#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11184573	11184573	+	Missense_Mutation	SNP	G	G	T	rs587777894		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr1:11184573G>T	ENST00000361445.4	-	47	6720	c.6644C>A	c.(6643-6645)tCt>tAt	p.S2215Y	MTOR_ENST00000376838.1_Missense_Mutation_p.S420Y	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2215	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		S -> Y (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.S2215Y(4)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTTCCGAAGAGATGTTGGGTC	0.438																																					p.S2215Y		.											.	MTOR-1439	4	Substitution - Missense(4)	large_intestine(2)|kidney(1)|endometrium(1)	c.C6644A						.						101.0	98.0	99.0					1																	11184573		2203	4300	6503	SO:0001583	missense	2475	exon47			CGAAGAGATGTTG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6644C>A	1.37:g.11184573G>T	ENSP00000354558:p.Ser2215Tyr	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	71	24	NM_004958	0	0	9	11	2	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903707	0.92035	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.78364	-1.17;-1.17	5.8	5.8	0.92144	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.88862	0.6552	M	0.86651	2.83	0.80722	D	1	D	0.58970	0.984	P	0.60541	0.876	D	0.90182	0.4243	10	0.87932	D	0	-14.2436	18.2956	0.90145	0.0:0.0:1.0:0.0	.	2215	P42345	MTOR_HUMAN	Y	2215;420	ENSP00000354558:S2215Y;ENSP00000366034:S420Y	ENSP00000354558:S2215Y	S	-	2	0	MTOR	11107160	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.362000	0.97126	2.761000	0.94854	0.650000	0.86243	TCT	.		0.438	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
BEST4	266675	hgsc.bcm.edu	37	1	45252159	45252159	+	Missense_Mutation	SNP	T	T	C	rs41306591	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr1:45252159T>C	ENST00000372207.3	-	3	456	c.457A>G	c.(457-459)Acc>Gcc	p.T153A		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	153						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					TGCTCCATGGTGGGGAAGCGC	0.736											OREG0013447	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	6	0.00119808	0.0	0.0014	5008	,	,		14773	0.0		0.005	False		,,,				2504	0.0				p.T153A		.											.	BEST4-91	0			c.A457G						.	T	ALA/THR	3,4269		0,3,2133	8.0	9.0	8.0		457	5.8	1.0	1	dbSNP_127	8	15,8343		0,15,4164	yes	missense	BEST4	NM_153274.2	58	0,18,6297	CC,CT,TT		0.1795,0.0702,0.1425	probably-damaging	153/474	45252159	18,12612	2136	4179	6315	SO:0001583	missense	266675	exon3			CCATGGTGGGGAA	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.457A>G	1.37:g.45252159T>C	ENSP00000361281:p.Thr153Ala	Somatic	2	1	930	WXS	Illumina HiSeq	Phase_I	8	3	NM_153274	0	0	0	0	0	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	37	CCDS514.1	6	0.0027472527472527475	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	T	36	5.748484	0.96882	7.02E-4	0.001795	ENSG00000142959	ENST00000372207	D	0.98264	-4.83	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.98588	0.9528	M	0.93808	3.46	0.58432	D	0.999995	P	0.44281	0.831	P	0.55713	0.782	D	0.96014	0.9004	10	0.72032	D	0.01	-32.0345	14.8939	0.70630	0.0:0.0:0.0:1.0	rs41306591	153	Q8NFU0	BEST4_HUMAN	A	153	ENSP00000361281:T153A	ENSP00000361281:T153A	T	-	1	0	BEST4	45024746	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.089000	0.71384	2.200000	0.70718	0.459000	0.35465	ACC	T|0.997;C|0.003		0.736	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274	
MROH7	374977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	55118778	55118778	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr1:55118778A>C	ENST00000421030.2	+	3	464	c.179A>C	c.(178-180)gAt>gCt	p.D60A	MROH7_ENST00000545244.1_Intron|MROH7_ENST00000395690.2_Missense_Mutation_p.D60A|MROH7_ENST00000454855.2_Intron|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.D60A|MROH7_ENST00000472987.1_3'UTR|MROH7_ENST00000339553.5_Missense_Mutation_p.D60A|MROH7_ENST00000409996.1_Intron	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	60						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CTCGTTCCAGATCTTAATGAT	0.567																																					p.D60A		.											.	.	0			c.A179C						.						77.0	78.0	77.0					1																	55118778		1918	4127	6045	SO:0001583	missense	374977	exon3			TTCCAGATCTTAA	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.179A>C	1.37:g.55118778A>C	ENSP00000396622:p.Asp60Ala	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	148	46	NM_001039464	0	0	0	0	0	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	ENST00000421030.2	37	CCDS41342.2	.	.	.	.	.	.	.	.	.	.	A	6.762	0.509542	0.12883	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000339553;ENST00000395690	T;T;T	0.02974	4.62;4.09;4.11	3.58	1.19	0.21007	.	.	.	.	.	T	0.02012	0.0063	N	0.17082	0.46	0.09310	N	0.999998	B;B;P	0.46142	0.154;0.015;0.873	B;B;B	0.42495	0.053;0.018;0.389	T	0.47724	-0.9095	9	0.33141	T	0.24	.	3.5678	0.07907	0.6251:0.247:0.1279:0.0	.	60;60;60	F8W8P2;Q68CQ1;Q68CQ1-4	.;HEAT8_HUMAN;.	A	60	ENSP00000396622:D60A;ENSP00000343211:D60A;ENSP00000379044:D60A	ENSP00000343211:D60A	D	+	2	0	HEATR8	54891366	0.027000	0.19231	0.058000	0.19502	0.109000	0.19521	0.013000	0.13310	0.238000	0.21222	0.459000	0.35465	GAT	.		0.567	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
TRIM33	51592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	114948195	114948195	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr1:114948195G>A	ENST00000358465.2	-	15	2688	c.2605C>T	c.(2605-2607)Cac>Tac	p.H869Y	TRIM33_ENST00000450349.2_Missense_Mutation_p.H501Y|TRIM33_ENST00000476908.1_5'UTR|TRIM33_ENST00000369543.2_Missense_Mutation_p.H869Y	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	869					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCGACCTGTGCATGAGGCTT	0.468			T	RET	papillary thyroid																																p.H869Y		.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33-1351	0			c.C2605T						.						218.0	196.0	203.0					1																	114948195		2203	4300	6503	SO:0001583	missense	51592	exon15			ACCTGTGCATGAG	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.2605C>T	1.37:g.114948195G>A	ENSP00000351250:p.His869Tyr	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	243	65	NM_033020	0	0	3	5	2	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895312	0.72639	.	.	ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349	T;T;T	0.75589	-0.81;-0.71;-0.95	5.29	5.29	0.74685	Zinc finger, FYVE/PHD-type (1);	0.224309	0.50627	D	0.000108	T	0.66944	0.2841	N	0.19112	0.55	0.53688	D	0.999974	D;D;P;P;P	0.54601	0.967;0.957;0.952;0.952;0.92	P;B;B;P;B	0.53102	0.718;0.402;0.446;0.548;0.346	T	0.72261	-0.4345	10	0.59425	D	0.04	-10.5094	19.2948	0.94118	0.0:0.0:1.0:0.0	.	501;501;64;869;869	E7EN20;B3KN30;Q9HAL0;Q9UPN9-2;Q9UPN9	.;.;.;.;TRI33_HUMAN	Y	869;869;501	ENSP00000351250:H869Y;ENSP00000358556:H869Y;ENSP00000412077:H501Y	ENSP00000351250:H869Y	H	-	1	0	TRIM33	114749718	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.388000	0.73195	2.636000	0.89361	0.491000	0.48974	CAC	.		0.468	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
OBSCN	84033	hgsc.bcm.edu	37	1	228467538	228467538	+	Silent	SNP	C	C	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr1:228467538C>G	ENST00000422127.1	+	28	7457	c.7413C>G	c.(7411-7413)ctC>ctG	p.L2471L	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Silent_p.L1318L|OBSCN_ENST00000284548.11_Silent_p.L2471L|OBSCN_ENST00000570156.2_Silent_p.L2900L|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2471	Ig-like 24.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCGTAGTCCTCACACGGCCGT	0.652																																					p.L2900L		.											.	OBSCN-403	0			c.C8700G						.						19.0	23.0	21.0					1																	228467538		2149	4246	6395	SO:0001819	synonymous_variant	84033	exon33			AGTCCTCACACGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7413C>G	1.37:g.228467538C>G		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_001271223	0	0	1	1	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RYR2	6262	hgsc.bcm.edu	37	1	237804221	237804221	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr1:237804221C>G	ENST00000366574.2	+	47	7457	c.7140C>G	c.(7138-7140)gaC>gaG	p.D2380E	RYR2_ENST00000360064.6_Missense_Mutation_p.D2378E|RYR2_ENST00000542537.1_Missense_Mutation_p.D2364E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2380	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGAAGATGACACTATCCACA	0.428																																					p.D2380E		.											.	RYR2-158	0			c.C7140G						.						168.0	162.0	164.0					1																	237804221		2066	4233	6299	SO:0001583	missense	6262	exon47			AGATGACACTATC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7140C>G	1.37:g.237804221C>G	ENSP00000355533:p.Asp2380Glu	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	30	2	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488252	0.26686	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98474	-4.95;-4.95;-4.95	5.6	-2.13	0.07144	.	0.000000	0.64402	D	0.000003	D	0.90672	0.7074	N	0.04043	-0.29	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.77726	-0.2480	10	0.24483	T	0.36	-26.3529	6.6308	0.22855	0.1122:0.424:0.0:0.4638	.	2380	Q92736	RYR2_HUMAN	E	2380;2378;2364	ENSP00000355533:D2380E;ENSP00000353174:D2378E;ENSP00000443798:D2364E	ENSP00000353174:D2378E	D	+	3	2	RYR2	235870844	0.002000	0.14202	0.967000	0.41034	0.977000	0.68977	-1.210000	0.02999	-0.290000	0.09025	0.591000	0.81541	GAC	.		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CCDC7	79741	broad.mit.edu	37	10	32854549	32854549	+	Splice_Site	SNP	G	G	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr10:32854549G>T	ENST00000362006.5	+	15	1740		c.e15+1		C10orf68_ENST00000572165.1_Splice_Site|C10orf68_ENST00000375030.2_5'Flank|CCDC7_ENST00000277657.6_Splice_Site|C10orf68_ENST00000375028.3_5'Flank	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7											NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				GGCTTTACAGGTAAAGGATGT	0.328																																					.													.	CCDC7-90	0			c.1197+1G>T						.						44.0	43.0	44.0					10																	32854549		2203	4297	6500	SO:0001630	splice_region_variant	221016	exon15			TTACAGGTAAAGG	BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.1197+1G>T	10.37:g.32854549G>T		Somatic	43	0		WXS	Illumina HiSeq	Phase_I	45	3	NM_145023	0	0	0	0	0	Q5VW55|Q8IVQ0|Q8NEQ0	Splice_Site	SNP	ENST00000362006.5	37	CCDS7173.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262780	0.59431	.	.	ENSG00000216937	ENST00000277657;ENST00000362006;ENST00000435402	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7259	0.62759	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC7	32894555	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.819000	0.55686	2.276000	0.75962	0.563000	0.77884	.	.		0.328	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047490.1	NM_145023	Intron
ZNF488	118738	broad.mit.edu	37	10	48371023	48371023	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr10:48371023G>T	ENST00000395702.2	+	2	718	c.491G>T	c.(490-492)aGc>aTc	p.S164I	ZNF488_ENST00000586537.1_Missense_Mutation_p.S57I|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	164					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						AGCGCCTTTAGCAAACCAACC	0.597																																					p.S164I													.	ZNF488-91	0			c.G491T						.						68.0	67.0	67.0					10																	48371023		2203	4300	6503	SO:0001583	missense	118738	exon2			CCTTTAGCAAACC	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.491G>T	10.37:g.48371023G>T	ENSP00000379054:p.Ser164Ile	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	88	5	NM_153034	0	0	0	0	0	Q05CE0	Missense_Mutation	SNP	ENST00000395702.2	37	CCDS7217.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.817368	0.70912	.	.	ENSG00000165388	ENST00000395702	T	0.31247	1.5	5.55	5.55	0.83447	.	0.159805	0.56097	D	0.000026	T	0.47710	0.1460	L	0.55481	1.735	0.30813	N	0.738595	D	0.71674	0.998	P	0.62014	0.897	T	0.53005	-0.8499	10	0.72032	D	0.01	.	14.1431	0.65331	0.0:0.1498:0.8502:0.0	.	164	Q96MN9	ZN488_HUMAN	I	164	ENSP00000379054:S164I	ENSP00000379054:S164I	S	+	2	0	ZNF488	47991029	1.000000	0.71417	0.997000	0.53966	0.374000	0.29953	4.688000	0.61715	2.613000	0.88420	0.561000	0.74099	AGC	.		0.597	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034	
EDRF1	26098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	127442312	127442312	+	Missense_Mutation	SNP	A	A	G	rs199695348		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr10:127442312A>G	ENST00000356792.4	+	24	3675	c.3443A>G	c.(3442-3444)aAt>aGt	p.N1148S	RP11-383C5.7_ENST00000602030.1_RNA|RP11-383C5.7_ENST00000594025.1_RNA|RP11-383C5.7_ENST00000593871.1_RNA|RP11-383C5.7_ENST00000601363.1_RNA|C10orf137_ENST00000337623.3_Missense_Mutation_p.N1114S	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		1148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CCTAGTCTCAATCGAGAAGAA	0.393																																					p.N1148S		.											.	C10orf137-590	0			c.A3443G						.						153.0	143.0	146.0					10																	127442312		2203	4300	6503	SO:0001583	missense	26098	exon24			GTCTCAATCGAGA																												ENST00000356792.4:c.3443A>G	10.37:g.127442312A>G	ENSP00000349244:p.Asn1148Ser	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	120	42	NM_001202438	0	0	4	6	2	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	A	8.698	0.908981	0.17833	.	.	ENSG00000107938	ENST00000356792;ENST00000337623	T;T	0.42131	0.98;0.98	4.89	-2.12	0.07165	.	0.274294	0.39020	N	0.001485	T	0.14313	0.0346	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.18310	0.027;0.013;0.0	B;B;B	0.14578	0.009;0.011;0.003	T	0.26018	-1.0115	10	0.13470	T	0.59	.	6.4393	0.21841	0.5191:0.1277:0.3532:0.0	.	1148;495;1114	Q3B7T1;Q5VZQ1;Q3B7T1-5	EDRF1_HUMAN;.;.	S	1148;1114	ENSP00000349244:N1148S;ENSP00000336727:N1114S	ENSP00000336727:N1114S	N	+	2	0	C10orf137	127432302	0.081000	0.21417	0.000000	0.03702	0.099000	0.18886	1.651000	0.37302	-0.178000	0.10672	-0.274000	0.10170	AAT	A|0.999;G|0.001		0.393	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1268488	1268488	+	Missense_Mutation	SNP	C	C	T	rs200106077		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr11:1268488C>T	ENST00000529681.1	+	31	10436	c.10378C>T	c.(10378-10380)Ccc>Tcc	p.P3460S	MUC5B_ENST00000447027.1_Missense_Mutation_p.P3463S|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3460	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCGGTCCCTGCCCCCCAGCAG	0.672																																					p.P3460S		.											.	.	0			c.C10378T						.						92.0	127.0	115.0					11																	1268488		2115	4227	6342	SO:0001583	missense	727897	exon31			TCCCTGCCCCCCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10378C>T	11.37:g.1268488C>T	ENSP00000436812:p.Pro3460Ser	Somatic	95	2		WXS	Illumina HiSeq	Phase_I	112	13	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	c	4.064	0.009588	0.07912	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21734	1.99;2.18	2.39	0.0952	0.14484	.	.	.	.	.	T	0.19565	0.0470	L	0.46157	1.445	0.09310	N	1	B;P	0.47841	0.274;0.901	B;P	0.44811	0.2;0.461	T	0.15178	-1.0446	9	0.87932	D	0	.	5.7781	0.18292	0.188:0.6856:0.0:0.1263	.	3988;3463	A7Y9J9;E9PBJ0	.;.	S	3460;3463;3432;3365	ENSP00000436812:P3460S;ENSP00000415793:P3463S	ENSP00000343037:P3432S	P	+	1	0	MUC5B	1225064	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.924000	0.00333	0.339000	0.23719	-0.642000	0.03964	CCC	.		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TCN1	6947	bcgsc.ca	37	11	59622265	59622265	+	Silent	SNP	A	A	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr11:59622265A>G	ENST00000257264.3	-	7	1085	c.981T>C	c.(979-981)ccT>ccC	p.P327P	TCN1_ENST00000532419.1_5'UTR	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	327	Flexible linker.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTGAGTCAGGAGGTGTCACAG	0.393																																					p.P327P													.	TCN1-92	0			c.T981C						.						114.0	108.0	110.0					11																	59622265		2201	4295	6496	SO:0001819	synonymous_variant	6947	exon7			GTCAGGAGGTGTC	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.981T>C	11.37:g.59622265A>G		Somatic	94	0		WXS	Illumina HiSeq	Phase_1	150	5	NM_001062	0	0	121	121	0	A8KAC5|Q8WV77	Silent	SNP	ENST00000257264.3	37	CCDS7978.1																																																																																			.		0.393	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394503.1	NM_001062	
SLCO2B1	11309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74883496	74883496	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr11:74883496G>C	ENST00000289575.5	+	7	1249	c.854G>C	c.(853-855)gGt>gCt	p.G285A	SLCO2B1_ENST00000526660.1_3'UTR|SLCO2B1_ENST00000454962.2_Missense_Mutation_p.G58A|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.G263A|SLCO2B1_ENST00000531756.1_Missense_Mutation_p.G30A|SLCO2B1_ENST00000341411.4_Missense_Mutation_p.G58A|SLCO2B1_ENST00000525650.1_Missense_Mutation_p.G141A|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.G169A	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	285					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	ATCGCTGCCGGTGCAGTGGCC	0.557																																					p.G285A		.											.	SLCO2B1-154	0			c.G854C						.						93.0	81.0	85.0					11																	74883496		2200	4293	6493	SO:0001583	missense	11309	exon7			CTGCCGGTGCAGT	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.854G>C	11.37:g.74883496G>C	ENSP00000289575:p.Gly285Ala	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	103	30	NM_007256	0	0	10	10	0	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	G	5.226	0.227121	0.09916	.	.	ENSG00000137491	ENST00000289575;ENST00000341411;ENST00000532236;ENST00000531756;ENST00000525650;ENST00000454962;ENST00000428359	T;T;T;T;T;T;T	0.80033	0.41;-1.33;-1.33;-1.33;-1.33;-1.33;0.41	5.65	3.76	0.43208	Major facilitator superfamily domain, general substrate transporter (1);	0.406164	0.30347	N	0.009837	T	0.67979	0.2951	N	0.26092	0.79	0.19945	N	0.999945	B;B;B;B	0.19935	0.019;0.04;0.016;0.008	B;B;B;B	0.26969	0.034;0.075;0.02;0.015	T	0.51545	-0.8692	10	0.16896	T	0.51	.	10.9072	0.47086	0.0:0.1411:0.7122:0.1467	.	141;30;58;285	E9PPU8;E9PPJ4;O94956-2;O94956	.;.;.;SO2B1_HUMAN	A	285;58;169;30;141;58;263	ENSP00000289575:G285A;ENSP00000341286:G58A;ENSP00000434112:G169A;ENSP00000432650:G30A;ENSP00000436324:G141A;ENSP00000389653:G58A;ENSP00000388912:G263A	ENSP00000289575:G285A	G	+	2	0	SLCO2B1	74561144	0.897000	0.30589	0.001000	0.08648	0.003000	0.03518	3.898000	0.56281	0.903000	0.36546	0.655000	0.94253	GGT	.		0.557	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
ARHGEF12	23365	broad.mit.edu	37	11	120300474	120300474	+	Silent	SNP	C	C	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr11:120300474C>T	ENST00000397843.2	+	10	883	c.717C>T	c.(715-717)atC>atT	p.I239I	ARHGEF12_ENST00000532993.1_Silent_p.I136I|ARHGEF12_ENST00000356641.3_Silent_p.I220I	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	239					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TAAAAGAGATCCAAGAGGCCA	0.378			T	MLL	AML																																p.I239I				Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12-661	0			c.C717T						.						82.0	78.0	79.0					11																	120300474		1869	4099	5968	SO:0001819	synonymous_variant	23365	exon10			AGAGATCCAAGAG	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.717C>T	11.37:g.120300474C>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	103	4	NM_015313	0	0	16	17	1	O15086|Q6P526	Silent	SNP	ENST00000397843.2	37	CCDS41727.1																																																																																			.		0.378	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
GTSF1	121355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54857070	54857070	+	Silent	SNP	A	A	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr12:54857070A>G	ENST00000552397.1	-	4	1025	c.129T>C	c.(127-129)gaT>gaC	p.D43D	GTSF1_ENST00000305879.5_Silent_p.D43D|GTSF1_ENST00000552395.1_5'UTR|RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1	43						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				TGCTTGCAACATCAGGATGAT	0.433																																					p.D43D		.											.	GTSF1-90	0			c.T129C						.						125.0	113.0	117.0					12																	54857070		2203	4300	6503	SO:0001819	synonymous_variant	121355	exon4			TGCAACATCAGGA	AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.129T>C	12.37:g.54857070A>G		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	93	27	NM_144594	0	0	0	0	0	B3KQ60|Q0VGM4|Q8N778	Silent	SNP	ENST00000552397.1	37	CCDS8881.1																																																																																			.		0.433	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406187.1	NM_144594	
AGAP2	116986	hgsc.bcm.edu	37	12	58120409	58120409	+	Missense_Mutation	SNP	C	C	T	rs199546118	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr12:58120409C>T	ENST00000547588.1	-	19	3504	c.3505G>A	c.(3505-3507)Gcc>Acc	p.A1169T	AGAP2-AS1_ENST00000542466.2_Intron|RP11-571M6.8_ENST00000548410.2_RNA|AGAP2_ENST00000257897.3_Missense_Mutation_p.A813T	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	1169					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						CTGGGCGTGGCGGTGATGCTG	0.751											OREG0021951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	71	0.0141773	0.0507	0.0043	5008	,	,		5966	0.0		0.0	False		,,,				2504	0.001				p.A1169T		.											.	AGAP2-716	0			c.G3505A						.						2.0	2.0	2.0					12																	58120409		1012	2358	3370	SO:0001583	missense	116986	exon19			GCGTGGCGGTGAT	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.3505G>A	12.37:g.58120409C>T	ENSP00000449241:p.Ala1169Thr	Somatic	3	0	1028	WXS	Illumina HiSeq	Phase_I	7	6	NM_001122772	0	0	0	0	0	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	37	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.51|15.51	2.855284|2.855284	0.51376|0.51376	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000257897;ENST00000547588|ENST00000328568	T;T|.	0.35605|.	1.5;1.3|.	2.6|2.6	2.6|2.6	0.31112|0.31112	.|.	.|.	.|.	.|.	.|.	T|T	0.42585|0.42585	0.1209|0.1209	N|N	0.22421|0.22421	0.69|0.69	0.34065|0.34065	D|D	0.657751|0.657751	B;D;D|.	0.57257|.	0.35;0.979;0.964|.	B;P;B|.	0.53006|.	0.006;0.715;0.42|.	T|T	0.52808|0.52808	-0.8526|-0.8526	9|5	0.54805|.	T|.	0.06|.	.|.	10.9754|10.9754	0.47463|0.47463	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	813;1169;1169|.	Q99490-2;F8VVT9;Q99490|.	.;.;AGAP2_HUMAN|.	T|H	813;1169|1012	ENSP00000257897:A813T;ENSP00000449241:A1169T|.	ENSP00000257897:A813T|.	A|R	-|-	1|2	0|0	AGAP2|AGAP2	56406676|56406676	0.997000|0.997000	0.39634|0.39634	0.993000|0.993000	0.49108|0.49108	0.429000|0.429000	0.31625|0.31625	0.614000|0.614000	0.24314|0.24314	1.783000|1.783000	0.52377|0.52377	0.305000|0.305000	0.20034|0.20034	GCC|CGC	.		0.751	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
NAV3	89795	hgsc.bcm.edu	37	12	78574710	78574710	+	Silent	SNP	A	A	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr12:78574710A>G	ENST00000397909.2	+	30	5750	c.5577A>G	c.(5575-5577)acA>acG	p.T1859T	NAV3_ENST00000266692.7_Silent_p.T1660T|NAV3_ENST00000552300.1_3'UTR|NAV3_ENST00000536525.2_Silent_p.T1837T|NAV3_ENST00000228327.6_Silent_p.T1837T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1859						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTGGTAACACAGCTAAGCCTA	0.413										HNSCC(70;0.22)																											p.T1837T		.											.	NAV3-279	0			c.A5511G						.						93.0	94.0	94.0					12																	78574710		1965	4149	6114	SO:0001819	synonymous_variant	89795	exon29			TAACACAGCTAAG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5577A>G	12.37:g.78574710A>G		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	75	26	NM_014903	0	0	0	0	0	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	A	8.767	0.925079	0.18056	.	.	ENSG00000067798	ENST00000552895	.	.	.	6.02	-12.0	0.00017	.	.	.	.	.	T	0.30448	0.0765	.	.	.	0.47994	D	0.999561	.	.	.	.	.	.	T	0.39702	-0.9601	4	.	.	.	-0.0484	1.2926	0.02063	0.2205:0.141:0.3103:0.3282	.	.	.	.	G	732	.	.	S	+	1	0	NAV3	77098841	0.000000	0.05858	0.000000	0.03702	0.921000	0.55340	-2.756000	0.00789	-2.540000	0.00486	-0.263000	0.10527	AGC	.		0.413	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
SHISA2	387914	hgsc.bcm.edu	37	13	26625047	26625047	+	Silent	SNP	G	G	A	rs4770911	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr13:26625047G>A	ENST00000319420.3	-	1	122	c.67C>T	c.(67-69)Ctg>Ttg	p.L23L	LINC00415_ENST00000439079.1_lincRNA	NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	23					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						AGCGCAGCCAGCAGCAGCTGC	0.731													G|||	768	0.153355	0.1036	0.1167	5008	,	,		13796	0.1032		0.171	False		,,,				2504	0.2802				p.L23L		.											.	SHISA2-69	0			c.C67T						.	G		241,2763		3,235,1264	2.0	2.0	2.0		67	4.4	1.0	13	dbSNP_111	2	750,5346		25,700,2323	no	coding-synonymous	SHISA2	NM_001007538.1		28,935,3587	AA,AG,GG		12.3031,8.0226,10.8901		23/296	26625047	991,8109	1502	3048	4550	SO:0001819	synonymous_variant	387914	exon1			CAGCCAGCAGCAG		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.67C>T	13.37:g.26625047G>A		Somatic	3	1		WXS	Illumina HiSeq	Phase_I	9	5	NM_001007538	0	0	0	1	1	B9EH70|Q5W0G8	Silent	SNP	ENST00000319420.3	37	CCDS31951.1																																																																																			G|0.870;A|0.130		0.731	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
FRY	10129	bcgsc.ca	37	13	32811616	32811616	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr13:32811616G>A	ENST00000380250.3	+	44	6407	c.5911G>A	c.(5911-5913)Gca>Aca	p.A1971T		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1971						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CGGCAACACCGCAACTGCCGA	0.537																																					p.A1971T													.	FRY-142	0			c.G5911A						.						60.0	69.0	66.0					13																	32811616		2020	4189	6209	SO:0001583	missense	10129	exon44			AACACCGCAACTG	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.5911G>A	13.37:g.32811616G>A	ENSP00000369600:p.Ala1971Thr	Somatic	86	1		WXS	Illumina HiSeq	Phase_1	84	6	NM_023037	0	0	4	4	0	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	9.183	1.023983	0.19433	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.21734	1.99	5.65	-5.39	0.02664	.	0.703225	0.13908	N	0.354457	T	0.09774	0.0240	N	0.11427	0.14	0.23936	N	0.996414	B	0.06786	0.001	B	0.01281	0.0	T	0.22173	-1.0224	10	0.23302	T	0.38	.	15.1608	0.72782	0.3067:0.0:0.6933:0.0	.	1971	Q5TBA9	FRY_HUMAN	T	1971;808	ENSP00000369600:A1971T	ENSP00000369600:A1971T	A	+	1	0	FRY	31709616	0.044000	0.20184	0.000000	0.03702	0.005000	0.04900	0.435000	0.21510	-1.087000	0.03081	-0.768000	0.03414	GCA	.		0.537	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
MYH6	4624	hgsc.bcm.edu;broad.mit.edu	37	14	23859655	23859655	+	Splice_Site	SNP	C	C	G	rs375733891		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr14:23859655C>G	ENST00000356287.3	-	25	3372	c.3343G>C	c.(3343-3345)Gca>Cca	p.A1115P	MYH6_ENST00000405093.3_Splice_Site_p.A1115P|MIR208A_ENST00000362287.1_RNA			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1115					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		tcGATGCGTGCCTGGGTCAGA	0.627																																					p.A1115P		.											.	MYH6-94	0			c.G3343C						.						18.0	20.0	19.0					14																	23859655		2203	4298	6501	SO:0001630	splice_region_variant	4624	exon26			TGCGTGCCTGGGT	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3343-1G>C	14.37:g.23859655C>G		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	43	14	NM_002471	0	0	0	0	0	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	26.1	4.701069	0.88924	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.80480	-1.38;-1.38	4.25	4.25	0.50352	Myosin tail (1);	.	.	.	.	D	0.92698	0.7679	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95199	0.8315	9	0.87932	D	0	.	17.0442	0.86498	0.0:1.0:0.0:0.0	.	1115	P13533	MYH6_HUMAN	P	1115	ENSP00000386041:A1115P;ENSP00000348634:A1115P	ENSP00000348634:A1115P	A	-	1	0	MYH6	22929495	1.000000	0.71417	0.779000	0.31741	0.049000	0.14656	7.575000	0.82447	2.092000	0.63282	0.561000	0.74099	GCA	.		0.627	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		Missense_Mutation
COCH	1690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31353851	31353851	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr14:31353851A>C	ENST00000396618.3	+	9	778	c.722A>C	c.(721-723)aAt>aCt	p.N241T	RP11-829H16.3_ENST00000468444.2_RNA|RP11-829H16.3_ENST00000556786.1_RNA|COCH_ENST00000216361.4_Missense_Mutation_p.N241T|COCH_ENST00000475087.1_Missense_Mutation_p.N241T|COCH_ENST00000460581.2_Missense_Mutation_p.N129T|COCH_ENST00000382493.4_Missense_Mutation_p.N48T|RP11-829H16.3_ENST00000555421.1_RNA|RP11-829H16.3_ENST00000555108.1_RNA	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	241	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		AGAGGGGGTAATTCCAATACA	0.358																																					p.N241T		.											.	COCH-228	0			c.A722C						.						69.0	72.0	71.0					14																	31353851		2203	4299	6502	SO:0001583	missense	1690	exon9			GGGGTAATTCCAA		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.722A>C	14.37:g.31353851A>C	ENSP00000379862:p.Asn241Thr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	71	18	NM_004086	0	0	0	0	0	A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	ENST00000396618.3	37	CCDS9640.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.1|23.1	4.373608|4.373608	0.82573|0.82573	.|.	.|.	ENSG00000100473|ENSG00000100473	ENST00000468826|ENST00000216361;ENST00000396618;ENST00000475087;ENST00000555881;ENST00000460581;ENST00000542225;ENST00000382493	.|D;D;D;D;D;D	.|0.83075	.|-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.78|5.78	5.78|5.78	0.91487|0.91487	.|von Willebrand factor, type A (3);	.|0.040966	.|0.85682	.|D	.|0.000000	D|D	0.89114|0.89114	0.6623|0.6623	M|M	0.64676|0.64676	1.99|1.99	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.64830	.|0.994;0.992;0.975	.|D;P;P	.|0.67231	.|0.95;0.87;0.819	D|D	0.88337|0.88337	0.2972|0.2972	5|10	.|0.39692	.|T	.|0.17	-22.9226|-22.9226	16.1145|16.1145	0.81295|0.81295	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|48;241;241	.|E7EN67;Q96IU6;O43405	.|.;.;COCH_HUMAN	L|T	81|241;241;241;123;129;129;48	.|ENSP00000216361:N241T;ENSP00000379862:N241T;ENSP00000451528:N241T;ENSP00000452569:N123T;ENSP00000451713:N129T;ENSP00000371933:N48T	.|ENSP00000216361:N241T	I|N	+|+	1|2	0|0	COCH|COCH	30423602|30423602	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.474000|8.474000	0.90413|0.90413	2.205000|2.205000	0.71048|0.71048	0.454000|0.454000	0.30748|0.30748	ATT|AAT	.		0.358	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	
DTD2	112487	hgsc.bcm.edu	37	14	31926584	31926584	+	Missense_Mutation	SNP	G	G	A	rs17097904	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr14:31926584G>A	ENST00000310850.4	-	1	132	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	DTD2_ENST00000356180.4_Missense_Mutation_p.R6W|RP11-176H8.1_ENST00000547378.1_Missense_Mutation_p.R6W	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	6			R -> W (in dbSNP:rs17097904).		D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R6W(1)									TGAGGAATCCGGCTACCCTCA	0.697																																					p.R6W		.											.	.	1	Substitution - Missense(1)	skin(1)	c.C16T						.						12.0	12.0	12.0					14																	31926584		2183	4278	6461	SO:0001583	missense	112487	exon1			GAATCCGGCTACC	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.16C>T	14.37:g.31926584G>A	ENSP00000312224:p.Arg6Trp	Somatic	11	1		WXS	Illumina HiSeq	Phase_I	11	2	NM_080664	0	0	2	4	2	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758136	0.69763	.	.	ENSG00000203546;ENSG00000129480;ENSG00000129480	ENST00000547378;ENST00000310850;ENST00000356180	T;T;T	0.55052	0.54;0.71;0.71	4.84	2.97	0.34412	D-Tyr tRNAtyr deacylase-like domain (1);	0.302778	0.30901	N	0.008651	T	0.52419	0.1733	M	0.69823	2.125	0.36855	D	0.888115	D	0.67145	0.996	B	0.43623	0.425	T	0.65220	-0.6221	10	0.87932	D	0	.	11.9711	0.53063	0.0:0.0:0.5428:0.4572	rs17097904	6	Q96FN9	DTD2_HUMAN	W	6	ENSP00000447056:R6W;ENSP00000312224:R6W;ENSP00000348503:R6W	ENSP00000312224:R6W	R	-	1	2	C14orf126;RP11-176H8.1	30996335	0.001000	0.12720	0.005000	0.12908	0.004000	0.04260	0.080000	0.14802	0.618000	0.30179	0.561000	0.74099	CGG	.		0.697	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
TRAF7	84231	hgsc.bcm.edu	37	16	2222231	2222231	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr16:2222231T>G	ENST00000326181.6	+	8	647	c.515T>G	c.(514-516)gTg>gGg	p.V172G		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	172					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						ACCGTGGTGGTGAACAACATC	0.662																																					p.V172G		.											.	TRAF7-661	0			c.T515G						.						67.0	61.0	63.0					16																	2222231		2197	4300	6497	SO:0001583	missense	84231	exon8			TGGTGGTGAACAA	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.515T>G	16.37:g.2222231T>G	ENSP00000318944:p.Val172Gly	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	56	3	NM_032271	0	1	25	26	0	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	37	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.682097	0.47991	.	.	ENSG00000131653	ENST00000326181	T	0.54071	0.59	4.38	4.38	0.52667	Zinc finger, RING/FYVE/PHD-type (1);	0.132520	0.50627	D	0.000110	T	0.49270	0.1547	L	0.60455	1.87	0.80722	D	1	P	0.43477	0.808	B	0.39419	0.299	T	0.58222	-0.7674	10	0.87932	D	0	-16.0939	12.9098	0.58173	0.0:0.0:0.0:1.0	.	172	Q6Q0C0	TRAF7_HUMAN	G	172	ENSP00000318944:V172G	ENSP00000318944:V172G	V	+	2	0	TRAF7	2162232	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	6.127000	0.71642	1.837000	0.53436	0.459000	0.35465	GTG	.		0.662	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
CCDC64B	146439	hgsc.bcm.edu	37	16	3081004	3081004	+	Nonsense_Mutation	SNP	G	G	A	rs199875074	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr16:3081004G>A	ENST00000572449.1	-	3	492	c.430C>T	c.(430-432)Cga>Tga	p.R144*	CCDC64B_ENST00000389347.4_Nonsense_Mutation_p.R144*|CCDC64B_ENST00000573514.1_5'UTR|RP11-473M20.5_ENST00000382225.3_RNA			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	144										breast(1)|endometrium(2)|large_intestine(1)	4						GCCCGTTCTCGCCCACTGTCC	0.721													G|||	6	0.00119808	0.0045	0.0	5008	,	,		15044	0.0		0.0	False		,,,				2504	0.0				p.R144X		.											.	.	0			c.C430T						.	G	stop/ARG	10,4056		0,10,2023	11.0	15.0	14.0		430	5.3	0.1	16		14	0,8340		0,0,4170	yes	stop-gained	CCDC64B	NM_001103175.1		0,10,6193	AA,AG,GG		0.0,0.2459,0.0806		144/509	3081004	10,12396	2033	4170	6203	SO:0001587	stop_gained	146439	exon2			GTTCTCGCCCACT	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.430C>T	16.37:g.3081004G>A	ENSP00000459043:p.Arg144*	Somatic	9	2		WXS	Illumina HiSeq	Phase_I	12	8	NM_001103175	0	0	0	0	0	Q658L9	Nonsense_Mutation	SNP	ENST00000572449.1	37	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036215	0.54896	0.002459	0.0	ENSG00000162069	ENST00000389347	.	.	.	5.28	5.28	0.74379	.	0.067706	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.426	11.4983	0.50422	0.0:0.0:0.8205:0.1795	.	.	.	.	X	144	.	ENSP00000373998:R144X	R	-	1	2	CCDC64B	3021005	0.996000	0.38824	0.087000	0.20705	0.341000	0.28922	2.452000	0.44961	2.477000	0.83638	0.561000	0.74099	CGA	.		0.721	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	373	57		WXS	Illumina HiSeq		404	64	NM_145301	0	0	0	14	14	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
ABCC3	8714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48734448	48734448	+	Silent	SNP	C	C	T	rs139452504	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr17:48734448C>T	ENST00000285238.8	+	4	470	c.390C>T	c.(388-390)ggC>ggT	p.G130G	ABCC3_ENST00000427699.1_Silent_p.G130G	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	130					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GGCTGCAGGGCGTACAGTCTT	0.587													C|||	9	0.00179712	0.0008	0.0	5008	,	,		18107	0.0079		0.0	False		,,,				2504	0.0				p.G130G		.											.	ABCC3-93	0			c.C390T						.						122.0	101.0	108.0					17																	48734448		2203	4300	6503	SO:0001819	synonymous_variant	8714	exon4			GCAGGGCGTACAG	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.390C>T	17.37:g.48734448C>T		Somatic	118	1		WXS	Illumina HiSeq	Phase_I	137	27	NM_003786	0	0	8	10	2	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Silent	SNP	ENST00000285238.8	37	CCDS32681.1																																																																																			C|0.998;T|0.002		0.587	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
EPX	8288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56281634	56281634	+	Silent	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr17:56281634G>A	ENST00000225371.5	+	12	2108	c.1998G>A	c.(1996-1998)ctG>ctA	p.L666L		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	666					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	GCAAGGCCCTGAGCAGAATTT	0.502																																					p.L666L		.											.	EPX-92	0			c.G1998A						.						112.0	99.0	103.0					17																	56281634		2203	4300	6503	SO:0001819	synonymous_variant	8288	exon12			GGCCCTGAGCAGA	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1998G>A	17.37:g.56281634G>A		Somatic	123	1		WXS	Illumina HiSeq	Phase_I	113	35	NM_000502	0	0	0	1	1	Q4TVP3	Silent	SNP	ENST00000225371.5	37	CCDS11602.1																																																																																			.		0.502	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502	
CCDC57	284001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80129603	80129603	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr17:80129603C>G	ENST00000389641.4	-	12	1892	c.1856G>C	c.(1855-1857)aGc>aCc	p.S619T	CCDC57_ENST00000327026.3_5'UTR|CCDC57_ENST00000392347.1_Missense_Mutation_p.S619T|CCDC57_ENST00000392343.3_Missense_Mutation_p.S619T			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	619										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GGTGCGGACGCTGGGCTGAGA	0.478																																					p.S619T		.											.	CCDC57-24	0			c.G1856C						.						95.0	99.0	98.0					17																	80129603		1929	4143	6072	SO:0001583	missense	284001	exon12			CGGACGCTGGGCT	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.1856G>C	17.37:g.80129603C>G	ENSP00000374292:p.Ser619Thr	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	90	15	NM_198082	0	0	3	3	0	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37		.	.	.	.	.	.	.	.	.	.	C	10.52	1.371836	0.24857	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000327026;ENST00000392343	T;T;T	0.24538	3.02;3.02;1.85	2.92	-1.57	0.08506	.	2.029070	0.02447	N	0.085210	T	0.23846	0.0577	L	0.57536	1.79	0.09310	N	0.999995	P;P	0.44816	0.844;0.572	B;B	0.41088	0.347;0.122	T	0.19257	-1.0311	10	0.22109	T	0.4	5.4141	3.303	0.06989	0.0:0.3889:0.2116:0.3995	.	619;619	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	T	619;619;127;619	ENSP00000374292:S619T;ENSP00000376158:S619T;ENSP00000376154:S619T	ENSP00000315967:S127T	S	-	2	0	CCDC57	77722892	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.431000	0.06965	-0.298000	0.08921	0.561000	0.74099	AGC	.		0.478	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	5416056	5416056	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr18:5416056T>A	ENST00000341928.2	-	13	2168	c.1828A>T	c.(1828-1830)Aac>Tac	p.N610Y	EPB41L3_ENST00000427684.2_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000342933.3_Missense_Mutation_p.N610Y|EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000542146.1_Intron|EPB41L3_ENST00000542652.2_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	610	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TCAGAAAGGTTGGGGAAAGAG	0.532																																					p.N610Y		.											.	EPB41L3-95	0			c.A1828T						.						157.0	126.0	136.0					18																	5416056		2203	4300	6503	SO:0001583	missense	23136	exon13			AAAGGTTGGGGAA	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1828A>T	18.37:g.5416056T>A	ENSP00000343158:p.Asn610Tyr	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	138	37	NM_012307	0	0	0	0	0	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.558267	0.45590	.	.	ENSG00000082397	ENST00000341928;ENST00000342933	T;T	0.81415	-1.49;-1.49	5.74	4.55	0.56014	.	0.102804	0.64402	D	0.000003	T	0.77377	0.4121	L	0.57536	1.79	0.80722	D	1	P	0.49447	0.924	B	0.41088	0.347	T	0.78593	-0.2144	10	0.72032	D	0.01	.	12.8348	0.57767	0.0:0.0:0.1364:0.8636	.	610	Q9Y2J2	E41L3_HUMAN	Y	610	ENSP00000343158:N610Y;ENSP00000341138:N610Y	ENSP00000343158:N610Y	N	-	1	0	EPB41L3	5406056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.743000	0.62110	0.958000	0.37956	0.460000	0.39030	AAC	.		0.532	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
PRAM1	84106	hgsc.bcm.edu	37	19	8563524	8563524	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr19:8563524C>A	ENST00000423345.4	-	2	1688	c.1168G>T	c.(1168-1170)Gag>Tag	p.E390*	PRAM1_ENST00000255612.3_Nonsense_Mutation_p.E390*			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	438	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						AGTGAGCTCTCGGAAGCGGAG	0.672																																					p.E390X		.											.	.	0			c.G1168T						.						9.0	12.0	11.0					19																	8563524		1967	4100	6067	SO:0001587	stop_gained	84106	exon2			AGCTCTCGGAAGC	BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.1168G>T	19.37:g.8563524C>A	ENSP00000408342:p.Glu390*	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_032152	0	0	5	5	0	Q8N6W7	Nonsense_Mutation	SNP	ENST00000423345.4	37	CCDS45954.2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959595	0.92791	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	.	.	.	4.06	4.06	0.47325	.	0.172051	0.28011	N	0.016953	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.0355	0.47797	0.1863:0.8136:0.0:0.0	.	.	.	.	X	390	.	ENSP00000255612:E390X	E	-	1	0	PRAM1	8469524	0.824000	0.29247	0.826000	0.32828	0.136000	0.21042	1.952000	0.40343	2.205000	0.71048	0.462000	0.41574	GAG	.		0.672	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
TMEM205	374882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11453637	11453637	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr19:11453637G>T	ENST00000354882.5	-	3	850	c.424C>A	c.(424-426)Cag>Aag	p.Q142K	TMEM205_ENST00000586218.1_Missense_Mutation_p.Q81K|TMEM205_ENST00000447337.1_Missense_Mutation_p.Q142K|TMEM205_ENST00000593256.2_Missense_Mutation_p.Q142K|TMEM205_ENST00000586956.1_Missense_Mutation_p.Q142K|TMEM205_ENST00000589555.1_Missense_Mutation_p.Q142K|RAB3D_ENST00000589655.1_Intron|CCDC159_ENST00000588790.1_5'Flank|TMEM205_ENST00000588560.1_Missense_Mutation_p.Q142K|TMEM205_ENST00000586590.1_Missense_Mutation_p.Q142K|TMEM205_ENST00000587948.1_Missense_Mutation_p.Q142K			Q6UW68	TM205_HUMAN	transmembrane protein 205	142						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						TCTCGCAGCTGGCGGTAGGGA	0.627																																					p.Q142K		.											.	TMEM205-22	0			c.C424A						.						94.0	85.0	88.0					19																	11453637		2203	4300	6503	SO:0001583	missense	374882	exon4			GCAGCTGGCGGTA	AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68		ENST00000354882.5:c.424C>A	19.37:g.11453637G>T	ENSP00000346954:p.Gln142Lys	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	149	48	NM_033408	0	0	128	226	98		Missense_Mutation	SNP	ENST00000354882.5	37	CCDS32909.1	.	.	.	.	.	.	.	.	.	.	G	6.199	0.404917	0.11754	.	.	ENSG00000105518	ENST00000354882;ENST00000447337	.	.	.	4.96	3.9	0.45041	.	0.240493	0.34245	U	0.004140	T	0.34250	0.0891	L	0.36672	1.1	0.30403	N	0.779844	B	0.12013	0.005	B	0.09377	0.004	T	0.26224	-1.0109	9	0.06365	T	0.9	-4.5936	14.6711	0.68945	0.0:0.1463:0.8537:0.0	.	142	Q6UW68	TM205_HUMAN	K	142	.	ENSP00000346954:Q142K	Q	-	1	0	TMEM205	11314637	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	3.726000	0.54977	1.193000	0.43086	0.655000	0.94253	CAG	.		0.627	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458743.1	NM_198536	
ANO8	57719	hgsc.bcm.edu	37	19	17439378	17439378	+	Missense_Mutation	SNP	G	G	A	rs73511896	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr19:17439378G>A	ENST00000159087.4	-	13	1977	c.1819C>T	c.(1819-1821)Ctc>Ttc	p.L607F		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	607	Glu-rich.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						CAGTCCAGGAGGCccccttcc	0.731													G|||	51	0.0101837	0.0371	0.0029	5008	,	,		7740	0.0		0.0	False		,,,				2504	0.0				p.L607F		.											.	ANO8-93	0			c.C1819T						.	G	PHE/LEU	87,4125		1,85,2020	9.0	7.0	7.0		1819	4.0	0.9	19	dbSNP_131	7	1,8251		0,1,4125	yes	missense	ANO8	NM_020959.2	22	1,86,6145	AA,AG,GG		0.0121,2.0655,0.706	probably-damaging	607/1233	17439378	88,12376	2106	4126	6232	SO:0001583	missense	57719	exon13			CCAGGAGGCCCCC	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.1819C>T	19.37:g.17439378G>A	ENSP00000159087:p.Leu607Phe	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	9	5	NM_020959	0	0	1	1	0	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	37	CCDS32949.1	17	0.007783882783882784	16	0.032520325203252036	1	0.0027624309392265192	0	0.0	0	0.0	G	13.87	2.365625	0.41902	0.020655	1.21E-4	ENSG00000074855	ENST00000159087	T	0.70282	-0.47	5.06	4.03	0.46877	.	0.080524	0.48286	D	0.000196	T	0.57902	0.2085	M	0.78456	2.415	0.27653	N	0.947327	D	0.56746	0.977	P	0.60012	0.867	T	0.65368	-0.6185	10	0.72032	D	0.01	.	5.7041	0.17899	0.0985:0.0:0.7064:0.1951	.	607	Q9HCE9	ANO8_HUMAN	F	607	ENSP00000159087:L607F	ENSP00000159087:L607F	L	-	1	0	ANO8	17300378	0.998000	0.40836	0.921000	0.36526	0.416000	0.31233	1.549000	0.36212	2.372000	0.80975	0.484000	0.47621	CTC	G|0.992;A|0.008		0.731	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
CACNG8	59283	hgsc.bcm.edu	37	19	54485464	54485464	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr19:54485464C>G	ENST00000270458.2	+	4	742	c.639C>G	c.(637-639)ttC>ttG	p.F213L	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	213					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GGCTGTCGTTCATCCTGGCCG	0.652																																					p.F213L		.											.	CACNG8-90	0			c.C639G						.						58.0	42.0	47.0					19																	54485464		2202	4298	6500	SO:0001583	missense	59283	exon4			GTCGTTCATCCTG	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.639C>G	19.37:g.54485464C>G	ENSP00000270458:p.Phe213Leu	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_031895	0	0	0	0	0	Q9BXT0|Q9BY23	Missense_Mutation	SNP	ENST00000270458.2	37	CCDS33104.1	.	.	.	.	.	.	.	.	.	.	.	20.8	4.055205	0.75960	.	.	ENSG00000142408	ENST00000270458	D	0.89875	-2.58	1.91	1.91	0.25777	.	0.000000	0.64402	U	0.000003	D	0.92548	0.7633	M	0.83483	2.645	0.35646	D	0.811372	D	0.65815	0.995	D	0.80764	0.994	D	0.91889	0.5522	9	0.87932	D	0	-10.5923	4.4689	0.11703	0.0:0.7951:0.0:0.2048	.	213	Q8WXS5	CCG8_HUMAN	L	213	ENSP00000270458:F213L	ENSP00000270458:F213L	F	+	3	2	CACNG8	59177276	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	2.644000	0.46613	1.062000	0.40625	0.289000	0.19496	TTC	.		0.652	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139361.3		
ISOC2	79763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55966664	55966664	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr19:55966664G>A	ENST00000425675.2	-	4	442	c.382C>T	c.(382-384)Cag>Tag	p.Q128*	ISOC2_ENST00000438389.2_Nonsense_Mutation_p.Q58*|ISOC2_ENST00000085068.3_Nonsense_Mutation_p.Q144*			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	128					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		ACATGGACCTGCAGCCCCCGG	0.662																																					p.Q144X		.											.	ISOC2-91	0			c.C430T						.						32.0	34.0	33.0					19																	55966664		2203	4300	6503	SO:0001587	stop_gained	79763	exon4			GGACCTGCAGCCC	AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.382C>T	19.37:g.55966664G>A	ENSP00000401726:p.Gln128*	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	28	5	NM_024710	0	0	31	33	2	Q6ZN91|Q9H5G0	Nonsense_Mutation	SNP	ENST00000425675.2	37	CCDS46195.1	.	.	.	.	.	.	.	.	.	.	G	34	5.324290	0.95708	.	.	ENSG00000063241	ENST00000085068;ENST00000425675;ENST00000438389	.	.	.	3.62	2.44	0.29823	.	0.212717	0.38436	N	0.001695	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-16.1072	10.4505	0.44520	0.0:0.2009:0.7991:0.0	.	.	.	.	X	144;128;58	.	ENSP00000085068:Q144X	Q	-	1	0	ISOC2	60658476	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.156000	0.50708	1.977000	0.57605	0.486000	0.48141	CAG	.		0.662	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453179.1	NM_024710	
DHRS9	10170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	169938176	169938176	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr2:169938176G>A	ENST00000327239.4	+	5	1589	c.85G>A	c.(85-87)Gat>Aat	p.D29N	DHRS9_ENST00000412271.1_Missense_Mutation_p.D29N|DHRS9_ENST00000436483.2_Missense_Mutation_p.D29N|DHRS9_ENST00000602501.1_Missense_Mutation_p.D29N|DHRS9_ENST00000428522.1_Missense_Mutation_p.D29N|DHRS9_ENST00000432060.2_Missense_Mutation_p.D89N|DHRS9_ENST00000421653.1_5'UTR|DHRS9_ENST00000357546.2_Missense_Mutation_p.D29N	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	29					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						AGACATCACTGATAAGTACAT	0.428																																					p.D29N		.											.	DHRS9-90	0			c.G85A						.						118.0	117.0	117.0					2																	169938176		2203	4300	6503	SO:0001583	missense	10170	exon5			ATCACTGATAAGT	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.85G>A	2.37:g.169938176G>A	ENSP00000316670:p.Asp29Asn	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	134	7	NM_005771	0	0	0	0	0	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Missense_Mutation	SNP	ENST00000327239.4	37	CCDS2231.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099956	0.56183	.	.	ENSG00000073737	ENST00000327239;ENST00000357546;ENST00000432060;ENST00000428522;ENST00000450153;ENST00000436483;ENST00000412271	D;D;D;D;T;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;0.73;-2.53;-2.53	5.88	2.98	0.34508	NAD(P)-binding domain (1);	0.501056	0.24625	N	0.036936	T	0.77624	0.4158	N	0.11756	0.17	0.34824	D	0.738968	B;B	0.17268	0.021;0.013	B;B	0.19666	0.026;0.018	T	0.73550	-0.3947	10	0.30854	T	0.27	.	10.261	0.43427	0.228:0.0:0.772:0.0	.	89;29	B7Z416;Q9BPW9	.;DHRS9_HUMAN	N	29;29;89;29;29;29;29	ENSP00000316670:D29N;ENSP00000350154:D29N;ENSP00000389241:D89N;ENSP00000388564:D29N;ENSP00000391214:D29N;ENSP00000407167:D29N;ENSP00000407747:D29N	ENSP00000316670:D29N	D	+	1	0	DHRS9	169646422	0.316000	0.24580	0.753000	0.31225	0.908000	0.53690	0.839000	0.27586	0.752000	0.32923	0.655000	0.94253	GAT	.		0.428	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333612.3	NM_005771	
CDCA7	83879	bcgsc.ca	37	2	174231883	174231883	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr2:174231883G>A	ENST00000347703.3	+	8	1098	c.954G>A	c.(952-954)tgG>tgA	p.W318*	CDCA7_ENST00000410019.3_Nonsense_Mutation_p.W276*|CDCA7_ENST00000306721.3_Nonsense_Mutation_p.W397*|CDCA7_ENST00000410101.3_Nonsense_Mutation_p.W353*|CDCA7_ENST00000392567.2_Nonsense_Mutation_p.W268*	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	318	Mediates transcriptional activity.				apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TTCAGAACTGGCATTGCCCGC	0.463																																					p.W397X													.	CDCA7-91	0			c.G1191A						.						121.0	116.0	118.0					2																	174231883		2203	4300	6503	SO:0001587	stop_gained	83879	exon9			GAACTGGCATTGC	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.954G>A	2.37:g.174231883G>A	ENSP00000272789:p.Trp318*	Somatic	115	1		WXS	Illumina HiSeq	Phase_1	138	6	NM_031942	0	0	0	0	0	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Nonsense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	G	36	5.963895	0.97151	.	.	ENSG00000144354	ENST00000347703;ENST00000392567;ENST00000306721;ENST00000410101;ENST00000410019	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.1383	18.9676	0.92702	0.0:0.0:1.0:0.0	.	.	.	.	X	318;268;397;353;276	.	ENSP00000306968:W397X	W	+	3	0	CDCA7	173940129	1.000000	0.71417	0.999000	0.59377	0.772000	0.43724	9.785000	0.99042	2.473000	0.83533	0.563000	0.77884	TGG	.		0.463	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
PGAP1	80055	hgsc.bcm.edu;broad.mit.edu	37	2	197781305	197781305	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr2:197781305C>A	ENST00000354764.4	-	3	428	c.314G>T	c.(313-315)gGc>gTc	p.G105V	PGAP1_ENST00000485830.1_5'UTR|PGAP1_ENST00000409188.1_Missense_Mutation_p.G63V|PGAP1_ENST00000409475.1_Missense_Mutation_p.G105V	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	105					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						TGCAATGGAGCCAATAGAACG	0.368																																					p.G105V		.											.	PGAP1-93	0			c.G314T						.						69.0	63.0	65.0					2																	197781305		2203	4300	6503	SO:0001583	missense	80055	exon3			ATGGAGCCAATAG		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.314G>T	2.37:g.197781305C>A	ENSP00000346809:p.Gly105Val	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	47	9	NM_024989	0	0	0	0	0	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973928	0.74246	.	.	ENSG00000197121	ENST00000354764;ENST00000409475;ENST00000409188	D;D;D	0.86097	-2.07;-2.07;-2.07	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.92361	0.7576	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.83275	0.844;0.996	D	0.92756	0.6220	10	0.72032	D	0.01	-10.0578	15.4815	0.75530	0.0:0.862:0.138:0.0	.	105;105	Q75T13-3;Q75T13	.;PGAP1_HUMAN	V	105;105;63	ENSP00000346809:G105V;ENSP00000387028:G105V;ENSP00000386802:G63V	ENSP00000346809:G105V	G	-	2	0	PGAP1	197489550	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.646000	0.67916	2.796000	0.96246	0.644000	0.83932	GGC	.		0.368	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	
SPAG16	79582	hgsc.bcm.edu	37	2	214204970	214204970	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr2:214204970A>C	ENST00000331683.5	+	6	715	c.620A>C	c.(619-621)aAc>aCc	p.N207T	SPAG16_ENST00000272898.7_Missense_Mutation_p.N207T|SPAG16_ENST00000414961.2_3'UTR|SPAG16_ENST00000413312.1_Missense_Mutation_p.N176T|SPAG16_ENST00000447990.1_Missense_Mutation_p.N207T|SPAG16_ENST00000374309.3_Missense_Mutation_p.N113T	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	207					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		CAGGAAAAAAACAAATTAATT	0.279																																					p.N207T		.											.	SPAG16-188	0			c.A620C						.						36.0	38.0	37.0					2																	214204970		2203	4296	6499	SO:0001583	missense	79582	exon6			AAAAAAACAAATT	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.620A>C	2.37:g.214204970A>C	ENSP00000332592:p.Asn207Thr	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_024532	0	0	2	2	0	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	A	14.13	2.443855	0.43429	.	.	ENSG00000144451	ENST00000331683;ENST00000413312;ENST00000272898;ENST00000447990;ENST00000374309	T;T	0.58506	0.36;0.33	5.96	3.55	0.40652	.	0.097154	0.64402	N	0.000002	T	0.55433	0.1920	M	0.67700	2.07	0.35052	D	0.760759	B;B;B;B;B	0.28512	0.004;0.214;0.176;0.008;0.004	B;B;B;B;B	0.29077	0.004;0.098;0.046;0.019;0.004	T	0.62909	-0.6754	10	0.62326	D	0.03	.	11.639	0.51222	0.718:0.282:0.0:0.0	.	113;58;176;147;207	B4DYB5;Q8N0X2-2;Q8N0X2-3;Q4G1A2;Q8N0X2	.;.;.;.;SPG16_HUMAN	T	207;176;207;207;113	ENSP00000332592:N207T;ENSP00000363428:N113T	ENSP00000272898:N207T	N	+	2	0	SPAG16	213913215	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.005000	0.49521	0.479000	0.27511	-0.313000	0.08912	AAC	.		0.279	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
DHX35	60625	bcgsc.ca	37	20	37623476	37623476	+	Silent	SNP	C	C	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr20:37623476C>A	ENST00000252011.3	+	8	628	c.595C>A	c.(595-597)Cga>Aga	p.R199R	DHX35_ENST00000373323.4_Silent_p.R168R|DHX35_ENST00000373325.2_Silent_p.R199R	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	199	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TCAGAAAAAGCGAGGGGATCT	0.383																																					p.R199R													.	DHX35-226	0			c.C595A						.						134.0	125.0	128.0					20																	37623476		2203	4300	6503	SO:0001819	synonymous_variant	60625	exon8			AAAAAGCGAGGGG	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.595C>A	20.37:g.37623476C>A		Somatic	144	0		WXS	Illumina HiSeq	Phase_1	170	6	NM_021931	0	0	0	0	0	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	ENST00000252011.3	37	CCDS13310.1																																																																																			.		0.383	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	41306544	41306544	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr20:41306544G>T	ENST00000373187.1	-	7	1114	c.1115C>A	c.(1114-1116)cCg>cAg	p.P372Q	PTPRT_ENST00000373184.1_Missense_Mutation_p.P372Q|PTPRT_ENST00000373198.4_Missense_Mutation_p.P372Q|PTPRT_ENST00000356100.2_Missense_Mutation_p.P372Q|PTPRT_ENST00000373193.3_Missense_Mutation_p.P372Q|PTPRT_ENST00000373201.1_Missense_Mutation_p.P372Q|PTPRT_ENST00000373190.1_Missense_Mutation_p.P372Q			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	372	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGGCCCTGGCGGTCCCGTACC	0.542																																					p.P372Q		.											.	PTPRT-664	0			c.C1115A						.						87.0	87.0	87.0					20																	41306544		1919	4125	6044	SO:0001583	missense	11122	exon7			CCTGGCGGTCCCG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1115C>A	20.37:g.41306544G>T	ENSP00000362283:p.Pro372Gln	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	150	42	NM_007050	0	0	0	0	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737618	0.49045	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43	5.42	5.42	0.78866	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81346	0.4803	L	0.29908	0.895	0.58432	D	0.999991	D;D	0.56746	0.971;0.977	P;P	0.55391	0.775;0.772	T	0.78523	-0.2171	10	0.28530	T	0.3	.	19.1814	0.93625	0.0:0.0:1.0:0.0	.	372;372	O14522-1;O14522	.;PTPRT_HUMAN	Q	372	ENSP00000362286:P372Q;ENSP00000362283:P372Q;ENSP00000362289:P372Q;ENSP00000348408:P372Q;ENSP00000362294:P372Q;ENSP00000362280:P372Q;ENSP00000362297:P372Q	ENSP00000348408:P372Q	P	-	2	0	PTPRT	40739958	1.000000	0.71417	0.973000	0.42090	0.948000	0.59901	5.469000	0.66749	2.705000	0.92388	0.655000	0.94253	CCG	.		0.542	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770156	48770156	+	Missense_Mutation	SNP	A	A	C	rs2026757	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr20:48770156A>C	ENST00000341698.2	-	1	18	c.19T>G	c.(19-21)Tgg>Ggg	p.W7G	TMEM189_ENST00000371652.4_Missense_Mutation_p.W7G|TMEM189_ENST00000371650.5_Missense_Mutation_p.W7G|TMEM189_ENST00000557021.1_Missense_Mutation_p.W7G	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			TGGCCCGGCCAGTTCTCGGCG	0.776													C|||	602	0.120208	0.3903	0.036	5008	,	,		6116	0.0208		0.004	False		,,,				2504	0.0368				p.W7G		.											.	TMEM189-22	0			c.T19G						.	C	GLY/TRP,GLY/TRP,GLY/TRP	475,1843		15,445,699	2.0	2.0	2.0		19,19,19	3.8	0.5	20	dbSNP_94	2	6,4692		0,6,2343	no	missense,missense,missense	TMEM189,TMEM189-UBE2V1	NM_001162505.1,NM_199129.2,NM_199203.2	184,184,184	15,451,3042	CC,CA,AA		0.1277,20.4918,6.8558	benign,benign,benign	7/268,7/271,7/371	48770156	481,6535	1159	2349	3508	SO:0001583	missense	387521	exon1			CCGGCCAGTTCTC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.19T>G	20.37:g.48770156A>C	ENSP00000344166:p.Trp7Gly	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	10	7	NM_199129	0	0	0	0	0		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	211	0.09661172161172162	166	0.33739837398373984	16	0.04419889502762431	22	0.038461538461538464	7	0.009234828496042216	C	0.099	-1.154825	0.01700	0.204918	0.001277	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.48836	0.8;0.8;1.06;1.06	3.81	3.81	0.43845	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.58432	P	9.99999999995449E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37526	-0.9702	8	0.08599	T	0.76	.	8.6645	0.34112	0.2276:0.7724:0.0:0.0	rs2026757;rs57405958	7;7;7	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	G	7	ENSP00000344166:W7G;ENSP00000450635:W7G;ENSP00000360713:W7G;ENSP00000360715:W7G	ENSP00000360713:W7G	W	-	1	0	TMEM189-UBE2V1;TMEM189	48203563	0.998000	0.40836	0.481000	0.27354	0.065000	0.16274	1.462000	0.35266	0.820000	0.34516	-0.407000	0.06327	TGG	A|0.903;C|0.097		0.776	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
MYT1	4661	broad.mit.edu	37	20	62851191	62851191	+	Silent	SNP	C	C	T	rs117853857		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr20:62851191C>T	ENST00000328439.1	+	13	2461	c.2097C>T	c.(2095-2097)gaC>gaT	p.D699D	MYT1_ENST00000360149.4_Silent_p.D401D|MYT1_ENST00000536311.1_Silent_p.D726D	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AGTCTCCCGACGCCTCCCAGC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16055	0.001		0.0	False		,,,				2504	0.0				p.D699D	GBM(59;481 1041 20555 21139 33705)												.	MYT1-704	0			c.C2097T						.						38.0	39.0	39.0					20																	62851191		2203	4299	6502	SO:0001819	synonymous_variant	4661	exon13			TCCCGACGCCTCC	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2097C>T	20.37:g.62851191C>T		Somatic	22	0		WXS	Illumina HiSeq	Phase_I	19	5	NM_004535	0	0	0	0	0	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	ENST00000328439.1	37	CCDS13558.1																																																																																			C|0.999;T|0.001		0.657	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
SLC9C1	285335	hgsc.bcm.edu	37	3	111983130	111983130	+	Silent	SNP	T	T	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr3:111983130T>C	ENST00000305815.5	-	9	1191	c.939A>G	c.(937-939)ctA>ctG	p.L313L	SLC9C1_ENST00000487372.1_Intron	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	313					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										GTGCAGGAATTAGAAGTCCAA	0.244																																					p.L313L		.											.	.	0			c.A939G						.						27.0	29.0	28.0					3																	111983130		2171	4252	6423	SO:0001819	synonymous_variant	285335	exon9			AGGAATTAGAAGT	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.939A>G	3.37:g.111983130T>C		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_183061	0	0	0	0	0	Q6ZRP4|Q7RTP2	Silent	SNP	ENST00000305815.5	37	CCDS33817.1																																																																																			.		0.244	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
CLCN2	1181	hgsc.bcm.edu	37	3	184075764	184075764	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr3:184075764G>A	ENST00000265593.4	-	5	772	c.601C>T	c.(601-603)Ccg>Tcg	p.P201S	CLCN2_ENST00000457512.1_Missense_Mutation_p.P201S|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000434054.2_Missense_Mutation_p.P157S|CLCN2_ENST00000423355.2_5'UTR|CLCN2_ENST00000344937.7_Missense_Mutation_p.P201S	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	201					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TTGCCAAGCGGCATCCCGCTG	0.597																																					p.P201S		.											.	CLCN2-90	0			c.C601T						.						57.0	55.0	56.0					3																	184075764		2203	4300	6503	SO:0001583	missense	1181	exon5			CAAGCGGCATCCC	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.601C>T	3.37:g.184075764G>A	ENSP00000265593:p.Pro201Ser	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	100	5	NM_001171087	0	0	0	0	0	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	g	21.3	4.123267	0.77436	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	4.58	4.58	0.56647	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.92450	0.7603	L	0.31926	0.97	0.80722	D	1	D;D;P;D;D	0.89917	0.999;1.0;0.915;0.976;0.992	D;D;P;P;D	0.97110	0.994;1.0;0.851;0.9;0.932	D	0.93567	0.6900	10	0.87932	D	0	-17.2281	16.3077	0.82855	0.0:0.0:1.0:0.0	.	201;157;201;201;201	B4DYE3;E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;.;CLCN2_HUMAN	S	201;201;157;201	ENSP00000265593:P201S;ENSP00000345056:P201S;ENSP00000400425:P157S;ENSP00000391928:P201S	ENSP00000265593:P201S	P	-	1	0	CLCN2	185558458	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	9.595000	0.98260	2.378000	0.81104	0.561000	0.74099	CCG	.		0.597	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
ITGA2	3673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	52366069	52366069	+	Silent	SNP	C	C	G	rs142557473		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr5:52366069C>G	ENST00000296585.5	+	17	2357	c.2214C>G	c.(2212-2214)ccC>ccG	p.P738P		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	738					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				AGAGTTGCCCCGAGCACATCA	0.398																																					p.P738P		.											.	ITGA2-226	0			c.C2214G						.						72.0	71.0	71.0					5																	52366069		2203	4300	6503	SO:0001819	synonymous_variant	3673	exon17			TTGCCCCGAGCAC		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2214C>G	5.37:g.52366069C>G		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	114	34	NM_002203	0	0	6	11	5	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																			C|1.000;T|0.000		0.398	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797258	128797258	+	Silent	SNP	G	G	C	rs147557427	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr5:128797258G>C	ENST00000274487.4	+	2	682	c.537G>C	c.(535-537)ctG>ctC	p.L179L	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	179	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGTACCTGCTGCTCCGGAGAG	0.741													G|||	42	0.00838658	0.0303	0.0029	5008	,	,		10775	0.0		0.0	False		,,,				2504	0.0				p.L179L		.											.	ADAMTS19-295	0			c.G537C						.	G		59,3989		0,59,1965	4.0	5.0	5.0		537	1.5	1.0	5	dbSNP_134	5	2,8144		0,2,4071	no	coding-synonymous	ADAMTS19	NM_133638.3		0,61,6036	CC,CG,GG		0.0246,1.4575,0.5002		179/1208	128797258	61,12133	2024	4073	6097	SO:0001819	synonymous_variant	171019	exon2			CCTGCTGCTCCGG	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.537G>C	5.37:g.128797258G>C		Somatic	7	1		WXS	Illumina HiSeq	Phase_I	7	4	NM_133638	0	0	0	0	0		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			G|0.993;C|0.007		0.741	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
ANKHD1	54882	hgsc.bcm.edu	37	5	139828840	139828840	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr5:139828840C>G	ENST00000360839.2	+	7	1346	c.1192C>G	c.(1192-1194)Caa>Gaa	p.Q398E	ANKHD1_ENST00000394723.3_Missense_Mutation_p.Q398E|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.Q398E|ANKHD1_ENST00000394722.3_Missense_Mutation_p.Q387E|ANKHD1_ENST00000297183.6_Missense_Mutation_p.Q398E	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	398						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGCAGATCAAGAGCACAA	0.348																																					p.Q398E		.											.	ANKHD1-185	0			c.C1192G						.						88.0	75.0	80.0					5																	139828840		2203	4300	6503	SO:0001583	missense	54882	exon7			GCAGATCAAGAGC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.1192C>G	5.37:g.139828840C>G	ENSP00000354085:p.Gln398Glu	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_024668	0	0	10	10	0	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470542	0.63625	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000394722;ENST00000532219	T;T;T;T;T;T	0.71103	-0.54;-0.54;2.43;2.43;2.43;-0.54	5.97	5.97	0.96955	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.73032	0.3535	N	0.11106	0.095	0.80722	D	1	B;D;D;B;B	0.59357	0.185;0.985;0.985;0.214;0.317	B;D;D;B;B	0.73708	0.205;0.981;0.981;0.089;0.205	T	0.74680	-0.3584	10	0.38643	T	0.18	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	398;398;398;387;398	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	E	398;412;398;398;398;398;387;398	ENSP00000354085:Q398E;ENSP00000297183:Q398E;ENSP00000394489:Q398E;ENSP00000378212:Q398E;ENSP00000378211:Q387E;ENSP00000432016:Q398E	ENSP00000432016:Q398E	Q	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139809024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.833000	0.97629	0.585000	0.79938	CAA	.		0.348	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHAC1	56135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140307713	140307713	+	Silent	SNP	A	A	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr5:140307713A>G	ENST00000253807.2	+	1	1236	c.1236A>G	c.(1234-1236)caA>caG	p.Q412Q	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.Q412Q|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAATACCAAGTCCTGATCA	0.517																																					p.Q412Q		.											.	PCDHAC1-28	0			c.A1236G						.						81.0	79.0	80.0					5																	140307713		2203	4300	6503	SO:0001819	synonymous_variant	56135	exon1			ATACCAAGTCCTG	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1236A>G	5.37:g.140307713A>G		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	99	22	NM_031882	0	0	0	0	0	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	CCDS4241.1																																																																																			.		0.517	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	169446069	169446069	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr5:169446069A>G	ENST00000256935.8	+	33	3418	c.3338A>G	c.(3337-3339)gAc>gGc	p.D1113G	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.D174G|DOCK2_ENST00000520908.1_Missense_Mutation_p.D605G	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1113	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCTTCTTCGACATGATGCTG	0.463																																					p.D1113G		.											.	DOCK2-97	0			c.A3338G						.						180.0	180.0	180.0					5																	169446069		2203	4300	6503	SO:0001583	missense	1794	exon33			TCTTCGACATGAT	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3338A>G	5.37:g.169446069A>G	ENSP00000256935:p.Asp1113Gly	Somatic	350	1		WXS	Illumina HiSeq	Phase_I	308	74	NM_004946	0	0	3	3	0	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.613086	0.87258	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.58060	0.36;0.36;0.36	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.66799	0.2826	M	0.91510	3.215	0.58432	D	0.999998	D;P	0.53151	0.958;0.688	P;B	0.46825	0.528;0.138	T	0.76432	-0.2961	10	0.56958	D	0.05	.	14.3619	0.66779	1.0:0.0:0.0:0.0	.	605;1113	E7ERW7;Q92608	.;DOCK2_HUMAN	G	1113;605;174	ENSP00000256935:D1113G;ENSP00000429283:D605G;ENSP00000438827:D174G	ENSP00000256935:D1113G	D	+	2	0	DOCK2	169378647	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.218000	0.95166	1.795000	0.52594	0.528000	0.53228	GAC	.		0.463	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
HLA-A	3105	hgsc.bcm.edu	37	6	29910594	29910594	+	Missense_Mutation	SNP	G	G	A	rs199474366		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr6:29910594G>A	ENST00000396634.1	+	4	475	c.134G>A	c.(133-135)cGc>cAc	p.R45H	HLA-A_ENST00000376806.5_Missense_Mutation_p.R45H|HLA-A_ENST00000376802.2_Missense_Mutation_p.R45H|HLA-A_ENST00000376809.5_Missense_Mutation_p.R45H			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	45	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.R41fs*31(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GGGGAGCCCCGCTTCATCGCC	0.692									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.R45H		.											.	HLA-A-92	1	Deletion - Frameshift(1)	ovary(1)	c.G134A						.						28.0	25.0	26.0					6																	29910594		2200	4297	6497	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	AGCCCCGCTTCAT	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.134G>A	6.37:g.29910594G>A	ENSP00000379873:p.Arg45His	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	56	5	NM_001242758	1	0	1761	1765	3	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	16.53	3.150382	0.57151	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00011	9.34;9.34;9.34;9.34	3.48	-3.9	0.04181	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.379952	0.15817	U	0.243173	T	0.00109	0.0003	M	0.92604	3.325	0.09310	N	1	D;D;D;D;D	0.64830	0.991;0.989;0.994;0.989;0.994	P;P;P;P;P	0.58820	0.846;0.659;0.846;0.764;0.846	T	0.43360	-0.9396	10	0.52906	T	0.07	.	3.2665	0.06867	0.306:0.0:0.2428:0.4512	.	45;45;45;45;45	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	H	45	ENSP00000379873:R45H;ENSP00000366002:R45H;ENSP00000366005:R45H;ENSP00000365998:R45H	ENSP00000348012:R45H	R	+	2	0	HLA-A	30018573	0.000000	0.05858	0.000000	0.03702	0.293000	0.27360	-2.405000	0.01045	-0.716000	0.04962	0.478000	0.44815	CGC	A|0.001;G|0.999		0.692	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
PKIB	5570	hgsc.bcm.edu	37	6	123022647	123022647	+	Intron	SNP	T	T	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr6:123022647T>C	ENST00000368448.1	+	4	619				PKIB_ENST00000392490.1_Intron|PKIB_ENST00000258014.3_Splice_Site|PKIB_ENST00000368452.2_Intron|PKIB_ENST00000392491.2_Intron			Q9C010	IPKB_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor beta								cAMP-dependent protein kinase inhibitor activity (GO:0004862)			large_intestine(3)|lung(1)	4				GBM - Glioblastoma multiforme(226;0.164)		CACACCAGGGTATAGTTAACA	0.463																																					.		.											.	PKIB-90	0			c.13+2T>C						.						25.0	21.0	22.0					6																	123022647		876	1991	2867	SO:0001627	intron_variant	5570	exon6			CCAGGGTATAGTT		CCDS5126.1, CCDS59033.1	6q21-q22.1	2008-05-27			ENSG00000135549	ENSG00000135549			9018	protein-coding gene	gene with protein product		606914		PRKACN2		10880337	Standard	NM_181795		Approved		uc003pzc.4	Q9C010	OTTHUMG00000015488	ENST00000368448.1:c.-9+278T>C	6.37:g.123022647T>C		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_001270394	0	0	0	0	0	B2RCK2|Q567T9|Q5T0Z7	Splice_Site	SNP	ENST00000368448.1	37	CCDS5126.1	.	.	.	.	.	.	.	.	.	.	T	8.126	0.781931	0.16189	.	.	ENSG00000135549	ENST00000258014	.	.	.	3.37	0.892	0.19230	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.6659	0.05051	0.2265:0.1265:0.0:0.6469	.	.	.	.	.	-1	.	.	.	+	.	.	PKIB	123064346	0.000000	0.05858	0.006000	0.13384	0.105000	0.19272	-0.224000	0.09164	0.189000	0.20188	0.449000	0.29647	.	.		0.463	PKIB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042035.1		
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	47944905	47944905	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr7:47944905T>A	ENST00000289672.2	-	11	1590	c.1540A>T	c.(1540-1542)Aat>Tat	p.N514Y		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	514	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ACAGTTCCATTTGTGTAGACA	0.443																																					p.N514Y		.											.	PKD1L1-145	0			c.A1540T						.						139.0	128.0	132.0					7																	47944905		2203	4300	6503	SO:0001583	missense	168507	exon11			TTCCATTTGTGTA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1540A>T	7.37:g.47944905T>A	ENSP00000289672:p.Asn514Tyr	Somatic	221	0		WXS	Illumina HiSeq	Phase_I	174	37	NM_138295	0	0	0	0	0	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518459	0.64634	.	.	ENSG00000158683	ENST00000289672	T	0.69435	-0.4	5.38	5.38	0.77491	PKD/Chitinase domain (1);	0.178382	0.36519	N	0.002559	T	0.72260	0.3438	L	0.29908	0.895	0.32501	N	0.53884	D	0.89917	1.0	D	0.75484	0.986	T	0.78435	-0.2205	10	0.59425	D	0.04	-24.3676	13.6779	0.62465	0.0:0.0:0.0:1.0	.	514	Q8TDX9	PK1L1_HUMAN	Y	514	ENSP00000289672:N514Y	ENSP00000289672:N514Y	N	-	1	0	PKD1L1	47911430	0.998000	0.40836	0.991000	0.47740	0.970000	0.65996	2.029000	0.41098	2.185000	0.69588	0.529000	0.55759	AAT	.		0.443	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
ZKSCAN5	23660	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99129235	99129235	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr7:99129235G>A	ENST00000394170.2	+	7	2134	c.1883G>A	c.(1882-1884)aGt>aAt	p.S628N	ZKSCAN5_ENST00000326775.5_Missense_Mutation_p.S628N|ZKSCAN5_ENST00000451158.1_Missense_Mutation_p.S628N	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	628					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AGCGTGCACAGTGGGGAGAGA	0.557																																					p.S628N		.											.	ZKSCAN5-91	0			c.G1883A						.						80.0	70.0	74.0					7																	99129235		2203	4300	6503	SO:0001583	missense	23660	exon7			TGCACAGTGGGGA	AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.1883G>A	7.37:g.99129235G>A	ENSP00000377725:p.Ser628Asn	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	85	5	NM_145102	0	0	10	10	0	A4D280|D6W5S9	Missense_Mutation	SNP	ENST00000394170.2	37	CCDS5667.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852959	0.71719	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170	T;T;T	0.19394	2.15;2.15;2.15	5.23	4.29	0.51040	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.091827	0.48767	D	0.000175	T	0.29389	0.0732	L	0.46885	1.475	0.35690	D	0.814761	P;P	0.49185	0.92;0.92	P;P	0.53313	0.598;0.723	T	0.14090	-1.0485	10	0.52906	T	0.07	.	11.8173	0.52218	0.0:0.2653:0.7347:0.0	.	628;628	Q8N718;Q9Y2L8	.;ZKSC5_HUMAN	N	628	ENSP00000322872:S628N;ENSP00000392104:S628N;ENSP00000377725:S628N	ENSP00000322872:S628N	S	+	2	0	ZKSCAN5	98967171	0.999000	0.42202	0.986000	0.45419	0.987000	0.75469	3.694000	0.54742	2.894000	0.99253	0.591000	0.81541	AGT	.		0.557	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
VGF	7425	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	100806695	100806695	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr7:100806695T>A	ENST00000249330.2	-	2	1669	c.1430A>T	c.(1429-1431)gAg>gTg	p.E477V	VGF_ENST00000445482.2_Missense_Mutation_p.E477V	NM_003378.3	NP_003369.2	O15240	VGF_HUMAN	VGF nerve growth factor inducible	477					defense response to bacterium (GO:0042742)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|ovarian follicle development (GO:0001541)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)|response to insulin (GO:0032868)|sexual reproduction (GO:0019953)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				cervix(1)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	9	Lung NSC(181;0.168)|all_lung(186;0.215)					CCGCTTCTCCTCCACCTCCTC	0.697																																					p.E477V		.											.	VGF-90	0			c.A1430T						.						58.0	61.0	60.0					7																	100806695		2203	4300	6503	SO:0001583	missense	7425	exon2			TTCTCCTCCACCT	Y12661	CCDS5712.1	7q22	2008-07-18			ENSG00000128564	ENSG00000128564			12684	protein-coding gene	gene with protein product	"""neuro-endocrine specific protein VGF"""	602186				9344675	Standard	NM_003378		Approved		uc003uxx.4	O15240	OTTHUMG00000157109	ENST00000249330.2:c.1430A>T	7.37:g.100806695T>A	ENSP00000249330:p.Glu477Val	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	56	15	NM_003378	0	0	0	0	0	Q9UDW8	Missense_Mutation	SNP	ENST00000249330.2	37	CCDS5712.1	.	.	.	.	.	.	.	.	.	.	T	17.42	3.386102	0.61956	.	.	ENSG00000128564	ENST00000249330;ENST00000445482	.	.	.	4.41	4.41	0.53225	.	0.000000	0.48286	U	0.000186	T	0.56307	0.1976	N	0.24115	0.695	0.40841	D	0.983675	D	0.76494	0.999	D	0.80764	0.994	T	0.61720	-0.7005	9	0.87932	D	0	-7.6164	10.0532	0.42228	0.0:0.0:0.0:1.0	.	477	O15240	VGF_HUMAN	V	477	.	ENSP00000249330:E477V	E	-	2	0	VGF	100593415	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.280000	0.51677	1.650000	0.50662	0.449000	0.29647	GAG	.		0.697	VGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347462.1	NM_003378	
TBXAS1	6916	hgsc.bcm.edu;bcgsc.ca	37	7	139719838	139719838	+	Nonstop_Mutation	SNP	T	T	C			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr7:139719838T>C	ENST00000411653.1	+	12	1505	c.1378T>C	c.(1378-1380)Tag>Cag	p.*460Q	TBXAS1_ENST00000436047.2_Missense_Mutation_p.L515P|TBXAS1_ENST00000448866.1_Missense_Mutation_p.L514P|TBXAS1_ENST00000425687.1_Missense_Mutation_p.L447P|TBXAS1_ENST00000263552.6_Missense_Mutation_p.L515P|TBXAS1_ENST00000414508.2_Nonstop_Mutation_p.*461Q|TBXAS1_ENST00000458722.1_Missense_Mutation_p.L560P|TBXAS1_ENST00000416849.2_Missense_Mutation_p.L561P|TBXAS1_ENST00000336425.5_Missense_Mutation_p.L514P			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	0					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	CCGCTGCAGCTAGAATCCAAA	0.453																																					p.X461Q		.											.	TBXAS1-155	0			c.T1381C						.						86.0	87.0	86.0					7																	139719838		2203	4300	6503	SO:0001578	stop_lost	6916	exon12			TGCAGCTAGAATC	L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000411653.1:c.1378T>C	7.37:g.139719838T>C	ENSP00000411326:p.*460Glnext*6	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	79	4	NM_030984	0	0	16	16	0	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	ENST00000411653.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.44|16.44	3.125072|3.125072	0.56721|0.56721	.|.	.|.	ENSG00000059377|ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000448866;ENST00000458722|ENST00000414508;ENST00000411653	T;T;T;T;T;T;T|.	0.68331|.	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|.	0.70657|.	0.3249|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;1.0;1.0;0.996;0.996|.	T|.	0.69914|.	-0.5016|.	9|.	0.87932|.	D|.	0|.	.|.	14.324|14.324	0.66507|0.66507	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	495;561;447;515;514|.	B4DVP1;E7EP08;E7ESB5;Q53F23;P24557|.	.;.;.;.;THAS_HUMAN|.	P|Q	447;515;514;561;515;514;560|461;460	ENSP00000388736:L447P;ENSP00000263552:L515P;ENSP00000338087:L514P;ENSP00000389414:L561P;ENSP00000392361:L515P;ENSP00000402536:L514P;ENSP00000411274:L560P|.	ENSP00000263552:L515P|.	L|X	+|+	2|1	0|0	TBXAS1|TBXAS1	139366307|139366307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.872000|0.872000	0.50106|0.50106	5.929000|5.929000	0.70096|0.70096	2.187000|2.187000	0.69744|0.69744	0.459000|0.459000	0.35465|0.35465	CTA|TAG	.		0.453	TBXAS1-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348377.1		
CPA6	57094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	68397000	68397000	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr8:68397000G>A	ENST00000297770.4	-	7	876	c.661C>T	c.(661-663)Cca>Tca	p.P221S	CPA6_ENST00000297769.4_Missense_Mutation_p.P73S|CPA6_ENST00000518549.1_Missense_Mutation_p.P221S	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	221						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			CTCATGGCTGGGTCACTCTTA	0.353																																					p.P221S		.											.	CPA6-92	0			c.C661T						.						92.0	81.0	84.0					8																	68397000		2203	4300	6503	SO:0001583	missense	57094	exon7			TGGCTGGGTCACT	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.661C>T	8.37:g.68397000G>A	ENSP00000297770:p.Pro221Ser	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	85	21	NM_020361	0	0	0	0	0	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689277	0.29962	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.10860	2.83;2.83;2.83	5.25	4.36	0.52297	Peptidase M14, carboxypeptidase A (2);	0.112178	0.64402	D	0.000006	T	0.08980	0.0222	L	0.28115	0.83	0.44587	D	0.997554	P;P;B	0.48230	0.907;0.537;0.003	B;B;B	0.41691	0.364;0.203;0.013	T	0.26573	-1.0099	10	0.32370	T	0.25	.	13.3643	0.60674	0.0:0.1588:0.8412:0.0	.	221;73;221	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	S	73;221;221	ENSP00000297769:P73S;ENSP00000297770:P221S;ENSP00000431112:P221S	ENSP00000297769:P73S	P	-	1	0	CPA6	68559554	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.498000	0.66931	1.306000	0.44926	0.643000	0.83706	CCA	.		0.353	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
MROH1	727957	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	145267981	145267981	+	Intron	SNP	C	C	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr8:145267981C>T	ENST00000528919.1	+	12	1262				MROH1_ENST00000398656.4_Intron|MROH1_ENST00000423230.2_Missense_Mutation_p.P409L|MROH1_ENST00000326134.5_Intron|MROH1_ENST00000534366.1_Intron|MROH1_ENST00000527071.1_Intron	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1																		CGTGCTGCTCCGCAGCCTGCT	0.557																																					p.P409L		.											.	.	0			c.C1226T						.						93.0	104.0	100.0					8																	145267981		2144	4245	6389	SO:0001627	intron_variant	727957	exon13			CTGCTCCGCAGCC		CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.1142-7522C>T	8.37:g.145267981C>T		Somatic	134	0		WXS	Illumina HiSeq	Phase_I	118	21	NM_001099280	0	0	1	1	0	C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Missense_Mutation	SNP	ENST00000528919.1	37	CCDS47938.1	.	.	.	.	.	.	.	.	.	.	C	2.586	-0.296322	0.05532	.	.	ENSG00000179832	ENST00000423230	T	0.15718	2.4	0.818	-1.64	0.08318	.	.	.	.	.	T	0.06371	0.0164	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40627	-0.9553	8	0.13470	T	0.59	.	1.5793	0.02631	0.3347:0.385:0.0:0.2803	.	409	Q8NDA8-4	.	L	409	ENSP00000388174:P409L	ENSP00000388174:P409L	P	+	2	0	HEATR7A	145339969	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.583000	0.23849	-0.788000	0.04504	0.460000	0.39030	CCG	.		0.557	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1	NM_032450	
WNK2	65268	hgsc.bcm.edu	37	9	96055159	96055159	+	Silent	SNP	C	C	T	rs56125631	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr9:96055159C>T	ENST00000297954.4	+	23	5523	c.5523C>T	c.(5521-5523)ccC>ccT	p.P1841P	WNK2_ENST00000349097.3_Silent_p.P1453P|WNK2_ENST00000356055.3_Silent_p.P168P|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000395477.2_Silent_p.P1804P|WNK2_ENST00000427277.2_Silent_p.P1416P	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1841					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TGGGCGAGCCCGTGTCCAGCG	0.726													C|||	34	0.00678914	0.0234	0.0043	5008	,	,		12809	0.0		0.0	False		,,,				2504	0.0				p.P1804P		.											.	WNK2-765	0			c.C5412T						.	C		78,4248		0,78,2085	7.0	8.0	8.0		5412	-10.5	0.0	9	dbSNP_129	8	0,8488		0,0,4244	no	coding-synonymous	WNK2	NM_006648.3		0,78,6329	TT,TC,CC		0.0,1.8031,0.6087		1804/2218	96055159	78,12736	2163	4244	6407	SO:0001819	synonymous_variant	65268	exon22			CGAGCCCGTGTCC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.5523C>T	9.37:g.96055159C>T		Somatic	10	1		WXS	Illumina HiSeq	Phase_I	5	3	NM_006648	0	0	0	0	0	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.180|2.180	-0.387838|-0.387838	0.04932|0.04932	0.018031|0.018031	0.0|0.0	ENSG00000165238|ENSG00000165238	ENST00000432730;ENST00000448251;ENST00000453718|ENST00000411624	T;T;D|.	0.83075|.	-0.42;-0.66;-1.68|.	5.24|5.24	-10.5|-10.5	0.00291|0.00291	.|.	0.486738|.	0.22537|.	N|.	0.058779|.	T|T	0.20210|0.20210	0.0486|0.0486	.|.	.|.	.|.	0.26704|0.26704	N|N	0.971117|0.971117	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39313|0.39313	-0.9620|-0.9620	7|4	0.48119|.	T|.	0.1|.	.|.	13.7224|13.7224	0.62735|0.62735	0.0:0.1023:0.3462:0.5515|0.0:0.1023:0.3462:0.5515	rs56125631;rs61743448|rs56125631;rs61743448	.|.	.|.	.|.	L|C	1800;601;326|1408	ENSP00000415038:P1800L;ENSP00000390441:P601L;ENSP00000413325:P326L|.	ENSP00000415038:P1800L|.	P|R	+|+	2|1	0|0	WNK2|WNK2	95094980|95094980	0.000000|0.000000	0.05858|0.05858	0.007000|0.007000	0.13788|0.13788	0.299000|0.299000	0.27559|0.27559	-0.879000|-0.879000	0.04188|0.04188	-2.637000|-2.637000	0.00431|0.00431	-0.997000|-0.997000	0.02515|0.02515	CCG|CGT	C|0.986;T|0.014		0.726	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
Unknown	0	ucsc.edu	37	X	71379997	71379997	+	IGR	SNP	C	C	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:71379997C>G								BX119917.1 (7733 upstream) : PIN4 (21528 downstream)																							CAATCAAAGGCAAACTGGAAG	0.378																																					p.G106G													.	FLJ44635-108	0			c.C318G						.						81.0	72.0	75.0					X																	71379997		2202	4300	6502	SO:0001628	intergenic_variant	0	exon2			CAAAGGCAAACTG																													X.37:g.71379997C>G		Somatic	122	0		WXS	Illumina HiSeq		117	1	NM_207422	0	0	0	4	4		Silent	SNP		37																																																																																				.	0	0.378								
RGAG1	57529	bcgsc.ca	37	X	109695057	109695057	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:109695057A>T	ENST00000465301.2	+	3	1458	c.1212A>T	c.(1210-1212)agA>agT	p.R404S	RGAG1_ENST00000540313.1_Missense_Mutation_p.R404S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	404										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CACCAGTAAGAGCTTTAGATT	0.498																																					p.R404S													.	RGAG1-132	0			c.A1212T						.						195.0	202.0	200.0					X																	109695057		2203	4300	6503	SO:0001583	missense	57529	exon3			AGTAAGAGCTTTA	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1212A>T	X.37:g.109695057A>T	ENSP00000419786:p.Arg404Ser	Somatic	579	0		WXS	Illumina HiSeq	Phase_1	647	180	NM_020769	0	0	0	0	0	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954058	0.34471	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.49720	0.77;0.77	4.06	4.06	0.47325	.	0.000000	0.37809	N	0.001935	T	0.39332	0.1074	L	0.46741	1.465	0.09310	N	1	P	0.42296	0.775	B	0.39660	0.306	T	0.29579	-1.0007	9	.	.	.	-7.0542	10.3612	0.43994	1.0:0.0:0.0:0.0	.	404	Q8NET4	RGAG1_HUMAN	S	404	ENSP00000419786:R404S;ENSP00000441452:R404S	.	R	+	3	2	RGAG1	109581713	0.999000	0.42202	0.018000	0.16275	0.101000	0.19017	4.796000	0.62496	1.807000	0.52817	0.486000	0.48141	AGA	.		0.498	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
MBNL3	55796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	131540269	131540269	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:131540269T>A	ENST00000370853.3	-	2	407	c.329A>T	c.(328-330)cAa>cTa	p.Q110L	MBNL3_ENST00000394311.2_Missense_Mutation_p.Q14L|RAP2C-AS1_ENST00000441399.2_RNA|MBNL3_ENST00000370857.3_Missense_Mutation_p.Q110L|MBNL3_ENST00000370839.3_Missense_Mutation_p.Q110L|MBNL3_ENST00000370849.3_Missense_Mutation_p.Q60L|RAP2C-AS1_ENST00000421483.2_RNA|MBNL3_ENST00000473364.1_5'UTR|MBNL3_ENST00000370844.1_Missense_Mutation_p.Q14L|MBNL3_ENST00000538204.1_Missense_Mutation_p.Q60L	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	110					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					TGATGACATTTGAGCGTTTTG	0.453																																					p.Q110L		.											.	MBNL3-130	0			c.A329T						.						144.0	116.0	125.0					X																	131540269		2203	4300	6503	SO:0001583	missense	55796	exon2			GACATTTGAGCGT	AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.329A>T	X.37:g.131540269T>A	ENSP00000359890:p.Gln110Leu	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	183	62	NM_018388	0	0	0	0	0	Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Missense_Mutation	SNP	ENST00000370853.3	37	CCDS14633.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534641	0.27475	.	.	ENSG00000076770	ENST00000394311;ENST00000538204;ENST00000370857;ENST00000370853;ENST00000370849;ENST00000370839;ENST00000370844;ENST00000436215;ENST00000421707	T;T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.57	5.57	0.84162	.	0.086244	0.49916	D	0.000138	T	0.46328	0.1387	M	0.66939	2.045	0.49483	D	0.999793	B;B;B;P;P	0.35272	0.404;0.246;0.246;0.454;0.493	B;B;B;B;B	0.42771	0.287;0.346;0.286;0.397;0.157	T	0.38373	-0.9664	10	0.07644	T	0.81	-4.1668	14.7499	0.69516	0.0:0.0:0.0:1.0	.	60;110;110;60;14	Q9NUK0-4;Q9NUK0;Q9NUK0-2;Q9NUK0-3;Q8IUR4	.;MBNL3_HUMAN;.;.;.	L	14;60;110;110;60;110;14;14;14	ENSP00000377848:Q14L;ENSP00000439618:Q60L;ENSP00000359894:Q110L;ENSP00000359890:Q110L;ENSP00000359886:Q60L;ENSP00000359876:Q110L;ENSP00000359881:Q14L;ENSP00000406014:Q14L;ENSP00000402128:Q14L	ENSP00000359876:Q110L	Q	-	2	0	MBNL3	131367950	1.000000	0.71417	0.905000	0.35620	0.731000	0.41821	4.662000	0.61525	1.864000	0.54056	0.486000	0.48141	CAA	.		0.453	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058319.1	NM_018388	
CDR1	1038	hgsc.bcm.edu	37	X	139866440	139866440	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:139866440A>G	ENST00000370532.2	-	1	283	c.92T>C	c.(91-93)gTa>gCa	p.V31A		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	31	23 X 6 AA approximate repeats.									breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CAACAAAGGTACGTCTTCCAA	0.448																																					p.V31A		.											.	CDR1-130	0			c.T92C						.						171.0	162.0	165.0					X																	139866440		2203	4300	6503	SO:0001583	missense	1038	exon1			AAAGGTACGTCTT		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.92T>C	X.37:g.139866440A>G	ENSP00000359563:p.Val31Ala	Somatic	145	2		WXS	Illumina HiSeq	Phase_I	299	16	NM_004065	0	0	0	0	0	Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	A	2.772	-0.255469	0.05829	.	.	ENSG00000184258	ENST00000370532	T	0.35048	1.33	1.84	-0.941	0.10402	.	.	.	.	.	T	0.15912	0.0383	N	0.19112	0.55	0.09310	N	1	P	0.35481	0.504	B	0.29598	0.104	T	0.14420	-1.0473	8	.	.	.	.	2.5052	0.04643	0.6001:0.0:0.1643:0.2356	.	31	P51861	CDR1_HUMAN	A	31	ENSP00000359563:V31A	.	V	-	2	0	CDR1	139694106	0.000000	0.05858	0.011000	0.14972	0.002000	0.02628	-0.414000	0.07114	-0.339000	0.08401	-1.671000	0.00744	GTA	.		0.448	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065	
SLC6A8	6535	broad.mit.edu	37	X	152960547	152960547	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:152960547C>T	ENST00000253122.5	+	13	2262	c.1786C>T	c.(1786-1788)Cag>Tag	p.Q596*	SLC6A8_ENST00000430077.2_Nonsense_Mutation_p.Q481*|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	596					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GCACCTGACCCAGCCCATCTG	0.652																																					p.Q596X													.	SLC6A8-131	0			c.C1786T						.						23.0	20.0	21.0					X																	152960547		2200	4296	6496	SO:0001587	stop_gained	6535	exon13			CTGACCCAGCCCA		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1786C>T	X.37:g.152960547C>T	ENSP00000253122:p.Gln596*	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	23	3	NM_005629	0	0	77	77	0	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Nonsense_Mutation	SNP	ENST00000253122.5	37	CCDS14726.1	.	.	.	.	.	.	.	.	.	.	c	38	6.723814	0.97792	.	.	ENSG00000130821	ENST00000253122;ENST00000430077;ENST00000328897	.	.	.	5.18	5.18	0.71444	.	0.415204	0.20801	U	0.085434	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	11.7212	0.51683	0.1766:0.8234:0.0:0.0	.	.	.	.	X	596;481;690	.	ENSP00000253122:Q596X	Q	+	1	0	SLC6A8	152613741	0.998000	0.40836	1.000000	0.80357	0.951000	0.60555	1.925000	0.40074	2.152000	0.67230	0.525000	0.51046	CAG	.		0.652	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1		
ATP6AP1	537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153657422	153657422	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:153657422C>A	ENST00000369762.2	+	2	251	c.190C>A	c.(190-192)Cat>Aat	p.H64N		NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	64					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCCGACACTCATGAAGGCCA	0.617																																					p.H64N		.											.	ATP6AP1-138	0			c.C190A						.						87.0	75.0	79.0					X																	153657422		2203	4300	6503	SO:0001583	missense	537	exon2			GACACTCATGAAG	D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.190C>A	X.37:g.153657422C>A	ENSP00000358777:p.His64Asn	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	130	33	NM_001183	0	0	59	59	0	A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	ENST00000369762.2	37	CCDS35451.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756732	0.49362	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000449556	.	.	.	4.74	4.74	0.60224	.	0.240499	0.42420	D	0.000718	T	0.49133	0.1539	M	0.70275	2.135	0.09310	N	0.999994	B;B	0.30439	0.279;0.178	B;B	0.35813	0.18;0.211	T	0.43491	-0.9388	9	0.28530	T	0.3	-20.593	12.2641	0.54668	0.0:1.0:0.0:0.0	.	24;64	B3KR70;Q15904	.;VAS1_HUMAN	N	64	.	ENSP00000358777:H64N	H	+	1	0	ATP6AP1	153310616	0.775000	0.28604	0.966000	0.40874	0.457000	0.32468	1.869000	0.39519	1.939000	0.56221	0.529000	0.55759	CAT	.		0.617	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183	
GPRIN2	9721	hgsc.bcm.edu	37	10	46999189	46999190	+	Frame_Shift_Del	DEL	CA	CA	-	rs71185249|rs3127678|rs3127679	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr10:46999189_46999190delCA	ENST00000374317.1	+	3	582_583	c.309_310delCA	c.(307-312)ggcagtfs	p.S104fs	GPRIN2_ENST00000374314.4_Frame_Shift_Del_p.S104fs	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	104			S -> G (in dbSNP:rs3127679). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9628581}.							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CCATGGGCGGCAGTGACCTGTG	0.653																																					p.103_104del		.											.	GPRIN2-90	0			c.309_310del						.																																			SO:0001589	frameshift_variant	9721	exon3			.	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.309_310delCA	10.37:g.46999189_46999190delCA	ENSP00000363436:p.Ser104fs	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	68	11	NM_014696	0	0	0	0	0	Q5SVF0	Frame_Shift_Del	DEL	ENST00000374317.1	37	CCDS31192.1																																																																																			.		0.653	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
TUBGCP5	114791	broad.mit.edu;bcgsc.ca	37	15	22872435	22872444	+	Frame_Shift_Del	DEL	AAACTGCCAT	AAACTGCCAT	-	rs201453400		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	AAACTGCCAT	AAACTGCCAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr15:22872435_22872444delAAACTGCCAT	ENST00000283645.4	+	22	3094_3103	c.2964_2973delAAACTGCCAT	c.(2962-2973)aaaaactgccatfs	p.KNCH988fs	TUBGCP5_ENST00000453949.2_Frame_Shift_Del_p.KNCH988fs	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	988					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		CTGATTTTAAAAACTGCCATATGTTTCTTG	0.324																																					p.988_991del													.	TUBGCP5-91	0			c.2964_2973del						.																																			SO:0001589	frameshift_variant	114791	exon22			TTTTAAAAACTGC	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.2964_2973delAAACTGCCAT	15.37:g.22872435_22872444delAAACTGCCAT	ENSP00000283645:p.Lys988fs	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	114	8	NM_052903	0	0	0	0	0	E9PB12|Q6IQ52|Q96PY8	Frame_Shift_Del	DEL	ENST00000283645.4	37	CCDS10008.1																																																																																			.		0.324	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2	NM_052903	
SPAG9	9043	broad.mit.edu	37	17	49063070	49063071	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr17:49063070_49063071delAA	ENST00000262013.7	-	23	3216_3217	c.3008_3009delTT	c.(3007-3009)attfs	p.I1003fs	SPAG9_ENST00000510283.1_Frame_Shift_Del_p.I846fs|SPAG9_ENST00000357122.4_Frame_Shift_Del_p.I989fs|SPAG9_ENST00000505279.1_Frame_Shift_Del_p.I993fs	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	1003					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CAATACTGAGAATCGAATCTTT	0.322																																					p.1003_1003del													.	SPAG9-659	0			c.3008_3009del						.																																			SO:0001589	frameshift_variant	9043	exon23			ACTGAGAATCGAA	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.3008_3009delTT	17.37:g.49063070_49063071delAA	ENSP00000262013:p.Ile1003fs	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	36	8	NM_001130528	0	0	0	0	0	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Frame_Shift_Del	DEL	ENST00000262013.7	37	CCDS45740.1																																																																																			.		0.322	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971	
EIF4G1	1981	broad.mit.edu	37	3	184039744	184039746	+	In_Frame_Del	DEL	GAA	GAA	-	rs530167757	byFrequency	TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr3:184039744_184039746delGAA	ENST00000346169.2	+	10	1643_1645	c.1372_1374delGAA	c.(1372-1374)gaadel	p.E465del	EIF4G1_ENST00000352767.3_In_Frame_Del_p.E472del|EIF4G1_ENST00000414031.1_In_Frame_Del_p.E425del|EIF4G1_ENST00000435046.2_In_Frame_Del_p.E269del|EIF4G1_ENST00000319274.6_In_Frame_Del_p.E465del|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000441154.1_In_Frame_Del_p.E301del|EIF4G1_ENST00000382330.3_In_Frame_Del_p.E472del|EIF4G1_ENST00000342981.4_In_Frame_Del_p.E465del|EIF4G1_ENST00000434061.2_In_Frame_Del_p.E269del|EIF4G1_ENST00000350481.5_In_Frame_Del_p.E301del|EIF4G1_ENST00000424196.1_In_Frame_Del_p.E472del|EIF4G1_ENST00000392537.2_In_Frame_Del_p.E378del|EIF4G1_ENST00000411531.1_In_Frame_Del_p.E425del|EIF4G1_ENST00000427845.1_In_Frame_Del_p.E378del	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	465	Poly-Glu.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGAGGAAATGgaagaagaagaag	0.562																																					p.465_465del													.	EIF4G1-344	0			c.1393_1395del						.																																			SO:0001651	inframe_deletion	1981	exon11			GAAATGGAAGAAG	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1372_1374delGAA	3.37:g.184039753_184039755delGAA	ENSP00000316879:p.Glu465del	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	150	9	NM_001194946	0	0	0	0	0	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	In_Frame_Del	DEL	ENST00000346169.2	37	CCDS3259.1																																																																																			.		0.562	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	57888371	57888373	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr4:57888371_57888373delAAG	ENST00000381227.1	+	19	2887_2889	c.2474_2476delAAG	c.(2473-2478)caagaa>caa	p.E827del	POLR2B_ENST00000441246.2_In_Frame_Del_p.E820del|POLR2B_ENST00000431623.2_In_Frame_Del_p.E752del|POLR2B_ENST00000314595.5_In_Frame_Del_p.E827del			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	827					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					GGATTTGATCAAGAAGAAGTTTT	0.34																																					p.825_826del		.											.	POLR2B-92	0			c.2474_2476del						.																																			SO:0001651	inframe_deletion	5431	exon18			.		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2474_2476delAAG	4.37:g.57888377_57888379delAAG	ENSP00000370625:p.Glu827del	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	81	13	NM_000938	0	0	0	0	0	A8K1A8|Q8IZ61	In_Frame_Del	DEL	ENST00000381227.1	37	CCDS3511.1																																																																																			.		0.340	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	79034426	79034426	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr5:79034426delG	ENST00000446378.2	+	2	9869	c.9838delG	c.(9838-9840)gggfs	p.G3280fs		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3280					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGCTGCAGAAGGGGAAATTTG	0.453																																					p.G3280fs		.											.	CMYA5-77	0			c.9838delG						.						104.0	100.0	101.0					5																	79034426		1865	4114	5979	SO:0001589	frameshift_variant	202333	exon2			.	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9838delG	5.37:g.79034426delG	ENSP00000394770:p.Gly3280fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	144	25	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Frame_Shift_Del	DEL	ENST00000446378.2	37	CCDS47238.1																																																																																			.		0.453	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	109695056	109695056	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:109695056delG	ENST00000465301.2	+	3	1457	c.1211delG	c.(1210-1212)agafs	p.R404fs	RGAG1_ENST00000540313.1_Frame_Shift_Del_p.R404fs	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	404										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CCACCAGTAAGAGCTTTAGAT	0.502																																					p.R404fs		.											.	RGAG1-132	0			c.1211delG						.						195.0	202.0	200.0					X																	109695056		2203	4300	6503	SO:0001589	frameshift_variant	57529	exon3			.	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1211delG	X.37:g.109695056delG	ENSP00000419786:p.Arg404fs	Somatic	585	0		WXS	Illumina HiSeq	Phase_I	661	185	NM_020769	0	0	0	0	0	Q9P2M8	Frame_Shift_Del	DEL	ENST00000465301.2	37	CCDS14552.1																																																																																			.		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21224920	21224921	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chr2:21224920_21224921insG	ENST00000233242.1	-	29	13500_13501	c.13373_13374insC	c.(13372-13374)ccafs	p.P4458fs	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4458					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTTCCATCTGGATCGGTAAG	0.396																																					p.P4458fs		.											.	APOB-175	0			c.13374_13375insC						.																																			SO:0001589	frameshift_variant	338	exon29			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13374dupC	2.37:g.21224922_21224922dupG	ENSP00000233242:p.Pro4458fs	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	117	33	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.396	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382372	24382373	+	IGR	DNP	AT	AT	GC	rs371342199|rs35206911|rs2695489|rs201827126		TCGA-A4-7828-01A-11D-2136-08	TCGA-A4-7828-10A-01D-2136-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	89b510b4-b46f-44f1-b973-0e7b01c3afd1	df0c98a4-c394-4d62-ac84-e6893a743883	g.chrX:24382372_24382373AT>GC								AC004552.1 (15349 upstream) : PDK3 (100964 downstream)																							tgctgctgctattgctgctgct	0.574																																					.		.											.	.	0			c.T1496C						.																																			SO:0001628	intergenic_variant	100130302	exon1			CTGCTATTGCTGC																													X.37:g.24382372_24382373delinsGC		Somatic	10.0	1.0		WXS	Illumina HiSeq	Phase_I	6.0	2.0		0	0	0	0	0		Missense_Mutation	DNP		37																																																																																				.	0	0.574								
