENSP00000344233:p.Lys526Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	37	CCDS45001.1																																																																																				0.579	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1		NM_152759	
LRRK2	120892	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	40689408	40689408	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:40689408C>A	ENST00000298910.7	+	23	3116	c.3058C>A	c.(3058-3060)Cag>Aag	p.Q1020K	LRRK2_ENST00000343742.2_Missense_Mutation_p.Q1020K	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1020					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.Q1020K(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGAGCTTCACCAGAATGCACT	0.358																																																	2	Substitution - Missense(2)	kidney(2)											67.0	62.0	64.0					12																	40689408		2203	4299	6502	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3058C>A	12.37:g.40689408C>A	ENSP00000298910:p.Gln1020Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392436	0.83011	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.56103	0.48;0.48	5.71	5.71	0.89125	.	0.119263	0.64402	D	0.000019	T	0.58666	0.2138	N	0.21324	0.655	0.46078	D	0.998859	D;P	0.64830	0.994;0.934	D;P	0.64506	0.926;0.634	T	0.51458	-0.8703	10	0.20046	T	0.44	.	19.8379	0.96666	0.0:1.0:0.0:0.0	.	1020;1020	E9PC85;Q5S007	.;LRRK2_HUMAN	K	1020	ENSP00000341930:Q1020K;ENSP00000298910:Q1020K	ENSP00000298910:Q1020K	Q	+	1	0	LRRK2	38975675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.585000	0.67497	2.695000	0.91970	0.591000	0.81541	CAG		0.358	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1		XM_058513	
LRRC43	254050	hgsc.bcm.edu	37	12	122685176	122685176	+	Missense_Mutation	SNP	G	G	A	rs527456159	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:122685176G>A	ENST00000339777.4	+	9	1617	c.1589G>A	c.(1588-1590)aGg>aAg	p.R530K	LRRC43_ENST00000425921.1_Missense_Mutation_p.R345K|LRRC43_ENST00000537733.1_3'UTR|B3GNT4_ENST00000324189.4_5'Flank	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	530	Lys-rich.									NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		gagaaagacaggacggggaaa	0.577													G|||	71	0.0141773	0.0008	0.036	5008	,	,		17279	0.0		0.0368	False		,,,				2504	0.0082																0													87.0	104.0	98.0					12																	122685176		1981	4130	6111	SO:0001583	missense	254050			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1589G>A	12.37:g.122685176G>A	ENSP00000344233:p.Arg530Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	37	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	G	0.059	-1.227668	0.01518	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.48522	0.81;1.2	3.37	0.927	0.19437	.	0.793313	0.10251	N	0.697195	T	0.25158	0.0611	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29212	-1.0019	10	0.02654	T	1	-17.5604	3.4297	0.07424	0.5356:0.2049:0.2595:0.0	.	530	Q8N309	LRC43_HUMAN	K	530;401;345	ENSP00000344233:R530K;ENSP00000416628:R345K	ENSP00000289014:R401K	R	+	2	0	LRRC43	121251129	0.014000	0.17966	0.002000	0.10522	0.006000	0.05464	0.818000	0.27295	0.061000	0.16311	-0.312000	0.09012	AGG		0.577	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1		NM_152759	
LTN1	26046	hgsc.bcm.edu;ucsc.edu	37	21	30339421	30339422	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr21:30339421_30339422insA	ENST00000361371.5	-	10	1470_1471	c.1391_1392insT	c.(1390-1392)ctafs	p.L464fs	LTN1_ENST00000389195.2_Frame_Shift_Ins_p.L510fs|LTN1_ENST00000389194.2_Frame_Shift_Ins_p.L510fs			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	464					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CCCAGGAACTTAGAGTTTCTGC	0.401																																																	0																																										SO:0001589	frameshift_variant	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1392dupT	21.37:g.30339422_30339422dupA	ENSP00000354977:p.Leu464fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Frame_Shift_Ins	INS	ENST00000361371.5	37																																																																																					0.401	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1		NM_015565	
MET	4233	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	116411638	116411638	+	Silent	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:116411638C>G	ENST00000318493.6	+	13	3058	c.2871C>G	c.(2869-2871)gtC>gtG	p.V957V	MET_ENST00000397752.3_Silent_p.V939V			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V957V(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTGGTGTTGTCTCAATATCAA	0.348			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	1	Substitution - coding silent(1)	kidney(1)											141.0	131.0	134.0					7																	116411638		1841	4097	5938	SO:0001819	synonymous_variant	4233	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.2871C>G	7.37:g.116411638C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	ENST00000318493.6	37	CCDS47689.1																																																																																				0.348	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			
MIOX	55586	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	50927866	50927867	+	Frame_Shift_Ins	INS	-	-	C	rs140383906		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr22:50927866_50927867insC	ENST00000216075.6	+	8	701_702	c.627_628insC	c.(628-630)cccfs	p.P210fs	MIOX_ENST00000395733.3_Intron|MIOX_ENST00000395732.3_Frame_Shift_Ins_p.P210fs	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	210					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGTTCTCACTGCCCCCTGAGGT	0.658																																																	0																																										SO:0001589	frameshift_variant	55586			AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.632dupC	22.37:g.50927871_50927871dupC	ENSP00000216075:p.Pro210fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Frame_Shift_Ins	INS	ENST00000216075.6	37	CCDS14092.1																																																																																				0.658	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316835.1		NM_017584	
MLH3	27030	hgsc.bcm.edu;ucsc.edu	37	14	75513395	75513396	+	Frame_Shift_Ins	INS	-	-	AT	rs201936675	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr14:75513395_75513396insAT	ENST00000556740.1	-	1	2998_2999	c.2963_2964insAT	c.(2962-2964)atcfs	p.I988fs	MLH3_ENST00000555671.1_5'UTR|MLH3_ENST00000556257.1_Frame_Shift_Ins_p.I988fs|MLH3_ENST00000355774.2_Frame_Shift_Ins_p.I988fs|MLH3_ENST00000238662.7_Frame_Shift_Ins_p.I988fs|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000544985.1_5'Flank			Q9UHC1	MLH3_HUMAN	mutL homolog 3	988					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		CTGAGGCTCTGATAAGAACATC	0.386								Mismatch excision repair (MMR)																																									0																																										SO:0001589	frameshift_variant	27030			AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.2962_2963dupAT	14.37:g.75513396_75513397dupAT	ENSP00000452316:p.Ile988fs	Somatic		WXS	Illumina HiSeq	Phase_I	P49751|Q56DK9|Q9P292|Q9UHC0	Frame_Shift_Ins	INS	ENST00000556740.1	37	CCDS32123.1																																																																																				0.386	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1		NM_014381	
MRGPRG	386746	hgsc.bcm.edu	37	11	3239798	3239798	+	Silent	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:3239798G>A	ENST00000332314.3	-	1	245	c.246C>T	c.(244-246)ttC>ttT	p.F82F	MRGPRG-AS1_ENST00000420873.2_RNA|MRGPRG-AS1_ENST00000434798.1_RNA	NM_001164377.1	NP_001157849.1	Q86SM5	MRGRG_HUMAN	MAS-related GPR, member G	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)										AGGTGAGCACGAAGTAGAGTG	0.682																																																	0													60.0	72.0	68.0					11																	3239798		692	1588	2280	SO:0001819	synonymous_variant	386746			AY255583	CCDS44520.1	11p15.4	2012-08-21	2004-03-25		ENSG00000182170	ENSG00000182170		"""GPCR / Class A : Orphans"""	24829	protein-coding gene	gene with protein product		607234	"""G protein-coupled receptor 169"""	GPR169		12679517	Standard	NM_001164377		Approved	mrgG	uc001lxp.2	Q86SM5	OTTHUMG00000011709	ENST00000332314.3:c.246C>T	11.37:g.3239798G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000332314.3	37	CCDS44520.1																																																																																				0.682	MRGPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032347.1			
KMT2A	4297	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118390456	118390456	+	Missense_Mutation	SNP	A	A	G	rs564690648		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:118390456A>G	ENST00000389506.5	+	32	11261	c.11261A>G	c.(11260-11262)aAt>aGt	p.N3754S	RP11-770J1.3_ENST00000554407.1_RNA|KMT2A_ENST00000534358.1_Missense_Mutation_p.N3757S|KMT2A_ENST00000354520.4_Missense_Mutation_p.N3716S|RP11-770J1.3_ENST00000556583.1_RNA|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000528578.1_RNA|RP11-770J1.3_ENST00000525992.2_RNA			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3754					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.N3757S(1)|p.N3754S(1)									GAGGAGGCCAATGAACCCCCC	0.507													A|||	1	0.000199681	0.0	0.0	5008	,	,		20518	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	kidney(2)											119.0	114.0	116.0					11																	118390456		2200	4295	6495	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11261A>G	11.37:g.118390456A>G	ENSP00000374157:p.Asn3754Ser	Somatic		WXS	Illumina HiSeq	Phase_I	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.672490	0.47781	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;T	0.81499	-1.5;-1.5;-1.47	5.82	5.82	0.92795	.	0.097922	0.64402	D	0.000001	T	0.62925	0.2468	N	0.08118	0	0.48511	D	0.999665	P;P	0.39782	0.688;0.688	B;B	0.31442	0.13;0.13	T	0.69191	-0.5210	10	0.46703	T	0.11	.	16.19	0.81981	1.0:0.0:0.0:0.0	.	3757;3754	E9PQG7;Q03164	.;MLL1_HUMAN	S	3757;3754;3716;2664	ENSP00000436786:N3757S;ENSP00000374157:N3754S;ENSP00000346516:N3716S	ENSP00000346516:N3716S	N	+	2	0	MLL	117895666	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	7.013000	0.76373	2.225000	0.72522	0.460000	0.39030	AAT		0.507	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2		NM_005933	
MSLNL	401827	hgsc.bcm.edu	37	16	830786	830787	+	Intron	INS	-	-	A	rs371048330|rs199521360|rs374071660	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr16:830786_830787insA	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Frame_Shift_Ins_p.R72fs			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GGGTAGGTGACGGTGTGCACGG	0.594																																																	0																																										SO:0001627	intron_variant	401827					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-624->T	16.37:g.830786_830787insA		Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000442466.1	37																																																																																					0.594	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001025190	
MUC2	4583	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1092095	1092095	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:1092095G>A	ENST00000441003.2	+	30	3941	c.3914G>A	c.(3913-3915)tGg>tAg	p.W1305*	MUC2_ENST00000359061.5_Nonsense_Mutation_p.W1306*|MUC2_ENST00000361558.6_5'Flank|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1305					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.W1305*(1)|p.W1306*(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGCTGCCTCTGGTCTGACTGG	0.592																																																	2	Substitution - Nonsense(2)	kidney(2)											36.0	38.0	37.0					11																	1092095		2074	4188	6262	SO:0001587	stop_gained	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3914G>A	11.37:g.1092095G>A	ENSP00000415183:p.Trp1305*	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Nonsense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	g	42	9.670564	0.99234	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	.	.	.	3.34	3.34	0.38264	.	0.391048	0.20000	U	0.101346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5049	0.67746	0.0:0.0:1.0:0.0	.	.	.	.	X	1305;1306	.	ENSP00000351956:W1306X	W	+	2	0	MUC2	1082095	1.000000	0.71417	0.069000	0.20011	0.157000	0.22087	7.567000	0.82357	1.736000	0.51660	0.466000	0.42574	TGG		0.592	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
MUC4	4585	hgsc.bcm.edu	37	3	195509563	195509563	+	Missense_Mutation	SNP	A	A	T	rs28605870		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:195509563A>T	ENST00000463781.3	-	2	9347	c.8888T>A	c.(8887-8889)gTc>gAc	p.V2963D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V2963D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V2963D(5)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGA	0.587																																																	5	Substitution - Missense(5)	kidney(2)|skin(2)|endometrium(1)											8.0	7.0	7.0					3																	195509563		603	1454	2057	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8888T>A	3.37:g.195509563A>T	ENSP00000417498:p.Val2963Asp	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	5.292	0.239303	0.10023	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.47;1.53	.	.	.	.	.	.	.	.	T	0.28366	0.0701	N	0.19112	0.55	0.09310	N	1	D	0.65815	0.995	D	0.68483	0.958	T	0.11372	-1.0590	7	.	.	.	.	1.4974	0.02469	0.4322:0.0:0.2571:0.3107	rs60024035	2835	E7ESK3	.	D	2963	ENSP00000417498:V2963D;ENSP00000420243:V2963D	.	V	-	2	0	MUC4	196994342	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.570000	0.02140	-0.942000	0.03695	0.000000	0.15137	GTC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MYO15A	51168	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	18055188	18055188	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:18055188C>T	ENST00000205890.5	+	41	8154	c.7816C>T	c.(7816-7818)Cgg>Tgg	p.R2606W	MYO15A_ENST00000585180.1_5'Flank|MYO15A_ENST00000418233.3_5'Flank	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2606	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R2606W(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GTTCATGAAGCGGCCAGACCC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											41.0	47.0	45.0					17																	18055188		2028	4173	6201	SO:0001583	missense	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.7816C>T	17.37:g.18055188C>T	ENSP00000205890:p.Arg2606Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.176378	0.57692	.	.	ENSG00000091536	ENST00000205890	D	0.88277	-2.36	5.24	2.95	0.34219	.	.	.	.	.	T	0.80602	0.4654	L	0.29908	0.895	0.80722	D	1	B	0.11235	0.004	B	0.04013	0.001	T	0.76833	-0.2813	9	0.87932	D	0	.	6.2759	0.20981	0.3292:0.5756:0.0:0.0952	.	2606	Q9UKN7	MYO15_HUMAN	W	2606	ENSP00000205890:R2606W	ENSP00000205890:R2606W	R	+	1	2	MYO15A	17995913	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	5.152000	0.64882	1.335000	0.45486	0.561000	0.74099	CGG		0.577	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1		NM_016239	
NALCN	259232	broad.mit.edu;hgsc.bcm.edu	37	13	101717877	101717877	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr13:101717877G>A	ENST00000251127.6	-	40	4564	c.4483C>T	c.(4483-4485)Cgg>Tgg	p.R1495W		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1495					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.R1495W(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CGCAGTAGCCGCAGCAGGAAC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											89.0	72.0	78.0					13																	101717877		2203	4300	6503	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4483C>T	13.37:g.101717877G>A	ENSP00000251127:p.Arg1495Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123923	0.77436	.	.	ENSG00000102452	ENST00000251127	D	0.98207	-4.79	5.71	-3.76	0.04359	.	0.000000	0.85682	D	0.000000	D	0.98353	0.9453	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94426	0.7645	10	0.87932	D	0	.	22.1592	0.99967	0.0:0.0:0.1114:0.8886	.	1495	Q8IZF0	NALCN_HUMAN	W	1495	ENSP00000251127:R1495W	ENSP00000251127:R1495W	R	-	1	2	NALCN	100515878	0.998000	0.40836	0.808000	0.32385	0.967000	0.64934	1.474000	0.35398	-1.058000	0.03197	-0.181000	0.13052	CGG		0.567	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2		NM_052867	
NRXN2	9379	broad.mit.edu;ucsc.edu	37	11	64453329	64453329	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:64453329A>G	ENST00000377551.1	-	5	1152	c.941T>C	c.(940-942)aTc>aCc	p.I314T	NRXN2_ENST00000409571.1_Missense_Mutation_p.I314T|NRXN2_ENST00000377559.3_Missense_Mutation_p.I290T|NRXN2_ENST00000265459.6_Missense_Mutation_p.I314T			Q9P2S2	NRX2A_HUMAN	neurexin 2	314	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.I314T(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GGCCAGTGTGATCTCATCAGT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											383.0	304.0	331.0					11																	64453329		2201	4297	6498	SO:0001583	missense	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.941T>C	11.37:g.64453329A>G	ENSP00000366774:p.Ile314Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.8|21.8	4.200888|4.200888	0.79015|0.79015	.|.	.|.	ENSG00000110076|ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000442300|ENST00000417749	D;D;D;D;D|.	0.81908|.	-1.55;-1.53;-1.55;-1.55;-1.55|.	4.17|4.17	4.17|4.17	0.49024|0.49024	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);|.	0.000000|.	0.42964|.	U|.	0.000627|.	T|T	0.78059|0.78059	0.4224|0.4224	M|M	0.88377|0.88377	2.95|2.95	0.53688|0.53688	D|D	0.999977|0.999977	D;D|.	0.69078|.	0.997;0.997|.	D;D|.	0.74348|.	0.983;0.961|.	T|T	0.81364|0.81364	-0.0966|-0.0966	10|5	0.87932|.	D|.	0|.	.|.	11.4909|11.4909	0.50381|0.50381	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	290;314|.	Q9P2S2-2;Q9P2S2|.	.;NRX2A_HUMAN|.	T|P	314;290;314;290;314;85|75	ENSP00000366774:I314T;ENSP00000366782:I290T;ENSP00000265459:I314T;ENSP00000386416:I314T;ENSP00000388971:I85T|.	ENSP00000265459:I314T|.	I|S	-|-	2|1	0|0	NRXN2|NRXN2	64209905|64209905	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	9.335000|9.335000	0.96500|0.96500	1.677000|1.677000	0.50941|0.50941	0.383000|0.383000	0.25322|0.25322	ATC|TCA		0.577	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3		NM_015080	
OCIAD2	132299	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	48887578	48887578	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr4:48887578A>G	ENST00000508632.1	-	7	620	c.388T>C	c.(388-390)Tgc>Cgc	p.C130R	OCIAD2_ENST00000273860.4_Silent_p.T90T|OCIAD2_ENST00000508069.2_5'UTR	NM_001014446.1	NP_001014446.1	Q56VL3	OCAD2_HUMAN	OCIA domain containing 2	130						endosome (GO:0005768)|mitochondrial inner membrane (GO:0005743)		p.C130R(1)		kidney(1)|lung(3)|skin(1)|urinary_tract(1)	6						GTAAGGAGGCAGTGCCTAGAA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											139.0	133.0	135.0					4																	48887578		2203	4300	6503	SO:0001583	missense	132299			BC032808	CCDS3485.1, CCDS33981.1	4p12	2013-10-11			ENSG00000145247	ENSG00000145247			28685	protein-coding gene	gene with protein product						17054434	Standard	NM_001286774		Approved	MGC45416	uc003gyt.3	Q56VL3	OTTHUMG00000128626	ENST00000508632.1:c.388T>C	4.37:g.48887578A>G	ENSP00000423014:p.Cys130Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPE7|Q8N544	Missense_Mutation	SNP	ENST00000508632.1	37	CCDS33981.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.352153	0.61183	.	.	ENSG00000145247	ENST00000508632	T	0.55930	0.49	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.69815	0.3153	.	.	.	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.71307	-0.4632	8	.	.	.	-4.9143	11.4785	0.50312	1.0:0.0:0.0:0.0	.	130	Q56VL3	OCAD2_HUMAN	R	130	ENSP00000423014:C130R	.	C	-	1	0	OCIAD2	48582335	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	4.596000	0.61055	2.207000	0.71202	0.460000	0.39030	TGC		0.383	OCIAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361984.5		NM_152398	
OPHN1	4983	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	67413751	67413751	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:67413751G>C	ENST00000355520.5	-	14	1823	c.1182C>G	c.(1180-1182)atC>atG	p.I394M	OPHN1_ENST00000540071.1_Missense_Mutation_p.I394M	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	394	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.I394M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						CAATAATATTGATGCACTTCC	0.408																																																	1	Substitution - Missense(1)	kidney(1)											191.0	146.0	161.0					X																	67413751		2203	4300	6503	SO:0001583	missense	4983			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1182C>G	X.37:g.67413751G>C	ENSP00000347710:p.Ile394Met	Somatic		WXS	Illumina HiSeq	Phase_I	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	CCDS14388.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546039	0.65198	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.21932	1.98;1.98	4.86	4.86	0.63082	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.50394	0.1613	M	0.90082	3.085	0.80722	D	1	P;D	0.63046	0.816;0.992	B;P	0.61592	0.405;0.891	T	0.61515	-0.7047	10	0.87932	D	0	.	14.4981	0.67702	0.0:0.0:1.0:0.0	.	394;394	F5H2E3;O60890	.;OPHN1_HUMAN	M	394	ENSP00000347710:I394M;ENSP00000438617:I394M	ENSP00000347710:I394M	I	-	3	3	OPHN1	67330476	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.528000	0.81941	2.391000	0.81399	0.600000	0.82982	ATC		0.408	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1		NM_002547	
OR2L8	391190	broad.mit.edu;hgsc.bcm.edu	37	1	248112361	248112361	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:248112361delA	ENST00000357191.3	+	1	202	c.202delA	c.(202-204)attfs	p.I68fs	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GCTCTCCCTCATTGACCTAAA	0.443																																																	0													359.0	313.0	329.0					1																	248112361		2203	4300	6503	SO:0001589	frameshift_variant	391190			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.202delA	1.37:g.248112361delA	ENSP00000349719:p.Ile68fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF03	Frame_Shift_Del	DEL	ENST00000357191.3	37	CCDS31101.1																																																																																				0.443	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52696199	52696199	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:52696199delC	ENST00000296302.7	-	4	479	c.478delG	c.(478-480)gaafs	p.E160fs	PBRM1_ENST00000409767.1_Frame_Shift_Del_p.E160fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.E160fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.E160fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.E160fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.E160fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.E160fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.E160fs			Q86U86	PB1_HUMAN	polybromo 1	160			E -> A (found in a malignant melanoma cell line). {ECO:0000269|PubMed:21248752}.		chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E160*(3)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATCATCTTCGTCATCTGCT	0.453			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Nonsense(3)	kidney(3)											333.0	291.0	306.0					3																	52696199		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.478delG	3.37:g.52696199delC	ENSP00000296302:p.Glu160fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.453	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PARP14	54625	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	122437546	122437546	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:122437546G>T	ENST00000474629.2	+	14	4814	c.4548G>T	c.(4546-4548)aaG>aaT	p.K1516N	PARP14_ENST00000475640.1_3'UTR	NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.K1353N(1)|p.K1516N(1)		NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CGATGATCAAGAGAGTTCGAT	0.388																																																	2	Substitution - Missense(2)	kidney(2)											210.0	205.0	207.0					3																	122437546		1902	4140	6042	SO:0001583	missense	54625			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.4548G>T	3.37:g.122437546G>T	ENSP00000418194:p.Lys1516Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359412	0.61403	.	.	ENSG00000173193	ENST00000474629;ENST00000398162;ENST00000310290;ENST00000398157	T	0.29397	1.57	5.05	3.21	0.36854	.	0.296252	0.28724	N	0.014351	T	0.49389	0.1554	M	0.74881	2.28	0.33738	D	0.619026	D;D	0.89917	1.0;0.995	D;P	0.83275	0.996;0.871	T	0.60910	-0.7169	10	0.49607	T	0.09	.	6.7554	0.23510	0.3345:0.0:0.6655:0.0	.	1516;1516	Q460N5-4;Q460N5	.;PAR14_HUMAN	N	1516;1435;119;512	ENSP00000418194:K1516N	ENSP00000310633:K119N	K	+	3	2	PARP14	123920236	0.158000	0.22850	0.982000	0.44146	0.945000	0.59286	0.434000	0.21494	1.343000	0.45638	0.650000	0.86243	AAG		0.388	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2		NM_017554	
PCDH10	57575	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	134073481	134073481	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr4:134073481T>G	ENST00000264360.5	+	1	3012	c.2186T>G	c.(2185-2187)tTc>tGc	p.F729C		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	729					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F729C(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TCCTTCATCTTCCTGCTGGCC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											90.0	102.0	98.0					4																	134073481		2203	4300	6503	SO:0001583	missense	57575			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2186T>G	4.37:g.134073481T>G	ENSP00000264360:p.Phe729Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009735	0.54361	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.57907	0.37	4.48	4.48	0.54585	.	0.000000	0.47455	D	0.000234	T	0.71929	0.3398	M	0.79011	2.435	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.87578	0.993;0.998	T	0.76639	-0.2885	10	0.87932	D	0	.	13.6128	0.62091	0.0:0.0:0.0:1.0	.	729;729	Q9P2E7;Q96SF0	PCD10_HUMAN;.	C	729	ENSP00000264360:F729C	ENSP00000264360:F729C	F	+	2	0	PCDH10	134292931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.094000	0.71431	1.883000	0.54544	0.459000	0.35465	TTC		0.592	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2		NM_032961	
PCSK9	255738	broad.mit.edu;hgsc.bcm.edu	37	1	55505552	55505553	+	In_Frame_Ins	INS	-	-	CTG	rs35574083|rs371488778|rs113330492|rs45454392|rs67610340	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:55505552_55505553insCTG	ENST00000302118.5	+	1	332_333	c.42_43insCTG	c.(43-45)ctg>CTGctg	p.15_15L>LL	PCSK9_ENST00000543384.1_5'Flank|PCSK9_ENST00000452118.2_In_Frame_Ins_p.15_15L>LL	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	15					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.P14_L15insL(2)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						Ggccgctgccactgctgctgct	0.703																																					Pancreas(137;1454 1827 5886 22361 42375)												2	Insertion - In frame(2)	breast(1)|central_nervous_system(1)																																								SO:0001652	inframe_insertion	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.61_63dupCTG	1.37:g.55505559_55505561dupCTG	ENSP00000303208:p.Leu23dup	Somatic		WXS	Illumina HiSeq	Phase_I	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	In_Frame_Ins	INS	ENST00000302118.5	37	CCDS603.1																																																																																				0.703	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1		NM_174936	
PDLIM2	64236	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	22452072	22452072	+	IGR	SNP	A	A	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr8:22452072A>T	ENST00000397760.4	+	0	1837				PDLIM2_ENST00000265810.4_Missense_Mutation_p.R337S|AC037459.4_ENST00000430850.2_Intron			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R337S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		AGGGAATGAGATTGTCACTGG	0.532																																																	1	Substitution - Missense(1)	kidney(1)											173.0	174.0	173.0					8																	22452072		2203	4300	6503	SO:0001628	intergenic_variant	64236			AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270		8.37:g.22452072A>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	37		.	.	.	.	.	.	.	.	.	.	A	12.11	1.840380	0.32513	.	.	ENSG00000120913	ENST00000265810	T	0.13657	2.57	1.99	-2.96	0.05547	.	.	.	.	.	T	0.08088	0.0202	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34875	-0.9811	8	0.62326	D	0.03	.	2.9994	0.06009	0.3871:0.0:0.2975:0.3155	.	337	Q96JY6-3	.	S	337	ENSP00000265810:R337S	ENSP00000265810:R337S	R	+	3	2	PDLIM2	22508017	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	-0.207000	0.09384	-0.736000	0.04831	-1.585000	0.00851	AGA		0.532	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1			
PDS5B	23047	hgsc.bcm.edu	37	13	33344580	33344580	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr13:33344580delA	ENST00000315596.10	+	32	4132	c.3946delA	c.(3946-3948)aaafs	p.K1318fs		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1318					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.K1318fs*76(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AAAAGGAAGCAAAAAAAAATC	0.443																																																	1	Deletion - Frameshift(1)	ovary(1)								12,3522		1,10,1756	36.0	35.0	36.0			4.2	1.0	13		36	23,7817		2,19,3899	no	frameshift	PDS5B	NM_015032.3		3,29,5655	A1A1,A1R,RR		0.2934,0.3396,0.3077			33344580	35,11339	1833	4094	5927	SO:0001589	frameshift_variant	23047			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3946delA	13.37:g.33344580delA	ENSP00000313851:p.Lys1318fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Frame_Shift_Del	DEL	ENST00000315596.10	37	CCDS41878.1																																																																																				0.443	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3		NM_015032	
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	32090803	32090803	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr5:32090803T>G	ENST00000438447.1	+	20	7637	c.7249T>G	c.(7249-7251)Tct>Gct	p.S2417A	PDZD2_ENST00000282493.3_Missense_Mutation_p.S2417A			O15018	PDZD2_HUMAN	PDZ domain containing 2	2417					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.S2417A(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GATGGCCAAGTCTCCCTCAAT	0.557																																																	1	Substitution - Missense(1)	kidney(1)											58.0	61.0	60.0					5																	32090803		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7249T>G	5.37:g.32090803T>G	ENSP00000402033:p.Ser2417Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	T	15.49	2.850198	0.51270	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.09073	3.02;3.02	5.15	5.15	0.70609	.	0.000000	0.49916	D	0.000124	T	0.19725	0.0474	M	0.67953	2.075	0.26942	N	0.966237	D	0.62365	0.991	P	0.62382	0.901	T	0.09684	-1.0663	10	0.25751	T	0.34	.	8.4301	0.32753	0.1741:0.0:0.0:0.8259	.	2417	O15018	PDZD2_HUMAN	A	2417;2218;2417	ENSP00000402033:S2417A;ENSP00000282493:S2417A	ENSP00000282493:S2417A	S	+	1	0	PDZD2	32126560	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	2.369000	0.44231	1.930000	0.55929	0.459000	0.35465	TCT		0.557	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PITPNM1	9600	broad.mit.edu;ucsc.edu	37	11	67265791	67265791	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:67265791A>C	ENST00000534749.1	-	10	1675	c.1487T>G	c.(1486-1488)cTg>cGg	p.L496R	PITPNM1_ENST00000356404.3_Missense_Mutation_p.L496R|PITPNM1_ENST00000436757.2_Missense_Mutation_p.L496R			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	496					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)	p.L496R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GTAAGGGCTCAGGCTGTAGGA	0.652																																					GBM(28;144 709 4607 5525)												1	Substitution - Missense(1)	kidney(1)											54.0	53.0	53.0					11																	67265791		2195	4292	6487	SO:0001583	missense	9600			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1487T>G	11.37:g.67265791A>C	ENSP00000437286:p.Leu496Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	a	18.24	3.579638	0.65992	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.23147	1.92;1.92;1.92	4.39	3.23	0.37069	.	0.000000	0.40640	N	0.001053	T	0.49677	0.1571	M	0.83774	2.66	0.49798	D	0.999824	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	T	0.54543	-0.8278	10	0.87932	D	0	-0.6142	9.1028	0.36678	0.9088:0.0:0.0912:0.0	.	496;496	O00562-2;O00562	.;PITM1_HUMAN	R	496	ENSP00000437286:L496R;ENSP00000398787:L496R;ENSP00000348772:L496R	ENSP00000348772:L496R	L	-	2	0	PITPNM1	67022367	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.213000	0.77950	1.856000	0.53863	0.449000	0.29647	CTG		0.652	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1		NM_004910	
PKHD1L1	93035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	110460595	110460595	+	Silent	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr8:110460595T>C	ENST00000378402.5	+	39	6104	c.6000T>C	c.(5998-6000)aaT>aaC	p.N2000N		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2000	IPT/TIG 13.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.N2002N(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCCGCTTAATATTCAAAATA	0.373										HNSCC(38;0.096)																																							1	Substitution - coding silent(1)	kidney(1)											58.0	57.0	57.0					8																	110460595		1852	4109	5961	SO:0001819	synonymous_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6000T>C	8.37:g.110460595T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																				0.373	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
PORCN	64840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	48378842	48378842	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:48378842T>G	ENST00000326194.6	+	14	1407	c.1364T>G	c.(1363-1365)aTc>aGc	p.I455S	PORCN_ENST00000355092.3_Missense_Mutation_p.I449S|PORCN_ENST00000367574.4_Missense_Mutation_p.I373S|PORCN_ENST00000355961.4_Missense_Mutation_p.I450S|EBP_ENST00000495186.1_5'Flank|PORCN_ENST00000537758.1_Missense_Mutation_p.I455S|PORCN_ENST00000359882.4_Missense_Mutation_p.I449S|PORCN_ENST00000361988.3_Missense_Mutation_p.I444S	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	455					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)	p.I455S(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGATGCTGGATCTTCTACCGT	0.562																																																	1	Substitution - Missense(1)	kidney(1)											146.0	109.0	122.0					X																	48378842		2203	4300	6503	SO:0001583	missense	64840			AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.1364T>G	X.37:g.48378842T>G	ENSP00000322304:p.Ile455Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	ENST00000326194.6	37	CCDS14299.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.230417	0.79688	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	D;D;D;D;D;D;D	0.97888	-3.59;-4.59;-3.3;-3.59;-3.59;-4.59;-3.59	5.31	5.31	0.75309	.	0.255981	0.41001	D	0.000965	D	0.96106	0.8731	L	0.40543	1.245	0.49051	D	0.999742	P;P;P;P;P	0.51791	0.948;0.725;0.59;0.893;0.948	P;B;B;P;P	0.47528	0.549;0.347;0.347;0.463;0.549	D	0.96003	0.8995	10	0.72032	D	0.01	-10.3226	12.1995	0.54317	0.0:0.0:0.0:1.0	.	449;455;373;444;450	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	S	449;455;373;450;444;455;449	ENSP00000352946:I449S;ENSP00000446401:I455S;ENSP00000356546:I373S;ENSP00000348233:I450S;ENSP00000354978:I444S;ENSP00000322304:I455S;ENSP00000347207:I449S	ENSP00000322304:I455S	I	+	2	0	PORCN	48263786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.970000	0.76099	1.785000	0.52413	0.372000	0.22366	ATC		0.562	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1		NM_022825	
PPP6R1	22870	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	55752433	55752436	+	Frame_Shift_Del	DEL	ATGG	ATGG	-	rs370452155		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	ATGG	ATGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr19:55752433_55752436delATGG	ENST00000412770.2	-	10	1739_1742	c.1173_1176delCCAT	c.(1171-1176)ttccatfs	p.FH391fs	PPP6R1_ENST00000587283.1_Frame_Shift_Del_p.FH391fs	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	391	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						TGAAGACATAATGGAAGAAGAGGT	0.627																																																	0																																										SO:0001589	frameshift_variant	22870			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1173_1176delCCAT	19.37:g.55752433_55752436delATGG	ENSP00000414202:p.Phe391fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Frame_Shift_Del	DEL	ENST00000412770.2	37	CCDS46186.1																																																																																				0.627	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1		NM_014931	
PRG4	10216	hgsc.bcm.edu	37	1	186276284	186276286	+	In_Frame_Del	DEL	CTC	CTC	-	rs200031345|rs145095882|rs143141440	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:186276284_186276286delCTC	ENST00000445192.2	+	7	1478_1480	c.1433_1435delCTC	c.(1432-1437)actccc>acc	p.P479del	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_In_Frame_Del_p.P386del|PRG4_ENST00000367483.4_In_Frame_Del_p.P438del|PRG4_ENST00000367486.3_In_Frame_Del_p.P436del	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	479	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P479delP(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GCACCCACCACTCCCAAAGAGCC	0.65																																																	1	Deletion - In frame(1)	large_intestine(1)							,,,	348,3912		14,320,1796					,,,	-1.4	0.0			89	1023,7215		71,881,3167	no	coding,coding,coding,coding	PRG4	NM_005807.3,NM_001127710.1,NM_001127709.1,NM_001127708.1	,,,	85,1201,4963	A1A1,A1R,RR		12.4181,8.169,10.9698	,,,	,,,		1371,11127				SO:0001651	inframe_deletion	23572			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1433_1435delCTC	1.37:g.186276284_186276286delCTC	ENSP00000399679:p.Pro479del	Somatic		WXS	Illumina HiSeq	Phase_I	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	In_Frame_Del	DEL	ENST00000445192.2	37	CCDS1369.1																																																																																				0.650	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1		NM_005807	
PRICKLE1	144165	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	42853975	42853975	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:42853975T>G	ENST00000455697.1	-	8	2417	c.2132A>C	c.(2131-2133)aAa>aCa	p.K711T	PRICKLE1_ENST00000548696.1_Missense_Mutation_p.K711T|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.K711T|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.K711T|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.K711T	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	711					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.K711T(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CTGTATAAATTTCTCATAGTT	0.478																																																	1	Substitution - Missense(1)	kidney(1)											73.0	76.0	75.0					12																	42853975		2203	4300	6503	SO:0001583	missense	144165			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2132A>C	12.37:g.42853975T>G	ENSP00000401060:p.Lys711Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.189479	0.38707	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94	5.58	4.44	0.53790	.	0.323197	0.38326	N	0.001739	T	0.76709	0.4025	L	0.36672	1.1	0.41513	D	0.988357	B	0.32302	0.363	B	0.24006	0.05	T	0.75241	-0.3387	10	0.56958	D	0.05	0.2251	11.4484	0.50138	0.0:0.0704:0.0:0.9296	.	711	Q96MT3	PRIC1_HUMAN	T	711	ENSP00000401060:K711T;ENSP00000398947:K711T;ENSP00000448359:K711T;ENSP00000345064:K711T;ENSP00000449819:K711T	ENSP00000345064:K711T	K	-	2	0	PRICKLE1	41140242	1.000000	0.71417	0.814000	0.32528	0.997000	0.91878	3.807000	0.55591	1.057000	0.40506	0.533000	0.62120	AAA		0.478	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1			
PRRC2B	84726	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	134350077	134350077	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:134350077C>T	ENST00000357304.4	+	15	2616	c.2561C>T	c.(2560-2562)cCa>cTa	p.P854L	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	854							poly(A) RNA binding (GO:0044822)	p.P854L(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						AGGTGTTCCCCATTGGAGCCT	0.527																																																	2	Substitution - Missense(2)	kidney(2)											28.0	30.0	30.0					9																	134350077		1947	4133	6080	SO:0001583	missense	84726			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.2561C>T	9.37:g.134350077C>T	ENSP00000349856:p.Pro854Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856960	0.71834	.	.	ENSG00000130723	ENST00000357304;ENST00000418650;ENST00000456307	T;T	0.13657	2.57;2.57	5.7	5.7	0.88788	.	.	.	.	.	T	0.16171	0.0389	L	0.27053	0.805	0.80722	D	1	P;P	0.42296	0.775;0.518	B;B	0.43916	0.436;0.115	T	0.00888	-1.1526	9	0.72032	D	0.01	.	18.8293	0.92132	0.0:1.0:0.0:0.0	.	150;854	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	L	854;150;123	ENSP00000349856:P854L;ENSP00000400608:P123L	ENSP00000349856:P854L	P	+	2	0	PRRC2B	133339898	0.928000	0.31464	0.597000	0.28824	0.977000	0.68977	2.747000	0.47475	2.683000	0.91414	0.655000	0.94253	CCA		0.527	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
PTPRM	5797	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	7955120	7955120	+	Splice_Site	SNP	A	A	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr18:7955120A>T	ENST00000332175.8	+	7	1877	c.840A>T	c.(838-840)gaA>gaT	p.E280D	PTPRM_ENST00000444013.1_Splice_Site_p.E67D|PTPRM_ENST00000400060.4_Splice_Site_p.E280D|PTPRM_ENST00000580170.1_Splice_Site_p.E280D|PTPRM_ENST00000400053.4_Splice_Site_p.E218D	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	280					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E280D(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GTCTTTCAGAACCACCCGTTC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											64.0	62.0	63.0					18																	7955120		2203	4300	6503	SO:0001630	splice_region_variant	5797			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.839-1A>T	18.37:g.7955120A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.618058	0.46736	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	6.02	-8.1	0.01086	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.160023	0.56097	D	0.000035	T	0.69033	0.3066	L	0.55990	1.75	0.44694	D	0.997684	B;B;B	0.25719	0.132;0.032;0.032	B;B;B	0.21151	0.033;0.011;0.011	T	0.37174	-0.9717	10	0.40728	T	0.16	.	20.6393	0.99526	0.2766:0.0:0.7234:0.0	.	67;280;280	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	D	280;280;218;67	ENSP00000331418:E280D;ENSP00000382933:E280D;ENSP00000382927:E218D;ENSP00000387608:E67D	ENSP00000331418:E280D	E	+	3	2	PTPRM	7945120	0.770000	0.28543	0.509000	0.27700	0.960000	0.62799	-0.017000	0.12590	-1.573000	0.01659	-0.408000	0.06270	GAA		0.443	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1			Missense_Mutation
PUM1	9698	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	31447563	31447563	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:31447563C>T	ENST00000257075.5	-	10	1534	c.1441G>A	c.(1441-1443)Gcc>Acc	p.A481T	PUM1_ENST00000373741.4_Missense_Mutation_p.A517T|PUM1_ENST00000440538.2_Missense_Mutation_p.A482T|PUM1_ENST00000373742.2_Missense_Mutation_p.A422T|PUM1_ENST00000426105.2_Missense_Mutation_p.A481T|PUM1_ENST00000423018.2_Missense_Mutation_p.A385T|PUM1_ENST00000373747.3_Missense_Mutation_p.A482T|PUM1_ENST00000490546.1_5'UTR|PUM1_ENST00000424085.2_Missense_Mutation_p.A239T	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	481	Ala-rich.|Gln-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)	p.A481T(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GCTGCAGCGGCAGCGGCAGCT	0.507																																																	1	Substitution - Missense(1)	kidney(1)											62.0	62.0	62.0					1																	31447563		2203	4300	6503	SO:0001583	missense	9698			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1441G>A	1.37:g.31447563C>T	ENSP00000257075:p.Ala481Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.862048|4.862048	0.91433|0.91433	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000543952|ENST00000525843;ENST00000498419;ENST00000532678	T;T;T;T;T;T;T;T|.	0.18016|.	2.24;2.27;2.49;2.48;2.5;2.46;2.5;2.27|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.047154|.	0.85682|.	D|.	0.000000|.	T|T	0.66963|0.66963	0.2843|0.2843	L|L	0.37630|0.37630	1.12|1.12	0.58432|0.58432	D|D	0.999999|0.999999	D;P;D;D;D;D;D;D|.	0.59357|.	0.985;0.948;0.973;0.969;0.985;0.973;0.985;0.985|.	P;P;P;P;P;P;P;P|.	0.55923|.	0.638;0.588;0.638;0.766;0.638;0.638;0.638;0.787|.	T|T	0.58769|0.58769	-0.7578|-0.7578	10|5	0.56958|.	D|.	0.05|.	-7.754|-7.754	20.4549|20.4549	0.99139|0.99139	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	422;385;517;482;481;481;482;481|.	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5|.	.;.;.;.;PUM1_HUMAN;.;.;.|.	T|Y	239;481;482;219;481;482;517;385;422;481|498;192;168	ENSP00000400141:A239T;ENSP00000257075:A481T;ENSP00000362852:A482T;ENSP00000391723:A481T;ENSP00000401777:A482T;ENSP00000362846:A517T;ENSP00000399440:A385T;ENSP00000362847:A422T|.	ENSP00000257075:A481T|.	A|C	-|-	1|2	0|0	PUM1|PUM1	31220150|31220150	1.000000|1.000000	0.71417|0.71417	0.309000|0.309000	0.25155|0.25155	0.789000|0.789000	0.44602|0.44602	5.931000|5.931000	0.70113|0.70113	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCC|TGC		0.507	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1			
RANBP6	26953	broad.mit.edu;hgsc.bcm.edu	37	9	6013478	6013478	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:6013478T>G	ENST00000259569.5	-	1	2140	c.2130A>C	c.(2128-2130)caA>caC	p.Q710H	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	710					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q710H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GCTTCACAACTTGTTCTGTAT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											119.0	122.0	121.0					9																	6013478		2203	4300	6503	SO:0001583	missense	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2130A>C	9.37:g.6013478T>G	ENSP00000259569:p.Gln710His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.537389	0.45176	.	.	ENSG00000137040	ENST00000259569	T	0.24723	1.84	3.79	2.64	0.31445	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.38374	0.1038	L	0.60067	1.865	0.53688	D	0.999979	D;D	0.64830	0.994;0.994	P;P	0.61201	0.827;0.885	T	0.12889	-1.0530	10	0.62326	D	0.03	-7.507	7.7413	0.28843	0.0:0.1035:0.0:0.8965	.	298;710	B4DTX6;O60518	.;RNBP6_HUMAN	H	710	ENSP00000259569:Q710H	ENSP00000259569:Q710H	Q	-	3	2	RANBP6	6003478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.461000	0.35255	0.803000	0.34113	0.528000	0.53228	CAA		0.403	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1		NM_012416	
RFX8	731220	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	102019046	102019047	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:102019046_102019047insA	ENST00000376826.2	-	14	1434_1435	c.1435_1436insT	c.(1435-1437)tccfs	p.S479fs	RFX8_ENST00000428343.1_Frame_Shift_Ins_p.S366fs			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						CGACAGTGAGGAATTCAGAGAA	0.599																																																	0																																										SO:0001589	frameshift_variant	731220			AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1436dupT	2.37:g.102019048_102019048dupA	ENSP00000366022:p.Ser479fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DQ32	Frame_Shift_Ins	INS	ENST00000376826.2	37																																																																																					0.599	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001145664	
RGMA	56963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	93616253	93616253	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr15:93616253G>C	ENST00000329082.7	-	2	293	c.22C>G	c.(22-24)Cta>Gta	p.L8V	RGMA_ENST00000542321.2_5'UTR|RGMA_ENST00000556087.1_5'UTR|RGMA_ENST00000557301.1_Missense_Mutation_p.L16V|RGMA_ENST00000543599.1_5'UTR|RGMA_ENST00000538818.1_5'UTR|RGMA_ENST00000556658.1_5'UTR|RGMA_ENST00000557420.1_5'UTR|RGMA_ENST00000425933.2_5'UTR	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	8					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.L8V(1)|p.L16V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GTTACCACTAGCCTCTCCCTG	0.592																																																	2	Substitution - Missense(2)	kidney(2)											35.0	45.0	42.0					15																	93616253		1911	4123	6034	SO:0001583	missense	56963			AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.22C>G	15.37:g.93616253G>C	ENSP00000330005:p.Leu8Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	37	CCDS45357.1	.	.	.	.	.	.	.	.	.	.	G	1.869	-0.460784	0.04508	.	.	ENSG00000182175	ENST00000329082;ENST00000557301	D;D	0.90788	-2.73;-2.7	3.82	2.69	0.31865	.	.	.	.	.	T	0.76644	0.4016	N	0.08118	0	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.003	T	0.67991	-0.5527	9	0.14252	T	0.57	-16.517	7.439	0.27172	0.0:0.1349:0.6127:0.2523	.	16;8	G3V518;Q96B86	.;RGMA_HUMAN	V	8;16	ENSP00000330005:L8V;ENSP00000452126:L16V	ENSP00000330005:L8V	L	-	1	2	RGMA	91417257	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.389000	0.34453	1.819000	0.53055	0.455000	0.32223	CTA		0.592	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1		NM_020211	
RHOJ	57381	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	63735887	63735887	+	Splice_Site	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr14:63735887G>C	ENST00000316754.3	+	2	699		c.e2+1		RHOJ_ENST00000555125.1_Splice_Site|RHOJ_ENST00000557133.1_3'UTR	NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J						actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.?(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		CGCGGGACAGGTACATTTTTA	0.453																																																	1	Unknown(1)	kidney(1)											138.0	121.0	127.0					14																	63735887		2203	4300	6503	SO:0001630	splice_region_variant	57381			AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	ENST00000316754.3:c.237+1G>C	14.37:g.63735887G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q96KC1	Splice_Site	SNP	ENST00000316754.3	37	CCDS9757.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015377	0.75161	.	.	ENSG00000126785	ENST00000316754;ENST00000555125	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6027	0.84820	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RHOJ	62805640	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.107000	0.71517	2.599000	0.87857	0.655000	0.94253	.		0.453	RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276975.3			Intron
RMND1	55005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	151726969	151726969	+	Silent	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:151726969G>T	ENST00000367303.4	-	11	1325	c.1203C>A	c.(1201-1203)gtC>gtA	p.V401V	RMND1_ENST00000336451.3_Silent_p.V190V	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	401					translation (GO:0006412)	mitochondrion (GO:0005739)		p.V401V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		TTTCATTCATGACCTATGTAA	0.368																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	79.0	82.0					6																	151726969		2203	4300	6503	SO:0001819	synonymous_variant	55005			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.1203C>A	6.37:g.151726969G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Silent	SNP	ENST00000367303.4	37	CCDS5232.1																																																																																				0.368	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042718.2		NM_017909	
SAAL1	113174	hgsc.bcm.edu	37	11	18127558	18127559	+	In_Frame_Ins	INS	-	-	CGG	rs74589784|rs72431213|rs148650821	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:18127558_18127559insCGG	ENST00000524803.1	-	1	79_80	c.30_31insCCG	c.(28-33)ccgggt>ccgCCGggt	p.10_11insP	SAAL1_ENST00000300013.4_In_Frame_Ins_p.10_11insP|SAAL1_ENST00000529318.1_In_Frame_Ins_p.10_11insP|SAAL1_ENST00000533851.1_5'UTR			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	10				P -> PP (in Ref. 3; AAH12010). {ECO:0000305}.						breast(2)|large_intestine(5)|lung(8)	15						TTGTCGCGACCCGGCGGCGGCG	0.673											OREG0020819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		734	0.146565	0.0174	0.1556	5008	,	,		17393	0.1349		0.2604	False		,,,				2504	0.2096																0																																										SO:0001652	inframe_insertion	113174			AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.28_30dupCCG	11.37:g.18127565_18127567dupCGG	ENSP00000432487:p.Pro10_Pro10dup	Somatic	723	WXS	Illumina HiSeq	Phase_I	A6NH05	In_Frame_Ins	INS	ENST00000524803.1	37	CCDS31439.1																																																																																				0.673	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1		NM_138421	
MSMO1	6307	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	166254730	166254730	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr4:166254730delT	ENST00000261507.6	+	2	381	c.208delT	c.(208-210)tttfs	p.F70fs	MSMO1_ENST00000393766.2_Intron|MSMO1_ENST00000504317.1_Frame_Shift_Del_p.F70fs	NM_006745.4	NP_006736.1	Q15800	MSMO1_HUMAN	methylsterol monooxygenase 1	70					cholesterol biosynthetic process (GO:0006695)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-4 methylsterol oxidase activity (GO:0000254)|iron ion binding (GO:0005506)										TTTACCTGGATTTTTATTTCA	0.274																																																	0													68.0	72.0	71.0					4																	166254730		2203	4298	6501	SO:0001589	frameshift_variant	0			U93162	CCDS3809.1, CCDS43280.1	4q32-q34	2013-03-04	2011-09-01	2011-09-01	ENSG00000052802	ENSG00000052802	1.14.13.72	"""Fatty acid hydroxylase domain containing"""	10545	protein-coding gene	gene with protein product		607545	"""sterol-C4-methyl oxidase-like"""	SC4MOL		8663358	Standard	NM_006745		Approved	DESP4, ERG25	uc003ire.3	Q15800	OTTHUMG00000161126	ENST00000261507.6:c.208delT	4.37:g.166254730delT	ENSP00000261507:p.Phe70fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q3|A8MYF6|D3DP32|Q32Q24	Frame_Shift_Del	DEL	ENST00000261507.6	37	CCDS3809.1																																																																																				0.274	MSMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363880.1		NM_006745	
SCN4A	6329	broad.mit.edu;hgsc.bcm.edu	37	17	62029159	62029159	+	Silent	SNP	G	G	T	rs371914255		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:62029159G>T	ENST00000435607.1	-	14	2554	c.2478C>A	c.(2476-2478)atC>atA	p.I826I	SCN4A_ENST00000578147.1_Silent_p.I826I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	826					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.I826I(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGATGCGCCCGATGGCAATCT	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											13.0	14.0	14.0					17																	62029159		2042	4181	6223	SO:0001819	synonymous_variant	6329			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2478C>A	17.37:g.62029159G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																				0.607	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			NM_000334	
SCRN1	9805	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	29980329	29980330	+	Frame_Shift_Ins	INS	-	-	C	rs371750124		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:29980329_29980330insC	ENST00000426154.1	-	5	883_884	c.707_708insG	c.(706-708)ggtfs	p.G236fs	SCRN1_ENST00000409497.1_Frame_Shift_Ins_p.G236fs|SCRN1_ENST00000434476.2_Frame_Shift_Ins_p.G256fs|SCRN1_ENST00000242059.5_Frame_Shift_Ins_p.G236fs|SCRN1_ENST00000425819.2_Frame_Shift_Ins_p.G168fs|SCRN1_ENST00000416113.2_Intron	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	236					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						CTTTGCCAGCACCGCAGTCTAG	0.48																																																	0																																										SO:0001589	frameshift_variant	9805			D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.708dupG	7.37:g.29980331_29980331dupC	ENSP00000409068:p.Gly236fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Frame_Shift_Ins	INS	ENST00000426154.1	37	CCDS5422.1																																																																																				0.480	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2		NM_014766	
SEC14L5	9717	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	5040871	5040871	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr16:5040871A>G	ENST00000251170.7	+	5	629	c.449A>G	c.(448-450)aAg>aGg	p.K150R		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	150	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)	p.K150R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						ATCGCCATGAAGCAGTACACC	0.527																																																	1	Substitution - Missense(1)	kidney(1)											45.0	47.0	46.0					16																	5040871		2112	4223	6335	SO:0001583	missense	9717			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.449A>G	16.37:g.5040871A>G	ENSP00000251170:p.Lys150Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000251170.7	37	CCDS45403.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.004606	0.74932	.	.	ENSG00000103184	ENST00000251170	T	0.19105	2.17	4.37	3.28	0.37604	PRELI/MSF1 (2);	0.087760	0.47455	N	0.000235	T	0.38665	0.1049	M	0.77103	2.36	0.53688	D	0.999976	B	0.29671	0.254	P	0.47827	0.558	T	0.19353	-1.0308	10	0.45353	T	0.12	-24.4667	9.7337	0.40376	0.9174:0.0:0.0826:0.0	.	150	O43304	S14L5_HUMAN	R	150	ENSP00000251170:K150R	ENSP00000251170:K150R	K	+	2	0	SEC14L5	4980872	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.838000	0.75359	0.719000	0.32188	0.454000	0.30748	AAG		0.527	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434379.1			
SEMA3B	7869	hgsc.bcm.edu	37	3	50310781	50310781	+	RNA	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:50310781C>T	ENST00000418948.1	+	0	951							Q13214	SEM3B_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B						axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			central_nervous_system(2)|kidney(1)|lung(2)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		ACCCAGACGACGACAAAATCT	0.622											OREG0015583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													43.0	48.0	47.0					3																	50310781		1912	4111	6023			7869			U28369	CCDS74941.1	3p21.3	2013-01-11			ENSG00000012171	ENSG00000012171		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10724	protein-coding gene	gene with protein product		601281		SEMAA		7748561, 8633026	Standard	NM_004636		Approved	SemA, semaV, LUCA-1, sema5	uc003cyu.3	Q13214	OTTHUMG00000156970		3.37:g.50310781C>T		Somatic	968	WXS	Illumina HiSeq	Phase_I	Q6GU46|Q8TB71|Q8TDV7|Q93018|Q96GX0	Missense_Mutation	SNP	ENST00000418948.1	37																																																																																					0.622	SEMA3B-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000346890.2		NM_001005914	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350758	50350759	+	In_Frame_Ins	INS	-	-	TGCTGCTGCTGT	rs201922875|rs553160982		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:50350758_50350759insTGCTGCTGCTGT	ENST00000289292.7	-	6	3666_3667	c.3383_3384insACAGCAGCAGCA	c.(3382-3384)cag>caACAGCAGCAGCAg	p.1128_1128Q>QQQQQ	SHROOM4_ENST00000376020.2_In_Frame_Ins_p.1128_1128Q>QQQQQ|SHROOM4_ENST00000460112.3_In_Frame_Ins_p.1012_1012Q>QQQQQ			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1128	Gln-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctgttgcttctgctgctgctg	0.589																																																	0										12,1892,1813		0,4,5,3,450,721,267,412,263						-6.4	0.0			16	21,2147,4298		1,7,3,9,306,942,586,1095,1163	no	codingComplex	SHROOM4	NM_020717.3		1,11,8,12,756,1663,853,1507,1426	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		33.5292,49.0987,39.9882				33,4039,6111				SO:0001652	inframe_insertion	57477			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3372_3383dupACAGCAGCAGCA	X.37:g.50350758_50350759insTGCTGCTGCTGT	ENSP00000289292:p.GlnGlnGlnGln1128dup	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2X9|D6RFW0|Q96LA0	In_Frame_Ins	INS	ENST00000289292.7	37	CCDS35277.1																																																																																				0.589	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4		NM_020717	
SLC5A12	159963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	26695022	26695022	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:26695022delA	ENST00000396005.3	-	14	1943	c.1634delT	c.(1633-1635)ttafs	p.L545fs		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	545					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AAAGCAAAATAAATTACAAAC	0.398																																																	0													118.0	118.0	118.0					11																	26695022		1986	4184	6170	SO:0001589	frameshift_variant	159963			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1634delT	11.37:g.26695022delA	ENSP00000379326:p.Leu545fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q86UC7	Frame_Shift_Del	DEL	ENST00000396005.3	37	CCDS7860.2																																																																																				0.398	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1		NM_178498	
SLC15A3	51296	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	60711236	60711236	+	Silent	SNP	G	G	A	rs373300409		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr11:60711236G>A	ENST00000227880.3	-	3	1154	c.921C>T	c.(919-921)atC>atT	p.I307I		NM_016582.2	NP_057666.1	Q8IY34	S15A3_HUMAN	solute carrier family 15 (oligopeptide transporter), member 3	307					ion transport (GO:0006811)|peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	symporter activity (GO:0015293)	p.I307I(1)		central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)	17						GGAAGTTGGCGATGTCCTCTT	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20023	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											109.0	92.0	98.0					11																	60711236		2203	4299	6502	SO:0001819	synonymous_variant	51296			AB020598	CCDS7998.1	11q12.2	2013-07-18	2013-07-18		ENSG00000110446	ENSG00000110446		"""Solute carriers"""	18068	protein-coding gene	gene with protein product		610408	"""solute carrier family 15, member 3"""			11336635, 11741232	Standard	NM_016582		Approved	PHT2, hPTR3	uc001nqn.2	Q8IY34	OTTHUMG00000167804	ENST00000227880.3:c.921C>T	11.37:g.60711236G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9P2X9	Silent	SNP	ENST00000227880.3	37	CCDS7998.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526466	0.27299	.	.	ENSG00000110446	ENST00000442626;ENST00000537307	.	.	.	4.77	-9.54	0.00572	.	.	.	.	.	T	0.16896	0.0406	.	.	.	0.22989	N	0.998468	.	.	.	.	.	.	T	0.12915	-1.0529	5	0.23302	T	0.38	-0.0469	4.3701	0.11244	0.4022:0.3785:0.1338:0.0854	.	.	.	.	L	307;10	.	ENSP00000403318:S307L	S	-	2	0	SLC15A3	60467812	0.000000	0.05858	0.024000	0.17045	0.538000	0.34931	-1.533000	0.02215	-2.396000	0.00582	-0.156000	0.13503	TCG		0.592	SLC15A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396366.1		NM_016582	
SP1	6667	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	53776832	53776832	+	Silent	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:53776832T>G	ENST00000327443.4	+	3	1199	c.1101T>G	c.(1099-1101)gcT>gcG	p.A367A	SP1_ENST00000426431.2_Silent_p.A360A	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	367	Ser/Thr-rich.|Transactivation domain B (Gln-rich).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A367A(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGTCTGATGCTCTGAACATCC	0.498																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	75.0	76.0					12																	53776832		2203	4300	6503	SO:0001819	synonymous_variant	6667			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1101T>G	12.37:g.53776832T>G		Somatic		WXS	Illumina HiSeq	Phase_I	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Silent	SNP	ENST00000327443.4	37	CCDS8857.1																																																																																				0.498	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1			
SRGAP2B	647135	broad.mit.edu;hgsc.bcm.edu	37	1	206516309	206516309	+	IGR	SNP	A	A	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:206516309A>G								CTSE (184205 upstream) : SRGAP2-AS1 (35909 downstream)														p.N37S(1)									CCTGAATAATATCATTCCTCG	0.453																																																	1	Substitution - Missense(1)	kidney(1)											20.0	18.0	18.0					1																	206516309		1826	4059	5885	SO:0001628	intergenic_variant	23380																															1.37:g.206516309A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP		37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.946|3.946	-0.013282|-0.013282	0.07727|0.07727	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000414359|ENST00000295713	.|.	.|.	.|.	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65365|0.65365	0.2684|0.2684	.|.	.|.	.|.	0.31700|.	N|.	0.640816|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.71457|0.71457	-0.4587|-0.4587	5|3	0.13470|.	T|.	0.59|.	.|.	14.5359|14.5359	0.67960|0.67960	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	V|C	38|37	.|.	ENSP00000408089:I38V|.	I|Y	+|+	1|2	0|0	SRGAP2|SRGAP2	204582932|204582932	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	2.909000|2.909000	0.48758|0.48758	1.838000|1.838000	0.53458|0.53458	0.454000|0.454000	0.30748|0.30748	ATC|TAT	0	0.453									
SPATA17	128153	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	217947704	217947704	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:217947704G>T	ENST00000366933.4	+	7	603	c.548G>T	c.(547-549)aGa>aTa	p.R183I		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	183						cytoplasm (GO:0005737)		p.R183I(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TCACCCTTCAGAAAAGAGCCT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											83.0	82.0	82.0					1																	217947704		2203	4300	6503	SO:0001583	missense	128153			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.548G>T	1.37:g.217947704G>T	ENSP00000355900:p.Arg183Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190511	0.78789	.	.	ENSG00000162814	ENST00000366933	T	0.48201	0.82	5.45	4.53	0.55603	.	0.048454	0.85682	D	0.000000	T	0.65801	0.2726	M	0.78916	2.43	0.53688	D	0.99997	D	0.69078	0.997	D	0.65773	0.938	T	0.69932	-0.5011	10	0.72032	D	0.01	-11.2255	11.3603	0.49640	0.0697:0.1267:0.8037:0.0	.	183	Q96L03	SPT17_HUMAN	I	183	ENSP00000355900:R183I	ENSP00000355900:R183I	R	+	2	0	SPATA17	216014327	1.000000	0.71417	0.828000	0.32881	0.981000	0.71138	4.655000	0.61476	1.429000	0.47314	0.563000	0.77884	AGA		0.378	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2		NM_138796	
TBC1D22B	55633	hgsc.bcm.edu	37	6	37250060	37250060	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:37250060G>A	ENST00000373491.3	+	4	667	c.521G>A	c.(520-522)gGg>gAg	p.G174E		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	174							Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			AACGCTTCTGGGGCCCCCCCA	0.572																																																	0													53.0	56.0	55.0					6																	37250060		2203	4300	6503	SO:0001583	missense	55633			AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.521G>A	6.37:g.37250060G>A	ENSP00000362590:p.Gly174Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Missense_Mutation	SNP	ENST00000373491.3	37	CCDS4832.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257443	0.80246	.	.	ENSG00000065491	ENST00000373491	T	0.14144	2.53	5.81	5.81	0.92471	.	0.102764	0.64402	D	0.000003	T	0.06462	0.0166	M	0.66939	2.045	0.80722	D	1	P	0.36789	0.57	B	0.28916	0.096	T	0.05835	-1.0861	10	0.02654	T	1	.	18.854	0.92244	0.0:0.0:1.0:0.0	.	174	Q9NU19	TB22B_HUMAN	E	174	ENSP00000362590:G174E	ENSP00000362590:G174E	G	+	2	0	TBC1D22B	37358038	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.430000	0.97488	2.746000	0.94184	0.655000	0.94253	GGG		0.572	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040402.1		NM_017772	
TBC1D3F	84218	hgsc.bcm.edu	37	17	36294433	36294434	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:36294433_36294434insC	ENST00000327454.6	+	14	1629_1630	c.1483_1484insC	c.(1483-1485)gctfs	p.A495fs	TBC1D3F_ENST00000378174.5_3'UTR|TBC1D3F_ENST00000539424.1_Frame_Shift_Ins_p.A415fs|TBC1D3F_ENST00000505415.1_Frame_Shift_Ins_p.A473fs	NM_032258.2	NP_115634.2	A6NER0	TBC3F_HUMAN	TBC1 domain family, member 3F	495						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			liver(1)|pancreas(1)	2						CTGCTGGCAGGCTGAACACCCT	0.629																																																	0																																										SO:0001589	frameshift_variant	729873					17q12	2014-09-16				ENSG00000275954			18257	protein-coding gene	gene with protein product		610809				16863688	Standard	NM_032258		Approved			A6NER0	OTTHUMG00000188428	ENST00000327454.6:c.1484dupC	17.37:g.36294434_36294434dupC	ENSP00000329256:p.Ala495fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000327454.6	37	CCDS45657.1																																																																																				0.629	TBC1D3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256100.3		NM_032258.2	
TBP	6908	hgsc.bcm.edu	37	6	170871043	170871043	+	Silent	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:170871043G>A	ENST00000392092.2	+	3	498	c.219G>A	c.(217-219)caG>caA	p.Q73Q	TBP_ENST00000230354.6_Silent_p.Q73Q|TBP_ENST00000540980.1_Silent_p.Q53Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	73	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q73Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcaacagcaacagcagc	0.562																																																	1	Substitution - coding silent(1)	endometrium(1)											17.0	21.0	20.0					6																	170871043		1987	3877	5864	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.219G>A	6.37:g.170871043G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.562	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2		NM_003194	
TBP	6908	hgsc.bcm.edu	37	6	170871055	170871055	+	Silent	SNP	G	G	A	rs112928724|rs369312237		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:170871055G>A	ENST00000392092.2	+	3	510	c.231G>A	c.(229-231)caG>caA	p.Q77Q	TBP_ENST00000230354.6_Silent_p.Q77Q|TBP_ENST00000540980.1_Silent_p.Q57Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	77	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacagcagcagcagcagcagc	0.572																																																	0													14.0	18.0	17.0					6																	170871055		1934	3804	5738	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.231G>A	6.37:g.170871055G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2		NM_003194	
TBP	6908	hgsc.bcm.edu	37	6	170871097	170871097	+	Silent	SNP	G	G	A	rs200496051	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:170871097G>A	ENST00000392092.2	+	3	552	c.273G>A	c.(271-273)caG>caA	p.Q91Q	TBP_ENST00000230354.6_Silent_p.Q91Q|TBP_ENST00000540980.1_Silent_p.Q71Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	91	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcaac	0.617													G|||	38	0.00758786	0.0015	0.0014	5008	,	,		13915	0.0159		0.002	False		,,,				2504	0.0174																0													24.0	30.0	28.0					6																	170871097		1944	3761	5705	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.273G>A	6.37:g.170871097G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.617	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2		NM_003194	
TCHH	7062	hgsc.bcm.edu	37	1	152084694	152084696	+	In_Frame_Del	DEL	CTC	CTC	-	rs574276899	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:152084694_152084696delCTC	ENST00000368804.1	-	2	996_998	c.997_999delGAG	c.(997-999)gagdel	p.E333del		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	333	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			gctcgcgcctctcctcctgctgc	0.709														70	0.0139776	0.0068	0.0245	5008	,	,		15362	0.0		0.0437	False		,,,				2504	0.0																0										30,3864		1,28,1918						0.7	0.0			15	270,7620		5,260,3680	no	coding	TCHH	NM_007113.2		6,288,5598	A1A1,A1R,RR		3.4221,0.7704,2.5458				300,11484				SO:0001651	inframe_deletion	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.997_999delGAG	1.37:g.152084697_152084699delCTC	ENSP00000357794:p.Glu333del	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VUI3	In_Frame_Del	DEL	ENST00000368804.1	37	CCDS41396.1																																																																																				0.709	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2		NM_007113	
TMEM26	219623	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	63212753	63212753	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr10:63212753C>A	ENST00000399298.3	-	1	455	c.87G>T	c.(85-87)gaG>gaT	p.E29D	RP11-809M12.1_ENST00000389640.4_RNA|TMEM26_ENST00000399293.1_Missense_Mutation_p.E29D	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	29						integral component of membrane (GO:0016021)		p.E29D(1)		kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					CCTTCTTCACCTCGGTCACTC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											67.0	80.0	76.0					10																	63212753		2056	4195	6251	SO:0001583	missense	219623			BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.87G>T	10.37:g.63212753C>A	ENSP00000382237:p.Glu29Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	ENST00000399298.3	37	CCDS41530.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775473	0.49786	.	.	ENSG00000196932	ENST00000399298;ENST00000399293	.	.	.	5.14	3.28	0.37604	.	0.713793	0.14370	N	0.323879	T	0.30293	0.0760	L	0.44542	1.39	0.20638	N	0.999876	B	0.26708	0.157	B	0.31191	0.125	T	0.26950	-1.0088	9	0.13108	T	0.6	-21.2517	4.6019	0.12357	0.0:0.4296:0.2827:0.2876	.	29	Q6ZUK4	TMM26_HUMAN	D	29	.	ENSP00000382232:E29D	E	-	3	2	TMEM26	62882759	0.726000	0.28059	0.926000	0.36857	0.927000	0.56198	0.093000	0.15086	0.743000	0.32719	0.655000	0.94253	GAG		0.627	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1		NM_178505	
TMTC3	160418	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	88560118	88560118	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:88560118C>T	ENST00000266712.6	+	7	1029	c.809C>T	c.(808-810)cCa>cTa	p.P270L		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	270					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)		p.P270L(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						TTTGATAACCCAGCTGCTGTA	0.318																																																	1	Substitution - Missense(1)	kidney(1)											100.0	94.0	96.0					12																	88560118		2203	4300	6503	SO:0001583	missense	160418				CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.809C>T	12.37:g.88560118C>T	ENSP00000266712:p.Pro270Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	ENST00000266712.6	37	CCDS9032.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635373	0.87760	.	.	ENSG00000139324	ENST00000266712	T	0.69561	-0.41	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.87293	0.6141	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90717	0.4632	10	0.66056	D	0.02	-12.0589	18.6916	0.91585	0.0:1.0:0.0:0.0	.	270	Q6ZXV5-2	.	L	270	ENSP00000266712:P270L	ENSP00000266712:P270L	P	+	2	0	TMTC3	87084249	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.751000	0.85126	2.412000	0.81896	0.484000	0.47621	CCA		0.318	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1		NM_181783	
TMTC3	160418	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	88584363	88584363	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:88584363delG	ENST00000266712.6	+	12	1890	c.1670delG	c.(1669-1671)agcfs	p.S557fs		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	557					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						CAAGCAATAAGCATGAGGCCC	0.433																																																	0													113.0	98.0	103.0					12																	88584363		2203	4300	6503	SO:0001589	frameshift_variant	160418				CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1670delG	12.37:g.88584363delG	ENSP00000266712:p.Ser557fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Frame_Shift_Del	DEL	ENST00000266712.6	37	CCDS9032.1																																																																																				0.433	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1		NM_181783	
TRIM11	81559	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	228582654	228582654	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:228582654A>T	ENST00000284551.6	-	6	1437	c.1159T>A	c.(1159-1161)Tac>Aac	p.Y387N	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000493030.2_Missense_Mutation_p.Y262N|TRIM11_ENST00000460651.1_5'UTR	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	387	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y387N(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				GAGGAATTGTAATAGCTCCCC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											91.0	96.0	94.0					1																	228582654		2203	4300	6503	SO:0001583	missense	81559			AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.1159T>A	1.37:g.228582654A>T	ENSP00000284551:p.Tyr387Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	ENST00000284551.6	37	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.860911	0.32884	.	.	ENSG00000154370	ENST00000284551	T	0.68765	-0.35	4.76	4.76	0.60689	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.162003	0.29459	N	0.012097	D	0.85544	0.5721	H	0.95402	3.665	0.21325	N	0.999723	D;P	0.76494	0.999;0.642	D;B	0.69307	0.963;0.361	T	0.80320	-0.1432	10	0.72032	D	0.01	.	12.5428	0.56182	1.0:0.0:0.0:0.0	.	386;387	Q96F44-3;Q96F44	.;TRI11_HUMAN	N	387	ENSP00000284551:Y387N	ENSP00000284551:Y387N	Y	-	1	0	TRIM11	226649277	0.792000	0.28813	0.696000	0.30242	0.123000	0.20343	2.717000	0.47227	1.920000	0.55613	0.496000	0.49642	TAC		0.617	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3		NM_145214	
TRMT2B	79979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	100297051	100297051	+	Silent	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:100297051T>C	ENST00000372936.3	-	3	1000	c.228A>G	c.(226-228)ctA>ctG	p.L76L	TRMT2B-AS1_ENST00000443801.2_RNA|TRMT2B_ENST00000478422.1_Intron|TRMT2B_ENST00000338687.7_Silent_p.L76L|TRMT2B_ENST00000372931.5_Silent_p.L76L|TRMT2B_ENST00000545398.1_Silent_p.L76L|TRMT2B_ENST00000372935.1_Silent_p.L76L|TRMT2B_ENST00000372939.1_Silent_p.L76L	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	76						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)	p.L76L(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						AGGAACCATCTAGTGGTCCAA	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											158.0	127.0	138.0					X																	100297051		2203	4300	6503	SO:0001819	synonymous_variant	79979			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.228A>G	X.37:g.100297051T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Silent	SNP	ENST00000372936.3	37	CCDS14477.1																																																																																				0.458	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1		NM_024917	
TTC3	7267	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	38539860	38539860	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr21:38539860T>A	ENST00000399017.2	+	34	7152	c.4405T>A	c.(4405-4407)Tct>Act	p.S1469T	TTC3_ENST00000355666.1_Missense_Mutation_p.S1469T|TTC3_ENST00000354749.2_Missense_Mutation_p.S1469T|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1469					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S1469T(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				CCCACAGGTATCTTGGAACAT	0.323																																					Ovarian(38;194 1649 35661)												1	Substitution - Missense(1)	kidney(1)											72.0	70.0	71.0					21																	38539860		2203	4295	6498	SO:0001583	missense	7267			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.4405T>A	21.37:g.38539860T>A	ENSP00000381981:p.Ser1469Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.748611	0.49257	.	.	ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749	T;T;T	0.08634	3.07;3.07;3.07	5.78	-2.12	0.07165	.	0.730142	0.12928	N	0.427586	T	0.11580	0.0282	M	0.62723	1.935	0.19300	N	0.999975	D;P	0.56287	0.975;0.953	P;P	0.53861	0.736;0.551	T	0.15378	-1.0439	10	0.37606	T	0.19	-0.9535	0.6461	0.00818	0.1815:0.1736:0.2903:0.3546	.	527;1469	Q5GIT6;P53804	.;TTC3_HUMAN	T	1469	ENSP00000347889:S1469T;ENSP00000381981:S1469T;ENSP00000346791:S1469T	ENSP00000346791:S1469T	S	+	1	0	TTC3	37461730	0.021000	0.18746	0.354000	0.25760	0.005000	0.04900	-0.308000	0.08156	-0.058000	0.13177	0.533000	0.62120	TCT		0.323	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1			
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179569401	179569401	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr2:179569401G>A	ENST00000591111.1	-	103	29071	c.28847C>T	c.(28846-28848)tCg>tTg	p.S9616L	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.S8689L|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S9933L|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13692					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S8689L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGTACCACGAAAGCTTGAT	0.338																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.28847C>T	2.37:g.179569401G>A	ENSP00000465570:p.Ser9616Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	18.03	3.533523	0.64972	.	.	ENSG00000155657	ENST00000342992	T	0.70516	-0.49	5.82	5.82	0.92795	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81197	0.4772	L	0.45051	1.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81722	-0.0803	9	0.87932	D	0	.	20.0953	0.97838	0.0:0.0:1.0:0.0	.	9616	Q8WZ42	TITIN_HUMAN	L	8689	ENSP00000343764:S8689L	ENSP00000343764:S8689L	S	-	2	0	TTN	179277646	1.000000	0.71417	0.970000	0.41538	0.988000	0.76386	9.869000	0.99810	2.767000	0.95098	0.655000	0.94253	TCG		0.338	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
UHRF1BP1L	23074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	100452921	100452921	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr12:100452921T>G	ENST00000279907.7	-	14	2346	c.2134A>C	c.(2134-2136)Aaa>Caa	p.K712Q	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.K362Q	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	712								p.K712Q(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GGCCGTCCTTTTCCACTTTTC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											82.0	87.0	86.0					12																	100452921		2203	4300	6503	SO:0001583	missense	23074				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.2134A>C	12.37:g.100452921T>G	ENSP00000279907:p.Lys712Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	T	17.01	3.278080	0.59758	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.12039	2.76;2.72	5.78	5.78	0.91487	.	0.045934	0.85682	D	0.000000	T	0.26085	0.0636	L	0.53249	1.67	0.80722	D	1	D	0.55385	0.971	P	0.52598	0.703	T	0.00607	-1.1647	10	0.87932	D	0	-15.4343	16.1141	0.81289	0.0:0.0:0.0:1.0	.	712	A0JNW5	UH1BL_HUMAN	Q	712;362	ENSP00000279907:K712Q;ENSP00000444824:K362Q	ENSP00000279907:K712Q	K	-	1	0	UHRF1BP1L	98977052	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.636000	0.61339	2.214000	0.71695	0.528000	0.53228	AAA		0.388	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1		NM_001006947	
AC034110.1	0	broad.mit.edu;ucsc.edu	37	18	74402256	74402256	+	lincRNA	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr18:74402256T>C	ENST00000415242.1	+	0	271																											TCATGTAAGTTGGCCTTAGTA	0.468																																																	0													133.0	116.0	121.0					18																	74402256		692	1591	2283			0																															18.37:g.74402256T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000415242.1	37																																																																																					0.468	AC034110.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000256334.3			
URM1	81605	broad.mit.edu;hgsc.bcm.edu	37	9	131151698	131151698	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:131151698C>G	ENST00000452446.1	+	4	409	c.347C>G	c.(346-348)cCc>cGc	p.P116R	RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000483206.1_3'UTR|URM1_ENST00000372850.1_3'UTR|URM1_ENST00000372853.4_Intron	NM_001135947.2	NP_001129419.1			ubiquitin related modifier 1									p.P116R(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						AATCCTCCGCCCCACTCCAGC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											28.0	34.0	32.0					9																	131151698		692	1591	2283	SO:0001583	missense	81605			AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000452446.1:c.347C>G	9.37:g.131151698C>G	ENSP00000412922:p.Pro116Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000452446.1	37	CCDS48035.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947091	0.53186	.	.	ENSG00000167118	ENST00000452446	.	.	.	4.59	0.698	0.18087	.	.	.	.	.	T	0.17577	0.0422	.	.	.	0.09310	N	1	B	0.32160	0.358	B	0.24394	0.053	T	0.15925	-1.0420	6	.	.	.	.	3.5407	0.07809	0.1751:0.549:0.0:0.2759	.	116	Q9BTM9-2	.	R	116	.	.	P	+	2	0	URM1	130191519	0.000000	0.05858	0.002000	0.10522	0.383000	0.30230	0.158000	0.16422	0.135000	0.18707	-0.140000	0.14226	CCC		0.607	URM1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_030914	
USP24	23358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	55642115	55642115	+	Splice_Site	SNP	A	A	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:55642115A>T	ENST00000294383.6	-	3	491	c.492T>A	c.(490-492)ggT>ggA	p.G164G	USP24_ENST00000407756.1_Splice_Site_p.G52G	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	164					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.G133G(1)|p.G164G(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ACTCGGAAAGACCTTAGTAAA	0.323																																																	2	Substitution - coding silent(2)	kidney(2)											65.0	60.0	61.0					1																	55642115		1822	4083	5905	SO:0001630	splice_region_variant	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.491-1T>A	1.37:g.55642115A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	ENST00000294383.6	37	CCDS44154.2																																																																																				0.323	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			Silent
USH2A	7399	broad.mit.edu;ucsc.edu	37	1	215848923	215848923	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:215848923G>T	ENST00000307340.3	-	63	12716	c.12330C>A	c.(12328-12330)taC>taA	p.Y4110*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.Y4110*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4110	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.Y4110*(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAAACCAGAGTACTCCAGGA	0.488										HNSCC(13;0.011)																																							1	Substitution - Nonsense(1)	kidney(1)											70.0	66.0	67.0					1																	215848923		2203	4300	6503	SO:0001587	stop_gained	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12330C>A	1.37:g.215848923G>T	ENSP00000305941:p.Tyr4110*	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	54	21.785565	0.99943	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.25	4.13	0.48395	.	0.000000	0.41001	D	0.000975	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7198	0.69297	0.0819:0.0:0.9181:0.0	.	.	.	.	X	4110	.	ENSP00000305941:Y4110X	Y	-	3	2	USH2A	213915546	0.906000	0.30813	0.932000	0.37286	0.099000	0.18886	1.089000	0.30890	2.454000	0.82982	0.650000	0.86243	TAC		0.488	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1		NM_007123	
USP6NL	9712	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	11543102	11543102	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr10:11543102T>C	ENST00000609104.1	-	7	776	c.382A>G	c.(382-384)Agt>Ggt	p.S128G	USP6NL_ENST00000277575.5_Missense_Mutation_p.S145G|USP6NL_ENST00000379237.2_Missense_Mutation_p.S151G	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	128	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.S145G(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						CTACTCACACTATACAGGTCC	0.358																																																	1	Substitution - Missense(1)	kidney(1)											52.0	48.0	49.0					10																	11543102		1815	4068	5883	SO:0001583	missense	9712			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.382A>G	10.37:g.11543102T>C	ENSP00000476462:p.Ser128Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	ENST00000609104.1	37	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	T	14.29	2.491055	0.44249	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.31769	1.48;1.48	5.44	5.44	0.79542	Rab-GAP/TBC domain (4);	0.309269	0.41938	D	0.000800	T	0.26882	0.0658	L	0.38838	1.175	0.37932	D	0.932043	B;B	0.26547	0.152;0.077	B;B	0.33121	0.158;0.098	T	0.18967	-1.0320	10	0.48119	T	0.1	.	9.3356	0.38049	0.0:0.0817:0.0:0.9183	.	128;145	Q92738;Q92738-2	US6NL_HUMAN;.	G	128;145;128	ENSP00000277575:S145G;ENSP00000368539:S128G	ENSP00000277575:S145G	S	-	1	0	USP6NL	11583108	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	2.797000	0.47877	2.188000	0.69820	0.459000	0.35465	AGT		0.358	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3		NM_014688	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191480	10191480	+	Frame_Shift_Del	DEL	T	T	-	rs121913346		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:10191480delT	ENST00000256474.2	+	3	1313	c.473delT	c.(472-474)ctgfs	p.L158fs	VHL_ENST00000345392.2_Frame_Shift_Del_p.L117fs|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	158	Interaction with Elongin BC complex.		L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex). {ECO:0000269|PubMed:10635329, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.|L -> V (in VHLD; type I). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L158Q(6)|p.L158P(5)|p.V155fs*15(2)|p.L158R(1)|p.L158_K159del(1)|p.T157fs*14(1)|p.L158fs*16(1)|p.V155_K159delVYTLK(1)|p.T157_K159del(1)|p.Y156*(1)|p.T157_K159>I(1)|p.L158fs*6(1)|p.L158>?(1)|p.L158fs*15(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTGTATACTCTGAAAGAGCGA	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	24	Substitution - Missense(12)|Deletion - Frameshift(6)|Deletion - In frame(3)|Insertion - Frameshift(1)|Complex - deletion inframe(1)|Complex(1)	kidney(24)	GRCh37	CI024083|CI962364|CM941379	VHL	I|M	rs121913346						89.0	82.0	84.0					3																	10191480		2203	4300	6503	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.473delT	3.37:g.10191480delT	ENSP00000256474:p.Leu158fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZC3HAV1	56829	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	138764225	138764225	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:138764225G>A	ENST00000242351.5	-	4	1778	c.1462C>T	c.(1462-1464)Ctt>Ttt	p.L488F	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.L488F|ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.L488F	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	488					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.L488F(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						CCGTTAACAAGTGCTACTCTT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											99.0	99.0	99.0					7																	138764225		2203	4300	6503	SO:0001583	missense	56829			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1462C>T	7.37:g.138764225G>A	ENSP00000242351:p.Leu488Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	G	1.224	-0.626144	0.03610	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652;ENST00000540247	T;T;T	0.20332	3.12;3.33;2.08	4.64	0.412	0.16397	.	1.448070	0.04136	N	0.318770	T	0.09818	0.0241	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.24941	-1.0146	10	0.08837	T	0.75	.	2.6417	0.04973	0.5455:0.0:0.2594:0.1951	.	488;488	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	F	488;488;488;248	ENSP00000242351:L488F;ENSP00000418385:L488F;ENSP00000419855:L488F	ENSP00000242351:L488F	L	-	1	0	ZC3HAV1	138414765	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	0.825000	0.27393	0.292000	0.22492	-0.345000	0.07892	CTT		0.443	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1		NM_020119	
ZNF507	22847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	32843992	32843992	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr19:32843992T>A	ENST00000311921.4	+	2	448	c.256T>A	c.(256-258)Tgt>Agt	p.C86S	ZNF507_ENST00000355898.5_Missense_Mutation_p.C86S|ZNF507_ENST00000544431.1_Missense_Mutation_p.C86S	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C86S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					CCAAGAACTTTGTGAGATTCC	0.423																																																	1	Substitution - Missense(1)	kidney(1)											66.0	67.0	67.0					19																	32843992		2203	4300	6503	SO:0001583	missense	22847			AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.256T>A	19.37:g.32843992T>A	ENSP00000312277:p.Cys86Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Missense_Mutation	SNP	ENST00000311921.4	37	CCDS32985.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.094301	0.36952	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	T;T;T	0.05925	3.7;3.7;3.37	5.8	4.78	0.61160	.	0.452660	0.28659	N	0.014566	T	0.07638	0.0192	M	0.61703	1.905	0.30667	N	0.75376	B;P	0.41848	0.255;0.763	B;B	0.37144	0.026;0.242	T	0.10567	-1.0624	10	0.33141	T	0.24	.	8.2295	0.31590	0.0:0.0689:0.1353:0.7958	.	86;86	Q8TCN5;Q8TCN5-2	ZN507_HUMAN;.	S	86	ENSP00000348162:C86S;ENSP00000312277:C86S;ENSP00000441549:C86S	ENSP00000312277:C86S	C	+	1	0	ZNF507	37535832	0.057000	0.20700	0.720000	0.30636	0.785000	0.44390	0.583000	0.23849	0.997000	0.38969	0.402000	0.26972	TGT		0.423	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3		NM_014910	
ZNF132	7691	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	58948571	58948571	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr19:58948571C>T	ENST00000254166.3	-	2	475	c.75G>A	c.(73-75)tgG>tgA	p.W25*		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W25*(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		AGCCACAGGGCCAAGAAGTAT	0.463																																																	1	Substitution - Nonsense(1)	kidney(1)											77.0	68.0	71.0					19																	58948571		2203	4300	6503	SO:0001587	stop_gained	7691			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.75G>A	19.37:g.58948571C>T	ENSP00000254166:p.Trp25*	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MI9	Nonsense_Mutation	SNP	ENST00000254166.3	37	CCDS12980.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784475	0.90282	.	.	ENSG00000131849	ENST00000254166	.	.	.	2.92	0.607	0.17564	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	3.9121	0.09207	0.2349:0.6251:0.0:0.14	.	.	.	.	X	25	.	ENSP00000254166:W25X	W	-	3	0	ZNF132	63640383	0.000000	0.05858	0.001000	0.08648	0.075000	0.17131	-0.341000	0.07811	0.067000	0.16545	0.563000	0.77884	TGG		0.463	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1		NM_003433	
C14orf39	317761	broad.mit.edu	37	14	60938407	60938407	+	Missense_Mutation	SNP	T	T	A	rs1956551		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr14:60938407T>A	ENST00000321731.3	-	6	533	c.374A>T	c.(373-375)tAc>tTc	p.Y125F		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	125			Y -> C (in dbSNP:rs1956551).		multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)			p.Y125F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTTTAGTTGGTACTGCTTCAA	0.289																																																	1	Substitution - Missense(1)	kidney(1)											82.0	83.0	82.0					14																	60938407		2203	4293	6496	SO:0001583	missense	317761			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.374A>T	14.37:g.60938407T>A	ENSP00000324920:p.Tyr125Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.140818	0.77775	.	.	ENSG00000179008	ENST00000321731;ENST00000555476	T;T	0.54071	1.4;0.59	5.61	5.61	0.85477	.	0.100459	0.44688	D	0.000436	T	0.69052	0.3068	M	0.67953	2.075	0.31426	N	0.673753	D	0.71674	0.998	D	0.80764	0.994	T	0.72679	-0.4220	10	0.38643	T	0.18	-5.0817	13.7543	0.62926	0.0:0.0:0.0:1.0	.	125	Q8N1H7	S6OS1_HUMAN	F	125;96	ENSP00000324920:Y125F;ENSP00000451665:Y96F	ENSP00000324920:Y125F	Y	-	2	0	C14orf39	60008160	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.941000	0.63540	2.133000	0.65898	0.533000	0.62120	TAC		0.289	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1		NM_174978	
FAM47A	158724	broad.mit.edu	37	X	34148882	34148882	+	Missense_Mutation	SNP	C	C	T	rs5973089		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chrX:34148882C>T	ENST00000346193.3	-	1	1565	c.1514G>A	c.(1513-1515)cGc>cAc	p.R505H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	505			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.					p.R505H(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGGCTCCGAGCGGAGACTGGA	0.647																																																	2	Substitution - Missense(2)	kidney(1)|endometrium(1)											30.0	31.0	31.0					X																	34148882		2183	4272	6455	SO:0001583	missense	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1514G>A	X.37:g.34148882C>T	ENSP00000345029:p.Arg505His	Somatic		WXS	Illumina GAIIx	Phase_I	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	c	0.583	-0.836375	0.02692	.	.	ENSG00000185448	ENST00000346193	T	0.21191	2.02	0.513	-0.53	0.11898	.	.	.	.	.	T	0.11623	0.0283	N	0.21097	0.63	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.28106	-1.0054	8	0.40728	T	0.16	.	.	.	.	rs5973089	505	Q5JRC9	FA47A_HUMAN	H	505	ENSP00000345029:R505H	ENSP00000345029:R505H	R	-	2	0	FAM47A	34058803	0.076000	0.21285	0.002000	0.10522	0.006000	0.05464	-0.425000	0.07017	-0.338000	0.08413	-0.722000	0.03604	CGC		0.647	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1		NM_203408	
HSPBP1	23640	broad.mit.edu	37	19	55790886	55790887	+	In_Frame_Ins	INS	-	-	GCCGCCGCC	rs199849782|rs10701478|rs3040014		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr19:55790886_55790887insGCCGCCGCC	ENST00000255631.5	-	3	400_401	c.90_91insGGCGGCGGC	c.(88-93)ggctcc>ggcGGCGGCGGCtcc	p.29_30insGGG	HSPBP1_ENST00000433386.2_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000376343.3_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000587922.1_In_Frame_Ins_p.29_30insGGG|BRSK1_ENST00000590333.1_5'Flank	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	29	Gly-rich.				negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCAGCCGAGGAGCCGCCGCCGC	0.713																																																	0																																										SO:0001652	inframe_insertion	23640				CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.82_90dupGGCGGCGGC	19.37:g.55790887_55790895dupGCCGCCGCC	ENSP00000255631:p.Gly27_Gly29dup	Somatic		WXS	Illumina GAIIx	Phase_I	B3KQP0|B4DG11|O95351|Q6ZNU5	In_Frame_Ins	INS	ENST00000255631.5	37	CCDS33111.1																																																																																				0.713	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1		NM_012267	
KRTAP1-1	81851	broad.mit.edu	37	17	39197549	39197549	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr17:39197549G>C	ENST00000306271.4	-	1	164	c.101C>G	c.(100-102)tCc>tGc	p.S34C		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	34			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.|PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			keratin filament (GO:0045095)		p.S34C(6)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCTGGCAGGAGCTGGTCTC	0.612																																																	6	Substitution - Missense(6)	kidney(4)|lung(1)|prostate(1)											49.0	62.0	58.0					17																	39197549		2018	4199	6217	SO:0001583	missense	81851			AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.101C>G	17.37:g.39197549G>C	ENSP00000305975:p.Ser34Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	G	0.085	-1.176298	0.01646	.	.	ENSG00000188581	ENST00000306271	T	0.16196	2.36	3.91	1.65	0.23941	.	.	.	.	.	T	0.01835	0.0058	N	0.00010	-3.04	0.22552	N	0.998996	B	0.02656	0.0	B	0.01281	0.0	T	0.40924	-0.9537	9	0.02654	T	1	.	7.8006	0.29172	0.1777:0.6415:0.1808:0.0	.	34	Q07627	KRA11_HUMAN	C	34	ENSP00000305975:S34C	ENSP00000305975:S34C	S	-	2	0	KRTAP1-1	36451075	1.000000	0.71417	0.987000	0.45799	0.816000	0.46133	1.227000	0.32576	0.919000	0.36945	-0.233000	0.12211	TCC		0.612	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1		NM_030967	
GBP1P1	400759	broad.mit.edu	37	1	89875916	89875916	+	RNA	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:89875916C>T	ENST00000513638.1	+	0	138					NR_003133.2				guanylate binding protein 1, interferon-inducible pseudogene 1																		CAATGTGCCTCATTGAGAACA	0.502																																																	0																																												0					1p22.2	2011-03-09			ENSG00000225492	ENSG00000225492			39561	pseudogene	pseudogene							Standard	NR_003133		Approved		uc009wcy.1		OTTHUMG00000010128		1.37:g.89875916C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000513638.1	37																																																																																					0.502	GBP1P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000360073.1		NR_003133	
SMG1P5	595101	broad.mit.edu	37	16	30278845	30278845	+	IGR	DEL	A	A	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr16:30278845delA								RP11-347C12.1 (21723 upstream) : snoU13 (11723 downstream)																							TTTCTCTTACAAAAAAAAAAA	0.313																																																	0																																										SO:0001628	intergenic_variant	440354																															16.37:g.30278845delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL		37																																																																																				0	0.313									
MARCKS	4082	broad.mit.edu	37	6	114181210	114181210	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr6:114181210delA	ENST00000368635.4	+	2	835	c.454delA	c.(454-456)aaafs	p.K156fs		NM_002356.5	NP_002347.5	P29966	MARCS_HUMAN	myristoylated alanine-rich protein kinase C substrate	156	Calmodulin-binding (PSD).				energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|germinal vesicle (GO:0042585)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|calmodulin binding (GO:0005516)	p.K155fs*12(1)		breast(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(87;7.65e-05)|all_epithelial(87;0.000296)|all_hematologic(75;0.0172)|Colorectal(196;0.0317)|all_lung(197;0.198)		Epithelial(106;1.59e-07)|all cancers(137;9.85e-07)|OV - Ovarian serous cystadenocarcinoma(136;0.000322)		CGAGACCCCGAAAAAAAAAAA	0.612																																																	1	Deletion - Frameshift(1)	large_intestine(1)											9.0	11.0	10.0					6																	114181210		1892	3986	5878	SO:0001589	frameshift_variant	4082			M68956	CCDS5101.1	6q21	2014-04-10	2001-12-17	2001-12-20	ENSG00000155130	ENSG00000277443			6759	protein-coding gene	gene with protein product		177061	"""myristoylated alanine-rich protein kinase C substrate (MARCKS, 80K-L)"""	MACS		1560845, 8420923	Standard	NM_002356		Approved	PKCSL, 80K-L	uc003pvy.4	P29966	OTTHUMG00000188327	ENST00000368635.4:c.454delA	6.37:g.114181210delA	ENSP00000357624:p.Lys156fs	Somatic		WXS	Illumina GAIIx	Phase_I	E1P560|Q2LA83|Q5TDB7	Frame_Shift_Del	DEL	ENST00000368635.4	37	CCDS5101.1																																																																																				0.612	MARCKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041903.1		NM_002356	
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	A	G	rs372894655	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:20414343A>G	ENST00000380338.4	-	5	787	c.501T>C	c.(499-501)agT>agC	p.S167S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S164S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.532			T	MLL	ALL								A|||	612	0.122204	0.1505	0.1066	5008	,	,		12422	0.0833		0.0716	False		,,,				2504	0.1871							Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)											8.0	15.0	13.0					9																	20414343		1537	3257	4794	SO:0001819	synonymous_variant	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501T>C	9.37:g.20414343A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																				0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1		NM_004529	
KIZ-AS1	101929591	broad.mit.edu	37	20	21143043	21143043	+	RNA	SNP	G	G	A			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr20:21143043G>A	ENST00000591761.1	-	0	5142				PLK1S1_ENST00000457464.1_RNA|RP5-872K7.7_ENST00000425746.2_RNA																							TGAAGTTGAGGAAAAAAGAGC	0.443																																																	0													36.0	39.0	38.0					20																	21143043		1858	4101	5959			55857																															20.37:g.21143043G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000591761.1	37																																																																																					0.443	RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2			
POU6F2	11281	broad.mit.edu	37	7	39500265	39500265	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr7:39500265G>T	ENST00000403058.1	+	10	1676	c.1522G>T	c.(1522-1524)Gct>Tct	p.A508S	POU6F2_ENST00000518318.2_Missense_Mutation_p.A508S|POU6F2_ENST00000559001.1_Missense_Mutation_p.A453S	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	508	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A508S(3)		NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						GGTGGGACAGGCTCTCAGTGC	0.592																																																	3	Substitution - Missense(3)	endometrium(2)|kidney(1)											33.0	29.0	30.0					7																	39500265		2203	4300	6503	SO:0001583	missense	11281			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1522G>T	7.37:g.39500265G>T	ENSP00000384004:p.Ala508Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698778	0.68501	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	D;D	0.95342	-2.0;-3.68	5.48	5.48	0.80851	POU-specific (3);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.96842	0.8969	M	0.65320	2	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.97228	0.9882	10	0.87932	D	0	.	19.3555	0.94410	0.0:0.0:1.0:0.0	.	508	P78424	PO6F2_HUMAN	S	508	ENSP00000384004:A508S;ENSP00000430514:A508S	ENSP00000384004:A508S	A	+	1	0	POU6F2	39466790	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.773000	0.98989	2.572000	0.86782	0.511000	0.50034	GCT		0.592	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3		NM_007252	
PROS1	5627	broad.mit.edu	37	3	93643084	93643084	+	Splice_Site	SNP	C	C	T	rs557733421		TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:93643084C>T	ENST00000394236.3	-	3	575	c.259G>A	c.(259-261)Gtt>Att	p.V87I	PROS1_ENST00000407433.1_5'UTR	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	87	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.		V -> L (in THPH5). {ECO:0000269|PubMed:15238143}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.V87I(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TTGAACTTACCTAAGTATTTT	0.264																																																	1	Substitution - Missense(1)	kidney(1)	GRCh37	CS971880|CX973310	PROS1	S|X							44.0	44.0	44.0					3																	93643084		2183	4280	6463	SO:0001630	splice_region_variant	5627				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.259+1G>A	3.37:g.93643084C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822372	0.50739	.	.	ENSG00000184500	ENST00000394236;ENST00000348974	D;D	0.99766	-6.69;-6.69	4.33	4.33	0.51752	Gamma-carboxyglutamic acid-rich (GLA) domain (3);	0.811935	0.11149	N	0.594309	D	0.98692	0.9561	L	0.34521	1.04	0.80722	D	1	B	0.22604	0.072	B	0.26202	0.067	D	0.99797	1.1034	9	.	.	.	.	10.4768	0.44670	0.0:0.904:0.0:0.096	.	87	P07225	PROS_HUMAN	I	87;119	ENSP00000377783:V87I;ENSP00000330021:V119I	.	V	-	1	0	PROS1	95125774	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.562000	0.36353	2.416000	0.81992	0.549000	0.68633	GTT		0.264	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1		NM_000313	Missense_Mutation
MTATP6P1	106480796	broad.mit.edu	37	1	569343	569343	+	IGR	SNP	C	C	T			TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:569343C>T								RP5-857K21.5 (4953 upstream) : OR4F16 (51715 downstream)																							ACTCCTGCCTCACTCATTTAC	0.428																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.569343C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.428									
SLC2A1-AS1	440584	broad.mit.edu	37	1	43439784	43439784	+	lincRNA	SNP	C	C	T	rs191509438	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr1:43439784C>T	ENST00000431759.1	+	0	815					NR_033967.1				SLC2A1 antisense RNA 1																		cACGGAACCACGCAAACTCCT	0.473													C|||	6	0.00119808	0.0015	0.0014	5008	,	,		19173	0.0		0.003	False		,,,				2504	0.0																0																																												0			AK056786		1p34.2	2012-10-12	2012-08-15		ENSG00000227533	ENSG00000227533		"""Long non-coding RNAs"""	44187	non-coding RNA	RNA, long non-coding			"""SLC2A1 antisense RNA 1 (non-protein coding)"""				Standard	NR_033967		Approved		uc001cil.3		OTTHUMG00000007699		1.37:g.43439784C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000431759.1	37																																																																																					0.473	SLC2A1-AS1-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000020688.1		NR_033967	
HSPB1P1	653553	broad.mit.edu	37	9	74622853	74622853	+	IGR	SNP	G	G	A	rs10120981	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr9:74622853G>A								C9orf85 (21883 upstream) : C9orf57 (43438 downstream)																							AGCTGGGCCCGCGACTCGAAG	0.652													G|||	1763	0.352037	0.3464	0.3026	5008	,	,		12954	0.6667		0.2217	False		,,,				2504	0.2045																0																																										SO:0001628	intergenic_variant	0																															9.37:g.74622853G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.652									
VWA5B2	90113	broad.mit.edu	37	3	183951431	183951431	+	Missense_Mutation	SNP	C	C	T	rs902417	byFrequency	TCGA-CZ-5465-01A-01D-1806-10	TCGA-CZ-5465-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37	d0b450b6-994f-4b30-881c-bb9fa4fdc729	g.chr3:183951431C>T	ENST00000426955.2	+	4	698	c.598C>T	c.(598-600)Cct>Tct	p.P200S	VWA5B2_ENST00000273794.5_5'UTR|EIF2B5_ENST00000444495.1_Intron	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	211								p.P200S(1)		breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						GCTGGCTGCCCCTCGGGACGT	0.662													C|||	1088	0.217252	0.177	0.2075	5008	,	,		16546	0.2351		0.2485	False		,,,				2504	0.228																1	Substitution - Missense(1)	kidney(1)						C	SER/PRO	241,1143		25,191,476	30.0	37.0	35.0		598	2.0	1.0	3	dbSNP_92	35	724,2458		83,558,950	yes	missense	VWA5B2	NM_138345.1	74	108,749,1426	TT,TC,CC		22.753,17.4133,21.1345	benign	200/1243	183951431	965,3601	692	1591	2283	SO:0001583	missense	90113				CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.598C>T	3.37:g.183951431C>T	ENSP00000398688:p.Pro200Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B9EGN7	Missense_Mutation	SNP	ENST00000426955.2	37	CCDS54686.1	444	0.2032967032967033	88	0.17886178861788618	74	0.20441988950276244	94	0.16433566433566432	188	0.24802110817941952	C	1.623	-0.521080	0.04171	0.174133	0.22753	ENSG00000145198	ENST00000426955	T	0.60424	0.19	3.84	1.99	0.26369	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.09310	P	0.9999999999633179	B;B	0.27823	0.19;0.004	B;B	0.29267	0.1;0.006	T	0.19160	-1.0314	8	0.33141	T	0.24	-0.1148	4.7979	0.13281	0.2103:0.6742:0.0:0.1154	rs902417;rs1687244;rs3882317;rs59041042;rs902417	200;211	B9EGN7;C9JW99	.;.	S	200	ENSP00000398688:P200S	ENSP00000398688:P200S	P	+	1	0	VWA5B2	185434125	0.999000	0.42202	0.982000	0.44146	0.641000	0.38312	1.678000	0.37586	0.384000	0.24942	0.462000	0.41574	CCT		0.662	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346004.2		XM_291077	
