#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCC2	1244	hgsc.bcm.edu;ucsc.edu	37	10	101567974	101568006	+	Splice_Site	DEL	CTCCATGCTCCAGGTAGGTCGGCATTCTCACTG	CTCCATGCTCCAGGTAGGTCGGCATTCTCACTG	-	rs387906395|rs574319283|rs375127462	byFrequency	TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	CTCCATGCTCCAGGTAGGTCGGCATTCTCACTG	CTCCATGCTCCAGGTAGGTCGGCATTCTCACTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr10:101567974_101568006delCTCCATGCTCCAGGTAGGTCGGCATTCTCACTG	ENST00000370449.4	+	13	1916_1928	c.1803_1815delCTCCATGCTCCAGGTAGGTCGGCATTCTCACTG	c.(1801-1815)tcctccatgctccag>tc	p.SSMLQ601del		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	601	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TGATGATCTCCTCCATGCTCCAGGTAGGTCGGCATTCTCACTGCTAACTCCCT	0.468																																																	0			GRCh37	CS982117	ABCC2	S																																				SO:0001630	splice_region_variant	1244			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1815+1CTCCATGCTCCAGGTAGGTCGGCATTCTCACTG>-	10.37:g.101567974_101568006delCTCCATGCTCCAGGTAGGTCGGCATTCTCACTG		Somatic		WXS	Illumina HiSeq	Phase_I	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Frame_Shift_Del	DEL	ENST00000370449.4	37	CCDS7484.1																																																																																				0.468	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1		NM_000392	In_Frame_Del
AKAP13	11214	broad.mit.edu;ucsc.edu	37	15	86118435	86118435	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr15:86118435C>T	ENST00000394518.2	+	6	831	c.736C>T	c.(736-738)Cat>Tat	p.H246Y	AKAP13_ENST00000361243.2_Missense_Mutation_p.H246Y	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	246					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.H246Y(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TTCTGTGAGGCATCATCGAGA	0.433																																					Melanoma(94;603 1453 3280 32295 32951)												1	Substitution - Missense(1)	kidney(1)											160.0	150.0	153.0					15																	86118435		2202	4299	6501	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.736C>T	15.37:g.86118435C>T	ENSP00000378026:p.His246Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217636	0.79352	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.60548	0.18;0.18	5.2	5.2	0.72013	.	.	.	.	.	T	0.66416	0.2787	L	0.38175	1.15	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.80764	0.986;0.994	T	0.64706	-0.6344	9	0.46703	T	0.11	.	14.4378	0.67293	0.0:1.0:0.0:0.0	.	246;246	Q12802;Q12802-2	AKP13_HUMAN;.	Y	246;246;245;245	ENSP00000354718:H246Y;ENSP00000378026:H246Y	ENSP00000354718:H246Y	H	+	1	0	AKAP13	83919439	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.543000	0.36147	2.854000	0.98071	0.655000	0.94253	CAT		0.433	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1		NM_007200	
AMPD2	271	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	110170727	110170727	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:110170727C>G	ENST00000256578.3	+	10	1625	c.1265C>G	c.(1264-1266)tCg>tGg	p.S422W	AMPD2_ENST00000358729.4_Missense_Mutation_p.S347W|AMPD2_ENST00000528454.1_Missense_Mutation_p.S304W|AMPD2_ENST00000528667.1_Missense_Mutation_p.S422W|AMPD2_ENST00000393688.3_Missense_Mutation_p.S303W|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.S341W	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	422					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.S422W(1)		breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		ATCCATGCCTCGTCCTGCATG	0.607																																																	1	Substitution - Missense(1)	kidney(1)											67.0	63.0	65.0					1																	110170727		2203	4300	6503	SO:0001583	missense	271			S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.1265C>G	1.37:g.110170727C>G	ENSP00000256578:p.Ser422Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	CCDS805.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588961	0.86851	.	.	ENSG00000116337	ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000528454;ENST00000393688	D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	5.04	5.04	0.67666	Adenosine/AMP deaminase (1);	0.066752	0.64402	D	0.000007	D	0.96278	0.8786	M	0.87682	2.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.987;1.0;1.0;1.0	D	0.96660	0.9488	10	0.87932	D	0	-13.1768	17.3138	0.87217	0.0:1.0:0.0:0.0	.	347;303;422;341	Q01433-4;Q01433-3;Q01433;Q01433-2	.;.;AMPD2_HUMAN;.	W	341;422;422;347;304;303	ENSP00000345498:S341W;ENSP00000436541:S422W;ENSP00000256578:S422W;ENSP00000351573:S347W;ENSP00000437164:S304W;ENSP00000377292:S303W	ENSP00000256578:S422W	S	+	2	0	AMPD2	109972250	1.000000	0.71417	0.980000	0.43619	0.975000	0.68041	7.577000	0.82486	2.634000	0.89283	0.561000	0.74099	TCG		0.607	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			
BAP1	8314	broad.mit.edu;hgsc.bcm.edu	37	3	52441261	52441261	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:52441261A>C	ENST00000460680.1	-	7	980	c.509T>G	c.(508-510)tTt>tGt	p.F170C	BAP1_ENST00000296288.5_Missense_Mutation_p.F170C	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F170C(1)|p.E166fs*13(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		ATAGCTGACAAAGTGGAACGC	0.582			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	2	Substitution - Missense(1)|Deletion - Frameshift(1)	eye(1)|kidney(1)											83.0	81.0	81.0					3																	52441261		2203	4300	6503	SO:0001583	missense	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.509T>G	3.37:g.52441261A>C	ENSP00000417132:p.Phe170Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.663751	0.88251	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	T;T;T	0.75477	-0.94;-0.94;-0.94	5.95	5.95	0.96441	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	D	0.91074	0.7191	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93886	0.7175	10	0.87932	D	0	-8.6289	16.4216	0.83760	1.0:0.0:0.0:0.0	.	170	Q92560	BAP1_HUMAN	C	170;170;91	ENSP00000417132:F170C;ENSP00000296288:F170C;ENSP00000417776:F91C	ENSP00000296288:F170C	F	-	2	0	BAP1	52416301	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.297000	0.96120	2.285000	0.76669	0.533000	0.62120	TTT		0.582	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			
CASKIN2	57513	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	73500959	73500959	+	Missense_Mutation	SNP	C	C	T	rs370315404		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr17:73500959C>T	ENST00000321617.3	-	11	1712	c.1126G>A	c.(1126-1128)Gaa>Aaa	p.E376K	CASKIN2_ENST00000433559.2_Missense_Mutation_p.E294K	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	376						cytoplasm (GO:0005737)		p.E376K(1)		endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGGGGTTCTTCGGCAGGAGGC	0.701													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13526	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						C	LYS/GLU,LYS/GLU	0,4404		0,0,2202	31.0	31.0	31.0		880,1126	5.3	0.0	17		31	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CASKIN2	NM_001142643.1,NM_020753.3	56,56	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	294/1121,376/1203	73500959	1,13003	2202	4300	6502	SO:0001583	missense	57513			AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.1126G>A	17.37:g.73500959C>T	ENSP00000325355:p.Glu376Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Missense_Mutation	SNP	ENST00000321617.3	37	CCDS11723.1	.	.	.	.	.	.	.	.	.	.	C	10.13	1.264876	0.23136	0.0	1.16E-4	ENSG00000177303	ENST00000321617;ENST00000433559	T;T	0.68903	-0.36;-0.18	5.33	5.33	0.75918	.	0.428744	0.16942	N	0.193247	T	0.43831	0.1265	N	0.08118	0	0.31800	N	0.628559	B	0.06786	0.001	B	0.01281	0.0	T	0.45381	-0.9265	10	0.32370	T	0.25	.	8.3136	0.32086	0.0:0.8319:0.0:0.1681	.	376	Q8WXE0	CSKI2_HUMAN	K	376;294	ENSP00000325355:E376K;ENSP00000406963:E294K	ENSP00000325355:E376K	E	-	1	0	CASKIN2	71012554	0.000000	0.05858	0.047000	0.18901	0.304000	0.27724	0.243000	0.18106	2.498000	0.84270	0.561000	0.74099	GAA		0.701	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447609.1		NM_020753	
CDC25A	993	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	48215854	48215854	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:48215854G>T	ENST00000302506.3	-	9	1258	c.850C>A	c.(850-852)Cca>Aca	p.P284T	CDC25A_ENST00000351231.3_Missense_Mutation_p.P244T|CDC25A_ENST00000459900.1_5'UTR	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	284					cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.P284T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CTTCCAGGTGGAGACTCCTCT	0.517																																																	1	Substitution - Missense(1)	kidney(1)											117.0	119.0	118.0					3																	48215854		2203	4300	6503	SO:0001583	missense	993			M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.850C>A	3.37:g.48215854G>T	ENSP00000303706:p.Pro284Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	ENST00000302506.3	37	CCDS2760.1	.	.	.	.	.	.	.	.	.	.	G	3.290	-0.145096	0.06627	.	.	ENSG00000164045	ENST00000302506;ENST00000351231	T;T	0.19532	2.14;2.14	5.69	2.88	0.33553	.	0.432370	0.27673	N	0.018326	T	0.08133	0.0203	N	0.17082	0.46	0.09310	N	1	B;B	0.16603	0.018;0.013	B;B	0.17433	0.01;0.018	T	0.36648	-0.9739	10	0.02654	T	1	.	2.0648	0.03600	0.169:0.1582:0.5091:0.1637	.	244;284	P30304-2;P30304	.;MPIP1_HUMAN	T	284;244	ENSP00000303706:P284T;ENSP00000343166:P244T	ENSP00000303706:P284T	P	-	1	0	CDC25A	48190858	0.358000	0.24947	0.014000	0.15608	0.632000	0.37999	1.546000	0.36179	0.731000	0.32448	-0.229000	0.12294	CCA		0.517	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257512.2		NM_001789	
CEP68	23177	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	65300044	65300044	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr2:65300044C>A	ENST00000377990.2	+	3	2017	c.1814C>A	c.(1813-1815)cCa>cAa	p.P605Q	CEP68_ENST00000260569.4_Intron|RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000497039.1_3'UTR|CEP68_ENST00000546106.1_Missense_Mutation_p.P605Q|CEP68_ENST00000537589.1_Missense_Mutation_p.P217Q	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	605					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.P605Q(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						TTCTCAGACCCAGATGTTGAA	0.557																																																	1	Substitution - Missense(1)	kidney(1)											103.0	108.0	106.0					2																	65300044		1977	4161	6138	SO:0001583	missense	23177			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1814C>A	2.37:g.65300044C>A	ENSP00000367229:p.Pro605Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	37	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278772	0.23307	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000537589;ENST00000545501	T;T;T	0.27720	2.44;2.43;1.65	5.84	-2.9	0.05648	.	0.869615	0.09978	N	0.731433	T	0.32675	0.0837	L	0.60455	1.87	0.09310	N	1	B;B;B;B	0.30146	0.27;0.27;0.27;0.27	B;B;B;B	0.40940	0.213;0.344;0.22;0.344	T	0.47394	-0.9121	10	0.31617	T	0.26	0.5425	8.6867	0.34243	0.0:0.4486:0.1014:0.45	.	593;605;605;605	F5H3N9;F5H2Y2;Q76N32;Q05C09	.;.;CEP68_HUMAN;.	Q	605;605;217;593	ENSP00000367229:P605Q;ENSP00000438306:P605Q;ENSP00000443357:P217Q	ENSP00000367229:P605Q	P	+	2	0	CEP68	65153548	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.351000	0.02622	-0.746000	0.04766	-1.731000	0.00696	CCA		0.557	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2		NM_015147	
DCDC1	341019	broad.mit.edu;hgsc.bcm.edu	37	11	30921891	30921891	+	Splice_Site	SNP	A	A	G			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr11:30921891A>G	ENST00000597505.1	-	31	4654		c.e31+1		DCDC1_ENST00000406071.2_Splice_Site|DCDC1_ENST00000339794.5_Splice_Site			P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)			p.?(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CAAAAAAGTTACCATTTGGAG	0.343																																																	2	Unknown(2)	kidney(2)											71.0	67.0	69.0					11																	30921891		2199	4296	6495	SO:0001630	splice_region_variant	100506627			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4654+1T>C	11.37:g.30921891A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6PVL6|B7WNX6|Q6ZU04	Splice_Site	SNP	ENST00000597505.1	37		.	.	.	.	.	.	.	.	.	.	A	15.38	2.815753	0.50527	.	.	ENSG00000170959	ENST00000406071;ENST00000339794	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.94	0.58337	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCDC5	30878467	0.998000	0.40836	0.717000	0.30585	0.132000	0.20833	2.739000	0.47409	2.102000	0.63906	0.528000	0.53228	.		0.343	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1		NM_181807	Intron
DCST2	127579	broad.mit.edu;ucsc.edu	37	1	155002622	155002622	+	Missense_Mutation	SNP	G	G	A	rs138904334		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:155002622G>A	ENST00000368424.3	-	7	1173	c.1115C>T	c.(1114-1116)aCg>aTg	p.T372M	DCST2_ENST00000295536.5_Missense_Mutation_p.T372M	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	372						integral component of membrane (GO:0016021)		p.T372M(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGCCCTGCCGTGGAGCGCAC	0.597																																																	1	Substitution - Missense(1)	kidney(1)						G	MET/THR	0,4406		0,0,2203	87.0	86.0	86.0		1115	-8.8	0.0	1	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	no	missense	DCST2	NM_144622.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	372/774	155002622	1,13005	2203	4300	6503	SO:0001583	missense	127579			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1115C>T	1.37:g.155002622G>A	ENSP00000357409:p.Thr372Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	37	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	G	3.014	-0.203265	0.06180	0.0	1.16E-4	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.30981	1.51;1.51	4.38	-8.77	0.00827	Dendritic cell-specific transmembrane protein-like (1);	2.003710	0.02617	N	0.102803	T	0.03564	0.0102	N	0.12182	0.205	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.07829	-1.0752	10	0.48119	T	0.1	3.7718	0.4085	0.00437	0.303:0.2951:0.1873:0.2146	.	372	Q5T1A1	DCST2_HUMAN	M	372	ENSP00000357409:T372M;ENSP00000295536:T372M	ENSP00000295536:T372M	T	-	2	0	DCST2	153269246	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.767000	0.00188	-2.366000	0.00606	-0.136000	0.14681	ACG		0.597	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3		NM_144622	
DNAJC13	23317	hgsc.bcm.edu;ucsc.edu	37	3	132211264	132211275	+	In_Frame_Del	DEL	GATGATAGAGAA	GATGATAGAGAA	-	rs541274800		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	GATGATAGAGAA	GATGATAGAGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:132211264_132211275delGATGATAGAGAA	ENST00000260818.6	+	33	3878_3889	c.3630_3641delGATGATAGAGAA	c.(3628-3642)ctgatgatagagaag>ctg	p.MIEK1211del		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1211					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						GTAGGCGCCTGATGATAGAGAAGATTGCTGCC	0.382																																																	0																																										SO:0001651	inframe_deletion	23317			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.3630_3641delGATGATAGAGAA	3.37:g.132211264_132211275delGATGATAGAGAA	ENSP00000260818:p.Met1211_Lys1214del	Somatic		WXS	Illumina HiSeq	Phase_I	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	In_Frame_Del	DEL	ENST00000260818.6	37	CCDS33857.1																																																																																				0.382	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2		NM_015268	
EIF2B1	1967	broad.mit.edu;hgsc.bcm.edu	37	12	124116921	124116922	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr12:124116921_124116922GT>AA	ENST00000424014.2	-	2	293_294	c.85_86AC>TT	c.(85-87)ACg>TTg	p.T29L	EIF2B1_ENST00000537073.1_Missense_Mutation_p.T29L|GTF2H3_ENST00000228955.7_5'Flank|EIF2B1_ENST00000543940.1_5'UTR|GTF2H3_ENST00000543341.2_5'Flank|EIF2B1_ENST00000539951.1_Missense_Mutation_p.T16L	NM_001414.3	NP_001405.1	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa	29					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme regulator activity (GO:0030234)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)	p.T29M(1)|p.T29S(1)		breast(1)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		CTCCAGCAACGTCCGGATGGCA	0.376																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	1967			X95648	CCDS31924.1	12q24.3	1998-10-16	2002-08-29		ENSG00000111361	ENSG00000111361			3257	protein-coding gene	gene with protein product		606686	"""eukaryotic translation initiation factor 2B, subunit 1 (alpha, 26kD)"""	EIF2B			Standard	NM_001414		Approved	EIF-2Balpha, EIF-2B, EIF2BA	uc001ufm.3	Q14232	OTTHUMG00000168696	ENST00000424014.2:c.85_86delinsAA	12.37:g.124116921_124116922delinsAA	ENSP00000416250:p.Thr29Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLY9|B4DGX0|Q3SXP4	Missense_Mutation	SNP	ENST00000424014.2	37	CCDS31924.1																																																																																				0.376	EIF2B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400628.1		NM_001414	
FLYWCH1	84256	broad.mit.edu;hgsc.bcm.edu	37	16	2983245	2983245	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr16:2983245G>A	ENST00000253928.9	+	5	1316	c.911G>A	c.(910-912)tGc>tAc	p.C304Y	FLYWCH1_ENST00000399667.2_Missense_Mutation_p.C304Y|FLYWCH1_ENST00000416288.2_Missense_Mutation_p.C303Y			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	304						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C304Y(1)		kidney(1)|lung(3)	4						TATTGGACCTGCCGGGACCAC	0.657																																																	1	Substitution - Missense(1)	kidney(1)											22.0	27.0	25.0					16																	2983245		2083	4193	6276	SO:0001583	missense	84256			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.911G>A	16.37:g.2983245G>A	ENSP00000253928:p.Cys304Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	ENST00000253928.9	37		.	.	.	.	.	.	.	.	.	.	G	18.40	3.615974	0.66672	.	.	ENSG00000059122	ENST00000399667;ENST00000253928;ENST00000416288	.	.	.	4.33	4.33	0.51752	Zinc finger, FLYWCH-type (1);	.	.	.	.	T	0.81034	0.4739	M	0.88775	2.98	0.35653	D	0.811893	D;D	0.89917	0.997;1.0	D;D	0.87578	0.995;0.998	D	0.87938	0.2715	8	0.87932	D	0	.	12.687	0.56954	0.0:0.0:1.0:0.0	.	304;303	Q4VC44;Q4VC44-2	FWCH1_HUMAN;.	Y	304;304;303	.	ENSP00000253928:C304Y	C	+	2	0	FLYWCH1	2923246	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.680000	0.61656	2.139000	0.66308	0.561000	0.74099	TGC		0.657	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000436479.1		NM_032296	
GON4L	54856	broad.mit.edu;hgsc.bcm.edu	37	1	155764938	155764938	+	Silent	SNP	T	T	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:155764938T>C	ENST00000368331.1	-	12	1698	c.1650A>G	c.(1648-1650)gaA>gaG	p.E550E	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Silent_p.E550E|GON4L_ENST00000271883.5_Silent_p.E550E|GON4L_ENST00000361040.5_Silent_p.E550E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	550	Asp-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E550E(3)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CATCATCTGCTTCATCTAGGA	0.383																																																	3	Substitution - coding silent(3)	kidney(3)											86.0	83.0	84.0					1																	155764938		2203	4300	6503	SO:0001819	synonymous_variant	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1650A>G	1.37:g.155764938T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																					0.383	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_032292	
HSPG2	3339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	22222714	22222714	+	Silent	SNP	C	C	T	rs370635954		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:22222714C>T	ENST00000374695.3	-	2	232	c.153G>A	c.(151-153)tcG>tcA	p.S51S		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	51					angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.S51S(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CAGAAAGGTACGAATGTGTCC	0.557																																																	1	Substitution - coding silent(1)	kidney(1)						C		1,4405	2.1+/-5.4	0,1,2202	255.0	208.0	224.0		153	-9.7	0.0	1		224	0,8600		0,0,4300	no	coding-synonymous	HSPG2	NM_005529.5		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		51/4392	22222714	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.153G>A	1.37:g.22222714C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																				0.557	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1		NM_005529	
GON4L	54856	broad.mit.edu;hgsc.bcm.edu	37	1	155764940	155764940	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:155764940C>T	ENST00000368331.1	-	12	1696	c.1648G>A	c.(1648-1650)Gaa>Aaa	p.E550K	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Missense_Mutation_p.E550K|GON4L_ENST00000271883.5_Missense_Mutation_p.E550K|GON4L_ENST00000361040.5_Missense_Mutation_p.E550K	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	550	Asp-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E550K(3)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCATCTGCTTCATCTAGGAAA	0.383																																																	3	Substitution - Missense(3)	kidney(3)											83.0	80.0	81.0					1																	155764940		2203	4300	6503	SO:0001583	missense	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1648G>A	1.37:g.155764940C>T	ENSP00000357315:p.Glu550Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	C	29.1	4.979101	0.92982	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040;ENST00000368327	T;T;T;T	0.15139	2.61;2.61;2.61;2.45	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.35998	0.0951	M	0.69823	2.125	0.51482	D	0.999927	D;D;D;D;D;D	0.76494	0.999;0.997;0.999;0.999;0.998;0.999	D;P;D;D;D;D	0.83275	0.994;0.894;0.996;0.99;0.989;0.995	T	0.05683	-1.0870	10	0.59425	D	0.04	.	18.6864	0.91565	0.0:1.0:0.0:0.0	.	330;244;550;550;550;550	Q6PHZ4;Q9H5U2;A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;.;.;GON4L_HUMAN;.	K	550;550;550;550;550;29	ENSP00000396117:E550K;ENSP00000357315:E550K;ENSP00000271883:E550K;ENSP00000354322:E550K	ENSP00000271883:E550K	E	-	1	0	GON4L	154031564	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	5.499000	0.66937	2.807000	0.96579	0.591000	0.81541	GAA		0.383	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_032292	
KIAA0513	9764	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	85120766	85120766	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr16:85120766G>C	ENST00000566428.1	+	12	1811	c.1180G>C	c.(1180-1182)Gat>Cat	p.D394H	KIAA0513_ENST00000258180.3_Missense_Mutation_p.D394H|KIAA0513_ENST00000538274.1_Missense_Mutation_p.D384H			O60268	K0513_HUMAN	KIAA0513	394						cytoplasm (GO:0005737)		p.D394H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(9)|pancreas(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.234)		TGGCAACCTGGATGAAGGTGC	0.597											OREG0023994	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											84.0	76.0	79.0					16																	85120766		2198	4300	6498	SO:0001583	missense	9764			AB011085	CCDS32499.1, CCDS67091.1, CCDS73919.1	16q24.1	2012-11-29			ENSG00000135709	ENSG00000135709			29058	protein-coding gene	gene with protein product		611675				9628581	Standard	XM_005256265		Approved		uc002fiu.3	O60268	OTTHUMG00000176597	ENST00000566428.1:c.1180G>C	16.37:g.85120766G>C	ENSP00000457408:p.Asp394His	Somatic	1234	WXS	Illumina HiSeq	Phase_I	B4DSS5|D3DUM2|Q8N6G0	Missense_Mutation	SNP	ENST00000566428.1	37	CCDS32499.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277009	0.59758	.	.	ENSG00000135709	ENST00000538274;ENST00000258180	T;T	0.46819	0.87;0.86	4.97	4.97	0.65823	.	0.155105	0.56097	D	0.000029	T	0.41581	0.1165	L	0.36672	1.1	0.42061	D	0.991161	B;B	0.22851	0.063;0.076	B;B	0.19666	0.026;0.024	T	0.36744	-0.9735	10	0.59425	D	0.04	-12.2777	16.7973	0.85605	0.0:0.0:1.0:0.0	.	384;394	B4DSS5;O60268	.;K0513_HUMAN	H	384;394	ENSP00000446439:D384H;ENSP00000258180:D394H	ENSP00000258180:D394H	D	+	1	0	KIAA0513	83678267	1.000000	0.71417	0.994000	0.49952	0.959000	0.62525	4.351000	0.59398	2.289000	0.77006	0.462000	0.41574	GAT		0.597	KIAA0513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432736.1		NM_014732	
KIAA2022	340533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	73963362	73963362	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chrX:73963362T>C	ENST00000055682.6	-	3	1641	c.1030A>G	c.(1030-1032)Acc>Gcc	p.T344A		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	344					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.T344A(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTGGGGCAGGTAGTAAAGACG	0.468																																																	1	Substitution - Missense(1)	kidney(1)											59.0	52.0	54.0					X																	73963362		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1030A>G	X.37:g.73963362T>C	ENSP00000055682:p.Thr344Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	T	9.920	1.212038	0.22289	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.30182	1.54;1.54	5.83	3.48	0.39840	.	0.204009	0.49916	D	0.000124	T	0.19446	0.0467	N	0.22421	0.69	0.24537	N	0.994081	B	0.06786	0.001	B	0.04013	0.001	T	0.16453	-1.0402	10	0.56958	D	0.05	-10.2644	8.2189	0.31530	0.0:0.225:0.0:0.775	.	344	Q5QGS0	K2022_HUMAN	A	344	ENSP00000362567:T344A;ENSP00000055682:T344A	ENSP00000055682:T344A	T	-	1	0	KIAA2022	73880087	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.856000	0.62932	0.825000	0.34637	-0.323000	0.08544	ACC		0.468	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2		NM_001008537	
KRT73	319101	hgsc.bcm.edu;ucsc.edu	37	12	53011976	53011977	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr12:53011976_53011977insT	ENST00000305748.3	-	1	366_367	c.332_333insA	c.(331-333)aagfs	p.K111fs	RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	111	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCAGGAGGCTCTTGTTGATGGT	0.604																																																	0																																										SO:0001589	frameshift_variant	319101			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.333dupA	12.37:g.53011978_53011978dupT	ENSP00000307014:p.Lys111fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MB2	Frame_Shift_Ins	INS	ENST00000305748.3	37	CCDS8834.1																																																																																				0.604	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1		NM_175068	
KRTAP15-1	254950	broad.mit.edu;hgsc.bcm.edu	37	21	31812784	31812784	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr21:31812784C>A	ENST00000334067.3	+	1	188	c.139C>A	c.(139-141)Ctc>Atc	p.L47I		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	47						intermediate filament (GO:0005882)		p.L47I(1)		kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						GGGCTCCTCTCTCTACAATGG	0.483																																																	1	Substitution - Missense(1)	kidney(1)											87.0	86.0	87.0					21																	31812784		2203	4300	6503	SO:0001583	missense	254950			AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.139C>A	21.37:g.31812784C>A	ENSP00000334866:p.Leu47Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3F4	Missense_Mutation	SNP	ENST00000334067.3	37	CCDS13593.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071667	0.55646	.	.	ENSG00000186970	ENST00000334067	T	0.04015	3.73	4.79	-2.76	0.05896	.	1.818090	0.02934	N	0.139540	T	0.07413	0.0187	M	0.74467	2.265	0.09310	N	1	B	0.29955	0.263	B	0.30105	0.111	T	0.38908	-0.9639	10	0.66056	D	0.02	-1.0964	1.7247	0.02919	0.1696:0.2136:0.4014:0.2154	.	47	Q3LI76	KR151_HUMAN	I	47	ENSP00000334866:L47I	ENSP00000334866:L47I	L	+	1	0	KRTAP15-1	30734655	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	-1.398000	0.02509	-0.489000	0.06716	0.655000	0.94253	CTC		0.483	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128236.1			
MAPKAPK2	9261	hgsc.bcm.edu	37	1	206903392	206903393	+	Frame_Shift_Ins	INS	-	-	C	rs139297717|rs571837891	byFrequency	TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:206903392_206903393insC	ENST00000367103.3	+	5	833_834	c.640_641insC	c.(640-642)accfs	p.T214fs	MAPKAPK2_ENST00000294981.4_Frame_Shift_Ins_p.T214fs	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	214	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TGCCAAGGAAACCACCAGCCAC	0.48																																																	0																																										SO:0001589	frameshift_variant	9261			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.642dupC	1.37:g.206903394_206903394dupC	ENSP00000356070:p.Thr214fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SY30|Q5SY41|Q8IYD6	Frame_Shift_Ins	INS	ENST00000367103.3	37	CCDS31001.1																																																																																				0.480	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1		NM_004759	
MED15	51586	broad.mit.edu;ucsc.edu	37	22	20929497	20929497	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr22:20929497T>C	ENST00000263205.7	+	9	1319	c.1250T>C	c.(1249-1251)tTg>tCg	p.L417S	MED15_ENST00000542773.1_Intron|MED15_ENST00000382974.2_Intron|MED15_ENST00000478831.1_Intron|MED15_ENST00000292733.7_Intron|MED15_ENST00000406969.1_Intron|MED15_ENST00000425759.2_Intron|MED15_ENST00000541476.1_Intron	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	417	Pro-rich.				gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.L417S(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TCCATCCCTTTGGGCAGACAG	0.627																																																	1	Substitution - Missense(1)	kidney(1)											74.0	64.0	67.0					22																	20929497		2203	4300	6503	SO:0001583	missense	51586			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1250T>C	22.37:g.20929497T>C	ENSP00000263205:p.Leu417Ser	Somatic		WXS	Illumina GAIIx	Phase_I	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	ENST00000263205.7	37	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	T	16.59	3.165401	0.57476	.	.	ENSG00000099917	ENST00000263205;ENST00000542312	.	.	.	5.19	4.09	0.47781	Mediator complex, subunit Med15, metazoa (1);	1.044730	0.07453	N	0.899362	T	0.44414	0.1292	L	0.36672	1.1	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.11329	0.003;0.006	T	0.18147	-1.0346	9	0.06365	T	0.9	.	8.0673	0.30667	0.0:0.1124:0.0:0.8876	.	363;417	B4DGD6;Q96RN5	.;MED15_HUMAN	S	417;363	.	ENSP00000263205:L417S	L	+	2	0	MED15	19259497	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	2.010000	0.40913	0.741000	0.32674	0.482000	0.46254	TTG		0.627	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2		NM_015889	
NANOG	79923	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7947298	7947298	+	Silent	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr12:7947298C>T	ENST00000229307.4	+	4	744	c.525C>T	c.(523-525)ccC>ccT	p.P175P	NANOG_ENST00000526286.1_Intron	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	175					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P175P(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		CTACCTACCCCAGCCTTTACT	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	47.0	49.0					12																	7947298		2203	4299	6502	SO:0001819	synonymous_variant	79923			AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.525C>T	12.37:g.7947298C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DUU4|Q2TTG0|Q6JZS5	Silent	SNP	ENST00000229307.4	37	CCDS31736.1																																																																																				0.517	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2		NM_024865	
NHSL2	340527	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	71358471	71358471	+	5'UTR	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chrX:71358471C>T	ENST00000373677.1	+	0	1237				NHSL2_ENST00000540800.1_Missense_Mutation_p.A358V|NHSL2_ENST00000535692.1_5'UTR|NHSL2_ENST00000510661.1_Missense_Mutation_p.A127V			Q5HYW2	NHSL2_HUMAN	NHS-like 2									p.A358V(1)		NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CCTCACCAGGCACGGAGTGGC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											71.0	57.0	62.0					X																	71358471		2175	4237	6412	SO:0001623	5_prime_UTR_variant	340527					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.-26C>T	X.37:g.71358471C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RN94	Missense_Mutation	SNP	ENST00000373677.1	37		.	.	.	.	.	.	.	.	.	.	C	0.239	-1.014956	0.02078	.	.	ENSG00000204131	ENST00000540800;ENST00000510661	T;T	0.43688	1.59;0.94	5.87	0.599	0.17519	.	.	.	.	.	T	0.21801	0.0525	N	0.22421	0.69	0.09310	N	0.999995	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.003	T	0.22277	-1.0221	8	.	.	.	.	1.067	0.01613	0.1655:0.4114:0.1346:0.2885	.	358;127	F5H593;D6RBM4	.;.	V	358;127	ENSP00000444617:A358V;ENSP00000424079:A127V	.	A	+	2	0	NHSL2	71275196	0.234000	0.23783	0.005000	0.12908	0.013000	0.08279	0.518000	0.22847	-0.355000	0.08199	-0.332000	0.08345	GCA		0.552	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1		NM_001013627	
OCA2	4948	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	28267703	28267703	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr15:28267703T>G	ENST00000354638.3	-	6	745	c.590A>C	c.(589-591)tAt>tCt	p.Y197S	OCA2_ENST00000382996.2_Missense_Mutation_p.Y197S|OCA2_ENST00000353809.5_Missense_Mutation_p.Y197S	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	197					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.Y197S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TTGATCCGGATATAGGCTGAA	0.448									Oculocutaneous Albinism																																								1	Substitution - Missense(1)	kidney(1)											95.0	88.0	90.0					15																	28267703		2203	4300	6503	SO:0001583	missense	4948	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.590A>C	15.37:g.28267703T>G	ENSP00000346659:p.Tyr197Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	T	12.98	2.101586	0.37048	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996;ENST00000431101	D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07	4.74	4.74	0.60224	.	0.067061	0.64402	D	0.000007	T	0.79106	0.4390	L	0.56769	1.78	0.40083	D	0.976165	B;B	0.31125	0.309;0.083	B;B	0.26202	0.067;0.045	T	0.75485	-0.3301	10	0.26408	T	0.33	-15.0076	8.5263	0.33307	0.0:0.0:0.1958:0.8042	.	197;197	Q04671-2;Q04671	.;P_HUMAN	S	197	ENSP00000346659:Y197S;ENSP00000261276:Y197S;ENSP00000372457:Y197S;ENSP00000415431:Y197S	ENSP00000261276:Y197S	Y	-	2	0	OCA2	25941298	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	3.186000	0.50942	1.991000	0.58162	0.533000	0.62120	TAT		0.448	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1		NM_000275	
OR2C1	4993	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	3406081	3406081	+	Silent	SNP	G	G	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr16:3406081G>A	ENST00000304936.2	+	1	193	c.141G>A	c.(139-141)ttG>ttA	p.L47L		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	47					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L47L(1)		kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CCATCATCTTGCTTTCCCGCC	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											151.0	135.0	141.0					16																	3406081		2197	4300	6497	SO:0001819	synonymous_variant	4993			AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.141G>A	16.37:g.3406081G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0AVA4|Q6IF34|Q6IF55	Silent	SNP	ENST00000304936.2	37	CCDS10502.1																																																																																				0.507	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206993.3			
PLXND1	23129	broad.mit.edu;ucsc.edu	37	3	129308262	129308262	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:129308262C>T	ENST00000324093.4	-	2	1598	c.1420G>A	c.(1420-1422)Gtg>Atg	p.V474M	PLXND1_ENST00000393239.1_Missense_Mutation_p.V474M|RN7SL752P_ENST00000463779.2_RNA	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	474	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.V474M(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GCCACGGCCACGGAGGTGAGG	0.662																																					Ovarian(97;366 1484 3738 22084 39045)												1	Substitution - Missense(1)	kidney(1)											34.0	32.0	33.0					3																	129308262		2203	4300	6503	SO:0001583	missense	23129			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1420G>A	3.37:g.129308262C>T	ENSP00000317128:p.Val474Met	Somatic		WXS	Illumina GAIIx	Phase_I	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466104	0.84425	.	.	ENSG00000004399	ENST00000324093;ENST00000393239;ENST00000505237	T;T;T	0.09255	3.0;3.0;3.0	4.32	4.32	0.51571	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.077302	0.51477	D	0.000098	T	0.34483	0.0899	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.25916	-1.0118	10	0.87932	D	0	.	17.1784	0.86848	0.0:1.0:0.0:0.0	.	474	Q9Y4D7	PLXD1_HUMAN	M	474;474;37	ENSP00000317128:V474M;ENSP00000376931:V474M;ENSP00000426241:V37M	ENSP00000317128:V474M	V	-	1	0	PLXND1	130790952	1.000000	0.71417	0.998000	0.56505	0.821000	0.46438	7.022000	0.76431	2.114000	0.64651	0.442000	0.29010	GTG		0.662	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4		NM_015103	
POLI	11201	broad.mit.edu;ucsc.edu	37	18	51809261	51809261	+	Missense_Mutation	SNP	G	G	A	rs201346546	byFrequency	TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr18:51809261G>A	ENST00000579534.1	+	6	994	c.851G>A	c.(850-852)cGt>cAt	p.R284H	POLI_ENST00000406285.3_Missense_Mutation_p.R205H|POLI_ENST00000217800.5_Missense_Mutation_p.R158H|POLI_ENST00000579434.1_Missense_Mutation_p.R181H	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	284					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.R284H(1)|p.R259H(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AATAGTGTGCGTGATCTCCAA	0.358								DNA polymerases (catalytic subunits)																																									2	Substitution - Missense(2)	kidney(2)						G	HIS/ARG	0,4404		0,0,2202	54.0	51.0	52.0		851	-4.0	0.7	18		52	1,8595		0,1,4297	no	missense	POLI	NM_007195.2	29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	benign	284/741	51809261	1,12999	2202	4298	6500	SO:0001583	missense	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.851G>A	18.37:g.51809261G>A	ENSP00000462664:p.Arg284His	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	37	CCDS11954.2	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102433	0.37145	0.0	1.16E-4	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.22336	1.96	5.96	-3.99	0.04069	.	0.814674	0.11962	N	0.512670	T	0.12944	0.0314	N	0.25094	0.71	0.23277	N	0.997996	B;B	0.12013	0.005;0.005	B;B	0.09377	0.004;0.001	T	0.25398	-1.0133	10	0.18710	T	0.47	-0.4679	16.0002	0.80288	0.3638:0.0:0.6362:0.0	.	204;284	B7Z780;Q9UNA4	.;POLI_HUMAN	H	205;284	ENSP00000385196:R205H	ENSP00000217800:R284H	R	+	2	0	POLI	50063259	0.016000	0.18221	0.697000	0.30258	0.933000	0.57130	-0.107000	0.10873	-1.003000	0.03425	-0.294000	0.09567	CGT		0.358	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3		NM_007195	
PREX1	57580	broad.mit.edu;hgsc.bcm.edu	37	20	47244458	47244458	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr20:47244458G>A	ENST00000371941.3	-	38	4832	c.4810C>T	c.(4810-4812)Cgg>Tgg	p.R1604W	PREX1_ENST00000396220.1_3'UTR	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1604					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1604W(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCGTGGCTCCGTGCCAAGATG	0.692																																																	1	Substitution - Missense(1)	kidney(1)											48.0	36.0	40.0					20																	47244458		2203	4300	6503	SO:0001583	missense	57580			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4810C>T	20.37:g.47244458G>A	ENSP00000361009:p.Arg1604Trp	Somatic		WXS	Illumina HiSeq	Phase_I	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.130666	0.77549	.	.	ENSG00000124126	ENST00000371941	T	0.65178	-0.14	4.31	4.31	0.51392	.	0.000000	0.48767	U	0.000173	T	0.78991	0.4371	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82860	-0.0248	10	0.87932	D	0	.	16.7877	0.85578	0.0:0.0:1.0:0.0	.	1604;901	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	W	1604	ENSP00000361009:R1604W	ENSP00000361009:R1604W	R	-	1	2	PREX1	46677865	1.000000	0.71417	0.960000	0.40013	0.889000	0.51656	3.431000	0.52814	1.949000	0.56562	0.457000	0.33378	CGG		0.692	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1		NM_020820	
PSEN2	5664	broad.mit.edu;hgsc.bcm.edu	37	1	227073330	227073330	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:227073330G>T	ENST00000366783.3	+	6	884	c.448G>T	c.(448-450)Gtg>Ttg	p.V150L	PSEN2_ENST00000340188.4_Missense_Mutation_p.V150L|PSEN2_ENST00000422240.2_Missense_Mutation_p.V150L|PSEN2_ENST00000472139.2_Missense_Mutation_p.V6L|PSEN2_ENST00000366782.1_Missense_Mutation_p.V183L|PSEN2_ENST00000391872.2_Missense_Mutation_p.V183L	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	150					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)	p.V150L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				CAGCGTCATCGTGGTTATGAC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											220.0	145.0	170.0					1																	227073330		2203	4300	6503	SO:0001583	missense	5664			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.448G>T	1.37:g.227073330G>T	ENSP00000355747:p.Val150Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	ENST00000366783.3	37	CCDS1556.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968323	0.53614	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D	0.99652	-6.3;-6.3;-6.3;-6.3;-6.3;-6.3	5.27	5.27	0.74061	.	0.059913	0.64402	D	0.000003	D	0.98251	0.9421	L	0.52759	1.655	0.80722	D	1	B;B	0.12630	0.003;0.006	B;B	0.21360	0.023;0.034	D	0.95649	0.8705	10	0.39692	T	0.17	.	7.1259	0.25471	0.1495:0.1463:0.7042:0.0	.	150;150	A8K8D4;P49810	.;PSN2_HUMAN	L	150;150;150;183;183;6	ENSP00000355747:V150L;ENSP00000339860:V150L;ENSP00000403737:V150L;ENSP00000355746:V183L;ENSP00000375745:V183L;ENSP00000427806:V6L	ENSP00000339860:V150L	V	+	1	0	PSEN2	225139953	0.998000	0.40836	0.998000	0.56505	0.992000	0.81027	2.679000	0.46909	2.485000	0.83878	0.555000	0.69702	GTG		0.597	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1		NM_000447	
SEZ6	124925	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	27286442	27286442	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr17:27286442G>A	ENST00000317338.12	-	9	2248	c.1820C>T	c.(1819-1821)cCc>cTc	p.P607L	SEZ6_ENST00000442608.3_Missense_Mutation_p.P607L|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000360295.9_Missense_Mutation_p.P607L|SEZ6_ENST00000335960.6_Intron			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	607	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.P607L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TGGCCAGTTGGGAGAGAGTAC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											67.0	75.0	72.0					17																	27286442		2103	4238	6341	SO:0001583	missense	124925			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.1820C>T	17.37:g.27286442G>A	ENSP00000312942:p.Pro607Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	ENST00000317338.12	37	CCDS45639.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.653815	0.67472	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000541381	T;T;T	0.58210	0.35;0.35;1.63	5.21	4.24	0.50183	CUB (5);	0.062824	0.64402	N	0.000005	T	0.76471	0.3992	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.81553	-0.0880	10	0.87932	D	0	.	12.0642	0.53578	0.0849:0.0:0.9151:0.0	.	607;607	Q53EL9-3;Q53EL9	.;SEZ6_HUMAN	L	607;607;482;607	ENSP00000403784:P607L;ENSP00000353440:P607L;ENSP00000312942:P482L	ENSP00000312942:P482L	P	-	2	0	SEZ6	24310568	1.000000	0.71417	0.996000	0.52242	0.408000	0.30992	9.854000	0.99522	1.344000	0.45657	0.650000	0.86243	CCC		0.587	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397475.3			
SNAP91	9892	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	84302945	84302945	+	Missense_Mutation	SNP	G	G	A	rs370989881		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr6:84302945G>A	ENST00000439399.2	-	19	2046	c.1730C>T	c.(1729-1731)gCg>gTg	p.A577V	SNAP91_ENST00000369694.2_Missense_Mutation_p.A577V|SNAP91_ENST00000521743.1_Missense_Mutation_p.A577V|SNAP91_ENST00000428679.2_Missense_Mutation_p.A577V|SNAP91_ENST00000195649.6_Missense_Mutation_p.A577V|SNAP91_ENST00000520302.1_Missense_Mutation_p.A575V|SNAP91_ENST00000520213.1_Intron|SNAP91_ENST00000521485.1_Missense_Mutation_p.A577V|SNAP91_ENST00000437520.1_Intron	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	577	Ala-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)	p.A577V(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TGGCTTAGGCGCTGCAGCAAC	0.413																																																	2	Substitution - Missense(2)	kidney(2)						G	VAL/ALA,VAL/ALA,,VAL/ALA	0,4052		0,0,2026	54.0	55.0	55.0		1730,1724,,1730	4.7	1.0	6		55	1,8391		0,1,4195	no	missense,missense,intron,missense	SNAP91	NM_001242792.1,NM_001242793.1,NM_001242794.1,NM_014841.2	64,64,,64	0,1,6221	AA,AG,GG		0.0119,0.0,0.0080	benign,benign,,benign	577/908,575/878,,577/908	84302945	1,12443	2026	4196	6222	SO:0001583	missense	9892			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1730C>T	6.37:g.84302945G>A	ENSP00000400459:p.Ala577Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	37	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	G	9.134	1.012174	0.19277	0.0	1.19E-4	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000520302;ENST00000521743;ENST00000521931	T;T;T;T;T;T;T;T	0.32023	2.44;2.46;2.46;2.44;2.44;2.45;2.46;1.47	5.56	4.69	0.59074	.	0.255397	0.38111	N	0.001801	T	0.11452	0.0279	L	0.31294	0.92	0.80722	D	1	B;P;P	0.45715	0.007;0.865;0.865	B;B;B	0.36808	0.002;0.233;0.217	T	0.03795	-1.1003	10	0.33141	T	0.24	-8.4864	13.8295	0.63370	0.0737:0.0:0.9263:0.0	.	458;575;575	B7Z2N2;E5RI02;E1P549	.;.;.	V	577;577;577;577;577;575;577;390	ENSP00000429776:A577V;ENSP00000358708:A577V;ENSP00000400459:A577V;ENSP00000195649:A577V;ENSP00000412492:A577V;ENSP00000428511:A575V;ENSP00000428215:A577V;ENSP00000430071:A390V	ENSP00000195649:A577V	A	-	2	0	SNAP91	84359664	1.000000	0.71417	0.998000	0.56505	0.138000	0.21146	4.770000	0.62309	2.598000	0.87819	0.655000	0.94253	GCG		0.413	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1			
SRPK2	6733	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	104844182	104844182	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr7:104844182G>C	ENST00000393651.3	-	3	209	c.122C>G	c.(121-123)cCa>cGa	p.P41R	SRPK2_ENST00000489828.1_Missense_Mutation_p.P30R|SRPK2_ENST00000357311.3_Missense_Mutation_p.P30R	NM_182692.1	NP_872634.1			SRSF protein kinase 2									p.P30R(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						tggtggtggtggtggcggtgg	0.552																																																	1	Substitution - Missense(1)	kidney(1)											49.0	44.0	46.0					7																	104844182		2203	4300	6503	SO:0001583	missense	6733			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.122C>G	7.37:g.104844182G>C	ENSP00000377262:p.Pro41Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000393651.3	37	CCDS34724.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691053	0.48097	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828;ENST00000482897;ENST00000460391	D;D;D;T;T	0.87966	-2.32;-2.32;-2.32;0.77;0.77	6.04	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.82733	0.5101	L	0.27053	0.805	0.58432	D	0.999999	P;B	0.45212	0.853;0.265	P;B	0.46049	0.502;0.229	T	0.82390	-0.0481	10	0.38643	T	0.18	-3.8272	13.5063	0.61485	0.0727:0.0:0.9273:0.0	.	41;30	P78362-2;P78362	.;SRPK2_HUMAN	R	41;30;30;78;30	ENSP00000377262:P41R;ENSP00000349863:P30R;ENSP00000419791:P30R;ENSP00000419240:P78R;ENSP00000417357:P30R	ENSP00000349863:P30R	P	-	2	0	SRPK2	104631418	1.000000	0.71417	0.264000	0.24511	0.681000	0.39784	8.856000	0.92245	1.568000	0.49683	0.561000	0.74099	CCA		0.552	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348723.1		NM_182691	
STAU2	27067	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	74440017	74440017	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr8:74440017C>A	ENST00000521210.1	-	12	1515	c.1241G>T	c.(1240-1242)aGt>aTt	p.S414I	STAU2_ENST00000524300.1_Intron|STAU2_ENST00000522695.1_Intron|STAU2_ENST00000523558.1_Intron	NM_001164382.1	NP_001157854.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	509	Required for dendritic transport. {ECO:0000250}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.S414I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			CTCTTTGCCACTTTGTCTATC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											203.0	157.0	171.0					8																	74440017		692	1591	2283	SO:0001583	missense	27067			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521210.1:c.1241G>T	8.37:g.74440017C>A	ENSP00000429173:p.Ser414Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	ENST00000521210.1	37	CCDS55245.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235070	0.39498	.	.	ENSG00000040341	ENST00000521210;ENST00000523533	T	0.53857	0.6	4.87	2.91	0.33838	.	.	.	.	.	T	0.33673	0.0871	N	0.24115	0.695	0.80722	D	1	B	0.34015	0.435	B	0.30782	0.12	T	0.25882	-1.0119	9	0.72032	D	0.01	.	6.3496	0.21369	0.0:0.6821:0.0:0.3179	.	414	E9PEI3	.	I	414;131	ENSP00000429173:S414I	ENSP00000429173:S414I	S	-	2	0	STAU2	74602571	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.452000	0.35156	1.271000	0.44313	0.591000	0.81541	AGT		0.443	STAU2-011	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379002.2		NM_001164380	
TINAGL1	64129	broad.mit.edu;ucsc.edu	37	1	32050373	32050373	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:32050373G>T	ENST00000271064.7	+	6	753	c.677G>T	c.(676-678)tGt>tTt	p.C226F	TINAGL1_ENST00000457433.2_Missense_Mutation_p.C195F|TINAGL1_ENST00000537531.1_3'UTR|TINAGL1_ENST00000481165.1_3'UTR	NM_001204415.1|NM_022164.2	NP_001191344.1|NP_071447.1	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	226					endosomal transport (GO:0016197)|immune response (GO:0006955)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type peptidase activity (GO:0008234)|extracellular matrix structural constituent (GO:0005201)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.C226F(1)		breast(2)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		CAAGGCAACTGTGCAGGCTCC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											72.0	68.0	69.0					1																	32050373		2203	4300	6503	SO:0001583	missense	64129			AB050716	CCDS343.1, CCDS55586.1, CCDS72745.1	1p34.3	2014-04-22	2005-08-18	2005-08-18	ENSG00000142910	ENSG00000142910			19168	protein-coding gene	gene with protein product			"""lipocalin 7"", ""TINAG-like 1"""	LCN7		11170462	Standard	NM_022164		Approved	P3ECSL, LIECG3, ARG1, TINAGRP	uc001bta.3	Q9GZM7	OTTHUMG00000003884	ENST00000271064.7:c.677G>T	1.37:g.32050373G>T	ENSP00000271064:p.Cys226Phe	Somatic		WXS	Illumina GAIIx	Phase_I	A8K9Q5|B4DPK6|D3DPN8|Q8TEJ9|Q8WZ23|Q96GZ4|Q96JW3	Missense_Mutation	SNP	ENST00000271064.7	37	CCDS343.1	.	.	.	.	.	.	.	.	.	.	g	21.7	4.187676	0.78789	.	.	ENSG00000142910	ENST00000457433;ENST00000271064;ENST00000403321	D;D	0.98164	-4.76;-4.76	4.78	4.78	0.61160	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.99456	0.9807	H	0.98802	4.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97987	1.0352	10	0.87932	D	0	.	17.7882	0.88545	0.0:0.0:1.0:0.0	.	195;226	B4DPK6;Q9GZM7	.;TINAL_HUMAN	F	195;226;214	ENSP00000395137:C195F;ENSP00000271064:C226F	ENSP00000271064:C226F	C	+	2	0	TINAGL1	31822960	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.591000	0.98241	2.365000	0.80145	0.313000	0.20887	TGT		0.617	TINAGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011072.1		NM_022164	
THRAP3	9967	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	36755253	36755253	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:36755253C>T	ENST00000354618.5	+	5	1857	c.1633C>T	c.(1633-1635)Cga>Tga	p.R545*	THRAP3_ENST00000469141.2_Nonsense_Mutation_p.R545*	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	545	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R545*(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTCTGAGAGCCGAGACAAGCT	0.498			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)			Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	1	Substitution - Nonsense(1)	kidney(1)											86.0	93.0	90.0					1																	36755253		2203	4300	6503	SO:0001587	stop_gained	9967			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1633C>T	1.37:g.36755253C>T	ENSP00000346634:p.Arg545*	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPS5|Q5VTK6	Nonsense_Mutation	SNP	ENST00000354618.5	37	CCDS405.1	.	.	.	.	.	.	.	.	.	.	C	40	8.377516	0.98784	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	.	.	.	6.06	5.1	0.69264	.	0.162047	0.41938	D	0.000793	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3136	12.2869	0.54797	0.2929:0.7071:0.0:0.0	.	.	.	.	X	545	.	ENSP00000346634:R545X	R	+	1	2	THRAP3	36527840	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.490000	0.45294	2.882000	0.98803	0.655000	0.94253	CGA		0.498	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2		NM_005119	
VHL	7428	hgsc.bcm.edu	37	3	10183797	10183797	+	Missense_Mutation	SNP	T	T	A	rs5030807		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PacBio	.		Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:10183797T>A	ENST00000256474.2	+	1	1106	c.266T>A	c.(265-267)cTc>cAc	p.L89H	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Missense_Mutation_p.L89H	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	89			L -> H (in lung cancer).|L -> P (in VHLD; type I; dbSNP:rs5030807). {ECO:0000269|PubMed:8956040}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L89H(11)|p.L89P(6)|p.L89R(3)|p.R60fs*35(1)|p.V84_E94>E(1)|p.V84fs*69(1)|p.L89fs*67(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCGTATGGCTCAACTTCGAC	0.726	L89H(NCIH28_PLEURA)	1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																													.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	24	Substitution - Missense(20)|Deletion - Frameshift(3)|Complex - deletion inframe(1)	kidney(22)|pancreas(1)|pleura(1)	GRCh37	CM941368	VHL	M	rs5030807						13.0	16.0	15.0					3																	10183797		2106	4156	6262	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.266T>A	3.37:g.10183797T>A	ENSP00000256474:p.Leu89His	Somatic		WXS	Illumina MiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.986585	0.93106	.	.	ENSG00000134086	ENST00000256474;ENST00000345392	D;D	0.99815	-6.9;-6.9	5.06	5.06	0.68205	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.185584	0.46442	D	0.000292	D	0.99576	0.9847	L	0.41492	1.28	0.33129	D	0.542832	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.957	D	0.97755	1.0217	10	0.87932	D	0	-8.4916	12.8448	0.57823	0.0:0.0:0.0:1.0	.	89;89	P40337-2;P40337	.;VHL_HUMAN	H	89	ENSP00000256474:L89H;ENSP00000344757:L89H	ENSP00000256474:L89H	L	+	2	0	VHL	10158797	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.914000	0.63348	1.920000	0.55613	0.450000	0.29827	CTC		0.726	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
NME9	347736	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	138023808	138023808	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:138023808G>C	ENST00000333911.3	-	9	725	c.698C>G	c.(697-699)aCc>aGc	p.T233S	NME9_ENST00000341790.5_Missense_Mutation_p.T170S|NME9_ENST00000317876.4_Missense_Mutation_p.T172S|NME9_ENST00000484930.1_Missense_Mutation_p.T170S|NME9_ENST00000383180.2_Missense_Mutation_p.T172S|NME9_ENST00000536478.1_Missense_Mutation_p.T172S			Q86XW9	TXND6_HUMAN	NME/NM23 family member 9	233	NDK.				cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.T172S(1)									CTCAGTCCTGGTGAGGATCAG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											189.0	162.0	171.0					3																	138023808		2203	4300	6503	SO:0001583	missense	0			AF196568	CCDS3099.1	3q22.3	2012-05-18	2012-05-18	2011-08-24	ENSG00000181322	ENSG00000181322			21343	protein-coding gene	gene with protein product			"""thioredoxin domain containing 6"", ""NME gene family member 9"", ""NME family member 9"""	TXNDC6		12569107, 19852809	Standard	NM_178130		Approved	TXL-2, NM23-H9	uc003ese.1	Q86XW9	OTTHUMG00000159823	ENST00000333911.3:c.698C>G	3.37:g.138023808G>C	ENSP00000335444:p.Thr233Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z4A8|Q8N1V7	Missense_Mutation	SNP	ENST00000333911.3	37		.	.	.	.	.	.	.	.	.	.	G	7.638	0.680255	0.14907	.	.	ENSG00000181322	ENST00000383180;ENST00000317876;ENST00000484930;ENST00000341790;ENST00000536478;ENST00000333911	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	5.44	5.44	0.79542	.	0.407398	0.27618	N	0.018571	T	0.35828	0.0945	.	.	.	0.34051	D	0.656179	B;B;B	0.18013	0.015;0.025;0.005	B;B;B	0.27887	0.013;0.084;0.017	T	0.29882	-0.9997	9	0.05959	T	0.93	-8.9524	16.7443	0.85468	0.0:0.0:1.0:0.0	.	170;233;172	Q86XW9-3;Q86XW9;Q86XW9-2	.;TXND6_HUMAN;.	S	172;172;170;170;172;233	ENSP00000372667:T172S;ENSP00000321929:T172S;ENSP00000419882:T170S;ENSP00000341084:T170S;ENSP00000440143:T172S;ENSP00000335444:T233S	ENSP00000321929:T172S	T	-	2	0	TXNDC6	139506498	1.000000	0.71417	0.996000	0.52242	0.278000	0.26855	7.135000	0.77276	2.562000	0.86427	0.591000	0.81541	ACC		0.597	NME9-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357583.1		NM_178130	
WNT2	7472	broad.mit.edu;ucsc.edu	37	7	116918296	116918296	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr7:116918296G>C	ENST00000265441.3	-	5	1295	c.996C>G	c.(994-996)tgC>tgG	p.C332W		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	332					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.C332W(1)|p.C332C(1)		breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		AGCGCACGGCGCAGCACCAGT	0.602																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|kidney(1)											152.0	107.0	122.0					7																	116918296		2203	4300	6503	SO:0001583	missense	7472			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.996C>G	7.37:g.116918296G>C	ENSP00000265441:p.Cys332Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	37	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882381	0.72294	.	.	ENSG00000105989	ENST00000265441	D	0.83075	-1.68	5.87	-7.46	0.01369	.	0.100184	0.64402	D	0.000001	D	0.93536	0.7937	H	0.98866	4.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93602	0.6931	10	0.87932	D	0	.	18.5226	0.90959	0.3328:0.0:0.6672:0.0	.	332;332	A4D0V1;P09544	.;WNT2_HUMAN	W	332	ENSP00000265441:C332W	ENSP00000265441:C332W	C	-	3	2	WNT2	116705532	0.117000	0.22190	0.894000	0.35097	0.979000	0.70002	-0.371000	0.07513	-1.193000	0.02688	-0.794000	0.03295	TGC		0.602	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3		NM_003391	
ZBBX	79740	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	167000169	167000169	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:167000169G>A	ENST00000392766.2	-	19	2334	c.1994C>T	c.(1993-1995)tCa>tTa	p.S665L	ZBBX_ENST00000392767.2_Missense_Mutation_p.S665L|ZBBX_ENST00000455345.2_Missense_Mutation_p.S704L|ZBBX_ENST00000307529.5_Missense_Mutation_p.S704L|ZBBX_ENST00000392764.1_Missense_Mutation_p.S636L	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	665	Ser-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S665L(1)|p.S704L(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TCTAGATGATGATTGAGCAGC	0.378																																																	2	Substitution - Missense(2)	kidney(2)											134.0	126.0	129.0					3																	167000169		1851	4086	5937	SO:0001583	missense	79740			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1994C>T	3.37:g.167000169G>A	ENSP00000376519:p.Ser665Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	G	10.88	1.476880	0.26511	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.11604	2.93;2.93;2.94;2.94;2.76	5.28	4.39	0.52855	.	0.378131	0.22280	N	0.062133	T	0.10035	0.0246	L	0.46157	1.445	0.09310	N	1	P;P	0.38677	0.642;0.51	B;B	0.34452	0.183;0.089	T	0.16541	-1.0399	10	0.35671	T	0.21	-0.6186	10.8567	0.46802	0.0938:0.0:0.9062:0.0	.	704;665	A8MT70-2;A8MT70	.;ZBBX_HUMAN	L	665;665;704;704;636	ENSP00000376519:S665L;ENSP00000376520:S665L;ENSP00000390232:S704L;ENSP00000305065:S704L;ENSP00000376517:S636L	ENSP00000305065:S704L	S	-	2	0	ZBBX	168482863	0.007000	0.16637	0.002000	0.10522	0.002000	0.02628	1.372000	0.34261	1.192000	0.43071	0.650000	0.86243	TCA		0.378	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3		NM_024687	
ZNF649	65251	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	52394722	52394722	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr19:52394722C>T	ENST00000354957.3	-	5	951	c.667G>A	c.(667-669)Gaa>Aaa	p.E223K	ZNF649_ENST00000600738.1_Intron|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E223K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CTCTCGTGTTCAGTGAGCCTG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											118.0	114.0	115.0					19																	52394722		2203	4300	6503	SO:0001583	missense	65251			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.667G>A	19.37:g.52394722C>T	ENSP00000347043:p.Glu223Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	C	3.144	-0.175764	0.06421	.	.	ENSG00000198093	ENST00000354957	T	0.16073	2.37	2.23	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04318	0.0119	N	0.04063	-0.285	0.09310	N	1	P	0.37663	0.604	B	0.29353	0.101	T	0.20405	-1.0276	9	0.06494	T	0.89	.	3.1343	0.06434	0.0:0.4709:0.236:0.2931	.	223	Q9BS31	ZN649_HUMAN	K	223	ENSP00000347043:E223K	ENSP00000347043:E223K	E	-	1	0	ZNF649	57086534	0.000000	0.05858	0.127000	0.21898	0.007000	0.05969	-1.342000	0.02645	1.077000	0.40990	0.398000	0.26397	GAA		0.498	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1		NM_023074	
AKR1B10	57016	broad.mit.edu	37	7	134212620	134212620	+	5'UTR	SNP	G	G	A	rs374392895		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr7:134212620G>A	ENST00000359579.4	+	0	277				AKR1B10_ENST00000475559.1_3'UTR	NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)						cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						AGAGCAGGACGTGAGACTTCT	0.532																																																	0								G		0,4406		0,0,2203	98.0	84.0	89.0			-2.9	0.0	7		89	2,8598	818.9+/-406.8	0,2,4298	no	utr-5	AKR1B10	NM_020299.4		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154			134212620	2,13004	2203	4300	6503	SO:0001623	5_prime_UTR_variant	57016			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.-44G>A	7.37:g.134212620G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A4D1P1|O75890|Q6FHF3|Q8IWZ1	Translation_Start_Site	SNP	ENST00000359579.4	37	CCDS5832.1																																																																																				0.532	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1		NM_020299	
ANKRD23	200539	broad.mit.edu	37	2	97505515	97505515	+	Silent	SNP	T	T	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr2:97505515T>C	ENST00000318357.4	-	8	812	c.771A>G	c.(769-771)aaA>aaG	p.K257K	ANKRD23_ENST00000331001.2_Silent_p.K215K|ANKRD23_ENST00000418232.1_Silent_p.K257K|ANKRD23_ENST00000476975.1_Intron	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	257					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)	p.K257K(1)		endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						GCTTCATGGCTTTGTAGCTGC	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											34.0	31.0	32.0					2																	97505515		2203	4300	6503	SO:0001819	synonymous_variant	200539				CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.771A>G	2.37:g.97505515T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q711K7|Q8NAJ7	Silent	SNP	ENST00000318357.4	37	CCDS2027.1																																																																																				0.677	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252956.1		NM_144994	
CENPM	79019	broad.mit.edu	37	22	42335169	42335169	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr22:42335169C>A	ENST00000215980.5	-	6	521	c.434G>T	c.(433-435)cGc>cTc	p.R145L	CENPM_ENST00000407253.3_3'UTR|CENPM_ENST00000404067.1_3'UTR|CENPM_ENST00000472374.2_Missense_Mutation_p.R23L|CENPM_ENST00000402338.1_Missense_Mutation_p.R111L	NM_024053.3	NP_076958.1	Q9NSP4	CENPM_HUMAN	centromere protein M	145					mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)		p.R145L(1)		kidney(1)|large_intestine(1)|prostate(1)	3						GCGCACCAGGCGCTGCGCCAT	0.637																																																	1	Substitution - Missense(1)	kidney(1)											26.0	24.0	25.0					22																	42335169		2197	4299	6496	SO:0001583	missense	79019			BC000705	CCDS14025.1, CCDS46719.1, CCDS46720.1	22q13.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000100162	ENSG00000100162			18352	protein-coding gene	gene with protein product		610152	"""chromosome 22 open reading frame 18"""	C22orf18		16622420, 16622419	Standard	NM_001110215		Approved	Pane1, CENP-M, MGC861	uc003bbn.3	Q9NSP4	OTTHUMG00000151277	ENST00000215980.5:c.434G>T	22.37:g.42335169C>A	ENSP00000215980:p.Arg145Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A7LM22|B1AHQ9|Q6I9W3	Missense_Mutation	SNP	ENST00000215980.5	37	CCDS14025.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.348909	0.82132	.	.	ENSG00000100162	ENST00000215980;ENST00000472374;ENST00000402338	.	.	.	4.39	4.39	0.52855	.	0.049774	0.85682	D	0.000000	T	0.77336	0.4115	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	T	0.80390	-0.1402	9	0.87932	D	0	-21.6423	12.8477	0.57839	0.0:1.0:0.0:0.0	.	23;145	Q9NSP4-3;Q9NSP4	.;CENPM_HUMAN	L	145;23;111	.	ENSP00000215980:R145L	R	-	2	0	CENPM	40665115	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	4.101000	0.57769	2.180000	0.69256	0.561000	0.74099	CGC		0.637	CENPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322058.1		NM_024053	
ESPNP	284729	broad.mit.edu	37	1	17017734	17017734	+	RNA	SNP	C	C	T	rs12561805	byFrequency	TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr1:17017734C>T	ENST00000492551.1	-	0	1993					NR_026567.1				espin pseudogene																		CAGCTTCTTCCGCAGGAGGTC	0.647													c|||	1453	0.290136	0.1589	0.3184	5008	,	,		38815	0.4425		0.2913	False		,,,				2504	0.2894																0																																												284729			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17017734C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000492551.1	37																																																																																					0.647	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			
HLA-C	3107	broad.mit.edu	37	6	31237140	31237140	+	Silent	SNP	A	A	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr6:31237140A>T	ENST00000376228.5	-	7	1085	c.1071T>A	c.(1069-1071)tcT>tcA	p.S357S	HLA-C_ENST00000383329.3_Silent_p.S363S	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	363					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)	p.S357S(1)|p.S363S(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GAGACTCATCAGAGCCCTGGG	0.527																																																	2	Substitution - coding silent(2)	kidney(2)											39.0	47.0	44.0					6																	31237140		1511	2709	4220	SO:0001819	synonymous_variant	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.1071T>A	6.37:g.31237140A>T		Somatic		WXS	Illumina GAIIx	Phase_I	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	.	.	.	.	.	.	.	.	.	.	.	8.458	0.854611	0.17106	.	.	ENSG00000204525	ENST00000396254	.	.	.	3.33	2.08	0.27032	.	.	.	.	.	T	0.28995	0.0720	.	.	.	0.80722	D	1	D	0.53885	0.963	P	0.59012	0.85	T	0.43261	-0.9402	7	0.02654	T	1	.	6.8252	0.23878	0.7609:0.2391:0.0:0.0	.	356	A2AEA4	.	Q	356	.	ENSP00000379553:L356Q	L	-	2	0	HLA-C	31345119	0.073000	0.21202	0.451000	0.26982	0.218000	0.24690	0.538000	0.23160	0.419000	0.25927	0.248000	0.18094	CTG		0.527	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3		NM_002117	
HIVEP2	3097	broad.mit.edu	37	6	143093080	143093080	+	Silent	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr6:143093080C>T	ENST00000367604.1	-	4	3435	c.2796G>A	c.(2794-2796)gcG>gcA	p.A932A	HIVEP2_ENST00000012134.2_Silent_p.A932A|HIVEP2_ENST00000367603.2_Silent_p.A932A			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	932					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A932A(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCAACTTCTCCGCGGGGAGCT	0.562																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												1	Substitution - coding silent(1)	kidney(1)											61.0	64.0	63.0					6																	143093080		1883	4121	6004	SO:0001819	synonymous_variant	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.2796G>A	6.37:g.143093080C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q02646|Q5THT5|Q9NS05	Silent	SNP	ENST00000367604.1	37	CCDS43510.1																																																																																				0.562	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			
CCNT1	904	broad.mit.edu	37	12	49082927	49082927	+	3'UTR	DEL	T	T	-			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr12:49082927delT	ENST00000261900.3	-	0	6292					NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1						cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						AGTCCTTCTCTTTTTTTCATT	0.413																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.*3889A>-	12.37:g.49082927delT		Somatic		WXS	Illumina GAIIx	Phase_I	A9XU13|E7EX76|O60581	RNA	DEL	ENST00000261900.3	37	CCDS8766.1																																																																																				0.413	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1		NM_001240	
LRRC55	219527	broad.mit.edu	37	11	56958045	56958045	+	3'UTR	DEL	G	G	-			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr11:56958045delG	ENST00000497933.1	+	0	4264					NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55						ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						TGTATGTGATGGGGTATCTCT	0.438																																																	0																																										SO:0001624	3_prime_UTR_variant	219527				CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.*3091G>-	11.37:g.56958045delG		Somatic		WXS	Illumina GAIIx	Phase_I	A7E2U7|B2RN81	RNA	DEL	ENST00000497933.1	37	CCDS31539.1																																																																																				0.438	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2		NM_001005210	
MED12	9968	broad.mit.edu	37	X	70360569	70360569	+	Silent	SNP	T	T	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chrX:70360569T>C	ENST00000374080.3	+	42	6161	c.6129T>C	c.(6127-6129)cgT>cgC	p.R2043R	MED12_ENST00000374102.1_Silent_p.R2042R|AL590764.1_ENST00000579622.1_RNA|MED12_ENST00000333646.6_Silent_p.R2046R			Q93074	MED12_HUMAN	mediator complex subunit 12	2043	Gln-rich.|Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R2043R(2)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CAGGCGTCCGTTCAACAGCCA	0.562			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	2	Substitution - coding silent(2)	kidney(2)											80.0	81.0	80.0					X																	70360569		2197	4291	6488	SO:0001819	synonymous_variant	9968			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.6129T>C	X.37:g.70360569T>C		Somatic		WXS	Illumina GAIIx	Phase_I	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	C	0.914	-0.717961	0.03182	.	.	ENSG00000184634	ENST00000444034	.	.	.	4.69	-1.6	0.08426	.	.	.	.	.	T	0.40322	0.1112	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23833	-1.0177	4	.	.	.	-13.5124	1.3607	0.02191	0.2298:0.3023:0.2888:0.179	.	.	.	.	A	239	.	.	V	+	2	0	MED12	70277294	0.494000	0.26043	0.155000	0.22561	0.062000	0.15995	-0.135000	0.10420	-1.027000	0.03325	-0.416000	0.06073	GTT		0.562	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1		NM_005120	
MUC4	4585	broad.mit.edu	37	3	195515059	195515059	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr3:195515059G>A	ENST00000463781.3	-	2	3851	c.3392C>T	c.(3391-3393)aCa>aTa	p.T1131I	MUC4_ENST00000475231.1_Missense_Mutation_p.T1131I|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	570					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T1131I(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGCGTGACCTGTGGATGCTGA	0.562																																																	1	Substitution - Missense(1)	kidney(1)											6.0	6.0	6.0					3																	195515059		577	1300	1877	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3392C>T	3.37:g.195515059G>A	ENSP00000417498:p.Thr1131Ile	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.892	0.348764	0.11126	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35236	1.32;1.32	0.706	-0.423	0.12325	.	.	.	.	.	T	0.27663	0.0680	N	0.19112	0.55	0.09310	N	1	P	0.47302	0.893	P	0.50590	0.645	T	0.15752	-1.0426	8	.	.	.	.	5.2119	0.15322	0.2471:0.0:0.7529:0.0	.	1131	E7ESK3	.	I	1131	ENSP00000417498:T1131I;ENSP00000420243:T1131I	.	T	-	2	0	MUC4	196999454	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.130000	0.10498	-0.139000	0.11414	0.064000	0.15345	ACA		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
MYH14	79784	broad.mit.edu	37	19	50733855	50733855	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr19:50733855delG	ENST00000596571.1	+	7	924	c.924delG	c.(922-924)ctgfs	p.L308fs	MYH14_ENST00000440075.2_Frame_Shift_Del_p.L316fs|MYH14_ENST00000425460.1_Frame_Shift_Del_p.L316fs|MYH14_ENST00000376970.2_Frame_Shift_Del_p.L308fs|MYH14_ENST00000601313.1_Frame_Shift_Del_p.L316fs|MYH14_ENST00000598205.1_Frame_Shift_Del_p.L316fs|MYH14_ENST00000262269.8_Frame_Shift_Del_p.L316fs			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	308	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ACCAGCTGCTGGGGGGCGCTG	0.657																																																	0													14.0	17.0	16.0					19																	50733855		2085	4200	6285	SO:0001589	frameshift_variant	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.924delG	19.37:g.50733855delG	ENSP00000472819:p.Leu308fs	Somatic		WXS	Illumina GAIIx	Phase_I	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Frame_Shift_Del	DEL	ENST00000596571.1	37	CCDS59411.1																																																																																				0.657	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2		NM_024729	
OR10H5	284433	broad.mit.edu	37	19	15905371	15905371	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr19:15905371C>A	ENST00000308940.8	+	1	611	c.513C>A	c.(511-513)caC>caA	p.H171Q		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H171Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						TCTGTGGACACAAGGAGATCC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											146.0	118.0	128.0					19																	15905371		2203	4300	6503	SO:0001583	missense	284433			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.513C>A	19.37:g.15905371C>A	ENSP00000310704:p.His171Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	.	.	.	.	.	.	.	.	.	.	.	1.154	-0.645761	0.03531	.	.	ENSG00000172519	ENST00000308940	T	0.36878	1.23	3.36	-1.86	0.07760	GPCR, rhodopsin-like superfamily (1);	0.134657	0.34156	N	0.004204	T	0.19005	0.0456	N	0.21142	0.635	0.09310	N	1	B	0.12013	0.005	B	0.22601	0.04	T	0.09930	-1.0652	10	0.37606	T	0.19	.	5.4623	0.16624	0.1557:0.5871:0.0:0.2571	.	171	Q8NGA6	O10H5_HUMAN	Q	171	ENSP00000310704:H171Q	ENSP00000310704:H171Q	H	+	3	2	OR10H5	15766371	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.296000	0.01142	-0.467000	0.06932	0.585000	0.79938	CAC		0.607	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1			
PCDHA11	56138	broad.mit.edu	37	5	140250599	140250599	+	Silent	SNP	C	C	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr5:140250599C>T	ENST00000398640.2	+	1	1911	c.1911C>T	c.(1909-1911)gaC>gaT	p.D637D	PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	637	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D637D(1)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCCTGGACGAGGCAGACT	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	51.0	48.0					5																	140250599		2203	4298	6501	SO:0001819	synonymous_variant	56138			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1911C>T	5.37:g.140250599C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B2RN58|O75279	Silent	SNP	ENST00000398640.2	37	CCDS47284.1																																																																																				0.662	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2		NM_018902	
RIMS1	22999	broad.mit.edu	37	6	72892128	72892128	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr6:72892128G>T	ENST00000521978.1	+	6	954	c.954G>T	c.(952-954)agG>agT	p.R318S	RIMS1_ENST00000520567.1_Missense_Mutation_p.R318S|RIMS1_ENST00000491071.2_Missense_Mutation_p.R318S|RIMS1_ENST00000518273.1_Missense_Mutation_p.R318S|RIMS1_ENST00000522291.1_Missense_Mutation_p.R318S|RIMS1_ENST00000264839.7_Missense_Mutation_p.R318S|RIMS1_ENST00000348717.5_Missense_Mutation_p.R318S|RIMS1_ENST00000517960.1_Missense_Mutation_p.R318S	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	318					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.R318S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AAAGCCGAAGGCTTGAGAAAG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											36.0	44.0	41.0					6																	72892128		1928	4134	6062	SO:0001583	missense	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.954G>T	6.37:g.72892128G>T	ENSP00000428417:p.Arg318Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.136945	0.56936	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.16897	2.31;2.45;2.36;2.45;2.44;2.44;2.45;2.35	4.64	3.76	0.43208	.	0.000000	0.64402	D	0.000006	T	0.26666	0.0652	M	0.73962	2.25	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.02320	-1.1177	10	0.66056	D	0.02	-3.9561	6.9388	0.24481	0.3035:0.0:0.6965:0.0	.	318	Q86UR5	RIMS1_HUMAN	S	318	ENSP00000430101:R318S;ENSP00000275037:R318S;ENSP00000264839:R318S;ENSP00000429959:R318S;ENSP00000430408:R318S;ENSP00000430502:R318S;ENSP00000430932:R318S;ENSP00000428417:R318S	ENSP00000264839:R318S	R	+	3	2	RIMS1	72948849	1.000000	0.71417	0.992000	0.48379	0.761000	0.43186	0.905000	0.28504	2.123000	0.65237	0.462000	0.41574	AGG		0.582	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			
RRS1	23212	broad.mit.edu	37	8	67341565	67341565	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr8:67341565G>C	ENST00000320270.2	+	1	303	c.199G>C	c.(199-201)Gac>Cac	p.D67H	RP11-346I3.4_ENST00000499642.1_lincRNA	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	67					hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D67H(1)		kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CCTGGCGCGGGACAACACGCA	0.716											OREG0018806	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											15.0	15.0	15.0					8																	67341565		2119	4152	6271	SO:0001583	missense	23212			BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.199G>C	8.37:g.67341565G>C	ENSP00000322396:p.Asp67His	Somatic	1098	WXS	Illumina GAIIx	Phase_I	Q9BUX8	Missense_Mutation	SNP	ENST00000320270.2	37	CCDS6189.1	.	.	.	.	.	.	.	.	.	.	g	29.4	5.006453	0.93287	.	.	ENSG00000179041	ENST00000320270	T	0.27256	1.68	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.60183	0.2249	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66168	-0.5991	10	0.72032	D	0.01	-24.1021	18.5978	0.91235	0.0:0.0:1.0:0.0	.	67	Q15050	RRS1_HUMAN	H	67	ENSP00000322396:D67H	ENSP00000322396:D67H	D	+	1	0	RRS1	67504119	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.127000	0.77210	2.735000	0.93741	0.645000	0.84053	GAC		0.716	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380126.1		NM_015169	
SCNN1B	6338	broad.mit.edu	37	16	23360188	23360188	+	Missense_Mutation	SNP	A	A	G	rs150466803	byFrequency	TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr16:23360188A>G	ENST00000343070.2	+	2	444	c.268A>G	c.(268-270)Atg>Gtg	p.M90V	SCNN1B_ENST00000568085.1_Missense_Mutation_p.M90V|SCNN1B_ENST00000568923.1_Missense_Mutation_p.M90V|SCNN1B_ENST00000569789.1_3'UTR|SCNN1B_ENST00000307331.5_Missense_Mutation_p.M135V	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	90					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.M90V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CTTCAAGACCATGGACTTCCC	0.607													A|||	2	0.000399361	0.0	0.0	5008	,	,		15614	0.002		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						A	VAL/MET	1,4393	2.1+/-5.4	0,1,2196	73.0	64.0	67.0		268	4.9	1.0	16	dbSNP_134	67	0,8600		0,0,4300	no	missense	SCNN1B	NM_000336.2	21	0,1,6496	GG,GA,AA		0.0,0.0228,0.0077	benign	90/641	23360188	1,12993	2197	4300	6497	SO:0001583	missense	6338			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.268A>G	16.37:g.23360188A>G	ENSP00000345751:p.Met90Val	Somatic		WXS	Illumina GAIIx	Phase_I	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744373	0.49151	2.28E-4	0.0	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.62941	-0.01;-0.01	4.92	4.92	0.64577	.	0.118152	0.64402	D	0.000020	T	0.65749	0.2721	M	0.75447	2.3	0.45216	D	0.998226	B	0.24317	0.101	B	0.31946	0.138	T	0.67329	-0.5698	10	0.59425	D	0.04	-20.4874	13.7288	0.62774	1.0:0.0:0.0:0.0	.	90	P51168	SCNNB_HUMAN	V	90;135	ENSP00000345751:M90V;ENSP00000302874:M135V	ENSP00000302874:M135V	M	+	1	0	SCNN1B	23267689	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	6.613000	0.74192	1.834000	0.53371	0.459000	0.35465	ATG		0.607	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2			
LOC728084	728084	broad.mit.edu	37	12	89405717	89405717	+	lincRNA	DEL	A	A	-			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr12:89405717delA	ENST00000500381.2	-	0	1681					NR_038385.1																						ttgtgaagataaaatgaaaaa	0.423																																																	0																																												0																															12.37:g.89405717delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000500381.2	37																																																																																					0.423	RP11-13A1.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000406530.1			
SMG1P7	100506060	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	T	C			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr16:70268080T>C	ENST00000459379.1	-	0	0																											GTCTTACTGTTGGCTAAAAGG	0.373																																																	0																																												0																															16.37:g.70268080T>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000459379.1	37																																																																																					0.373	snoU13.216-201	NOVEL	basic	snoRNA	snoRNA				
PDE10A	10846	broad.mit.edu	37	6	166194842	166194842	+	5'UTR	DEL	G	G	-			TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr6:166194842delG	ENST00000535229.1	-	0	958							Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ctaagacaCTGGGGATCAGGT	0.393																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0																																										SO:0001623	5_prime_UTR_variant	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000535229.1:c.-1086C>-	6.37:g.166194842delG		Somatic		WXS	Illumina GAIIx	Phase_I	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	RNA	DEL	ENST00000535229.1	37																																																																																					0.393	PDE10A-004	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000470299.1			
RP11-764K9.1	0	broad.mit.edu	37	9	68412892	68412892	+	lincRNA	SNP	G	G	A	rs199765147		TCGA-CZ-5469-01A-01D-1501-10	TCGA-CZ-5469-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3df654a0-48b0-45ff-bfe1-b5f78f63b30d	774be195-fc56-42e0-ad6f-260df24d5f23	g.chr9:68412892G>A	ENST00000417843.2	-	0	0				MIR4477B_ENST00000581659.1_RNA																							atctcactctgtctctgttcc	0.562																																																	0																																												0																															9.37:g.68412892G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000417843.2	37																																																																																					0.562	RP11-764K9.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000129817.2			
