#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AASS	10157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	121717991	121717991	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr7:121717991delT	ENST00000393376.1	-	22	2658	c.2563delA	c.(2563-2565)acgfs	p.T855fs	AASS_ENST00000417368.2_Frame_Shift_Del_p.T855fs|AASS_ENST00000473553.1_5'UTR			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	855	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.T855P(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						AGATCAATCGTTTTATGTTCT	0.413																																																	1	Substitution - Missense(1)	large_intestine(1)											272.0	286.0	281.0					7																	121717991		2203	4300	6503	SO:0001589	frameshift_variant	10157			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2563delA	7.37:g.121717991delT	ENSP00000377040:p.Thr855fs	Somatic		WXS	Illumina HiSeq	Phase_I	O95462	Frame_Shift_Del	DEL	ENST00000393376.1	37	CCDS5783.1																																																																																				0.413	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1		NM_005763	
ABCA5	23461	broad.mit.edu;hgsc.bcm.edu	37	17	67280186	67280186	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:67280186G>C	ENST00000392676.3	-	18	2364	c.2300C>G	c.(2299-2301)tCa>tGa	p.S767*	ABCA5_ENST00000588877.1_Nonsense_Mutation_p.S767*|ABCA5_ENST00000392677.2_Nonsense_Mutation_p.S767*			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	767					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S767*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	ACCCAAATTTGAATGACTGTC	0.299																																																	1	Substitution - Nonsense(1)	kidney(1)											61.0	58.0	59.0					17																	67280186		2203	4300	6503	SO:0001587	stop_gained	23461			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.2300C>G	17.37:g.67280186G>C	ENSP00000376443:p.Ser767*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Nonsense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	G	50	16.797406	0.99872	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	.	.	.	5.58	5.58	0.84498	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1719	0.93581	0.0:0.0:1.0:0.0	.	.	.	.	X	767	.	.	S	-	2	0	ABCA5	64791781	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.998000	0.76277	2.622000	0.88805	0.650000	0.86243	TCA		0.299	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1		NM_018672	
ATG4C	84938	broad.mit.edu;hgsc.bcm.edu	37	1	63269471	63269471	+	Missense_Mutation	SNP	G	G	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr1:63269471G>C	ENST00000317868.4	+	2	221	c.14G>C	c.(13-15)gGa>gCa	p.G5A	ATG4C_ENST00000371120.3_Missense_Mutation_p.G5A	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	5					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)	p.G5A(2)	ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						GAGGCTACAGGAACAGATGAA	0.284																																																	2	Substitution - Missense(2)	kidney(2)											59.0	61.0	60.0					1																	63269471		2203	4287	6490	SO:0001583	missense	84938			AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.14G>C	1.37:g.63269471G>C	ENSP00000322159:p.Gly5Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLR8|D3DQ58|Q96K04	Missense_Mutation	SNP	ENST00000317868.4	37	CCDS623.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245851	0.59103	.	.	ENSG00000125703	ENST00000317868;ENST00000371120;ENST00000443289;ENST00000540025;ENST00000371118	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	L	0.53249	1.67	0.80722	D	1	P	0.39480	0.675	B	0.28553	0.091	T	0.38067	-0.9678	9	0.30078	T	0.28	-19.2855	18.2493	0.89997	0.0:0.0:1.0:0.0	.	5	Q96DT6	ATG4C_HUMAN	A	5	.	ENSP00000322159:G5A	G	+	2	0	ATG4C	63042059	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.660000	0.74417	2.318000	0.78349	0.555000	0.69702	GGA		0.284	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2		NM_032852	
ATP6V1B2	526	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	20075680	20075680	+	Missense_Mutation	SNP	T	T	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr8:20075680T>C	ENST00000276390.2	+	13	1323	c.1283T>C	c.(1282-1284)aTt>aCt	p.I428T		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	428					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.I428T(1)		endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	TGCTATGCTATTGGAAAGGAT	0.438																																					Pancreas(119;1230 1726 3901 4036 31644)												1	Substitution - Missense(1)	kidney(1)											158.0	144.0	149.0					8																	20075680		2203	4300	6503	SO:0001583	missense	526			L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.1283T>C	8.37:g.20075680T>C	ENSP00000276390:p.Ile428Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	37	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.105844	0.77096	.	.	ENSG00000147416	ENST00000276390;ENST00000542368	T	0.75938	-0.98	5.56	5.56	0.83823	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77471	0.4135	M	0.79614	2.46	0.80722	D	1	B	0.30793	0.295	B	0.36186	0.219	T	0.76745	-0.2846	10	0.42905	T	0.14	-31.3571	14.8249	0.70104	0.0:0.0:0.0:1.0	.	428	P21281	VATB2_HUMAN	T	428;302	ENSP00000276390:I428T	ENSP00000276390:I428T	I	+	2	0	ATP6V1B2	20119960	1.000000	0.71417	0.819000	0.32651	0.787000	0.44495	6.295000	0.72744	2.241000	0.73720	0.533000	0.62120	ATT		0.438	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1		NM_001693	
FAM216B	144809	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	43362794	43362794	+	Silent	SNP	A	A	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr13:43362794A>C	ENST00000537894.1	+	4	411	c.288A>C	c.(286-288)tcA>tcC	p.S96S	FAM216B_ENST00000313851.1_Silent_p.S96S	NM_182508.2	NP_872314.1	Q8N7L0	F216B_HUMAN	family with sequence similarity 216, member B	96								p.S96S(1)									AGAGAGCCTCAGCCAAGGTAG	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											111.0	103.0	105.0					13																	43362794		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098238	CCDS9386.1	13q14.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000179813	ENSG00000179813			26883	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 30"""	C13orf30			Standard	NM_182508		Approved	FLJ40919	uc010tfk.2	Q8N7L0	OTTHUMG00000016809	ENST00000537894.1:c.288A>C	13.37:g.43362794A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B1ALI3	Silent	SNP	ENST00000537894.1	37	CCDS9386.1																																																																																				0.453	FAM216B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044705.2		NM_182508	
CHST11	50515	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	104851282	104851282	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr12:104851282delC	ENST00000303694.5	+	1	532	c.93delC	c.(91-93)ttcfs	p.F31fs	CHST11_ENST00000549260.1_Frame_Shift_Del_p.F31fs|CHST11_ENST00000547956.1_Frame_Shift_Del_p.F31fs|CHST11_ENST00000546689.1_Frame_Shift_Del_p.F31fs	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	31					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						TGGTCATCTTCTATTTCCAAA	0.512																																																	0													217.0	203.0	207.0					12																	104851282		2203	4300	6503	SO:0001589	frameshift_variant	50515			AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.93delC	12.37:g.104851282delC	ENSP00000305725:p.Phe31fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4F8|Q9NXY6|Q9NY36	Frame_Shift_Del	DEL	ENST00000303694.5	37	CCDS9099.1																																																																																				0.512	CHST11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405960.2		NM_018413	
DDX18	8886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	118577223	118577223	+	Splice_Site	SNP	A	A	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr2:118577223A>G	ENST00000263239.2	+	3	498		c.e3-1		DDX18_ENST00000474694.1_Splice_Site	NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18						ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.?(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TTAAAACCAAAGATACGAAAA	0.303											OREG0003814	type=REGULATORY REGION|Gene=DDX18|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					1	Unknown(1)	kidney(1)											36.0	35.0	35.0					2																	118577223		2203	4299	6502	SO:0001630	splice_region_variant	8886			X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.371-1A>G	2.37:g.118577223A>G		Somatic	1489	WXS	Illumina HiSeq	Phase_I	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Splice_Site	SNP	ENST00000263239.2	37	CCDS2120.1	.	.	.	.	.	.	.	.	.	.	A	9.503	1.103767	0.20632	.	.	ENSG00000088205	ENST00000263239	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2167	0.48830	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DDX18	118293693	1.000000	0.71417	0.999000	0.59377	0.113000	0.19764	4.043000	0.57354	1.934000	0.56057	0.528000	0.53228	.		0.303	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129632.3		NM_006773	Intron
COL6A3	1293	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	238249156	238249156	+	Silent	SNP	G	G	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr2:238249156G>C	ENST00000295550.4	-	38	8855	c.8403C>G	c.(8401-8403)tcC>tcG	p.S2801S	COL6A3_ENST00000472056.1_Silent_p.S2194S|COL6A3_ENST00000347401.3_Silent_p.S2600S|COL6A3_ENST00000346358.4_Silent_p.S2601S|COL6A3_ENST00000409809.1_Silent_p.S2595S|COL6A3_ENST00000353578.4_Silent_p.S2595S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2801	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S2801S(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGAGCTCGGTGGACTTGTCCA	0.557																																																	1	Substitution - coding silent(1)	kidney(1)											95.0	84.0	88.0					2																	238249156		2203	4300	6503	SO:0001819	synonymous_variant	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8403C>G	2.37:g.238249156G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																				0.557	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2		NM_004369	
DLST	1743	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	75359600	75359601	+	Frame_Shift_Ins	INS	-	-	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr14:75359600_75359601insA	ENST00000334220.4	+	8	567_568	c.506_507insA	c.(505-510)acagcafs	p.A170fs	DLST_ENST00000555190.1_3'UTR|DLST_ENST00000334212.6_Frame_Shift_Ins_p.A84fs	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	170					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		GCAGAACCTACAGCAGCGGCAG	0.584																																																	0																																										SO:0001589	frameshift_variant	1743				CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.507dupA	14.37:g.75359601_75359601dupA	ENSP00000335304:p.Ala170fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Frame_Shift_Ins	INS	ENST00000334220.4	37	CCDS9833.1																																																																																				0.584	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1			
EIF3A	8661	broad.mit.edu;hgsc.bcm.edu	37	10	120832959	120832959	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr10:120832959G>A	ENST00000369144.3	-	3	498	c.371C>T	c.(370-372)cCt>cTt	p.P124L	EIF3A_ENST00000541549.1_Missense_Mutation_p.P90L	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.P124L(1)		endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ATACCTCTCAGGAGTTTGAAT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											106.0	109.0	108.0					10																	120832959		2203	4299	6502	SO:0001583	missense	8661			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.371C>T	10.37:g.120832959G>A	ENSP00000358140:p.Pro124Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333633	0.81801	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.45668	0.89;0.89	6.17	6.17	0.99709	.	0.000000	0.39146	N	0.001446	T	0.73837	0.3638	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77107	-0.2710	10	0.87932	D	0	-22.9813	20.8794	0.99867	0.0:0.0:1.0:0.0	.	124	Q14152	EIF3A_HUMAN	L	124;90	ENSP00000358140:P124L;ENSP00000438178:P90L	ENSP00000358140:P124L	P	-	2	0	EIF3A	120822949	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.827000	0.99397	2.941000	0.99782	0.655000	0.94253	CCT		0.353	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1		NM_003750	
EIF3L	51386	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	38274117	38274117	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr22:38274117G>T	ENST00000412331.2	+	11	2096	c.1514G>T	c.(1513-1515)gGt>gTt	p.G505V	EIF3L_ENST00000381683.6_Missense_Mutation_p.G457V|EIF3L_ENST00000406934.1_Missense_Mutation_p.G407V	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L									p.G505V(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGGACCAGCGGTATCTCAGCC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											66.0	63.0	64.0					22																	38274117		2179	4239	6418	SO:0001583	missense	51386			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.1514G>T	22.37:g.38274117G>T	ENSP00000416892:p.Gly505Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000412331.2	37	CCDS13960.1	.	.	.	.	.	.	.	.	.	.	g	16.49	3.138321	0.56936	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934;ENST00000450376	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.76076	0.3937	M	0.91300	3.195	0.80722	D	1	D;D;D;D	0.89917	0.992;0.991;1.0;1.0	D;D;D;D	0.79108	0.926;0.92;0.986;0.992	T	0.81784	-0.0774	10	0.62326	D	0.03	-18.4534	18.8132	0.92065	0.0:0.0:1.0:0.0	.	457;407;505;548	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	V	505;548;457;472;407;17	ENSP00000416892:G505V;ENSP00000371099:G457V;ENSP00000384634:G407V;ENSP00000412349:G17V	ENSP00000262832:G472V	G	+	2	0	EIF3L	36604063	1.000000	0.71417	1.000000	0.80357	0.194000	0.23727	9.824000	0.99380	2.497000	0.84241	0.443000	0.29094	GGT		0.522	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2		NM_016091	
EPB41L1	2036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	34776292	34776292	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr20:34776292G>T	ENST00000338074.2	+	9	1058	c.897G>T	c.(895-897)atG>atT	p.M299I	EPB41L1_ENST00000373946.3_Missense_Mutation_p.M268I|EPB41L1_ENST00000441639.1_Missense_Mutation_p.M237I|EPB41L1_ENST00000202028.5_Missense_Mutation_p.M237I|EPB41L1_ENST00000373950.2_Missense_Mutation_p.M202I|EPB41L1_ENST00000373941.1_Missense_Mutation_p.M299I	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	299	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.M299I(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TCGACATCATGTTAGGCGTTT	0.572																																																	1	Substitution - Missense(1)	kidney(1)											148.0	137.0	141.0					20																	34776292		2203	4300	6503	SO:0001583	missense	2036			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.897G>T	20.37:g.34776292G>T	ENSP00000337168:p.Met299Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	37	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	G	33	5.203386	0.95033	.	.	ENSG00000088367	ENST00000202028;ENST00000430276;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;T;D;D;D;D;D	0.86297	-2.1;-1.1;-2.1;-2.1;-2.1;-2.1;-2.1	5.75	5.75	0.90469	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	.	.	.	.	D	0.90896	0.7139	L	0.48362	1.52	0.80722	D	1	P;D;P;D;B;B	0.58268	0.566;0.969;0.556;0.982;0.089;0.119	P;D;B;D;B;B	0.68943	0.545;0.959;0.118;0.961;0.062;0.098	D	0.88254	0.2918	9	0.27082	T	0.32	.	18.5116	0.90918	0.0:0.0:1.0:0.0	.	299;299;268;202;202;237	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	I	237;237;202;299;202;237;268;299;299	ENSP00000202028:M237I;ENSP00000404341:M237I;ENSP00000363061:M202I;ENSP00000399214:M237I;ENSP00000363057:M268I;ENSP00000337168:M299I;ENSP00000363052:M299I	ENSP00000202028:M237I	M	+	3	0	EPB41L1	34239706	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.869000	0.99810	2.721000	0.93114	0.561000	0.74099	ATG		0.572	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3		NM_012156	
SPATA31D1	389763	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	84605805	84605805	+	Silent	SNP	C	C	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr9:84605805C>A	ENST00000344803.2	+	4	467	c.420C>A	c.(418-420)atC>atA	p.I140I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	140					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.I140I(2)									CTGCTGATATCCAGCAACTGC	0.552																																																	2	Substitution - coding silent(2)	kidney(2)											123.0	119.0	120.0					9																	84605805		1997	4163	6160	SO:0001819	synonymous_variant	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.420C>A	9.37:g.84605805C>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000344803.2	37	CCDS47986.1																																																																																				0.552	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1		NM_001001670	
GOLPH3	64083	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	32126321	32126321	+	Silent	SNP	C	C	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr5:32126321C>T	ENST00000265070.6	-	4	1209	c.894G>A	c.(892-894)aaG>aaA	p.K298K	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	298					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)	p.K298K(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						AGCAGAGTTACTTGGTGAACG	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											106.0	107.0	106.0					5																	32126321		2203	4300	6503	SO:0001819	synonymous_variant	64083			AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.894G>A	5.37:g.32126321C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UIW5	Silent	SNP	ENST00000265070.6	37	CCDS3896.1																																																																																				0.488	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207363.2		NM_022130	
HPS5	11234	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	18303659	18303659	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr11:18303659C>G	ENST00000349215.3	-	22	3444	c.3167G>C	c.(3166-3168)gGg>gCg	p.G1056A	HPS5_ENST00000352460.3_5'UTR|HPS5_ENST00000396253.3_Missense_Mutation_p.G942A|HPS5_ENST00000438420.2_Missense_Mutation_p.G942A|HPS5_ENST00000537258.1_Missense_Mutation_p.G163A	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	1056					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.G1056A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GGGGGAAGGCCCATCACTGAG	0.562									Hermansky-Pudlak syndrome																																								1	Substitution - Missense(1)	kidney(1)											84.0	79.0	81.0					11																	18303659		2199	4293	6492	SO:0001583	missense	11234	Familial Cancer Database	HPS, HPS1-8	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.3167G>C	11.37:g.18303659C>G	ENSP00000265967:p.Gly1056Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	ENST00000349215.3	37	CCDS7836.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.752175	0.49362	.	.	ENSG00000110756	ENST00000396253;ENST00000438420;ENST00000349215;ENST00000537258	T;T;T	0.53857	0.6;0.6;0.6	4.82	3.92	0.45320	.	0.777924	0.12207	N	0.489725	T	0.33962	0.0881	N	0.19112	0.55	0.80722	D	1	P	0.34615	0.459	B	0.33960	0.173	T	0.09751	-1.0660	10	0.02654	T	1	.	13.0027	0.58685	0.0:0.9222:0.0:0.0778	.	1056	Q9UPZ3	HPS5_HUMAN	A	942;942;1056;163	ENSP00000379552:G942A;ENSP00000399590:G942A;ENSP00000265967:G1056A	ENSP00000265967:G1056A	G	-	2	0	HPS5	18260235	0.148000	0.22702	0.998000	0.56505	0.973000	0.67179	2.142000	0.42177	1.248000	0.43934	0.650000	0.86243	GGG		0.562	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1		NM_181507	
IL12RB1	3594	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	18191685	18191685	+	Silent	SNP	C	C	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr19:18191685C>T	ENST00000600835.2	-	5	664	c.366G>A	c.(364-366)caG>caA	p.Q122Q	IL12RB1_ENST00000322153.7_Silent_p.Q122Q|IL12RB1_ENST00000593993.2_Silent_p.Q122Q			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	122	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)	p.Q122Q(2)		endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						ACTTCTCTGTCTGGTTCCTGG	0.597																																																	2	Substitution - coding silent(2)	kidney(2)											93.0	86.0	88.0					19																	18191685		2203	4300	6503	SO:0001819	synonymous_variant	3594			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.366G>A	19.37:g.18191685C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Silent	SNP	ENST00000600835.2	37	CCDS54232.1																																																																																				0.597	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3			
KRT23	25984	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	39086293	39086293	+	Nonsense_Mutation	SNP	G	G	A	rs370055839		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:39086293G>A	ENST00000209718.3	-	4	959	c.535C>T	c.(535-537)Cga>Tga	p.R179*	KRT23_ENST00000436344.3_Nonsense_Mutation_p.R42*|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	179	Coil 1B.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R179*(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				AAGGTCCTTCGGAGGCCCTCG	0.458																																																	1	Substitution - Nonsense(1)	kidney(1)						G	stop/ARG	0,4406		0,0,2203	224.0	178.0	194.0		535	3.7	1.0	17		194	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	KRT23	NM_015515.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		179/423	39086293	1,13005	2203	4300	6503	SO:0001587	stop_gained	25984			AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.535C>T	17.37:g.39086293G>A	ENSP00000209718:p.Arg179*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Nonsense_Mutation	SNP	ENST00000209718.3	37	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153670	0.78114	0.0	1.16E-4	ENSG00000108244	ENST00000209718;ENST00000436344	.	.	.	5.74	3.72	0.42706	.	0.000000	0.45361	D	0.000363	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2982	0.73925	0.0:0.0:0.745:0.255	.	.	.	.	X	179;42	.	ENSP00000209718:R179X	R	-	1	2	KRT23	36339819	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	2.984000	0.49353	0.745000	0.32763	0.460000	0.39030	CGA		0.458	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1			
MET	4233	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	116380121	116380121	+	Missense_Mutation	SNP	G	G	C	rs587780735		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr7:116380121G>C	ENST00000318493.6	+	4	1697	c.1510G>C	c.(1510-1512)Gtt>Ctt	p.V504L	MET_ENST00000397752.3_Missense_Mutation_p.V504L|MET_ENST00000495962.1_3'UTR|MET_ENST00000436117.2_Missense_Mutation_p.V504L			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V504L(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CTACACACTGGTTATCACTGG	0.443			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	1	Substitution - Missense(1)	kidney(1)											151.0	133.0	139.0					7																	116380121		1871	4102	5973	SO:0001583	missense	4233	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1510G>C	7.37:g.116380121G>C	ENSP00000317272:p.Val504Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933589	0.34096	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.06294	3.32;3.32;3.32	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.178797	0.49916	D	0.000132	T	0.10981	0.0268	L	0.58428	1.81	0.80722	D	1	P;B;B;B;B;B;B;B;B;P	0.47302	0.893;0.003;0.245;0.005;0.005;0.009;0.009;0.052;0.057;0.891	B;B;B;B;B;B;B;B;B;B	0.41946	0.371;0.019;0.118;0.019;0.019;0.019;0.028;0.036;0.046;0.338	T	0.16512	-1.0400	10	0.22109	T	0.4	.	20.2896	0.98541	0.0:0.0:1.0:0.0	.	504;504;504;504;504;504;504;504;504;504	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;P08581-2;P08581	.;.;.;.;.;.;.;.;.;MET_HUMAN	L	504	ENSP00000380860:V504L;ENSP00000317272:V504L;ENSP00000410980:V504L	ENSP00000317272:V504L	V	+	1	0	MET	116167357	1.000000	0.71417	0.952000	0.39060	0.875000	0.50365	4.475000	0.60210	2.794000	0.96219	0.655000	0.94253	GTT		0.443	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			
MRPL2	51069	broad.mit.edu;hgsc.bcm.edu	37	6	43024130	43024130	+	Missense_Mutation	SNP	T	T	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr6:43024130T>G	ENST00000388752.3	-	3	743	c.319A>C	c.(319-321)Att>Ctt	p.I107L	CUL7_ENST00000265348.3_5'Flank|MRPL2_ENST00000489623.1_Intron|MRPL2_ENST00000230413.5_Missense_Mutation_p.I107L|CUL7_ENST00000535468.1_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	107					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.I107L(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		AGAAAGTCAATCATTCGATAA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											93.0	82.0	86.0					6																	43024130		2203	4300	6503	SO:0001583	missense	51069			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.319A>C	6.37:g.43024130T>G	ENSP00000373404:p.Ile107Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	ENST00000388752.3	37	CCDS34454.1	.	.	.	.	.	.	.	.	.	.	t	18.54	3.646818	0.67358	.	.	ENSG00000112651	ENST00000388752;ENST00000230413	T	0.51817	0.69	5.86	5.86	0.93980	Nucleic acid-binding, OB-fold-like (1);Ribosomal Proteins L2, RNA binding domain (1);Nucleic acid-binding, OB-fold (1);	0.051433	0.85682	D	0.000000	T	0.65428	0.2690	M	0.91768	3.24	0.80722	D	1	D;B	0.57899	0.981;0.137	P;B	0.58077	0.832;0.063	T	0.75277	-0.3374	10	0.87932	D	0	-13.5974	14.8262	0.70113	0.0:0.0:0.0:1.0	.	107;107	B4DVE2;Q5T653	.;RM02_HUMAN	L	107	ENSP00000373404:I107L	ENSP00000230413:I107L	I	-	1	0	MRPL2	43132108	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.413000	0.44618	2.239000	0.73571	0.529000	0.55759	ATT		0.512	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040577.2			
MTTP	4547	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	100532310	100532310	+	Missense_Mutation	SNP	C	C	T	rs561968572	byFrequency	TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr4:100532310C>T	ENST00000265517.5	+	13	1983	c.1780C>T	c.(1780-1782)Cgt>Tgt	p.R594C	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Missense_Mutation_p.R594C|MTTP_ENST00000511045.1_Missense_Mutation_p.R621C			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	594	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.R594C(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	CAAAATTGTCCGTCGAGTTCT	0.398													C|||	2	0.000399361	0.0	0.0	5008	,	,		17310	0.0		0.0	False		,,,				2504	0.002																1	Substitution - Missense(1)	kidney(1)											139.0	129.0	132.0					4																	100532310		2203	4300	6503	SO:0001583	missense	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1780C>T	4.37:g.100532310C>T	ENSP00000265517:p.Arg594Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	ENST00000265517.5	37	CCDS3651.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717701	0.68844	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.70869	-0.52;-0.52;-0.52	5.84	5.0	0.66597	Lipid transport protein, N-terminal (1);Vitellinogen, superhelical (2);	0.154327	0.64402	D	0.000012	T	0.78155	0.4239	M	0.70595	2.14	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.53185	0.72;0.609	T	0.80979	-0.1140	10	0.62326	D	0.03	-0.3192	14.7905	0.69837	0.0:0.9312:0.0:0.0688	.	621;594	E9PBP6;P55157	.;MTP_HUMAN	C	621;594;594	ENSP00000427679:R621C;ENSP00000400821:R594C;ENSP00000265517:R594C	ENSP00000265517:R594C	R	+	1	0	MTTP	100751333	1.000000	0.71417	0.990000	0.47175	0.613000	0.37349	3.848000	0.55903	1.475000	0.48197	0.655000	0.94253	CGT		0.398	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3			
MYH4	4622	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10366258	10366258	+	Missense_Mutation	SNP	T	T	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:10366258T>A	ENST00000255381.2	-	11	1042	c.932A>T	c.(931-933)tAt>tTt	p.Y311F	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	311	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.Y311F(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGCGAAGTCATATGGGTTGGT	0.418																																																	1	Substitution - Missense(1)	kidney(1)											124.0	120.0	121.0					17																	10366258		2203	4300	6503	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.932A>T	17.37:g.10366258T>A	ENSP00000255381:p.Tyr311Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425236	0.62733	.	.	ENSG00000141048	ENST00000255381	T	0.71698	-0.59	5.37	5.37	0.77165	Myosin head, motor domain (2);	0.000000	0.34245	U	0.004124	T	0.72203	0.3431	M	0.73962	2.25	0.58432	D	0.999998	B	0.06786	0.001	B	0.21360	0.034	T	0.70350	-0.4896	10	0.51188	T	0.08	.	15.659	0.77169	0.0:0.0:0.0:1.0	.	311	Q9Y623	MYH4_HUMAN	F	311	ENSP00000255381:Y311F	ENSP00000255381:Y311F	Y	-	2	0	MYH4	10306983	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	4.994000	0.63901	2.153000	0.67306	0.528000	0.53228	TAT		0.418	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1		NM_017533	
MYH4	4622	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10366705	10366705	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:10366705C>G	ENST00000255381.2	-	9	865	c.755G>C	c.(754-756)aGg>aCg	p.R252T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	252	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.R252T(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AAAATGGATCCTGATGAATTT	0.323																																																	1	Substitution - Missense(1)	kidney(1)											62.0	67.0	66.0					17																	10366705		2203	4300	6503	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.755G>C	17.37:g.10366705C>G	ENSP00000255381:p.Arg252Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488565	0.84854	.	.	ENSG00000141048	ENST00000255381	T	0.72167	-0.63	4.96	4.96	0.65561	Myosin head, motor domain (3);	0.000000	0.41097	U	0.000953	D	0.88897	0.6562	H	0.94306	3.52	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.92115	0.5699	10	0.87932	D	0	.	18.542	0.91031	0.0:1.0:0.0:0.0	.	252	Q9Y623	MYH4_HUMAN	T	252	ENSP00000255381:R252T	ENSP00000255381:R252T	R	-	2	0	MYH4	10307430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.746000	0.85057	2.436000	0.82500	0.557000	0.71058	AGG		0.323	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1		NM_017533	
MYH4	4622	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	10366884	10366884	+	Missense_Mutation	SNP	T	T	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:10366884T>A	ENST00000255381.2	-	8	835	c.725A>T	c.(724-726)gAc>gTc	p.D242V	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	242	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.D242V(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AGAGGAGTTGTCATTCCTCAC	0.438																																																	1	Substitution - Missense(1)	kidney(1)											116.0	111.0	113.0					17																	10366884		2203	4300	6503	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.725A>T	17.37:g.10366884T>A	ENSP00000255381:p.Asp242Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133712	0.77662	.	.	ENSG00000141048	ENST00000255381	D	0.89123	-2.47	4.96	4.96	0.65561	Myosin head, motor domain (3);	0.000000	0.39020	U	0.001482	D	0.97402	0.9150	H	0.99909	4.93	0.80722	D	1	D	0.53151	0.958	D	0.72625	0.978	D	0.98945	1.0792	10	0.87932	D	0	.	14.8998	0.70670	0.0:0.0:0.0:1.0	.	242	Q9Y623	MYH4_HUMAN	V	242	ENSP00000255381:D242V	ENSP00000255381:D242V	D	-	2	0	MYH4	10307609	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.966000	0.87956	1.971000	0.57363	0.455000	0.32223	GAC		0.438	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1		NM_017533	
MYO3A	53904	broad.mit.edu;ucsc.edu	37	10	26463158	26463158	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr10:26463158G>T	ENST00000265944.5	+	30	4131	c.3965G>T	c.(3964-3966)gGc>gTc	p.G1322V	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1322					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G1322V(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CAGGAGGAAGGCAGAGGCCGT	0.478																																																	1	Substitution - Missense(1)	kidney(1)											124.0	131.0	129.0					10																	26463158		2203	4300	6503	SO:0001583	missense	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3965G>T	10.37:g.26463158G>T	ENSP00000265944:p.Gly1322Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	1.657	-0.512406	0.04200	.	.	ENSG00000095777	ENST00000265944	T	0.78481	-1.18	0.158	0.158	0.14942	.	0.707258	0.12423	U	0.470276	T	0.52565	0.1742	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.42172	-0.9467	10	0.54805	T	0.06	.	2.9707	0.05922	2.0E-4:2.0E-4:0.5121:0.4875	.	1322	Q8NEV4	MYO3A_HUMAN	V	1322	ENSP00000265944:G1322V	ENSP00000265944:G1322V	G	+	2	0	MYO3A	26503164	0.014000	0.17966	0.003000	0.11579	0.005000	0.04900	0.251000	0.18257	0.202000	0.20498	0.205000	0.17691	GGC		0.478	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1		NM_017433	
NGFR	4804	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	47587945	47587945	+	Missense_Mutation	SNP	C	C	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:47587945C>A	ENST00000172229.3	+	4	865	c.740C>A	c.(739-741)aCc>aAc	p.T247N	NGFR_ENST00000504201.1_Missense_Mutation_p.T153N|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	247	Ser/Thr-rich.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.T247N(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					ACCCGAGGCACCACCGACAAC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											111.0	101.0	104.0					17																	47587945		2203	4300	6503	SO:0001583	missense	4804			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.740C>A	17.37:g.47587945C>A	ENSP00000172229:p.Thr247Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	C	8.152	0.787673	0.16258	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.90261	-2.57;-2.64	4.85	4.85	0.62838	.	0.377733	0.28921	N	0.013707	D	0.83013	0.5162	N	0.16368	0.405	0.23546	N	0.997447	P	0.40000	0.698	B	0.37888	0.26	T	0.74867	-0.3518	10	0.27082	T	0.32	-43.6711	16.0977	0.81139	0.0:1.0:0.0:0.0	.	247	P08138	TNR16_HUMAN	N	247;153	ENSP00000172229:T247N;ENSP00000421731:T153N	ENSP00000172229:T247N	T	+	2	0	NGFR	44942944	0.008000	0.16893	0.954000	0.39281	0.871000	0.50021	0.684000	0.25364	2.397000	0.81536	0.650000	0.86243	ACC		0.607	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1			
NYNRIN	57523	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24885001	24885001	+	Missense_Mutation	SNP	C	C	T	rs538061448		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr14:24885001C>T	ENST00000382554.3	+	9	4364	c.4046C>T	c.(4045-4047)aCg>aTg	p.T1349M		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1349					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.T1349M(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TCCCCTTACACGCCAACCTAT	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17104	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											102.0	109.0	106.0					14																	24885001		2038	4163	6201	SO:0001583	missense	57523			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4046C>T	14.37:g.24885001C>T	ENSP00000371994:p.Thr1349Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750312	0.49257	.	.	ENSG00000205978	ENST00000382554	T	0.12879	2.64	4.93	4.93	0.64822	Ribonuclease H-like (1);	.	.	.	.	T	0.25344	0.0616	N	0.24115	0.695	0.21841	N	0.999514	D	0.89917	1.0	D	0.73708	0.981	T	0.11348	-1.0591	9	0.87932	D	0	.	15.6876	0.77424	0.0:1.0:0.0:0.0	.	1349	Q9P2P1	NYNRI_HUMAN	M	1349	ENSP00000371994:T1349M	ENSP00000371994:T1349M	T	+	2	0	NYNRIN	23954841	0.719000	0.27986	0.767000	0.31495	0.960000	0.62799	3.413000	0.52686	2.551000	0.86045	0.655000	0.94253	ACG		0.597	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52661325	52661325	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr3:52661325G>C	ENST00000296302.7	-	13	1506	c.1505C>G	c.(1504-1506)tCa>tGa	p.S502*	PBRM1_ENST00000409057.1_Nonsense_Mutation_p.S502*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.S502*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.S502*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.S470*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.S502*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.S502*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.S502*			Q86U86	PB1_HUMAN	polybromo 1	502					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S502*(2)|p.S470*(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGAGGTGGCTGAAGAGATCAT	0.433			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Substitution - Nonsense(3)	kidney(3)											149.0	133.0	138.0					3																	52661325		2203	4300	6503	SO:0001587	stop_gained	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1505C>G	3.37:g.52661325G>C	ENSP00000296302:p.Ser502*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	39	7.440044	0.98286	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-0.253	20.3539	0.98825	0.0:0.0:1.0:0.0	.	.	.	.	X	470;502;502;502;502;502;502;502;502;446	.	ENSP00000296302:S502X	S	-	2	0	PBRM1	52636365	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.110000	0.94302	2.826000	0.97356	0.655000	0.94253	TCA		0.433	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PHF23	79142	broad.mit.edu;ucsc.edu	37	17	7139291	7139291	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:7139291C>G	ENST00000320316.3	-	4	1181	c.955G>C	c.(955-957)Ggc>Cgc	p.G319R	PHF23_ENST00000576955.1_Missense_Mutation_p.G189R|DVL2_ENST00000005340.5_5'Flank|PHF23_ENST00000570753.1_5'Flank|DVL2_ENST00000575458.1_5'Flank|PHF23_ENST00000571362.1_Missense_Mutation_p.G252R|PHF23_ENST00000454255.2_Missense_Mutation_p.G315R	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	319							zinc ion binding (GO:0008270)	p.G319R(1)		breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						CGCATCTCGCCTTCACTGGAG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											281.0	291.0	288.0					17																	7139291		2081	4216	6297	SO:0001583	missense	79142			AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.955G>C	17.37:g.7139291C>G	ENSP00000322579:p.Gly319Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Missense_Mutation	SNP	ENST00000320316.3	37	CCDS42250.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482018	0.44147	.	.	ENSG00000040633	ENST00000320316;ENST00000454255	T;T	0.31510	1.49;1.49	4.65	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.18882	0.0453	N	0.19112	0.55	0.51482	D	0.999926	P;B	0.36438	0.553;0.272	B;B	0.35240	0.198;0.085	T	0.05500	-1.0881	10	0.72032	D	0.01	-9.0452	8.4448	0.32836	0.0:0.8931:0.0:0.1069	.	252;319	B4DLK6;Q9BUL5	.;PHF23_HUMAN	R	319;315	ENSP00000322579:G319R;ENSP00000414607:G315R	ENSP00000322579:G319R	G	-	1	0	PHF23	7080015	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.603000	0.61105	1.161000	0.42604	0.313000	0.20887	GGC		0.577	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440047.1		NM_024297	
PI4KB	5298	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	151280208	151280208	+	Missense_Mutation	SNP	G	G	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr1:151280208G>C	ENST00000368873.1	-	4	1192	c.1024C>G	c.(1024-1026)Ctc>Gtc	p.L342V	PI4KB_ENST00000368875.2_Missense_Mutation_p.L354V|PI4KB_ENST00000368874.4_Missense_Mutation_p.L327V|PI4KB_ENST00000368872.1_Missense_Mutation_p.L327V|PI4KB_ENST00000271657.5_Missense_Mutation_p.L354V|PI4KB_ENST00000529142.1_Missense_Mutation_p.L10V			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	342					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.L354V(1)		breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTGGTGGGGAGCGTGGCCAGC	0.567																																					Colon(154;765 1838 9854 28443 37492)												1	Substitution - Missense(1)	kidney(1)											112.0	105.0	107.0					1																	151280208		2203	4300	6503	SO:0001583	missense	5298			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.1024C>G	1.37:g.151280208G>C	ENSP00000357867:p.Leu342Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37		.	.	.	.	.	.	.	.	.	.	G	19.74	3.883273	0.72410	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000529142;ENST00000368872;ENST00000430800;ENST00000489223	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-0.09;-1.46	5.89	5.89	0.94794	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	N	0.17838	0.53	0.80722	D	1	B;B;B	0.19331	0.005;0.035;0.027	B;B;B	0.27608	0.017;0.081;0.022	T	0.57441	-0.7811	10	0.18276	T	0.48	-16.6481	18.82	0.92092	0.0:0.0:1.0:0.0	.	342;327;10	Q9UBF8;Q9UBF8-2;Q9UBF8-3	PI4KB_HUMAN;.;.	V	327;354;354;342;10;327;10;10	ENSP00000357868:L327V;ENSP00000357869:L354V;ENSP00000271657:L354V;ENSP00000357867:L342V;ENSP00000433149:L10V;ENSP00000357866:L327V	ENSP00000271657:L354V	L	-	1	0	PI4KB	149546832	1.000000	0.71417	0.976000	0.42696	0.984000	0.73092	3.687000	0.54692	2.797000	0.96272	0.563000	0.77884	CTC		0.567	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3		NM_002651	
PIGT	51604	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	44045233	44045233	+	Silent	SNP	A	A	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr20:44045233A>G	ENST00000279036.6	+	2	344	c.264A>G	c.(262-264)tcA>tcG	p.S88S	PIGT_ENST00000545755.1_Intron|PIGT_ENST00000279035.9_Intron|PIGT_ENST00000543458.2_Silent_p.S88S|PIGT_ENST00000372689.5_Silent_p.S88S|PIGT_ENST00000341555.5_Intron|PIGT_ENST00000535404.1_5'UTR	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	88					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.S88S(2)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				TGCACCTGTCATTCACACAAG	0.577																																																	2	Substitution - coding silent(2)	kidney(2)											43.0	42.0	42.0					20																	44045233		2203	4300	6503	SO:0001819	synonymous_variant	51604				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.264A>G	20.37:g.44045233A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Silent	SNP	ENST00000279036.6	37	CCDS13353.1																																																																																				0.577	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2		NM_015937	
PIGT	51604	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	44045300	44045300	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr20:44045300G>A	ENST00000279036.6	+	2	411	c.331G>A	c.(331-333)Gag>Aag	p.E111K	PIGT_ENST00000545755.1_Intron|PIGT_ENST00000279035.9_Intron|PIGT_ENST00000543458.2_Intron|PIGT_ENST00000372689.5_Missense_Mutation_p.E111K|PIGT_ENST00000341555.5_Intron|PIGT_ENST00000535404.1_5'UTR	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	111					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.E111K(2)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				ATCAGGTGCAGAGCTGTGGGT	0.577																																																	2	Substitution - Missense(2)	kidney(2)											54.0	45.0	48.0					20																	44045300		2203	4300	6503	SO:0001583	missense	51604				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.331G>A	20.37:g.44045300G>A	ENSP00000279036:p.Glu111Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Missense_Mutation	SNP	ENST00000279036.6	37	CCDS13353.1	.	.	.	.	.	.	.	.	.	.	G	37	6.123245	0.97305	.	.	ENSG00000124155	ENST00000372689;ENST00000279036	T;T	0.57595	0.39;0.39	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	M	0.91872	3.25	0.80722	D	1	D;D	0.69078	0.997;0.989	D;P	0.71414	0.973;0.824	T	0.82829	-0.0264	10	0.72032	D	0.01	-28.5787	19.3629	0.94448	0.0:0.0:1.0:0.0	.	111;111	B7Z7C5;Q969N2	.;PIGT_HUMAN	K	111	ENSP00000361774:E111K;ENSP00000279036:E111K	ENSP00000279036:E111K	E	+	1	0	PIGT	43478714	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.455000	0.97625	2.817000	0.96982	0.563000	0.77884	GAG		0.577	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079434.2		NM_015937	
PKHD1L1	93035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	110477389	110477389	+	Silent	SNP	C	C	T	rs376156063		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr8:110477389C>T	ENST00000378402.5	+	49	8432	c.8328C>T	c.(8326-8328)gaC>gaT	p.D2776D		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2776					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.D2778D(2)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGTTTGTTGACGTCCAGTATT	0.433										HNSCC(38;0.096)																																							2	Substitution - coding silent(2)	prostate(1)|kidney(1)						C		0,3904		0,0,1952	106.0	108.0	108.0		8328	4.0	0.2	8		108	1,8275		0,1,4137	no	coding-synonymous	PKHD1L1	NM_177531.4		0,1,6089	TT,TC,CC		0.0121,0.0,0.0082		2776/4244	110477389	1,12179	1952	4138	6090	SO:0001819	synonymous_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8328C>T	8.37:g.110477389C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																				0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
PLEKHG7	440107	broad.mit.edu;ucsc.edu	37	12	93134670	93134670	+	Silent	SNP	T	T	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr12:93134670T>C	ENST00000344636.3	+	3	229	c.45T>C	c.(43-45)taT>taC	p.Y15Y	PLEKHG7_ENST00000549856.1_Silent_p.Y15Y	NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	15	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y15Y(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						CTCATGAATATCTCCTAGATG	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											84.0	84.0	84.0					12																	93134670		2203	4300	6503	SO:0001819	synonymous_variant	440107			AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.45T>C	12.37:g.93134670T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RNR7	Silent	SNP	ENST00000344636.3	37	CCDS31873.1																																																																																				0.323	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1		NM_001004330	
PRX	57716	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	40901528	40901528	+	Missense_Mutation	SNP	C	C	T	rs377457671		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr19:40901528C>T	ENST00000324001.7	-	7	3001	c.2731G>A	c.(2731-2733)Gtg>Atg	p.V911M	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	911					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V911M(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCAATTTCCACGGCGGGCAGC	0.587																																																	1	Substitution - Missense(1)	kidney(1)						C	,MET/VAL	0,4406		0,0,2203	55.0	65.0	62.0		,2731	1.8	0.0	19		62	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,missense	PRX	NM_020956.2,NM_181882.2	,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,benign	,911/1462	40901528	1,13005	2203	4300	6503	SO:0001583	missense	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2731G>A	19.37:g.40901528C>T	ENSP00000326018:p.Val911Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	3.809	-0.040145	0.07497	0.0	1.16E-4	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01516	4.81	5.3	1.75	0.24633	.	1.789140	0.03368	N	0.198570	T	0.01558	0.0050	N	0.19112	0.55	0.09310	N	1	P	0.50710	0.938	B	0.37731	0.257	T	0.44982	-0.9292	10	0.48119	T	0.1	-2.7585	5.2098	0.15310	0.1425:0.3632:0.416:0.0783	.	911	Q9BXM0	PRAX_HUMAN	M	911	ENSP00000326018:V911M	ENSP00000326018:V911M	V	-	1	0	PRX	45593368	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.067000	0.11579	0.175000	0.19841	0.650000	0.86243	GTG		0.587	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1		NM_020956	
PTEN	5728	broad.mit.edu;hgsc.bcm.edu	37	10	89692880	89692893	+	Frame_Shift_Del	DEL	ATTCACTGTAAAGC	ATTCACTGTAAAGC	-	rs121909222|rs121909223		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	ATTCACTGTAAAGC	ATTCACTGTAAAGC	ATTCACTGTAAAGC	-	ATTCACTGTAAAGC	ATTCACTGTAAAGC	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr10:89692880_89692893delATTCACTGTAAAGC	ENST00000371953.3	+	5	1721_1734	c.364_377delATTCACTGTAAAGC	c.(364-378)attcactgtaaagctfs	p.IHCKA122fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	122	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.C124S(7)|p.A126T(6)|p.?(5)|p.R55fs*1(5)|p.H123Y(5)|p.C124fs*10(3)|p.I122fs*2(3)|p.A126D(3)|p.K125N(2)|p.K125E(2)|p.A126V(2)|p.Y27fs*1(2)|p.A126S(2)|p.A126P(2)|p.C124F(1)|p.I122N(1)|p.I122S(1)|p.A121_F145del(1)|p.C124R(1)|p.F56fs*2(1)|p.C124Y(1)|p.A126fs*8(1)|p.H123D(1)|p.K125*(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGA	0.407		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	96	Whole gene deletion(37)|Substitution - Missense(37)|Deletion - Frameshift(15)|Unknown(5)|Deletion - In frame(1)|Substitution - Nonsense(1)	central_nervous_system(27)|endometrium(19)|prostate(16)|lung(8)|skin(6)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|large_intestine(3)|thyroid(1)|stomach(1)|soft_tissue(1)|urinary_tract(1)	GRCh37	CI004327|CM020755|CM041823|CM971270|CM971271	PTEN	I|M	rs121909222|rs121909223																																			SO:0001589	frameshift_variant	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.364_377delATTCACTGTAAAGC	10.37:g.89692880_89692893delATTCACTGTAAAGC	ENSP00000361021:p.Ile122fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.407	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1		NM_000314	
RABGGTA	5875	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24737807	24737807	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr14:24737807C>G	ENST00000399409.3	-	9	1402	c.919G>C	c.(919-921)Gcc>Ccc	p.A307P	RABGGTA_ENST00000216840.6_Missense_Mutation_p.A307P|RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000560777.1_Intron	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	307					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.A307P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		TTGAGGGAGGCAGCAGGCAGG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											85.0	91.0	89.0					14																	24737807		2085	4202	6287	SO:0001583	missense	5875				CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.919G>C	14.37:g.24737807C>G	ENSP00000382341:p.Ala307Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5N2|D3DS69	Missense_Mutation	SNP	ENST00000399409.3	37	CCDS45088.1	.	.	.	.	.	.	.	.	.	.	C	4.772	0.143537	0.09134	.	.	ENSG00000100949	ENST00000216840;ENST00000399409;ENST00000543002	T;T	0.50548	0.74;0.74	5.11	-0.039	0.13878	Rab geranylgeranyltransferase, alpha subunit, insert-domain (4);	0.698644	0.15113	N	0.279879	T	0.24547	0.0595	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.12682	-1.0538	10	0.30854	T	0.27	0.4037	5.3589	0.16077	0.1262:0.4833:0.0:0.3905	.	307	Q92696	PGTA_HUMAN	P	307;307;270	ENSP00000216840:A307P;ENSP00000382341:A307P	ENSP00000216840:A307P	A	-	1	0	RABGGTA	23807647	0.698000	0.27777	0.012000	0.15200	0.585000	0.36419	1.341000	0.33907	-0.216000	0.10048	-0.379000	0.06801	GCC		0.542	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5		NM_182836	
SLC22A9	114571	hgsc.bcm.edu	37	11	63137795	63137796	+	In_Frame_Ins	INS	-	-	CGCGCG	rs377211288		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr11:63137795_63137796insCGCGCG	ENST00000279178.3	+	1	516_517	c.267_268insCGCGCG	c.(268-270)cgc>CGCGCGcgc	p.90_90R>RAR	SLC22A9_ENST00000310969.4_In_Frame_Ins_p.90_90R>RAR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	90					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						AGAAGTGTCGTCGCTTTGTTCA	0.535																																																	0																																										SO:0001652	inframe_insertion	114571			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	Exception_encountered	11.37:g.63137795_63137796insCGCGCG	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	In_Frame_Ins	INS	ENST00000279178.3	37	CCDS8043.1																																																																																				0.535	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1		NM_080866	
SLC8A2	6543	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	47969097	47969097	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr19:47969097C>G	ENST00000236877.6	-	2	959	c.564G>C	c.(562-564)gaG>gaC	p.E188D	SLC8A2_ENST00000539381.1_Intron|SLC8A2_ENST00000542837.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	188					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)	p.E188D(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		TCTTGCGGCTCTCGCCGGCTG	0.572																																																	1	Substitution - Missense(1)	kidney(1)											66.0	47.0	53.0					19																	47969097		2203	4300	6503	SO:0001583	missense	6543			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.564G>C	19.37:g.47969097C>G	ENSP00000236877:p.Glu188Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	37	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340365	0.60963	.	.	ENSG00000118160	ENST00000391903;ENST00000236877	T	0.65178	-0.14	4.04	4.04	0.47022	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.78084	0.4228	M	0.88512	2.96	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.984	T	0.79761	-0.1667	10	0.66056	D	0.02	.	6.0397	0.19728	0.0:0.7885:0.0:0.2115	.	16;188	E9PGS7;Q9UPR5	.;NAC2_HUMAN	D	16;188	ENSP00000236877:E188D	ENSP00000236877:E188D	E	-	3	2	SLC8A2	52660909	0.038000	0.19896	1.000000	0.80357	0.993000	0.82548	0.464000	0.21988	2.098000	0.63641	0.462000	0.41574	GAG		0.572	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1			
SLIT2	9353	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	20541152	20541152	+	Missense_Mutation	SNP	C	C	A	rs553808717		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr4:20541152C>A	ENST00000504154.1	+	19	2173	c.1921C>A	c.(1921-1923)Caa>Aaa	p.Q641K	SLIT2_ENST00000273739.5_Missense_Mutation_p.Q645K|SLIT2_ENST00000503837.1_Missense_Mutation_p.Q637K|SLIT2_ENST00000503823.1_Missense_Mutation_p.Q633K	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	641					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.Q641K(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GTATGATAATCAAATTACTAC	0.378													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14976	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											136.0	129.0	131.0					4																	20541152		2203	4300	6503	SO:0001583	missense	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1921C>A	4.37:g.20541152C>A	ENSP00000422591:p.Gln641Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.376165	0.61735	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.88	5.88	0.94601	.	0.050442	0.85682	D	0.000000	T	0.42404	0.1201	L	0.38692	1.165	0.58432	D	0.999999	B;P	0.39920	0.008;0.695	B;B	0.32724	0.016;0.151	T	0.26916	-1.0089	10	0.16420	T	0.52	.	20.2187	0.98312	0.0:1.0:0.0:0.0	.	633;641	O94813-3;O94813	.;SLIT2_HUMAN	K	633;641;645;637;637	ENSP00000427548:Q633K;ENSP00000422591:Q641K;ENSP00000273739:Q645K;ENSP00000422261:Q637K	ENSP00000273739:Q645K	Q	+	1	0	SLIT2	20150250	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.036000	0.70948	2.780000	0.95670	0.655000	0.94253	CAA		0.378	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			
SPEN	23013	broad.mit.edu;hgsc.bcm.edu	37	1	16256217	16256217	+	Missense_Mutation	SNP	T	T	C			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr1:16256217T>C	ENST00000375759.3	+	11	3686	c.3482T>C	c.(3481-3483)aTt>aCt	p.I1161T		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1161					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.I1161T(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAAATTGGCATTGACATCGAT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											48.0	44.0	46.0					1																	16256217		2203	4300	6503	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3482T>C	1.37:g.16256217T>C	ENSP00000364912:p.Ile1161Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.732130	0.30684	.	.	ENSG00000065526	ENST00000375759	T	0.10288	2.89	5.2	5.2	0.72013	.	.	.	.	.	T	0.17450	0.0419	L	0.60455	1.87	0.42403	D	0.992579	P	0.52842	0.956	P	0.47528	0.549	T	0.02150	-1.1205	9	0.31617	T	0.26	-10.8372	15.2199	0.73303	0.0:0.0:0.0:1.0	.	1161	Q96T58	MINT_HUMAN	T	1161	ENSP00000364912:I1161T	ENSP00000364912:I1161T	I	+	2	0	SPEN	16128804	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.311000	0.65786	2.184000	0.69523	0.528000	0.53228	ATT		0.403	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1		NM_015001	
SPSB2	84727	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6981774	6981774	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr12:6981774C>A	ENST00000524270.1	-	2	478	c.292G>T	c.(292-294)Gag>Tag	p.E98*	LRRC23_ENST00000433346.1_5'Flank|SPSB2_ENST00000523102.1_Nonsense_Mutation_p.E98*|SPSB2_ENST00000519357.1_Nonsense_Mutation_p.E98*|RPL13P5_ENST00000412023.1_RNA	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2	98	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.E98*(1)		kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						CCCCTCTGCTCTAGGGGCCAG	0.697											OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Nonsense(1)	kidney(1)											29.0	33.0	31.0					12																	6981774		2203	4297	6500	SO:0001587	stop_gained	84727			AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.292G>T	12.37:g.6981774C>A	ENSP00000428338:p.Glu98*	Somatic	638	WXS	Illumina HiSeq	Phase_I	B7Z4W1|D3DUT0	Nonsense_Mutation	SNP	ENST00000524270.1	37	CCDS8567.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785609	0.49997	.	.	ENSG00000111671	ENST00000523102;ENST00000524270;ENST00000519357	.	.	.	3.84	2.94	0.34122	.	0.480118	0.19336	N	0.116781	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	5.3577	0.16071	0.0:0.677:0.2083:0.1147	.	.	.	.	X	98	.	ENSP00000431037:E98X	E	-	1	0	SPSB2	6852035	0.000000	0.05858	0.766000	0.31476	0.181000	0.23173	0.216000	0.17585	0.942000	0.37525	0.563000	0.77884	GAG		0.697	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375721.1		NM_032641	
THSD7B	80731	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	138414637	138414637	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr2:138414637G>A	ENST00000409968.1	+	24	4460	c.4282G>A	c.(4282-4284)Ggc>Agc	p.G1428S	THSD7B_ENST00000413152.2_Missense_Mutation_p.G1400S|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.G1431S			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1430	TSP type-1 18. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.G1400S(1)|p.G1431S(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ACTTACAGGAGGCAAATGTTA	0.393																																																	2	Substitution - Missense(2)	kidney(2)											109.0	106.0	107.0					2																	138414637		1915	4135	6050	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4282G>A	2.37:g.138414637G>A	ENSP00000387145:p.Gly1428Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	G	35	5.463320	0.96257	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.51325	0.71;0.71;0.71	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	T	0.70666	0.3250	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64019	-0.6505	10	0.32370	T	0.25	.	20.8599	0.99761	0.0:0.0:1.0:0.0	.	1400	C9JKN6	.	S	1428;1431;1400	ENSP00000387145:G1428S;ENSP00000272643:G1431S;ENSP00000413841:G1400S	ENSP00000272643:G1431S	G	+	1	0	THSD7B	138131107	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGC		0.393	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2		XM_046570.9	
TK1	7083	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	76170949	76170960	+	In_Frame_Del	DEL	CCGGCAGGCTGG	CCGGCAGGCTGG	-	rs1065767|rs386352371	byFrequency	TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	CCGGCAGGCTGG	CCGGCAGGCTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:76170949_76170960delCCGGCAGGCTGG	ENST00000301634.7	-	7	823_834	c.585_596delCCAGCCTGCCGG	c.(583-597)ggccagcctgccggg>ggg	p.195_199GQPAG>G	TK1_ENST00000590862.1_Intron|TK1_ENST00000588734.1_In_Frame_Del_p.228_232GQPAG>G|TK1_ENST00000405273.1_In_Frame_Del_p.195_199GQPAG>G|TK1_ENST00000590430.1_3'UTR	NM_003258.4	NP_003249.3	P04183	KITH_HUMAN	thymidine kinase 1, soluble	195					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|digestive tract development (GO:0048565)|DNA replication (GO:0006260)|fetal process involved in parturition (GO:0060138)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to copper ion (GO:0046688)|response to cortisol (GO:0051414)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|skeletal muscle cell proliferation (GO:0014856)|small molecule metabolic process (GO:0044281)|thymidine metabolic process (GO:0046104)	cytosol (GO:0005829)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|nucleoside kinase activity (GO:0019206)|thymidine kinase activity (GO:0004797)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|urinary_tract(2)	4			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)		Trifluridine(DB00432)|Zidovudine(DB00495)	GTTGTCCGGCCCGGCAGGCTGGCCTGAGGCCT	0.618																																																	0																																										SO:0001651	inframe_deletion	7083				CCDS11754.1	17q23.2-q25.3	2012-10-02			ENSG00000167900	ENSG00000167900	2.7.1.21		11830	protein-coding gene	gene with protein product		188300					Standard	NM_003258		Approved		uc002juw.2	P04183	OTTHUMG00000150674	ENST00000301634.7:c.585_596delCCAGCCTGCCGG	17.37:g.76170949_76170960delCCGGCAGGCTGG	ENSP00000301634:p.Gly195_Ala198del	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC58|Q969V0|Q9UMG9	In_Frame_Del	DEL	ENST00000301634.7	37	CCDS11754.1																																																																																				0.618	TK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319577.1		NM_003258	
TMC8	147138	broad.mit.edu;hgsc.bcm.edu	37	17	76137117	76137117	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr17:76137117G>A	ENST00000318430.5	+	16	2479	c.2105G>A	c.(2104-2106)cGt>cAt	p.R702H	TMC8_ENST00000589691.1_Missense_Mutation_p.R479H|TMC8_ENST00000591144.1_3'UTR	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	702					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)	p.R702H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GCGGGACTGCGTTCCCCTTGC	0.756																																																	1	Substitution - Missense(1)	kidney(1)											9.0	11.0	10.0					17																	76137117		2174	4260	6434	SO:0001583	missense	147138			AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.2105G>A	17.37:g.76137117G>A	ENSP00000325561:p.Arg702His	Somatic		WXS	Illumina HiSeq	Phase_I	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Missense_Mutation	SNP	ENST00000318430.5	37	CCDS32749.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741503	0.49151	.	.	ENSG00000167895	ENST00000318430	T	0.75477	-0.94	4.04	-3.25	0.05079	.	3.727870	0.00894	N	0.002268	T	0.59155	0.2173	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.32188	-0.9916	10	0.36615	T	0.2	0.4031	0.1294	0.00072	0.2687:0.1619:0.2416:0.3278	.	702	Q8IU68	TMC8_HUMAN	H	702	ENSP00000325561:R702H	ENSP00000325561:R702H	R	+	2	0	TMC8	73648712	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.516000	0.06282	-0.122000	0.11766	0.561000	0.74099	CGT		0.756	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3			
TMEM108	66000	hgsc.bcm.edu	37	3	133099097	133099097	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr3:133099097G>A	ENST00000321871.6	+	4	752	c.542G>A	c.(541-543)cGc>cAc	p.R181H	TMEM108_ENST00000515826.1_Missense_Mutation_p.R181H|TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.R181H	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	181	Pro-rich.					integral component of membrane (GO:0016021)		p.R181H(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						AATTCATCACGCCCTGTCCCG	0.682																																																	1	Substitution - Missense(1)	kidney(1)											23.0	26.0	25.0					3																	133099097		2203	4299	6502	SO:0001583	missense	66000			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.542G>A	3.37:g.133099097G>A	ENSP00000324651:p.Arg181His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610155	0.46527	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.50548	0.74;0.74;0.74	4.32	2.33	0.28932	.	0.391872	0.20199	N	0.097139	T	0.33933	0.0880	L	0.57536	1.79	0.09310	N	1	P;B	0.41265	0.744;0.36	B;B	0.28784	0.094;0.06	T	0.26467	-1.0102	10	0.46703	T	0.11	-7.3257	7.2305	0.26040	0.0952:0.1696:0.7352:0.0	.	181;181	E9PB58;Q6UXF1	.;TM108_HUMAN	H	181	ENSP00000324651:R181H;ENSP00000376838:R181H;ENSP00000423338:R181H	ENSP00000324651:R181H	R	+	2	0	TMEM108	134581787	0.001000	0.12720	0.269000	0.24586	0.793000	0.44817	0.956000	0.29202	0.928000	0.37168	0.561000	0.74099	CGC		0.682	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2		NM_023943	
TMEM123	114908	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	102272803	102272803	+	Missense_Mutation	SNP	T	T	C	rs373043680		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr11:102272803T>C	ENST00000398136.2	-	3	712	c.292A>G	c.(292-294)Aca>Gca	p.T98A	TMEM123_ENST00000361236.3_Missense_Mutation_p.T79A|TMEM123_ENST00000532161.1_Missense_Mutation_p.T10A|TMEM123_ENST00000525577.1_5'UTR	NM_052932.2	NP_443164.2	Q8N131	PORIM_HUMAN	transmembrane protein 123	98	Thr-rich.				oncosis (GO:0070267)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.T98A(1)		breast(3)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)		CCTGGTGTTGTTGTATTAGAT	0.423													T|||	1	0.000199681	0.0	0.0	5008	,	,		14653	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	kidney(1)						T	ALA/THR	0,4038		0,0,2019	459.0	424.0	435.0		292	-5.1	0.0	11		435	1,8337		0,1,4168	no	missense	TMEM123	NM_052932.2	58	0,1,6187	CC,CT,TT		0.012,0.0,0.0081	benign	98/209	102272803	1,12375	2019	4169	6188	SO:0001583	missense	114908			AL050161	CCDS41702.1	11q22.1	2014-01-02			ENSG00000152558	ENSG00000152558			30138	protein-coding gene	gene with protein product	"""pro oncosis receptor inducing membrane injury gene"""	606356				11481458, 24318988	Standard	NM_052932		Approved	PORIMIN, KCT3	uc001pha.3	Q8N131	OTTHUMG00000167326	ENST00000398136.2:c.292A>G	11.37:g.102272803T>C	ENSP00000381204:p.Thr98Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IWS2|Q96QV2	Missense_Mutation	SNP	ENST00000398136.2	37	CCDS41702.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799772	0.50208	0.0	1.2E-4	ENSG00000152558	ENST00000361236;ENST00000398136;ENST00000532161;ENST00000528969;ENST00000531103	T;T;T;T	0.52754	1.98;1.65;0.65;0.65	5.63	-5.07	0.02938	.	0.848450	0.10299	N	0.691332	T	0.27063	0.0663	L	0.34521	1.04	0.09310	N	1	B;B	0.17038	0.002;0.02	B;B	0.15484	0.004;0.013	T	0.25676	-1.0125	10	0.54805	T	0.06	-3.131	1.3565	0.02183	0.4037:0.3034:0.1198:0.1732	.	79;98	Q8N131-2;Q8N131	.;PORIM_HUMAN	A	79;98;10;10;10	ENSP00000355285:T79A;ENSP00000381204:T98A;ENSP00000435331:T10A;ENSP00000434976:T10A	ENSP00000355285:T79A	T	-	1	0	TMEM123	101778013	0.005000	0.15991	0.000000	0.03702	0.005000	0.04900	-0.154000	0.10130	-0.637000	0.05516	0.460000	0.39030	ACA		0.423	TMEM123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394178.1		NM_052932	
UNC5A	90249	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	176305475	176305475	+	Splice_Site	SNP	G	G	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr5:176305475G>A	ENST00000329542.4	+	13	2293		c.e13-1		UNC5A_ENST00000261961.3_Splice_Site	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCCCCATCAGGAGATCCCCT	0.612																																																	1	Unknown(1)	kidney(1)											89.0	83.0	85.0					5																	176305475		2203	4300	6503	SO:0001630	splice_region_variant	90249			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.2020-1G>A	5.37:g.176305475G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RXE6|Q8TF26|Q96GP4	Splice_Site	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275028	0.80580	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.176	0.89761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC5A	176238081	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.860000	0.99555	2.641000	0.89580	0.491000	0.48974	.		0.612	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1		XM_030300	Intron
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10183787	10183787	+	Frame_Shift_Del	DEL	C	C	-	rs398123481		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr3:10183787delC	ENST00000256474.2	+	1	1096	c.256delC	c.(256-258)cccfs	p.P86fs	snoU13_ENST00000458986.1_RNA|VHL_ENST00000345392.2_Frame_Shift_Del_p.P86fs	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	86			P -> A (in VHLD; type I). {ECO:0000269|PubMed:8956040}.|P -> H (in VHLD).|P -> L (in VHLD; type I). {ECO:0000269|PubMed:8956040}.|P -> R (in VHLD; type I). {ECO:0000269|PubMed:9829911}.|P -> S (in VHLD). {ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.P86S(5)|p.P86fs*72(2)|p.S72_V87>L(1)|p.R60fs*35(1)|p.P86A(1)|p.V87fs*72(1)|p.V84_E94>E(1)|p.V84fs*69(1)|p.P86T(1)|p.L85fs*46(1)|p.L85fs*44(1)|p.V84fs*72(1)|p.V84_P86del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGTCGTGCTGCCCGTATGGCT	0.721		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	18	Deletion - Frameshift(8)|Substitution - Missense(7)|Complex - deletion inframe(2)|Deletion - In frame(1)	kidney(17)|soft_tissue(1)	GRCh37	CM951276|CM952019	VHL	M							13.0	16.0	15.0					3																	10183787		2149	4208	6357	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.256delC	3.37:g.10183787delC	ENSP00000256474:p.Pro86fs	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.721	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZMIZ1	57178	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	81065919	81065919	+	Missense_Mutation	SNP	C	C	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr10:81065919C>T	ENST00000334512.5	+	22	3058	c.2486C>T	c.(2485-2487)tCg>tTg	p.S829L	ZMIZ1_ENST00000446377.2_5'Flank	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	829					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S829L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCCATCAAGTCGGACTTACAC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											75.0	64.0	68.0					10																	81065919		2203	4300	6503	SO:0001583	missense	57178			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2486C>T	10.37:g.81065919C>T	ENSP00000334474:p.Ser829Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	ENST00000334512.5	37	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014388	0.75161	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	T	0.34072	1.38	4.87	4.87	0.63330	.	0.000000	0.35096	N	0.003457	T	0.33904	0.0879	L	0.47190	1.495	0.80722	D	1	B	0.30741	0.293	B	0.24848	0.056	T	0.12319	-1.0552	10	0.38643	T	0.18	-7.9231	18.389	0.90475	0.0:1.0:0.0:0.0	.	829	Q9ULJ6	ZMIZ1_HUMAN	L	829;759;731	ENSP00000334474:S829L	ENSP00000334474:S829L	S	+	2	0	ZMIZ1	80735925	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.458000	0.80787	2.418000	0.82041	0.491000	0.48974	TCG		0.592	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2		NM_020338	
B4GALT5	9334	broad.mit.edu	37	20	48330184	48330184	+	Missense_Mutation	SNP	A	A	T			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr20:48330184A>T	ENST00000371711.4	-	1	231	c.44T>A	c.(43-45)cTg>cAg	p.L15Q		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	15					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)	p.L15Q(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CGCGGCGAGCAGCGAGCGGCG	0.721																																																	1	Substitution - Missense(1)	kidney(1)											5.0	8.0	7.0					20																	48330184		2066	4150	6216	SO:0001583	missense	9334			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.44T>A	20.37:g.48330184A>T	ENSP00000360776:p.Leu15Gln	Somatic		WXS	Illumina GAIIx	Phase_I	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	37	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	A	14.00	2.405520	0.42715	.	.	ENSG00000158470	ENST00000371711	T	0.47528	0.84	2.66	1.52	0.23074	.	0.400832	0.23539	U	0.047091	T	0.32255	0.0823	L	0.48642	1.525	0.38374	D	0.944945	P	0.48694	0.914	B	0.36030	0.216	T	0.15065	-1.0450	10	0.49607	T	0.09	-0.0625	6.6252	0.22826	0.8706:0.0:0.1294:0.0	.	15	O43286	B4GT5_HUMAN	Q	15	ENSP00000360776:L15Q	ENSP00000360776:L15Q	L	-	2	0	B4GALT5	47763591	1.000000	0.71417	0.811000	0.32455	0.742000	0.42306	3.248000	0.51430	0.161000	0.19458	0.156000	0.16432	CTG		0.721	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3		NM_004776	
FOXD1	2297	broad.mit.edu	37	5	72743654	72743654	+	Silent	SNP	C	C	T	rs1052207		TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr5:72743654C>T	ENST00000499003.3	-	1	698	c.534G>A	c.(532-534)tcG>tcA	p.S178S	FOXD1_ENST00000513595.1_5'Flank|RP11-79P5.2_ENST00000514661.1_lincRNA	NM_004472.2	NP_004463.1	Q16676	FOXD1_HUMAN	forkhead box D1	178					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in ureteric bud branching (GO:0060678)|metanephric capsule development (GO:0072213)|metanephric capsule specification (GO:0072267)|metanephric nephron development (GO:0072210)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme development (GO:0072076)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of gene expression (GO:0010628)|positive regulation of kidney development (GO:0090184)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S178S(2)		endometrium(1)|kidney(1)|lung(2)	4		Lung NSC(167;0.00327)|Ovarian(174;0.0175)|Prostate(461;0.151)		OV - Ovarian serous cystadenocarcinoma(47;1.07e-54)		AGTCGTTGAGCGAGAGGTTGT	0.637																																																	2	Substitution - coding silent(2)	kidney(2)											71.0	86.0	81.0					5																	72743654		2203	4299	6502	SO:0001819	synonymous_variant	2297			U59831	CCDS75259.1	5q13.2	2014-06-04			ENSG00000251493	ENSG00000251493		"""Forkhead boxes"""	3802	protein-coding gene	gene with protein product		601091		FKHL8		7957066, 8825632	Standard	NM_004472		Approved	FREAC4	uc003kcp.3	Q16676	OTTHUMG00000162495	ENST00000499003.3:c.534G>A	5.37:g.72743654C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q12949	Silent	SNP	ENST00000499003.3	37																																																																																					0.637	FOXD1-001	KNOWN	sequence_error|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000369154.2		NM_004472	
ZNRD1-AS1	80862	broad.mit.edu	37	6	29976859	29976859	+	RNA	SNP	T	T	A			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr6:29976859T>A	ENST00000376797.3	-	0	820				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|HLA-J_ENST00000462773.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		ACTAGGAGGTTCCTCTAGGAC	0.512																																																	0																																												3137			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29976859T>A		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000376797.3	37																																																																																					0.512	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	antisense	OTTHUMT00000253083.1		NR_026751	
RAP1GAP	5909	broad.mit.edu	37	1	21924516	21924516	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EU-5907-01A-11D-1669-08	TCGA-EU-5907-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5fded36e-05ba-4cce-8303-738f5b04ad16	fbe54bba-5614-4f31-9139-0fa08b9d72bb	g.chr1:21924516delC	ENST00000374765.4	-	23	2121	c.1921delG	c.(1921-1923)gacfs	p.D641fs	RAP1GAP_ENST00000374761.2_Frame_Shift_Del_p.D672fs|RAP1GAP_ENST00000374763.2_Frame_Shift_Del_p.D726fs|RAP1GAP_ENST00000542643.2_Frame_Shift_Del_p.D659fs|RAP1GAP_ENST00000290101.4_Frame_Shift_Del_p.D705fs	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	641					GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CACGCAGGGTCCCCCAACTTG	0.692																																																	0													16.0	17.0	17.0					1																	21924516		2196	4281	6477	SO:0001589	frameshift_variant	5909			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.1921delG	1.37:g.21924516delC	ENSP00000363897:p.Asp641fs	Somatic		WXS	Illumina GAIIx	Phase_I	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Frame_Shift_Del	DEL	ENST00000374765.4	37	CCDS218.1																																																																																				0.692	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2		NM_002885	
