#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27107195	27107195	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:27107195C>A	ENST00000324856.7	+	20	7177	c.6806C>A	c.(6805-6807)tCa>tAa	p.S2269*	ARID1A_ENST00000540690.1_Nonsense_Mutation_p.S597*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.S1886*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.S2052*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2269					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.S2269*(1)|p.S2269L(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTGATGAACTCATTGGTTTCA	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S2269X		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	2	Substitution - Missense(1)|Substitution - Nonsense(1)	urinary_tract(1)|endometrium(1)	c.C6806A						.						126.0	99.0	109.0					1																	27107195		2203	4300	6503	SO:0001587	stop_gained	8289	exon20			TGAACTCATTGGT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6806C>A	1.37:g.27107195C>A	ENSP00000320485:p.Ser2269*	Somatic	198	0		WXS	Illumina HiSeq	Phase_I	118	47	NM_006015	0	0	11	27	16	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	42	9.499439	0.99187	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	.	.	.	4.6	4.6	0.57074	.	0.216209	0.40385	N	0.001101	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9686	13.6859	0.62515	0.0:0.8453:0.1547:0.0	.	.	.	.	X	2269;2052;1886;597	.	ENSP00000320485:S2269X	S	+	2	0	ARID1A	26979782	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	5.627000	0.67784	2.552000	0.86080	0.591000	0.81541	TCA	.		0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
C1orf194	127003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109649721	109649721	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:109649721G>A	ENST00000369948.3	-	3	297	c.222C>T	c.(220-222)ttC>ttT	p.F74F	C1orf194_ENST00000369945.3_Silent_p.F35F|C1orf194_ENST00000369949.4_Silent_p.F62F			Q5T5A4	CA194_HUMAN	chromosome 1 open reading frame 194	74										large_intestine(2)|lung(2)|ovary(2)	6						CTGCTAAGCGGAAGTCCAGGT	0.483																																					p.F62F		.											.	C1orf194-23	0			c.C186T						.						210.0	178.0	188.0					1																	109649721		1568	3582	5150	SO:0001819	synonymous_variant	127003	exon3			TAAGCGGAAGTCC		CCDS41364.1	1p13.3	2011-03-31			ENSG00000179902	ENSG00000179902			32331	protein-coding gene	gene with protein product							Standard	NM_001122961		Approved		uc009wew.3	Q5T5A4	OTTHUMG00000011735	ENST00000369948.3:c.222C>T	1.37:g.109649721G>A		Somatic	183	0		WXS	Illumina HiSeq	Phase_I	217	93	NM_001122961	0	0	1	1	0	Q5T5A3	Silent	SNP	ENST00000369948.3	37																																																																																				.		0.483	C1orf194-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000032416.2	NM_001122961	
RFX5	5993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151314667	151314667	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:151314667G>T	ENST00000290524.4	-	11	2024	c.1846C>A	c.(1846-1848)Cca>Aca	p.P616T	RFX5_ENST00000368870.2_Missense_Mutation_p.P616T|RFX5_ENST00000452513.2_Missense_Mutation_p.P576T|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452671.2_Missense_Mutation_p.P616T|RP11-126K1.8_ENST00000422153.1_RNA	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	616					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTGTATCATGGGGGTGTTGCT	0.453																																					p.P616T		.											.	RFX5-91	0			c.C1846A						.						133.0	126.0	128.0					1																	151314667		2203	4300	6503	SO:0001583	missense	5993	exon11			ATCATGGGGGTGT		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1846C>A	1.37:g.151314667G>T	ENSP00000290524:p.Pro616Thr	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	94	47	NM_000449	0	0	20	44	24	B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	ENST00000290524.4	37	CCDS994.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686722	0.68157	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513	T;T;T;T	0.74632	-0.68;-0.68;-0.68;-0.86	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.76111	0.3942	L	0.36672	1.1	0.35535	D	0.8026	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.941	T	0.79593	-0.1739	10	0.87932	D	0	.	14.4852	0.67611	0.0:0.0:1.0:0.0	.	576;616	B7Z848;P48382	.;RFX5_HUMAN	T	616;616;616;576	ENSP00000290524:P616T;ENSP00000357864:P616T;ENSP00000389130:P616T;ENSP00000398388:P576T	ENSP00000290524:P616T	P	-	1	0	RFX5	149581291	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.473000	0.60196	2.806000	0.96561	0.591000	0.81541	CCA	.		0.453	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
ASH1L	55870	broad.mit.edu	37	1	155324299	155324299	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:155324299T>C	ENST00000368346.3	-	16	7832	c.7193A>G	c.(7192-7194)aAt>aGt	p.N2398S	ASH1L_ENST00000392403.3_Missense_Mutation_p.N2393S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2398					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GCAGATCCCATTCCAACGGGT	0.413																																					p.N2393S													.	ASH1L-234	0			c.A7178G						.						232.0	207.0	216.0					1																	155324299		2203	4300	6503	SO:0001583	missense	55870	exon16			ATCCCATTCCAAC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7193A>G	1.37:g.155324299T>C	ENSP00000357330:p.Asn2398Ser	Somatic	280	0		WXS	Illumina HiSeq	Phase_I	269	7	NM_018489	0	0	7	8	1	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	T	17.01	3.279551	0.59758	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88124	-2.34;-2.34	5.5	4.37	0.52481	Bromodomain (1);	0.103984	0.64402	D	0.000003	T	0.61060	0.2317	N	0.24115	0.695	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.56829	-0.7914	10	0.14656	T	0.56	.	8.5176	0.33255	0.0:0.1495:0.0:0.8505	.	2398;2393	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	2398;2393	ENSP00000357330:N2398S;ENSP00000376204:N2393S	ENSP00000357330:N2398S	N	-	2	0	ASH1L	153590923	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.914000	0.48797	1.096000	0.41439	0.533000	0.62120	AAT	.		0.413	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
CENPL	91687	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	173772191	173772191	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:173772191G>T	ENST00000345664.6	-	4	1086	c.873C>A	c.(871-873)ttC>ttA	p.F291L	CENPL_ENST00000356198.2_Missense_Mutation_p.F337L|CENPL_ENST00000367710.3_Missense_Mutation_p.F291L	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	291					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						AATGTCTATGGAAATGTGAAT	0.393																																					p.F337L		.											.	CENPL-90	0			c.C1011A						.						89.0	90.0	90.0					1																	173772191		2203	4300	6503	SO:0001583	missense	91687	exon6			TCTATGGAAATGT	BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.873C>A	1.37:g.173772191G>T	ENSP00000323543:p.Phe291Leu	Somatic	79	1		WXS	Illumina HiSeq	Phase_I	84	8	NM_001127181	0	0	1	1	0	Q5TEL5|Q96ND4	Missense_Mutation	SNP	ENST00000345664.6	37	CCDS30938.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218984	0.58560	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	T;T;T	0.49720	1.37;0.77;0.77	5.56	0.81	0.18732	.	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	L	0.54323	1.7	0.49051	D	0.99974	D;D	0.89917	0.999;1.0	D;D	0.87578	0.986;0.998	T	0.51108	-0.8747	10	0.87932	D	0	-5.3901	8.6851	0.34232	0.4999:0.0:0.5001:0.0	.	337;291	Q8N0S6-2;Q8N0S6	.;CENPL_HUMAN	L	337;291;291	ENSP00000348527:F337L;ENSP00000323543:F291L;ENSP00000356683:F291L	ENSP00000323543:F291L	F	-	3	2	CENPL	172038814	1.000000	0.71417	0.995000	0.50966	0.901000	0.52897	1.311000	0.33562	0.257000	0.21650	-0.302000	0.09304	TTC	.		0.393	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084213.1	NM_033319	
PRG4	10216	bcgsc.ca	37	1	186276075	186276075	+	Silent	SNP	T	T	C	rs540749159	byFrequency	TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:186276075T>C	ENST00000445192.2	+	7	1269	c.1224T>C	c.(1222-1224)acT>acC	p.T408T	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_Silent_p.T315T|PRG4_ENST00000367483.4_Silent_p.T367T|PRG4_ENST00000367486.3_Silent_p.T365T	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	408	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T408T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CACCCACCACTCCCAAGGAGC	0.662													-|||	16	0.00319489	0.0053	0.0014	5008	,	,		9339	0.001		0.003	False		,,,				2504	0.0041				p.T408T													.	PRG4-91	1	Substitution - coding silent(1)	kidney(1)	c.T1224C						.																																			SO:0001819	synonymous_variant	10216	exon7			CACCACTCCCAAG	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1224T>C	1.37:g.186276075T>C		Somatic	161	11		WXS	Illumina HiSeq	Phase_1	222	28	NM_005807	0	0	0	0	0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.662	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PIK3C2B	5287	bcgsc.ca	37	1	204412626	204412626	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:204412626C>A	ENST00000367187.3	-	20	3523	c.2967G>T	c.(2965-2967)gaG>gaT	p.E989D	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.E961D	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	989					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GGCGGTTAAACTCTTCTCTCA	0.597																																					p.E989D													.	PIK3C2B-1310	0			c.G2967T						.						82.0	85.0	84.0					1																	204412626		2203	4300	6503	SO:0001583	missense	5287	exon20			GTTAAACTCTTCT	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2967G>T	1.37:g.204412626C>A	ENSP00000356155:p.Glu989Asp	Somatic	262	1		WXS	Illumina HiSeq	Phase_1	190	57	NM_002646	0	0	2	2	0	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467982	0.84533	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.80909	-1.43;-1.43	5.79	3.59	0.41128	Phosphoinositide 3-kinase, accessory (PIK) domain (1);Protein kinase-like domain (1);	0.050509	0.85682	D	0.000000	T	0.78685	0.4322	M	0.71581	2.175	0.33052	D	0.532882	B;P	0.42296	0.289;0.775	B;B	0.39706	0.307;0.306	D	0.84478	0.0603	10	0.41790	T	0.15	.	13.435	0.61079	0.0:0.8484:0.0:0.1516	.	961;989	F5GWN5;O00750	.;P3C2B_HUMAN	D	989;961	ENSP00000356155:E989D;ENSP00000400561:E961D	ENSP00000356155:E989D	E	-	3	2	PIK3C2B	202679249	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.157000	0.50716	1.455000	0.47813	0.591000	0.81541	GAG	.		0.597	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	216017693	216017693	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:216017693A>T	ENST00000307340.3	-	46	9587	c.9201T>A	c.(9199-9201)aaT>aaA	p.N3067K	USH2A_ENST00000366943.2_Missense_Mutation_p.N3067K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3067	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACCCAGGCACATTCATTCCAG	0.393										HNSCC(13;0.011)																											p.N3067K		.											.	USH2A-115	0			c.T9201A						.						98.0	99.0	99.0					1																	216017693		2203	4300	6503	SO:0001583	missense	7399	exon46			AGGCACATTCATT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9201T>A	1.37:g.216017693A>T	ENSP00000305941:p.Asn3067Lys	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	77	24	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	8.287	0.816795	0.16607	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53423	0.62;0.62	6.04	0.803	0.18691	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.298923	0.23197	N	0.050821	T	0.29749	0.0743	L	0.35723	1.085	0.19775	N	0.999957	B	0.13594	0.008	B	0.08055	0.003	T	0.15578	-1.0432	10	0.17832	T	0.49	.	6.0414	0.19736	0.4009:0.2965:0.3026:0.0	.	3067	O75445	USH2A_HUMAN	K	3067	ENSP00000305941:N3067K;ENSP00000355910:N3067K	ENSP00000305941:N3067K	N	-	3	2	USH2A	214084316	0.008000	0.16893	0.941000	0.38009	0.993000	0.82548	0.037000	0.13840	0.158000	0.19367	0.529000	0.55759	AAT	.		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SIPA1L2	57568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	232650317	232650317	+	Missense_Mutation	SNP	G	G	A	rs371322486		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:232650317G>A	ENST00000366630.1	-	2	1127	c.769C>T	c.(769-771)Cgc>Tgc	p.R257C	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.R257C			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	257					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CCTGAGATGCGGACAAATTCT	0.502																																					p.R257C		.											.	SIPA1L2-95	0			c.C769T						.	G	CYS/ARG	1,3767		0,1,1883	68.0	67.0	67.0		769	5.4	1.0	1		67	0,8236		0,0,4118	no	missense	SIPA1L2	NM_020808.3	180	0,1,6001	AA,AG,GG		0.0,0.0265,0.0083	benign	257/1723	232650317	1,12003	1884	4118	6002	SO:0001583	missense	57568	exon1			AGATGCGGACAAA	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.769C>T	1.37:g.232650317G>A	ENSP00000355589:p.Arg257Cys	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	115	44	NM_020808	0	0	1	1	0	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588865	0.28357	2.65E-4	0.0	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.79749	-1.3;-1.3	5.44	5.44	0.79542	.	0.117092	0.56097	D	0.000023	T	0.69187	0.3083	N	0.25647	0.755	0.49483	D	0.999794	B	0.19935	0.04	B	0.12837	0.008	T	0.63963	-0.6518	10	0.37606	T	0.19	-23.1003	12.1037	0.53798	0.0:0.0:0.7162:0.2838	.	257	Q9P2F8	SI1L2_HUMAN	C	257	ENSP00000355589:R257C;ENSP00000262861:R257C	ENSP00000262861:R257C	R	-	1	0	SIPA1L2	230716940	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.388000	0.59633	2.834000	0.97654	0.650000	0.86243	CGC	.		0.502	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
UNC5B	219699	bcgsc.ca	37	10	73050759	73050759	+	Missense_Mutation	SNP	T	T	G	rs117156661		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr10:73050759T>G	ENST00000335350.6	+	9	1603	c.1187T>G	c.(1186-1188)gTg>gGg	p.V396G	UNC5B_ENST00000373192.4_Missense_Mutation_p.V385G	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	396					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCGGTGGGGGTGGTGGTGTAC	0.627																																					p.V396G													.	UNC5B-228	0			c.T1187G						.						176.0	172.0	173.0					10																	73050759		2203	4300	6503	SO:0001583	missense	219699	exon9			TGGGGGTGGTGGT	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1187T>G	10.37:g.73050759T>G	ENSP00000334329:p.Val396Gly	Somatic	675	46		WXS	Illumina HiSeq	Phase_1	333	147	NM_170744	0	0	0	0	0	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.510623	0.85389	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.55760	0.6;0.5	5.26	5.26	0.73747	.	0.062472	0.64402	D	0.000004	T	0.69557	0.3124	M	0.73217	2.22	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.66351	0.943;0.878	T	0.71364	-0.4615	10	0.46703	T	0.11	-20.6219	15.1633	0.72801	0.0:0.0:0.0:1.0	.	385;396	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	G	396;385	ENSP00000334329:V396G;ENSP00000362288:V385G	ENSP00000334329:V396G	V	+	2	0	UNC5B	72720765	1.000000	0.71417	0.929000	0.37066	0.557000	0.35523	4.283000	0.58977	1.996000	0.58369	0.460000	0.39030	GTG	T|0.999;G|0.001		0.627	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
GBF1	8729	bcgsc.ca	37	10	104120011	104120011	+	Silent	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr10:104120011T>C	ENST00000369983.3	+	12	1508	c.1248T>C	c.(1246-1248)aaT>aaC	p.N416N	GBF1_ENST00000476019.1_Intron	NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	416					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCCTCACCAATCCACACGACC	0.577																																					p.N417N													.	GBF1-91	0			c.T1251C						.						251.0	250.0	251.0					10																	104120011		2203	4300	6503	SO:0001819	synonymous_variant	8729	exon12			CACCAATCCACAC	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.1248T>C	10.37:g.104120011T>C		Somatic	633	7		WXS	Illumina HiSeq	Phase_1	397	76	NM_001199378	0	0	16	16	0	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Silent	SNP	ENST00000369983.3	37	CCDS7533.1																																																																																			.		0.577	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
NAV2	89797	broad.mit.edu	37	11	19954837	19954837	+	Silent	SNP	G	G	A	rs143560669		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:19954837G>A	ENST00000396087.3	+	8	1215	c.1116G>A	c.(1114-1116)ccG>ccA	p.P372P	NAV2_ENST00000396085.1_Silent_p.P349P|NAV2_ENST00000540292.1_Silent_p.P303P|NAV2_ENST00000527559.2_Silent_p.P301P|NAV2_ENST00000360655.4_Silent_p.P285P|NAV2_ENST00000349880.4_Silent_p.P349P	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	372					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CGGCCATCCCGCAGCCCGGTG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17564	0.0		0.001	False		,,,				2504	0.0				p.P372P													.	NAV2-96	0			c.G1116A						.	G	,,	0,4398		0,0,2199	131.0	133.0	132.0		855,1047,1047	2.6	1.0	11	dbSNP_134	132	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous,coding-synonymous	NAV2	NM_001111018.1,NM_145117.4,NM_182964.5	,,	0,1,6491	AA,AG,GG		0.0116,0.0,0.0077	,,	285/2366,349/2430,349/2433	19954837	1,12983	2199	4293	6492	SO:0001819	synonymous_variant	89797	exon8			CATCCCGCAGCCC	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.1116G>A	11.37:g.19954837G>A		Somatic	435	0		WXS	Illumina HiSeq	Phase_I	430	5	NM_001244963	0	0	2	2	0	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	37	CCDS58126.1																																																																																			G|0.999;A|0.000		0.627	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
FNBP4	23360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47745663	47745663	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:47745663G>T	ENST00000263773.5	-	14	2393	c.2381C>A	c.(2380-2382)aCa>aAa	p.T794K	Y_RNA_ENST00000363220.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	794			T -> A (in dbSNP:rs35040940).			nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						GCTAATTTCTGTAGCTTTCCT	0.428																																					p.T794K		.											.	FNBP4-91	0			c.C2381A						.						132.0	133.0	133.0					11																	47745663		1886	4120	6006	SO:0001583	missense	23360	exon14			ATTTCTGTAGCTT	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2381C>A	11.37:g.47745663G>T	ENSP00000263773:p.Thr794Lys	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	79	30	NM_015308	0	0	13	13	0	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.707845	0.48412	.	.	ENSG00000109920	ENST00000263773	T	0.50277	0.75	5.28	5.28	0.74379	.	0.468912	0.23563	N	0.046835	T	0.42337	0.1198	L	0.53249	1.67	0.28016	N	0.934697	B	0.31125	0.309	B	0.25140	0.058	T	0.47749	-0.9093	10	0.56958	D	0.05	-4.17	12.4896	0.55893	0.0803:0.0:0.9197:0.0	.	794	Q8N3X1	FNBP4_HUMAN	K	794	ENSP00000263773:T794K	ENSP00000263773:T794K	T	-	2	0	FNBP4	47702239	0.027000	0.19231	1.000000	0.80357	0.870000	0.49936	2.261000	0.43276	2.483000	0.83821	0.561000	0.74099	ACA	.		0.428	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
FNBP4	23360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47745665	47745665	+	Silent	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:47745665A>G	ENST00000263773.5	-	14	2391	c.2379T>C	c.(2377-2379)gcT>gcC	p.A793A	Y_RNA_ENST00000363220.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	793						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						TAATTTCTGTAGCTTTCCTCT	0.428																																					p.A793A		.											.	FNBP4-91	0			c.T2379C						.						131.0	132.0	132.0					11																	47745665		1883	4121	6004	SO:0001819	synonymous_variant	23360	exon14			TTCTGTAGCTTTC	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2379T>C	11.37:g.47745665A>G		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	75	29	NM_015308	0	0	11	11	0	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	37	CCDS41644.1																																																																																			.		0.428	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
PTPRJ	5795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	48142761	48142761	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:48142761A>G	ENST00000418331.2	+	4	911	c.559A>G	c.(559-561)Act>Gct	p.T187A	PTPRJ_ENST00000440289.2_Missense_Mutation_p.T187A	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	187	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATTCTCCATCACTCCAGGAAT	0.428																																					p.T187A		.											.	PTPRJ-541	0			c.A559G						.						129.0	120.0	123.0					11																	48142761		2201	4298	6499	SO:0001583	missense	5795	exon4			TCCATCACTCCAG	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.559A>G	11.37:g.48142761A>G	ENSP00000400010:p.Thr187Ala	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	69	20	NM_001098503	0	0	9	15	6	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.875810	0.33162	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289;ENST00000534219	T;T;T	0.76448	0.49;0.49;-1.02	5.05	0.487	0.16842	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70649	0.3248	L	0.44542	1.39	0.09310	N	1	B;P	0.36086	0.131;0.536	B;B	0.43623	0.068;0.425	T	0.57033	-0.7880	9	0.15066	T	0.55	.	8.4715	0.32988	0.4929:0.0:0.0:0.507	.	187;187	Q12913;Q6P4H4	PTPRJ_HUMAN;.	A	187;187;187;108	ENSP00000400010:T187A;ENSP00000409733:T187A;ENSP00000432686:T108A	ENSP00000278456:T187A	T	+	1	0	PTPRJ	48099337	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.045000	0.14013	0.206000	0.20587	0.482000	0.46254	ACT	.		0.428	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
GAB2	9846	bcgsc.ca	37	11	77937657	77937657	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:77937657C>G	ENST00000361507.4	-	4	1146	c.1061G>C	c.(1060-1062)cGc>cCc	p.R354P	GAB2_ENST00000340149.2_Missense_Mutation_p.R316P|GAB2_ENST00000526030.1_5'Flank	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	354					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CTTGGGGGGGCGGGGTGGGGG	0.582																																					p.R354P													.	GAB2-663	0			c.G1061C						.						46.0	52.0	50.0					11																	77937657		2200	4292	6492	SO:0001583	missense	9846	exon4			GGGGGGCGGGGTG	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1061G>C	11.37:g.77937657C>G	ENSP00000354952:p.Arg354Pro	Somatic	144	1		WXS	Illumina HiSeq	Phase_1	99	46	NM_080491	0	0	2	2	0	A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	37	CCDS8259.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749568	0.69533	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.33865	1.39;1.39	5.21	5.21	0.72293	.	0.000000	0.85682	U	0.000000	T	0.63803	0.2542	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61237	-0.7103	10	0.25106	T	0.35	-15.5922	19.1199	0.93358	0.0:1.0:0.0:0.0	.	354	Q9UQC2	GAB2_HUMAN	P	316;354	ENSP00000343959:R316P;ENSP00000354952:R354P	ENSP00000343959:R316P	R	-	2	0	GAB2	77615305	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.403000	0.79983	2.598000	0.87819	0.561000	0.74099	CGC	.		0.582	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113103986	113103986	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:113103986G>T	ENST00000533760.1	+	12	1855	c.1256G>T	c.(1255-1257)tGg>tTg	p.W419L	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.W546L|NCAM1_ENST00000316851.7_Missense_Mutation_p.W537L	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	547	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		AAAGCTGAGTGGAGAGCAGTT	0.532																																					p.W573L		.											.	NCAM1-23	0			c.G1718T						.						78.0	81.0	80.0					11																	113103986		2079	4205	6284	SO:0001583	missense	4684	exon15			CTGAGTGGAGAGC		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1256G>T	11.37:g.113103986G>T	ENSP00000473281:p.Trp419Leu	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	42	16	NM_001242607	0	0	0	0	0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	G	28.8	4.953276	0.92660	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.56103	0.48;0.48	6.06	6.06	0.98353	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.75459	0.3852	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.73808	-0.3866	9	0.49607	T	0.09	-34.0768	20.6208	0.99490	0.0:0.0:1.0:0.0	.	547;537;547;537	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	L	419;546;537	ENSP00000384055:W546L;ENSP00000318472:W537L	ENSP00000318472:W537L	W	+	2	0	NCAM1	112609196	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	TGG	.		0.532	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
CADM1	23705	bcgsc.ca	37	11	115049423	115049423	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:115049423A>C	ENST00000452722.3	-	9	1171	c.1151T>G	c.(1150-1152)gTg>gGg	p.V384G	CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000542447.2_Missense_Mutation_p.V356G|CADM1_ENST00000331581.6_Missense_Mutation_p.V413G|CADM1_ENST00000536727.1_Missense_Mutation_p.V385G|CADM1_ENST00000537058.1_Missense_Mutation_p.V395G	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		GGCGAACACCACCACCGCCAC	0.532																																					p.V384G													.	CADM1-92	0			c.T1151G						.						129.0	113.0	118.0					11																	115049423		2201	4296	6497	SO:0001583	missense	23705	exon9			AACACCACCACCG	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1151T>G	11.37:g.115049423A>C	ENSP00000395359:p.Val384Gly	Somatic	264	8		WXS	Illumina HiSeq	Phase_1	114	38	NM_014333	1	0	35	36	0		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531606	0.64972	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000001	D	0.83110	0.5183	M	0.84846	2.72	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.998	D;D;D;D	0.91635	0.999;0.991;0.979;0.981	D	0.86298	0.1678	10	0.87932	D	0	.	14.8691	0.70441	1.0:0.0:0.0:0.0	.	395;357;384;356	F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.;.;CADM1_HUMAN;.	G	356;384;395;385;315;413;69	ENSP00000439176:V356G;ENSP00000395359:V384G;ENSP00000439817:V395G;ENSP00000440322:V385G;ENSP00000329797:V413G	ENSP00000329797:V413G	V	-	2	0	CADM1	114554633	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.761000	0.91691	2.115000	0.64714	0.533000	0.62120	GTG	.		0.532	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CEP164	22897	bcgsc.ca	37	11	117280516	117280516	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:117280516A>C	ENST00000278935.3	+	30	4078	c.3931A>C	c.(3931-3933)Acc>Ccc	p.T1311P	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1311					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GAGCACCCCCACCCCCACCTA	0.662																																					p.T1311P													.	CEP164-69	0			c.A3931C						.						93.0	97.0	96.0					11																	117280516		2201	4296	6497	SO:0001583	missense	22897	exon30			ACCCCCACCCCCA	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3931A>C	11.37:g.117280516A>C	ENSP00000278935:p.Thr1311Pro	Somatic	408	7		WXS	Illumina HiSeq	Phase_1	231	44	NM_014956	0	0	8	8	0	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	A	9.089	1.001310	0.19121	.	.	ENSG00000110274	ENST00000278935	T	0.23950	1.88	4.19	-2.4	0.06583	.	2.488380	0.01670	N	0.025578	T	0.19565	0.0470	L	0.36672	1.1	0.09310	N	1	P;P	0.35982	0.531;0.531	B;B	0.34779	0.189;0.189	T	0.14559	-1.0468	10	0.34782	T	0.22	8.6364	5.5918	0.17305	0.342:0.0:0.4794:0.1786	.	1311;1306	Q9UPV0;Q9UPV0-2	CE164_HUMAN;.	P	1311	ENSP00000278935:T1311P	ENSP00000278935:T1311P	T	+	1	0	CEP164	116785726	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-1.319000	0.02702	-0.488000	0.06726	0.402000	0.26972	ACC	.		0.662	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
LAG3	3902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6886460	6886460	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:6886460C>G	ENST00000203629.2	+	6	1421	c.1088C>G	c.(1087-1089)tCc>tGc	p.S363C		NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	363	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TCACCTGGATCCCTGGGGAAG	0.517																																					p.S363C		.											.	LAG3-90	0			c.C1088G						.						112.0	111.0	111.0					12																	6886460		2203	4300	6503	SO:0001583	missense	3902	exon6			CTGGATCCCTGGG		CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.1088C>G	12.37:g.6886460C>G	ENSP00000203629:p.Ser363Cys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	158	67	NM_002286	0	0	0	0	0	A8K7T9|Q7Z643	Missense_Mutation	SNP	ENST00000203629.2	37	CCDS8561.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658513	0.47467	.	.	ENSG00000089692	ENST00000203629	T	0.15603	2.41	4.55	1.61	0.23674	.	0.653989	0.15030	N	0.284515	T	0.18509	0.0444	L	0.27053	0.805	0.19300	N	0.999976	D	0.71674	0.998	P	0.57371	0.819	T	0.10800	-1.0614	10	0.36615	T	0.2	-8.8465	6.2866	0.21037	0.2301:0.4544:0.3155:0.0	.	363	P18627	LAG3_HUMAN	C	363	ENSP00000203629:S363C	ENSP00000203629:S363C	S	+	2	0	LAG3	6756721	0.507000	0.26146	0.578000	0.28575	0.907000	0.53573	0.505000	0.22642	0.136000	0.18733	0.561000	0.74099	TCC	.		0.517	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402846.1		
PRB4	5545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	11461501	11461501	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:11461501C>A	ENST00000535904.1	-	3	449	c.416G>T	c.(415-417)gGa>gTa	p.G139V	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Missense_Mutation_p.G139V			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	160	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TTCTGGCTTTCCTGGAGGAGG	0.602										HNSCC(22;0.051)																											p.G139V		.											.	PRB4-91	0			c.G416T						.						176.0	197.0	190.0					12																	11461501		2202	4300	6502	SO:0001583	missense	5545	exon3			GGCTTTCCTGGAG		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.416G>T	12.37:g.11461501C>A	ENSP00000442834:p.Gly139Val	Somatic	531	0		WXS	Illumina HiSeq	Phase_I	566	232	NM_002723	0	0	0	0	0	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	5.316	0.243693	0.10077	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.08546	3.08;3.08	0.849	0.849	0.18972	.	.	.	.	.	T	0.22437	0.0541	M	0.78456	2.415	0.09310	N	0.999999	D	0.89917	1.0	D	0.66979	0.948	T	0.05178	-1.0901	9	0.87932	D	0	.	5.0427	0.14467	0.0:1.0:0.0:0.0	.	139	E9PAL0	.	V	139	ENSP00000279575:G139V;ENSP00000442834:G139V	ENSP00000279575:G139V	G	-	2	0	PRB4	11352768	0.002000	0.14202	0.003000	0.11579	0.004000	0.04260	0.087000	0.14958	0.744000	0.32741	0.502000	0.49764	GGA	.		0.602	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
TMTC2	160335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	83290130	83290130	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:83290130G>A	ENST00000321196.3	+	3	1895	c.1188G>A	c.(1186-1188)ctG>ctA	p.L396L	TMTC2_ENST00000549919.1_Silent_p.L390L|TMTC2_ENST00000548305.1_Silent_p.L396L	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	396					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TTGTTGTTCTGTCTTTATCTT	0.393																																					p.L396L		.											.	TMTC2-92	0			c.G1188A						.						191.0	193.0	192.0					12																	83290130		2203	4300	6503	SO:0001819	synonymous_variant	160335	exon3			TGTTCTGTCTTTA	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1188G>A	12.37:g.83290130G>A		Somatic	214	0		WXS	Illumina HiSeq	Phase_I	208	96	NM_152588	0	0	18	32	14	B2RCU7|Q8N2K8	Silent	SNP	ENST00000321196.3	37	CCDS9025.1																																																																																			.		0.393	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
BTG1	694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	92537939	92537939	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:92537939T>C	ENST00000256015.3	-	2	794	c.433A>G	c.(433-435)Agc>Ggc	p.S145G	C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000549802.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	145					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGATTCGGCTGTCTACCATT	0.473			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S145G		.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1-683	0			c.A433G						.						109.0	92.0	98.0					12																	92537939		2203	4300	6503	SO:0001583	missense	694	exon2			TTCGGCTGTCTAC		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.433A>G	12.37:g.92537939T>C	ENSP00000256015:p.Ser145Gly	Somatic	117	0	1291	WXS	Illumina HiSeq	Phase_I	116	56	NM_001731	0	0	90	174	84	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	T	6.001	0.368520	0.11352	.	.	ENSG00000133639	ENST00000256015;ENST00000552315	T;T	0.34275	1.79;1.37	5.8	5.8	0.92144	.	0.037276	0.85682	D	0.000000	T	0.31734	0.0806	L	0.36672	1.1	0.80722	D	1	B	0.12630	0.006	B	0.15484	0.013	T	0.04203	-1.0969	10	0.33141	T	0.24	-7.3735	16.1508	0.81622	0.0:0.0:0.0:1.0	.	145	P62324	BTG1_HUMAN	G	145;70	ENSP00000256015:S145G;ENSP00000447551:S70G	ENSP00000256015:S145G	S	-	1	0	BTG1	91062070	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.649000	0.83500	2.207000	0.71202	0.528000	0.53228	AGC	.		0.473	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
TMCC3	57458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	94976205	94976205	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:94976205T>A	ENST00000261226.4	-	2	319	c.188A>T	c.(187-189)aAg>aTg	p.K63M	TMCC3_ENST00000551457.1_Missense_Mutation_p.K32M	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	63						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GAGTTTGACCTTGTGGAAGTC	0.483																																					p.K63M		.											.	TMCC3-92	0			c.A188T						.						150.0	147.0	148.0					12																	94976205		2203	4300	6503	SO:0001583	missense	57458	exon2			TTGACCTTGTGGA	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.188A>T	12.37:g.94976205T>A	ENSP00000261226:p.Lys63Met	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	146	62	NM_020698	0	0	6	11	5	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	37	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457648	0.63401	.	.	ENSG00000057704	ENST00000261226;ENST00000551457;ENST00000548918	T;T	0.51574	1.34;0.7	5.91	5.91	0.95273	.	0.099394	0.64402	D	0.000002	T	0.67211	0.2869	M	0.61703	1.905	0.46203	D	0.998924	D	0.89917	1.0	D	0.91635	0.999	T	0.69555	-0.5114	10	0.72032	D	0.01	-45.39	16.3889	0.83525	0.0:0.0:0.0:1.0	.	63	Q9ULS5	TMCC3_HUMAN	M	63;32;32	ENSP00000261226:K63M;ENSP00000449888:K32M	ENSP00000261226:K63M	K	-	2	0	TMCC3	93500336	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	0.917000	0.28665	2.276000	0.75962	0.397000	0.26171	AAG	.		0.483	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
DENND4A	10260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	66031104	66031104	+	Silent	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr15:66031104A>G	ENST00000431932.2	-	6	949	c.741T>C	c.(739-741)aaT>aaC	p.N247N	DENND4A_ENST00000443035.3_Silent_p.N247N	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	247	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GGTATTTGCTATTTGATGGCC	0.363																																					p.N247N		.											.	DENND4A-229	0			c.T741C						.						117.0	113.0	114.0					15																	66031104		1819	4084	5903	SO:0001819	synonymous_variant	10260	exon6			TTTGCTATTTGAT	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.741T>C	15.37:g.66031104A>G		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	122	49	NM_001144823	0	0	1	3	2	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	CCDS45285.1																																																																																			.		0.363	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
C15orf59	388135	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	74032301	74032301	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr15:74032301A>T	ENST00000569673.1	-	3	2043	c.839T>A	c.(838-840)cTg>cAg	p.L280Q	C15orf59_ENST00000379822.4_Missense_Mutation_p.L280Q|C15orf59_ENST00000558834.1_5'UTR			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	280										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGTGTAGGGCAGAACCGTCTG	0.572																																					p.L280Q		.											.	C15orf59-91	0			c.T839A						.						92.0	99.0	97.0					15																	74032301		2198	4297	6495	SO:0001583	missense	388135	exon2			TAGGGCAGAACCG		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.839T>A	15.37:g.74032301A>T	ENSP00000457205:p.Leu280Gln	Somatic	250	0		WXS	Illumina HiSeq	Phase_I	163	72	NM_001039614	0	0	10	18	8		Missense_Mutation	SNP	ENST00000569673.1	37	CCDS32289.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.207083	0.79127	.	.	ENSG00000205363	ENST00000379822	T	0.57907	0.37	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000003	T	0.67933	0.2946	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71434	-0.4594	10	0.87932	D	0	.	14.5288	0.67909	1.0:0.0:0.0:0.0	.	280	Q2T9L4	CO059_HUMAN	Q	280	ENSP00000369150:L280Q	ENSP00000369150:L280Q	L	-	2	0	C15orf59	71819354	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.572000	0.90756	1.906000	0.55180	0.459000	0.35465	CTG	.		0.572	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614	
ACSM1	116285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20682868	20682868	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr16:20682868G>T	ENST00000307493.4	-	4	804	c.737C>A	c.(736-738)cCc>cAc	p.P246H	ACSM1_ENST00000520010.1_Missense_Mutation_p.P246H|ACSM1_ENST00000219151.4_5'UTR	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	246					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						TGGGAAGGAGGGTTGTAAGGC	0.527																																					p.P246H		.											.	ACSM1-91	0			c.C737A						.						99.0	83.0	89.0					16																	20682868		2201	4300	6501	SO:0001583	missense	116285	exon4			AAGGAGGGTTGTA	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.737C>A	16.37:g.20682868G>T	ENSP00000301956:p.Pro246His	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	111	36	NM_052956	0	0	37	45	8	Q08AH2|Q96A20	Missense_Mutation	SNP	ENST00000307493.4	37	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	G	2.027	-0.423437	0.04734	.	.	ENSG00000166743	ENST00000307493;ENST00000520010	T;T	0.47177	0.85;0.85	4.95	1.81	0.25067	AMP-dependent synthetase/ligase (1);	1.028510	0.07746	N	0.947678	T	0.28300	0.0699	N	0.12471	0.22	0.09310	N	0.999995	B	0.06786	0.001	B	0.08055	0.003	T	0.22556	-1.0213	10	0.45353	T	0.12	.	5.2282	0.15406	0.0815:0.1431:0.6274:0.148	.	246	Q08AH1	ACSM1_HUMAN	H	246	ENSP00000301956:P246H;ENSP00000428047:P246H	ENSP00000301956:P246H	P	-	2	0	ACSM1	20590369	0.351000	0.24887	0.000000	0.03702	0.001000	0.01503	3.098000	0.50259	0.238000	0.21222	0.603000	0.83216	CCC	.		0.527	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
APOBR	55911	hgsc.bcm.edu	37	16	28507273	28507273	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr16:28507273T>C	ENST00000431282.1	+	2	921	c.911T>C	c.(910-912)aTc>aCc	p.I304T	APOBR_ENST00000328423.5_Missense_Mutation_p.I304T|CLN3_ENST00000569430.1_5'Flank|CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.I304T			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	304	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GCCAGGACAATCTCAGGCGGG	0.652																																					p.I304T		.											.	APOBR-90	0			c.T911C						.						25.0	27.0	27.0					16																	28507273		1953	4120	6073	SO:0001583	missense	55911	exon2			GGACAATCTCAGG	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.911T>C	16.37:g.28507273T>C	ENSP00000416094:p.Ile304Thr	Somatic	53	1		WXS	Illumina HiSeq	Phase_I	68	5	NM_018690	0	0	0	0	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	37		.	.	.	.	.	.	.	.	.	.	T	7.813	0.716146	0.15306	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60920	0.15;0.15	3.64	-0.321	0.12717	.	.	.	.	.	T	0.31765	0.0807	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16217	-1.0410	9	0.14252	T	0.57	.	1.54	0.02553	0.1605:0.4546:0.1586:0.2263	.	295	Q9NS13	.	T	304	ENSP00000327669:I304T;ENSP00000416094:I304T	ENSP00000327669:I304T	I	+	2	0	APOBR	28414774	0.000000	0.05858	0.000000	0.03702	0.239000	0.25481	0.243000	0.18106	0.149000	0.19098	-0.320000	0.08662	ATC	.		0.652	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
WDR81	124997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	1633711	1633711	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:1633711G>A	ENST00000409644.1	+	2	3705	c.3705G>A	c.(3703-3705)aaG>aaA	p.K1235K	WDR81_ENST00000446363.1_Intron|WDR81_ENST00000437219.2_Silent_p.K32K|WDR81_ENST00000419248.1_Silent_p.K8K|WDR81_ENST00000545662.1_5'Flank|WDR81_ENST00000309182.5_Silent_p.K184K|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1235					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TGTCTGCCAAGCTCGGCCCCA	0.642																																					p.K1235K		.											.	WDR81-91	0			c.G3705A						.						33.0	31.0	32.0					17																	1633711		2203	4299	6502	SO:0001819	synonymous_variant	124997	exon2			TGCCAAGCTCGGC	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3705G>A	17.37:g.1633711G>A		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	69	15	NM_001163809	0	0	9	11	2	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Silent	SNP	ENST00000409644.1	37	CCDS54062.1																																																																																			.		0.642	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
MYBBP1A	10514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4445915	4445915	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:4445915T>C	ENST00000254718.4	-	21	3320	c.3014A>G	c.(3013-3015)cAc>cGc	p.H1005R	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.H1005R			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1005					cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						ACTCACCGGGTGCCGGGAGAA	0.627																																					p.H1005R		.											.	MYBBP1A-92	0			c.A3014G						.						99.0	98.0	98.0					17																	4445915		2203	4300	6503	SO:0001583	missense	10514	exon21			ACCGGGTGCCGGG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3014A>G	17.37:g.4445915T>C	ENSP00000254718:p.His1005Arg	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	189	115	NM_014520	0	0	0	0	0	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	37	CCDS11046.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527626	0.64860	.	.	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.19532	2.14;2.14	5.53	4.44	0.53790	Armadillo-type fold (1);	0.481948	0.24846	N	0.035136	T	0.23965	0.0580	L	0.54323	1.7	0.25888	N	0.9835	P;P	0.47106	0.824;0.89	B;P	0.46796	0.327;0.527	T	0.07309	-1.0779	10	0.26408	T	0.33	-19.5303	8.7411	0.34558	0.1687:0.0:0.0:0.8313	.	1005;1005	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	R	1005	ENSP00000370968:H1005R;ENSP00000254718:H1005R	ENSP00000254718:H1005R	H	-	2	0	MYBBP1A	4392664	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	3.604000	0.54081	0.910000	0.36722	0.533000	0.62120	CAC	.		0.627	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
ALOX15B	247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7948982	7948982	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:7948982C>T	ENST00000380183.4	+	8	1317	c.1178C>T	c.(1177-1179)cCc>cTc	p.P393L	ALOX15B_ENST00000572022.1_Missense_Mutation_p.P393L|ALOX15B_ENST00000380173.2_Missense_Mutation_p.P393L|ALOX15B_ENST00000573359.1_Missense_Mutation_p.P393L	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	393	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CGTCAGCTGCCCCACTGCCAC	0.612																																					p.P393L		.											.	ALOX15B-227	0			c.C1178T						.						66.0	51.0	56.0					17																	7948982		2203	4300	6503	SO:0001583	missense	247	exon8			AGCTGCCCCACTG	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1178C>T	17.37:g.7948982C>T	ENSP00000369530:p.Pro393Leu	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	78	38	NM_001141	0	0	2	2	0	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929812	0.92389	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.91521	-2.86;-2.86	4.53	4.53	0.55603	Lipoxygenase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.96062	0.8717	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97047	0.9761	10	0.87932	D	0	-23.6176	16.3899	0.83531	0.0:1.0:0.0:0.0	.	393;393;393;393	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	L	393	ENSP00000369520:P393L;ENSP00000369530:P393L	ENSP00000344337:P393L	P	+	2	0	ALOX15B	7889707	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	7.516000	0.81772	2.225000	0.72522	0.563000	0.77884	CCC	.		0.612	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
MYH2	4620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10433386	10433386	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:10433386G>A	ENST00000245503.5	-	23	3087	c.2703C>T	c.(2701-2703)gcC>gcT	p.A901A	MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Silent_p.A901A|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	901					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCAAGCCTTCGGCTTCCTTAA	0.398																																					p.A901A		.											.	MYH2-194	0			c.C2703T						.						124.0	121.0	122.0					17																	10433386		2203	4300	6503	SO:0001819	synonymous_variant	4620	exon23			GCCTTCGGCTTCC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2703C>T	17.37:g.10433386G>A		Somatic	152	0		WXS	Illumina HiSeq	Phase_I	254	82	NM_017534	0	0	0	0	0	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	CCDS11156.1																																																																																			.		0.398	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	301	46		WXS	Illumina HiSeq		471	79	NM_145301	0	0	7	50	43	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
ACE	1636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61561775	61561775	+	Silent	SNP	G	G	C	rs137910205		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:61561775G>C	ENST00000290866.4	+	12	1818	c.1794G>C	c.(1792-1794)ccG>ccC	p.P598P	ACE_ENST00000490216.2_5'Flank|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000428043.1_Silent_p.P598P|ACE_ENST00000577647.1_5'Flank|ACE_ENST00000421982.2_5'Flank|ACE_ENST00000413513.3_5'Flank	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	598	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	ATGCCCAGCCGCTGCTCAAGT	0.657																																					p.P598P		.											.	ACE-94	0			c.G1794C						.						44.0	32.0	36.0					17																	61561775		2203	4300	6503	SO:0001819	synonymous_variant	1636	exon12			CCAGCCGCTGCTC	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1794G>C	17.37:g.61561775G>C		Somatic	50	1		WXS	Illumina HiSeq	Phase_I	57	27	NM_000789	0	0	10	36	26	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	ENST00000290866.4	37	CCDS11637.1																																																																																			G|1.000;A|0.000		0.657	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	5406855	5406855	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr18:5406855T>C	ENST00000341928.2	-	16	2610	c.2270A>G	c.(2269-2271)aAg>aGg	p.K757R	EPB41L3_ENST00000400111.3_Missense_Mutation_p.K576R|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Missense_Mutation_p.K757R|EPB41L3_ENST00000544123.1_Missense_Mutation_p.K588R|EPB41L3_ENST00000427684.2_Missense_Mutation_p.K29R|EPB41L3_ENST00000542146.1_Missense_Mutation_p.K29R|EPB41L3_ENST00000540638.2_Missense_Mutation_p.K576R	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	757	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GGAAAGCCTCTTCTCCCATTC	0.512																																					p.K757R		.											.	EPB41L3-95	0			c.A2270G						.						179.0	143.0	155.0					18																	5406855		2203	4300	6503	SO:0001583	missense	23136	exon16			AGCCTCTTCTCCC	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2270A>G	18.37:g.5406855T>C	ENSP00000343158:p.Lys757Arg	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	116	49	NM_012307	0	0	21	43	22	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.245271	0.80024	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	D;D;D;D;D;D	0.89875	-2.12;-2.58;-1.59;-1.5;-2.12;-2.37	5.78	5.78	0.91487	SAB (1);	0.043558	0.85682	D	0.000000	D	0.93360	0.7883	M	0.62266	1.93	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	0.99;0.999;0.999;0.977;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.979;0.996;0.996;0.98;0.995;0.97;0.999;0.998	D	0.93204	0.6594	10	0.48119	T	0.1	.	16.1138	0.81283	0.0:0.0:0.0:1.0	.	588;29;29;149;467;576;757;29	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	R	757;467;588;467;29;29;757;576	ENSP00000343158:K757R;ENSP00000441174:K588R;ENSP00000392195:K29R;ENSP00000442233:K29R;ENSP00000341138:K757R;ENSP00000382981:K576R	ENSP00000343158:K757R	K	-	2	0	EPB41L3	5396855	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.698000	0.84413	2.220000	0.72140	0.533000	0.62120	AAG	.		0.512	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	28660278	28660278	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr18:28660278A>C	ENST00000280904.6	-	10	1747	c.1304T>G	c.(1303-1305)aTt>aGt	p.I435S	DSC2_ENST00000251081.6_Missense_Mutation_p.I435S	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	435	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			AACTACACCAATTTGCAAGAT	0.378																																					p.I435S		.											.	DSC2-517	0			c.T1304G						.						159.0	138.0	145.0					18																	28660278		2203	4300	6503	SO:0001583	missense	1824	exon10			ACACCAATTTGCA	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1304T>G	18.37:g.28660278A>C	ENSP00000280904:p.Ile435Ser	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	70	30	NM_024422	0	0	9	19	10		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.006051	0.54361	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.48836	0.8;0.8	5.92	5.92	0.95590	Cadherin (5);Cadherin-like (1);	0.000000	0.32884	N	0.005536	T	0.78997	0.4372	H	0.97491	4.015	0.54753	D	0.999989	D;D	0.69078	0.997;0.996	D;D	0.65443	0.934;0.935	D	0.86616	0.1876	10	0.87932	D	0	.	15.3456	0.74334	1.0:0.0:0.0:0.0	.	435;435	Q02487;Q02487-2	DSC2_HUMAN;.	S	435;435;201;448	ENSP00000251081:I435S;ENSP00000280904:I435S	ENSP00000251081:I435S	I	-	2	0	DSC2	26914276	1.000000	0.71417	0.226000	0.23910	0.115000	0.19883	7.733000	0.84916	2.266000	0.75297	0.533000	0.62120	ATT	.		0.378	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
ICAM5	7087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10403449	10403449	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr19:10403449A>G	ENST00000221980.4	+	5	1186	c.1123A>G	c.(1123-1125)Aac>Gac	p.N375D		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	375	Ig-like C2-type 4.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TGCCACCGAGAACGACGACAG	0.622																																					p.N375D		.											.	ICAM5-153	0			c.A1123G						.						52.0	54.0	53.0					19																	10403449		2203	4300	6503	SO:0001583	missense	7087	exon5			ACCGAGAACGACG	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1123A>G	19.37:g.10403449A>G	ENSP00000221980:p.Asn375Asp	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	56	8	NM_003259	0	0	0	0	0	Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	37	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	A	7.911	0.736583	0.15574	.	.	ENSG00000105376	ENST00000221980	T	0.05382	3.45	5.46	-10.9	0.00192	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.463300	0.03856	N	0.273164	T	0.02230	0.0069	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34354	-0.9832	10	0.16420	T	0.52	-0.0897	4.6077	0.12385	0.1132:0.1885:0.5112:0.1871	.	375	Q9UMF0	ICAM5_HUMAN	D	375	ENSP00000221980:N375D	ENSP00000221980:N375D	N	+	1	0	ICAM5	10264449	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-1.105000	0.03323	-3.113000	0.00241	-0.441000	0.05720	AAC	.		0.622	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
ZSWIM4	65249	ucsc.edu	37	19	13919690	13919690	+	Silent	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr19:13919690C>A	ENST00000254323.2	+	4	942	c.753C>A	c.(751-753)gcC>gcA	p.A251A	ZSWIM4_ENST00000440752.2_5'UTR	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	251							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			TCGAGGACGCCAACTGCTGGC	0.657																																					p.A251A													.	ZSWIM4-90	0			c.C753A						.						23.0	22.0	22.0					19																	13919690		2195	4296	6491	SO:0001819	synonymous_variant	65249	exon4			GGACGCCAACTGC	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.753C>A	19.37:g.13919690C>A		Somatic	30	0		WXS	Illumina HiSeq		35	4	NM_023072	0	0	2	2	0		Silent	SNP	ENST00000254323.2	37	CCDS32924.1																																																																																			.		0.657	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
PEG3	5178	broad.mit.edu	37	19	57326548	57326548	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr19:57326548C>A	ENST00000326441.9	-	10	3625	c.3262G>T	c.(3262-3264)Gtc>Ttc	p.V1088F	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.V1088F|PEG3_ENST00000593695.1_Missense_Mutation_p.V962F|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.V964F|ZIM2_ENST00000599935.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1088					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CCTTGAATGACAGGGTCTTCA	0.517																																					p.V1088F													.	PEG3-164	0			c.G3262T						.						128.0	120.0	123.0					19																	57326548		2203	4300	6503	SO:0001583	missense	5178	exon9			GAATGACAGGGTC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3262G>T	19.37:g.57326548C>A	ENSP00000326581:p.Val1088Phe	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	102	4	NM_001146184	0	0	0	0	0	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	4.117	0.019819	0.08006	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02446	4.29;4.29	3.15	1.71	0.24356	.	0.658998	0.13424	N	0.388972	T	0.06462	0.0166	L	0.57536	1.79	.	.	.	B;D;D	0.76494	0.012;0.999;0.981	B;D;P	0.66196	0.007;0.942;0.786	T	0.11842	-1.0571	9	0.02654	T	1	-9.2719	4.6601	0.12637	0.0:0.7375:0.0:0.2625	.	964;1088;1023	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	F	1088	ENSP00000326581:V1088F;ENSP00000403051:V1088F	ENSP00000326581:V1088F	V	-	1	0	ZIM2	62018360	0.000000	0.05858	0.001000	0.08648	0.944000	0.59088	-0.128000	0.10531	0.545000	0.28902	0.655000	0.94253	GTC	.		0.517	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PELI1	57162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	64323347	64323347	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:64323347G>A	ENST00000358912.4	-	6	1044	c.602C>T	c.(601-603)tCc>tTc	p.S201F		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	201					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S201Y(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						TCCAGGCTTGGAGTCTTCTGT	0.453																																					p.S201F		.											.	PELI1-91	1	Substitution - Missense(1)	lung(1)	c.C602T						.						166.0	151.0	156.0					2																	64323347		2203	4300	6503	SO:0001583	missense	57162	exon6			GGCTTGGAGTCTT		CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.602C>T	2.37:g.64323347G>A	ENSP00000351789:p.Ser201Phe	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	124	45	NM_020651	0	0	6	10	4	Q96SM0|Q9GZY5|Q9HCX0	Missense_Mutation	SNP	ENST00000358912.4	37	CCDS1876.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917014	0.92249	.	.	ENSG00000197329	ENST00000358912	T	0.53423	0.62	5.65	5.65	0.86999	.	0.096296	0.64402	D	0.000001	T	0.62720	0.2451	M	0.74881	2.28	0.80722	D	1	P	0.48911	0.917	P	0.50490	0.642	T	0.66044	-0.6021	10	0.72032	D	0.01	-12.6236	20.0965	0.97849	0.0:0.0:1.0:0.0	.	201	Q96FA3	PELI1_HUMAN	F	201	ENSP00000351789:S201F	ENSP00000351789:S201F	S	-	2	0	PELI1	64176851	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.813000	0.99286	2.824000	0.97209	0.655000	0.94253	TCC	.		0.453	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251686.1	NM_020651	
NCK2	8440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	106498221	106498221	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:106498221A>G	ENST00000233154.4	+	4	1106	c.664A>G	c.(664-666)Atg>Gtg	p.M222V	NCK2_ENST00000522586.1_Intron|NCK2_ENST00000393349.2_Missense_Mutation_p.M222V|NCK2_ENST00000451463.2_Intron	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	222	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						GGGGGAGACCATGGAGGTGAT	0.607																																					p.M222V		.											.	NCK2-415	0			c.A664G						.						79.0	87.0	84.0					2																	106498221		2203	4300	6503	SO:0001583	missense	8440	exon3			GAGACCATGGAGG	AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.664A>G	2.37:g.106498221A>G	ENSP00000233154:p.Met222Val	Somatic	198	1		WXS	Illumina HiSeq	Phase_I	178	71	NM_001004720	0	0	60	104	44	D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	ENST00000233154.4	37	CCDS33266.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.000019	0.74818	.	.	ENSG00000071051	ENST00000233154;ENST00000393349	T;T	0.44482	0.92;0.92	5.51	5.51	0.81932	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.37679	0.1012	N	0.12443	0.215	0.80722	D	1	P	0.41420	0.749	P	0.48334	0.574	T	0.42430	-0.9452	10	0.72032	D	0.01	.	15.9183	0.79539	1.0:0.0:0.0:0.0	.	222	O43639	NCK2_HUMAN	V	222	ENSP00000233154:M222V;ENSP00000377018:M222V	ENSP00000233154:M222V	M	+	1	0	NCK2	105864653	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.848000	0.92172	2.225000	0.72522	0.379000	0.24179	ATG	.		0.607	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581	
RGPD3	653489	broad.mit.edu	37	2	107049631	107049631	+	Silent	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:107049631C>T	ENST00000409886.3	-	16	2403	c.2316G>A	c.(2314-2316)gcG>gcA	p.A772A	RGPD3_ENST00000304514.7_Silent_p.A772A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)			p.A772A(4)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTCTGAATCCGCATTTCGCA	0.373																																					p.A772A													.	RGPD3-23	4	Substitution - coding silent(4)	kidney(2)|endometrium(2)	c.G2316A						.						81.0	68.0	72.0					2																	107049631		692	1590	2282	SO:0001819	synonymous_variant	653489	exon16			TGAATCCGCATTT		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2316G>A	2.37:g.107049631C>T		Somatic	292	0		WXS	Illumina HiSeq	Phase_I	383	6	NM_001144013	0	0	0	17	17	B8ZZM4	Silent	SNP	ENST00000409886.3	37	CCDS46379.1																																																																																			.		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
ZC3H6	376940	ucsc.edu	37	2	113069433	113069433	+	Silent	SNP	G	G	A	rs529964785		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:113069433G>A	ENST00000409871.1	+	5	1067	c.666G>A	c.(664-666)ccG>ccA	p.P222P	ZC3H6_ENST00000343936.4_Silent_p.P222P	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	222							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						GTGGCTTGCCGAAGAAAATCA	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		15850	0.0		0.0	False		,,,				2504	0.001				p.P222P													.	ZC3H6-93	0			c.G666A						.						71.0	73.0	72.0					2																	113069433		1829	4080	5909	SO:0001819	synonymous_variant	376940	exon5			CTTGCCGAAGAAA	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.666G>A	2.37:g.113069433G>A		Somatic	28	0		WXS	Illumina HiSeq		37	4	NM_198581	0	0	6	6	0	A9JR71|Q6ZW96	Silent	SNP	ENST00000409871.1	37	CCDS46393.1																																																																																			.		0.348	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
CCDC108	255101	bcgsc.ca	37	2	219886565	219886565	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:219886565T>G	ENST00000341552.5	-	18	3150	c.3067A>C	c.(3067-3069)Acc>Ccc	p.T1023P	CCDC108_ENST00000441968.1_Missense_Mutation_p.T1023P|CCDC108_ENST00000453220.1_Missense_Mutation_p.T1023P	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1023						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAATAGAGGGTGCAGTTGCCG	0.612																																					p.T1023P													.	CCDC108-94	0			c.A3067C						.						139.0	141.0	140.0					2																	219886565		2203	4300	6503	SO:0001583	missense	255101	exon18			AGAGGGTGCAGTT	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.3067A>C	2.37:g.219886565T>G	ENSP00000340776:p.Thr1023Pro	Somatic	308	3		WXS	Illumina HiSeq	Phase_1	232	72	NM_194302	0	0	0	0	0	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	T	17.88	3.496937	0.64186	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.06068	3.35;3.35;3.35	5.04	2.38	0.29361	.	0.284822	0.25244	N	0.032071	T	0.11281	0.0275	M	0.67953	2.075	0.80722	D	1	D	0.54601	0.967	P	0.54372	0.75	T	0.35773	-0.9775	10	0.16896	T	0.51	-15.8016	4.6117	0.12406	0.137:0.1925:0.0:0.6705	.	1023	Q6ZU64	CC108_HUMAN	P	1023	ENSP00000340776:T1023P;ENSP00000413377:T1023P;ENSP00000409117:T1023P	ENSP00000340776:T1023P	T	-	1	0	CCDC108	219594809	0.652000	0.27349	0.997000	0.53966	0.931000	0.56810	0.091000	0.15046	0.290000	0.22444	0.533000	0.62120	ACC	.		0.612	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
COL4A4	1286	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	227872789	227872789	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:227872789A>G	ENST00000396625.3	-	47	4961	c.4754T>C	c.(4753-4755)aTc>aCc	p.I1585T	COL4A4_ENST00000329662.7_Missense_Mutation_p.I1582T	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1585	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACATGGGGGGATGGACTGGTC	0.622																																					p.I1585T													.	COL4A4-142	0			c.T4754C						.						29.0	33.0	31.0					2																	227872789		1950	4146	6096	SO:0001583	missense	1286	exon47			GGGGGGATGGACT		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4754T>C	2.37:g.227872789A>G	ENSP00000379866:p.Ile1585Thr	Somatic	80	2		WXS	Illumina HiSeq	Phase_I	50	17	NM_000092	0	0	2	7	5	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	A	17.00	3.276850	0.59758	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.95035	-3.59;-3.59	5.91	5.91	0.95273	C-type lectin fold (1);	.	.	.	.	D	0.94647	0.8274	M	0.81942	2.565	0.44890	D	0.997901	P	0.42941	0.794	B	0.40825	0.341	D	0.95012	0.8152	9	0.66056	D	0.02	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	1585	P53420	CO4A4_HUMAN	T	1585;1582	ENSP00000379866:I1585T;ENSP00000328553:I1582T	ENSP00000328553:I1582T	I	-	2	0	COL4A4	227581033	1.000000	0.71417	0.904000	0.35570	0.725000	0.41563	6.102000	0.71486	2.254000	0.74563	0.533000	0.62120	ATC	.		0.622	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
FRG1B	284802	broad.mit.edu	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr20:29628236G>C	ENST00000278882.3	+	6	618	c.238G>C	c.(238-240)Gct>Cct	p.A80P	FRG1B_ENST00000358464.4_Missense_Mutation_p.A80P|FRG1B_ENST00000439954.2_Missense_Mutation_p.A85P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	80								p.A80P(8)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGGGAAAATGGCTTTGTTGGC	0.363																																					.													.	FRG1B-22	8	Substitution - Missense(8)	prostate(4)|kidney(4)	.						.																																			SO:0001583	missense	284802	.			AAAATGGCTTTGT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.238G>C	20.37:g.29628236G>C	ENSP00000278882:p.Ala80Pro	Somatic	238	2		WXS	Illumina HiSeq	Phase_I	218	5	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	15.73	2.920277	0.52653	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.57595	0.39	2.08	2.08	0.27032	Actin cross-linking (1);	0.052409	0.85682	D	0.000000	T	0.68952	0.3057	.	.	.	0.80722	D	1	D;D	0.64830	0.994;0.988	D;D	0.85130	0.997;0.993	T	0.72766	-0.4194	9	0.87932	D	0	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	85;80	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	P	80;85;80	ENSP00000408863:A85P	ENSP00000278882:A80P	A	+	1	0	FRG1B	28241897	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCT	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
CPNE1	8904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34215310	34215310	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr20:34215310G>T	ENST00000317619.3	-	16	1522	c.1128C>A	c.(1126-1128)taC>taA	p.Y376*	CPNE1_ENST00000397443.1_Nonsense_Mutation_p.Y376*|CPNE1_ENST00000397446.1_Nonsense_Mutation_p.Y376*|CPNE1_ENST00000397445.1_Nonsense_Mutation_p.Y376*|CPNE1_ENST00000317677.5_Nonsense_Mutation_p.Y381*|CPNE1_ENST00000352393.4_Nonsense_Mutation_p.Y376*|CPNE1_ENST00000397442.1_Nonsense_Mutation_p.Y376*			Q99829	CPNE1_HUMAN	copine I	376	VWFA.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GGGCTTGGCGGTAGGCATCCA	0.562																																					p.Y381X		.											.	CPNE1-91	0			c.C1143A						.						96.0	88.0	91.0					20																	34215310		2203	4300	6503	SO:0001587	stop_gained	8904	exon14			TTGGCGGTAGGCA	U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.1128C>A	20.37:g.34215310G>T	ENSP00000326126:p.Tyr376*	Somatic	112	1		WXS	Illumina HiSeq	Phase_I	110	49	NM_003915	0	0	48	55	7	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Nonsense_Mutation	SNP	ENST00000317619.3	37	CCDS13260.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	17.22|17.22	3.333654|3.333654	0.60853|0.60853	.|.	.|.	ENSG00000214078|ENSG00000214078	ENST00000415920|ENST00000352393;ENST00000317677;ENST00000317619;ENST00000397446;ENST00000397445;ENST00000397443;ENST00000397442;ENST00000437340;ENST00000430570	.|.	.|.	.|.	4.88|4.88	0.0193|0.0193	0.14120|0.14120	.|.	.|0.000000	.|0.64402	.|U	.|0.000001	T|.	0.16385|.	0.0394|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.40831|.	-0.9542|.	3|.	.|0.02654	.|T	.|1	-11.8283|-11.8283	8.2202|8.2202	0.31537|0.31537	0.5071:0.0:0.4929:0.0|0.5071:0.0:0.4929:0.0	.|.	.|.	.|.	.|.	N|X	15|376;381;376;376;376;376;376;376;352	.|.	.|ENSP00000326126:Y376X	T|Y	-|-	2|3	0|2	CPNE1|CPNE1	33678724|33678724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	1.060000|1.060000	0.30530|0.30530	0.146000|0.146000	0.19002|0.19002	-0.213000|-0.213000	0.12676|0.12676	ACC|TAC	.		0.562	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078909.3	NM_152930	
ROMO1	140823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34288799	34288799	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr20:34288799A>G	ENST00000374078.1	+	3	391	c.211A>G	c.(211-213)Atg>Gtg	p.M71V	NFS1_ENST00000374092.4_5'Flank|ROMO1_ENST00000336695.4_Missense_Mutation_p.M71V|NFS1_ENST00000397425.1_5'Flank|NFS1_ENST00000541387.1_5'Flank|ROMO1_ENST00000374077.3_Missense_Mutation_p.M71V|ROMO1_ENST00000397416.1_Missense_Mutation_p.M71V|NFS1_ENST00000374085.1_5'Flank|ROMO1_ENST00000374072.1_3'UTR|NFS1_ENST00000540053.1_5'Flank|NFS1_ENST00000306750.3_5'Flank	NM_080748.2	NP_542786.1	P60602	ROMO1_HUMAN	reactive oxygen species modulator 1	71					cellular response to reactive oxygen species (GO:0034614)|defense response to bacterium (GO:0042742)|positive regulation of cell proliferation (GO:0008284)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|replicative cell aging (GO:0001302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				cervix(1)	1						TGGCACATTCATGGCCATTGG	0.517																																					p.M71V		.											.	ROMO1-90	0			c.A211G						.						124.0	86.0	99.0					20																	34288799		2203	4300	6503	SO:0001583	missense	140823	exon3			ACATTCATGGCCA	AK000548	CCDS13264.1	20q11.22	2008-09-30	2008-09-30	2008-09-30	ENSG00000125995	ENSG00000125995			16185	protein-coding gene	gene with protein product	"""mitochondrial targeting GXXXG protein"""		"""chromosome 20 open reading frame 52"""	C20orf52		18313394, 17537404, 16842742	Standard	NM_080748		Approved	bA353C18.2, MTGMP	uc002xdy.3	P60602	OTTHUMG00000032360	ENST00000374078.1:c.211A>G	20.37:g.34288799A>G	ENSP00000363191:p.Met71Val	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	127	49	NM_080748	0	0	105	215	110	A7M872|E1P5R9|E9KL28|Q3MHD5|Q5QP16|Q9CQ98|Q9H1N2	Missense_Mutation	SNP	ENST00000374078.1	37	CCDS13264.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442280	0.63067	.	.	ENSG00000125995	ENST00000374078;ENST00000374077;ENST00000397416;ENST00000336695	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	4.68	4.68	0.58851	.	0.039506	0.85682	D	0.000000	T	0.48059	0.1479	.	.	.	0.80722	D	1	B	0.25351	0.124	B	0.25506	0.061	T	0.52124	-0.8617	9	0.87932	D	0	.	14.3539	0.66722	1.0:0.0:0.0:0.0	.	71	P60602	ROMO1_HUMAN	V	71	ENSP00000363191:M71V;ENSP00000363190:M71V;ENSP00000380561:M71V;ENSP00000338293:M71V	ENSP00000338293:M71V	M	+	1	0	ROMO1	33752213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.080000	0.94040	1.982000	0.57802	0.529000	0.55759	ATG	.		0.517	ROMO1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000126404.1	NM_080748	
TAF4	6874	hgsc.bcm.edu	37	20	60639811	60639811	+	Missense_Mutation	SNP	C	C	A	rs545583149	byFrequency	TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr20:60639811C>A	ENST00000252996.4	-	1	1055	c.1056G>T	c.(1054-1056)caG>caT	p.Q352H	hsa-mir-3195_ENST00000585001.1_RNA	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	352					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GGGGCGCCGCCTGCACCACCC	0.816													C|||	31	0.0061901	0.0227	0.0014	5008	,	,		2060	0.0		0.0	False		,,,				2504	0.0				p.Q352H		.											.	TAF4-93	0			c.G1056T						.						1.0	2.0	2.0					20																	60639811		361	897	1258	SO:0001583	missense	6874	exon1			CGCCGCCTGCACC	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1056G>T	20.37:g.60639811C>A	ENSP00000252996:p.Gln352His	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	9	6	NM_003185	0	0	0	0	0	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	c	6.786	0.514007	0.12944	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.26223	1.75;1.77	2.3	1.19	0.21007	.	11.033200	0.01102	U	0.005396	T	0.21962	0.0529	N	0.24115	0.695	0.09310	N	0.999997	P	0.39576	0.679	B	0.38562	0.276	T	0.32052	-0.9921	10	0.44086	T	0.13	.	9.8974	0.41327	0.0:0.7883:0.2117:0.0	.	352	O00268	TAF4_HUMAN	H	352;216	ENSP00000252996:Q352H;ENSP00000399091:Q216H	ENSP00000252996:Q352H	Q	-	3	2	TAF4	60073206	0.523000	0.26274	0.074000	0.20217	0.091000	0.18340	0.327000	0.19663	-0.099000	0.12263	0.177000	0.17058	CAG	.		0.816	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
SON	6651	hgsc.bcm.edu	37	21	34948684	34948684	+	Missense_Mutation	SNP	G	G	A	rs397829693|rs34377180		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr21:34948684G>A	ENST00000356577.4	+	12	7710	c.7235G>A	c.(7234-7236)gGa>gAa	p.G2412E	SON_ENST00000381692.2_Missense_Mutation_p.G440E|SON_ENST00000290239.6_3'UTR|DONSON_ENST00000303113.6_Intron|AP000304.1_ENST00000595468.1_5'Flank|SON_ENST00000470533.1_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2412	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TTGAGAAATGGAGCCCTTACC	0.338																																					p.G2412E		.											.	SON-97	0			c.G7235A						.						55.0	55.0	55.0					21																	34948684		2201	4295	6496	SO:0001583	missense	6651	exon12			GAAATGGAGCCCT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7235G>A	21.37:g.34948684G>A	ENSP00000348984:p.Gly2412Glu	Somatic	32	2		WXS	Illumina HiSeq	Phase_I	58	10	NM_138927	0	0	0	0	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434360	0.43224	.	.	ENSG00000159140	ENST00000356577;ENST00000381692	T;T	0.69306	-0.39;-0.39	5.42	5.42	0.78866	Double-stranded RNA-binding-like (1);	0.000000	0.51477	D	0.000097	T	0.71134	0.3304	M	0.69823	2.125	0.80722	D	1	D;P	0.59767	0.986;0.799	P;B	0.50970	0.655;0.435	T	0.75127	-0.3427	10	0.87932	D	0	.	9.3335	0.38036	0.0788:0.1457:0.7755:0.0	.	440;2412	Q6ZRV7;P18583	.;SON_HUMAN	E	2412;440	ENSP00000348984:G2412E;ENSP00000371111:G440E	ENSP00000348984:G2412E	G	+	2	0	SON	33870554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.898000	0.48672	2.560000	0.86352	0.555000	0.69702	GGA	.		0.338	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
IQSEC1	9922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	12957106	12957106	+	Silent	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:12957106C>T	ENST00000273221.4	-	7	2406	c.2190G>A	c.(2188-2190)gtG>gtA	p.V730V		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	730					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTTTTTCCCCACAATGAGCT	0.602																																					p.V730V		.											.	IQSEC1-91	0			c.G2190A						.						187.0	140.0	156.0					3																	12957106		2203	4300	6503	SO:0001819	synonymous_variant	9922	exon7			TTTCCCCACAATG	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2190G>A	3.37:g.12957106C>T		Somatic	134	0		WXS	Illumina HiSeq	Phase_I	94	22	NM_014869	0	0	0	0	0	O94863|Q96D85	Silent	SNP	ENST00000273221.4	37	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	C	8.705	0.910574	0.17833	.	.	ENSG00000144711	ENST00000450726	.	.	.	4.54	3.59	0.41128	.	.	.	.	.	T	0.46132	0.1377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43393	-0.9394	4	.	.	.	.	3.2074	0.06671	0.1579:0.5539:0.1539:0.1342	.	.	.	.	R	731	.	.	G	-	1	0	IQSEC1	12932106	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	0.932000	0.28884	2.229000	0.72834	0.655000	0.94253	GGG	.		0.602	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
GOLGA4	2803	broad.mit.edu;bcgsc.ca	37	3	37369907	37369907	+	Splice_Site	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:37369907A>G	ENST00000361924.2	+	15	6314	c.5940A>G	c.(5938-5940)aaA>aaG	p.K1980K	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Splice_Site_p.K2002K	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1980	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TATTACTCAGACAGGAGCAGG	0.413																																					p.K2002K													.	GOLGA4-93	0			c.A6006G						.						152.0	156.0	155.0					3																	37369907		2203	4300	6503	SO:0001630	splice_region_variant	2803	exon16			ACTCAGACAGGAG	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.5940-1A>G	3.37:g.37369907A>G		Somatic	157	0		WXS	Illumina HiSeq	Phase_I	180	8	NM_001172713	0	0	0	0	0	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Silent	SNP	ENST00000361924.2	37	CCDS2666.1																																																																																			.		0.413	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Silent
PLXNB1	5364	bcgsc.ca	37	3	48451952	48451952	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:48451952A>C	ENST00000358536.4	-	30	5701	c.5432T>G	c.(5431-5433)gTg>gGg	p.V1811G	PLXNB1_ENST00000358459.4_Missense_Mutation_p.V1628G|PLXNB1_ENST00000456774.1_Missense_Mutation_p.V1628G|PLXNB1_ENST00000296440.6_Missense_Mutation_p.V1811G|PLXNB1_ENST00000448774.2_Missense_Mutation_p.V422G	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1811					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.V1811G(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGCCCGGCCACCCCAGACCG	0.592																																					p.V1811G													.	PLXNB1-293	1	Substitution - Missense(1)	pancreas(1)	c.T5432G						.						42.0	46.0	44.0					3																	48451952		2203	4300	6503	SO:0001583	missense	5364	exon30			CCGGCCACCCCAG	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.5432T>G	3.37:g.48451952A>C	ENSP00000351338:p.Val1811Gly	Somatic	85	2		WXS	Illumina HiSeq	Phase_1	43	19	NM_001130082	0	0	88	89	1	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.907203	0.52333	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	4.56	4.56	0.56223	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.148520	0.45867	D	0.000337	T	0.17365	0.0417	N	0.24115	0.695	0.80722	D	1	D;P	0.69078	0.997;0.5	D;B	0.70487	0.969;0.266	T	0.09684	-1.0663	10	0.22706	T	0.39	.	13.1259	0.59354	1.0:0.0:0.0:0.0	.	1811;1628	O43157;O43157-2	PLXB1_HUMAN;.	G	1811;1628;1811;422;1628	ENSP00000296440:V1811G;ENSP00000351242:V1628G;ENSP00000351338:V1811G;ENSP00000389320:V422G;ENSP00000414199:V1628G	ENSP00000296440:V1811G	V	-	2	0	PLXNB1	48426956	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.451000	0.80668	1.683000	0.51011	0.460000	0.39030	GTG	.		0.592	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
MASP1	5648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	187009418	187009418	+	Start_Codon_SNP	SNP	C	C	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:187009418C>G	ENST00000337774.5	-	1	392	c.3G>C	c.(1-3)atG>atC	p.M1I	MASP1_ENST00000169293.6_Start_Codon_SNP_p.M1I|MASP1_ENST00000392470.2_5'UTR|MASP1_ENST00000296280.6_Start_Codon_SNP_p.M1I|MASP1_ENST00000392472.2_5'UTR|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	1					complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GCACGTACCTCATTTTCCTGC	0.602																																					p.M1I		.											.	MASP1-94	0			c.G3C						.						139.0	110.0	120.0					3																	187009418		2203	4300	6503	SO:0001582	initiator_codon_variant	5648	exon1			GTACCTCATTTTC	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.3G>C	3.37:g.187009418C>G	ENSP00000336792:p.Met1Ile	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	211	46	NM_139125	0	0	0	0	0	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809999	0.31961	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000169293;ENST00000392475	D;D;T;T	0.82803	-1.65;-1.54;1.04;0.44	5.86	5.86	0.93980	.	1.114860	0.06594	N	0.752580	D	0.82518	0.5054	.	.	.	0.80722	D	1	B;B;B	0.19200	0.026;0.034;0.007	B;B;B	0.20767	0.031;0.014;0.009	T	0.64698	-0.6346	9	0.72032	D	0.01	.	17.3491	0.87318	0.0:1.0:0.0:0.0	.	1;1;1	P48740-3;P48740-2;P48740	.;.;MASP1_HUMAN	I	1	ENSP00000336792:M1I;ENSP00000296280:M1I;ENSP00000169293:M1I;ENSP00000376267:M1I	ENSP00000169293:M1I	M	-	3	0	MASP1	188492112	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.252000	0.58785	2.771000	0.95319	0.563000	0.77884	ATG	.		0.602	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	Missense_Mutation
UGDH	7358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39515753	39515753	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr4:39515753A>G	ENST00000316423.6	-	3	556	c.214T>C	c.(214-216)Tct>Cct	p.S72P	UGDH_ENST00000501493.2_Missense_Mutation_p.S72P|UGDH_ENST00000506179.1_Missense_Mutation_p.S72P|UGDH_ENST00000515398.1_5'UTR|UGDH_ENST00000507089.1_5'UTR	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	72					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)	p.S72fs*18(1)		breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						ATATTGGTAGAAAAAAAAAGA	0.299																																					p.S72P		.											.	UGDH-156	1	Deletion - Frameshift(1)	large_intestine(1)	c.T214C						.						64.0	75.0	72.0					4																	39515753		2201	4290	6491	SO:0001583	missense	7358	exon3			TGGTAGAAAAAAA	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.214T>C	4.37:g.39515753A>G	ENSP00000319501:p.Ser72Pro	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	98	40	NM_003359	0	0	11	25	14	B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	37	CCDS3455.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.642875	0.87859	.	.	ENSG00000109814	ENST00000316423;ENST00000501493;ENST00000506179;ENST00000515021;ENST00000514106;ENST00000509391;ENST00000505698	T;T;T;T;T;T;T	0.78003	-1.14;-1.13;-1.14;-1.14;-1.14;-1.14;-1.14	5.66	5.66	0.87406	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90700	0.7082	M	0.93197	3.39	0.80722	D	1	D;P	0.71674	0.998;0.752	D;B	0.73708	0.981;0.32	D	0.92839	0.6287	10	0.66056	D	0.02	-3.2805	15.077	0.72084	1.0:0.0:0.0:0.0	.	72;72	B3KUU2;O60701	.;UGDH_HUMAN	P	72;72;72;85;72;72;72	ENSP00000319501:S72P;ENSP00000422909:S72P;ENSP00000421757:S72P;ENSP00000421954:S85P;ENSP00000425834:S72P;ENSP00000422603:S72P;ENSP00000422565:S72P	ENSP00000319501:S72P	S	-	1	0	UGDH	39192148	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.263000	0.89864	2.148000	0.66965	0.454000	0.30748	TCT	.		0.299	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	NM_003359	
NAF1	92345	broad.mit.edu	37	4	164050124	164050124	+	Silent	SNP	T	T	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr4:164050124T>G	ENST00000274054.2	-	8	1603	c.1410A>C	c.(1408-1410)ccA>ccC	p.P470P	NAF1_ENST00000509434.1_Intron|NAF1_ENST00000422287.2_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	470	Pro-rich.				pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				ggggagggggtgggggtaggg	0.522																																					p.P470P													.	NAF1-70	0			c.A1410C						.						10.0	10.0	10.0					4																	164050124		2188	4274	6462	SO:0001819	synonymous_variant	92345	exon8			AGGGGGTGGGGGT		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1410A>C	4.37:g.164050124T>G		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	20	9	NM_138386	0	0	3	3	0	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	37	CCDS3803.1																																																																																			.		0.522	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
CCDC110	256309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	186380257	186380257	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr4:186380257C>A	ENST00000307588.3	-	6	1559	c.1484G>T	c.(1483-1485)aGt>aTt	p.S495I	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Missense_Mutation_p.S458I|CCDC110_ENST00000510617.1_Missense_Mutation_p.S495I	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	495						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTCTGTTTTACTTAACTTAGA	0.284																																					p.S495I		.											.	CCDC110-90	0			c.G1484T						.						30.0	30.0	30.0					4																	186380257		2201	4278	6479	SO:0001583	missense	256309	exon6			GTTTTACTTAACT	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1484G>T	4.37:g.186380257C>A	ENSP00000306776:p.Ser495Ile	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	31	12	NM_152775	0	0	5	5	0	Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	37	CCDS3843.1	.	.	.	.	.	.	.	.	.	.	C	1.946	-0.442479	0.04604	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.07444	3.19;3.2;3.2	5.96	-8.17	0.01057	.	2.119420	0.01685	N	0.026366	T	0.03178	0.0093	N	0.02539	-0.55	0.09310	N	0.999999	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.002;0.002	T	0.41466	-0.9507	10	0.32370	T	0.25	0.1051	8.9096	0.35546	0.3181:0.3017:0.3802:0.0	.	495;458;495	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	I	458;495;495	ENSP00000377172:S458I;ENSP00000306776:S495I;ENSP00000427246:S495I	ENSP00000306776:S495I	S	-	2	0	CCDC110	186617251	0.023000	0.18921	0.005000	0.12908	0.210000	0.24377	-0.152000	0.10159	-0.952000	0.03649	-0.266000	0.10368	AGT	.		0.284	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2	NM_152775	
SORBS2	8470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	186545386	186545386	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr4:186545386G>T	ENST00000284776.7	-	13	1694	c.1185C>A	c.(1183-1185)ttC>ttA	p.F395L	SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.F495L|SORBS2_ENST00000431808.1_Missense_Mutation_p.F395L|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.F299L	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	395					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TCGGGTCCGGGAAGCTATCGC	0.577																																					p.F495L	Esophageal Squamous(153;41 2433 9491 36028)	.											.	SORBS2-91	0			c.C1485A						.						62.0	58.0	59.0					4																	186545386		2203	4300	6503	SO:0001583	missense	8470	exon16			GTCCGGGAAGCTA		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1185C>A	4.37:g.186545386G>T	ENSP00000284776:p.Phe395Leu	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	70	30	NM_001270771	0	0	0	0	0	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	1.601	-0.526481	0.04141	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.35236	1.43;1.43;1.32;1.42	5.72	-0.19	0.13256	.	0.433914	0.25001	N	0.033913	T	0.23572	0.0570	L	0.50333	1.59	0.24909	N	0.992056	P;P;B	0.35612	0.512;0.512;0.329	B;B;B	0.35073	0.195;0.18;0.084	T	0.29822	-0.9999	10	0.10111	T	0.7	-15.4985	5.7099	0.17929	0.4632:0.2512:0.2856:0.0	.	299;495;395	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	L	395;395;299;495	ENSP00000284776:F395L;ENSP00000411764:F395L;ENSP00000397482:F299L;ENSP00000347852:F495L	ENSP00000284776:F395L	F	-	3	2	SORBS2	186782380	0.867000	0.29959	0.659000	0.29680	0.299000	0.27559	-0.021000	0.12504	-0.396000	0.07703	0.558000	0.71614	TTC	.		0.577	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
MTRR	4552	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	7886796	7886796	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr5:7886796A>G	ENST00000264668.2	+	8	1237	c.1207A>G	c.(1207-1209)Atc>Gtc	p.I403V	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Missense_Mutation_p.I376V	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	403	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GTGTCTTGAAATCCGAGCAAT	0.363																																					p.I403V		.											.	MTRR-91	0			c.A1207G						.						129.0	124.0	126.0					5																	7886796		2203	4300	6503	SO:0001583	missense	4552	exon8			CTTGAAATCCGAG	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1207A>G	5.37:g.7886796A>G	ENSP00000264668:p.Ile403Val	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	79	5	NM_024010	0	0	27	28	1	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.176144	0.78564	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	T;T	0.42900	0.96;0.96	5.37	5.37	0.77165	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.047649	0.85682	D	0.000000	T	0.59851	0.2224	M	0.72353	2.195	0.80722	D	1	D	0.64830	0.994	P	0.62649	0.905	T	0.62756	-0.6787	10	0.54805	T	0.06	-26.3682	12.5449	0.56193	0.8615:0.1384:0.0:0.0	.	403	Q9UBK8	MTRR_HUMAN	V	403;376	ENSP00000264668:I403V;ENSP00000402510:I376V	ENSP00000264668:I403V	I	+	1	0	MTRR	7939796	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.194000	0.65125	2.038000	0.60285	0.533000	0.62120	ATC	.		0.363	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
P4HA2	8974	broad.mit.edu	37	5	131546092	131546092	+	Silent	SNP	G	G	T	rs147510145		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr5:131546092G>T	ENST00000401867.1	-	7	1162	c.594C>A	c.(592-594)gcC>gcA	p.A198A	P4HA2_ENST00000379086.1_Silent_p.A198A|P4HA2_ENST00000360568.3_Silent_p.A198A|P4HA2_ENST00000379104.2_Silent_p.A198A|P4HA2_ENST00000379100.2_Silent_p.A198A|P4HA2_ENST00000166534.4_Silent_p.A198A			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	198					peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CCTCCTCCCCGGCATCAAGCT	0.577																																					p.A198A	Esophageal Squamous(68;117 1135 17362 19256 34242)												.	P4HA2-68	0			c.C594A						.						208.0	190.0	196.0					5																	131546092		2203	4300	6503	SO:0001819	synonymous_variant	8974	exon6			CTCCCCGGCATCA	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.594C>A	5.37:g.131546092G>T		Somatic	245	0		WXS	Illumina HiSeq	Phase_I	264	5	NM_001017974	0	0	53	53	0	D3DQ85|D3DQ86|Q8WWN0	Silent	SNP	ENST00000401867.1	37	CCDS4151.1																																																																																			A|0.000;G|1.000		0.577	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199	
FAM46A	55603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	82461655	82461655	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:82461655C>A	ENST00000320172.6	-	2	518	c.204G>T	c.(202-204)tgG>tgT	p.W68C	FAM46A_ENST00000369756.3_Missense_Mutation_p.W149C|FAM46A_ENST00000369754.3_Missense_Mutation_p.W87C	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	68					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GCACTTGCTCCCAGTTCAGCA	0.647																																					p.W68C		.											.	FAM46A-90	0			c.G204T						.						57.0	52.0	54.0					6																	82461655		2184	4283	6467	SO:0001583	missense	55603	exon2			TTGCTCCCAGTTC	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.204G>T	6.37:g.82461655C>A	ENSP00000318298:p.Trp68Cys	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	124	61	NM_017633	0	0	1	3	2	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	ENST00000320172.6	37	CCDS34489.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404404	0.62288	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.23147	1.92;1.92;1.92	5.44	5.44	0.79542	Domain of unknown function DUF1693 (1);	0.056200	0.85682	D	0.000000	T	0.47600	0.1454	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.36114	-0.9761	9	.	.	.	-2.8137	19.0555	0.93062	0.0:1.0:0.0:0.0	.	68;87	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	C	87;68;149	ENSP00000358769:W87C;ENSP00000318298:W68C;ENSP00000358771:W149C	.	W	-	3	0	FAM46A	82518374	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	5.897000	0.69831	2.837000	0.97791	0.655000	0.94253	TGG	.		0.647	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
MDN1	23195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90411386	90411386	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:90411386T>A	ENST00000369393.3	-	55	8433	c.8318A>T	c.(8317-8319)gAa>gTa	p.E2773V	MDN1_ENST00000428876.1_Missense_Mutation_p.E2773V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2773					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGTCTGAACTTCTTTGTAATA	0.418																																					p.E2773V		.											.	MDN1-100	0			c.A8318T						.						40.0	41.0	41.0					6																	90411386		2203	4300	6503	SO:0001583	missense	23195	exon55			TGAACTTCTTTGT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.8318A>T	6.37:g.90411386T>A	ENSP00000358400:p.Glu2773Val	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	52	26	NM_014611	0	0	0	0	0	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.355386	0.61293	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03801	3.8;3.8	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.05686	0.0149	L	0.27053	0.805	0.53688	D	0.999978	D	0.71674	0.998	P	0.59115	0.852	T	0.49679	-0.8914	10	0.44086	T	0.13	.	16.1255	0.81392	0.0:0.0:0.0:1.0	.	2773	Q9NU22	MDN1_HUMAN	V	2773	ENSP00000358400:E2773V;ENSP00000413970:E2773V	ENSP00000358400:E2773V	E	-	2	0	MDN1	90468107	1.000000	0.71417	0.919000	0.36401	0.880000	0.50808	7.197000	0.77814	2.205000	0.71048	0.477000	0.44152	GAA	.		0.418	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
ECHDC1	55862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	127611395	127611395	+	Silent	SNP	T	T	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:127611395T>C	ENST00000531967.1	-	6	1046	c.543A>G	c.(541-543)agA>agG	p.R181R	ECHDC1_ENST00000488087.1_5'UTR|ECHDC1_ENST00000430841.2_Silent_p.R175R|ECHDC1_ENST00000368291.2_3'UTR|ECHDC1_ENST00000309620.9_Silent_p.R158R|ECHDC1_ENST00000368289.2_3'UTR|ECHDC1_ENST00000454859.3_Silent_p.R175R|ECHDC1_ENST00000474289.2_Silent_p.R175R|ECHDC1_ENST00000454591.2_Silent_p.R100R|ECHDC1_ENST00000528402.1_3'UTR	NM_001139510.1	NP_001132982.1	Q9NTX5	ECHD1_HUMAN	enoyl CoA hydratase domain containing 1	181						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxy-lyase activity (GO:0016831)|methylmalonyl-CoA decarboxylase activity (GO:0004492)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TGTGGACGAATCTGATCTTAC	0.408																																					p.R181R		.											.	ECHDC1-90	0			c.A543G						.						65.0	58.0	60.0					6																	127611395		1869	4110	5979	SO:0001819	synonymous_variant	55862	exon6			GACGAATCTGATC	AK025796	CCDS34530.1, CCDS43504.1, CCDS47471.1, CCDS47472.1, CCDS55054.1	6q22.33	2011-12-12	2010-04-30		ENSG00000093144	ENSG00000093144			21489	protein-coding gene	gene with protein product		612136	"""enoyl Coenzyme A hydratase domain containing 1"""			22016388	Standard	NM_001002030		Approved	dJ351K20.2	uc003qax.3	Q9NTX5	OTTHUMG00000015523	ENST00000531967.1:c.543A>G	6.37:g.127611395T>C		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	93	37	NM_001139510	0	0	28	46	18	A6NFJ5|B7Z8S0|E9PEN7|E9PR31|F8W851|Q5TEF6|Q5TEF7|Q5TEG0|Q5TEG4|Q9NZ30|V9HW18	Silent	SNP	ENST00000531967.1	37	CCDS47471.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.430675	0.25726	.	.	ENSG00000093144	ENST00000436638;ENST00000460558	.	.	.	5.65	2.0	0.26442	.	.	.	.	.	T	0.44829	0.1312	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36578	-0.9742	4	.	.	.	.	9.6944	0.40147	0.0:0.2675:0.0:0.7325	.	.	.	.	G	189;54	.	.	D	-	2	0	ECHDC1	127653088	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.054000	0.30455	0.414000	0.25790	0.533000	0.62120	GAT	.		0.408	ECHDC1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042131.2		
RSPH3	83861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	159401839	159401839	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:159401839C>T	ENST00000252655.1	-	6	1441	c.1252G>A	c.(1252-1254)Gat>Aat	p.D418N	RSPH3_ENST00000367069.2_Missense_Mutation_p.D276N|RSPH3_ENST00000449822.1_Missense_Mutation_p.D180N|RSPH3_ENST00000297262.3_Missense_Mutation_p.D322N	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	418										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		TAGCCACTATCCCTGAGGCTG	0.408																																					p.D418N		.											.	RSPH3-92	0			c.G1252A						.						126.0	104.0	111.0					6																	159401839		2203	4300	6503	SO:0001583	missense	83861	exon6			CACTATCCCTGAG	AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.1252G>A	6.37:g.159401839C>T	ENSP00000252655:p.Asp418Asn	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	44	18	NM_031924	0	0	11	27	16	Q96LQ5|Q96LX2|Q9BX75	Missense_Mutation	SNP	ENST00000252655.1	37	CCDS5260.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914542	0.52546	.	.	ENSG00000130363	ENST00000367069;ENST00000449822;ENST00000252655;ENST00000297262	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.81	4.94	0.65067	.	0.362264	0.33938	N	0.004405	T	0.05502	0.0145	L	0.38175	1.15	0.38862	D	0.9565	P;B	0.36010	0.532;0.091	B;B	0.30943	0.122;0.065	T	0.28586	-1.0039	10	0.23302	T	0.38	-23.6685	12.7512	0.57310	0.0:0.9196:0.0:0.0804	.	322;418	Q86UC2-2;Q86UC2	.;RSPH3_HUMAN	N	276;180;418;322	ENSP00000356036:D276N;ENSP00000393195:D180N;ENSP00000252655:D418N;ENSP00000297262:D322N	ENSP00000252655:D418N	D	-	1	0	RSPH3	159321827	1.000000	0.71417	0.838000	0.33150	0.987000	0.75469	3.471000	0.53107	1.431000	0.47355	0.591000	0.81541	GAT	.		0.408	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924	
C7orf26	79034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6639468	6639468	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:6639468A>T	ENST00000344417.5	+	4	856	c.589A>T	c.(589-591)Att>Ttt	p.I197F	C7orf26_ENST00000472693.1_3'UTR|C7orf26_ENST00000359073.5_Missense_Mutation_p.I178F	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	197										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		AGATGACCTCATTCCACCTAT	0.498																																					p.I197F		.											.	C7orf26-91	0			c.A589T						.						172.0	159.0	164.0					7																	6639468		2203	4300	6503	SO:0001583	missense	79034	exon4			GACCTCATTCCAC	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.589A>T	7.37:g.6639468A>T	ENSP00000340220:p.Ile197Phe	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	218	126	NM_024067	0	0	0	0	0	Q9BQ43	Missense_Mutation	SNP	ENST00000344417.5	37	CCDS5353.1	.	.	.	.	.	.	.	.	.	.	A	8.056	0.767095	0.15983	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	T;T	0.42900	0.96;0.96	5.08	3.89	0.44902	.	0.136974	0.64402	D	0.000003	T	0.28764	0.0713	L	0.43152	1.355	0.40382	D	0.979454	B;B	0.32160	0.358;0.358	B;B	0.30495	0.116;0.116	T	0.06789	-1.0807	10	0.17369	T	0.5	-23.9783	5.9553	0.19269	0.7464:0.1654:0.0882:0.0	.	178;197	Q96N11-2;Q96N11	.;CG026_HUMAN	F	197;178	ENSP00000340220:I197F;ENSP00000351974:I178F	ENSP00000340220:I197F	I	+	1	0	C7orf26	6605993	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.865000	0.62998	0.995000	0.38917	0.454000	0.30748	ATT	.		0.498	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246844.2	NM_024067	
HDAC9	9734	broad.mit.edu;bcgsc.ca	37	7	18625059	18625059	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:18625059C>T	ENST00000432645.2	+	2	178	c.178C>T	c.(178-180)Cag>Tag	p.Q60*	HDAC9_ENST00000417496.2_Nonsense_Mutation_p.Q102*|HDAC9_ENST00000524023.1_Nonsense_Mutation_p.Q29*|HDAC9_ENST00000406072.1_Nonsense_Mutation_p.Q88*|HDAC9_ENST00000476135.1_3'UTR|HDAC9_ENST00000441542.2_Nonsense_Mutation_p.Q60*|HDAC9_ENST00000405010.3_Nonsense_Mutation_p.Q60*|HDAC9_ENST00000401921.1_Nonsense_Mutation_p.Q60*|HDAC9_ENST00000406451.4_Nonsense_Mutation_p.Q60*|HDAC9_ENST00000456174.2_Nonsense_Mutation_p.Q29*|HDAC9_ENST00000428307.2_Nonsense_Mutation_p.Q60*	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	60					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GCAACAAATCCAGAAGCAGCT	0.493																																					p.Q102X													.	HDAC9-227	0			c.C304T						.						59.0	61.0	61.0					7																	18625059		2006	4193	6199	SO:0001587	stop_gained	9734	exon5			CAAATCCAGAAGC	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.178C>T	7.37:g.18625059C>T	ENSP00000410337:p.Gln60*	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	100	6	NM_001204144	0	0	9	10	1	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Nonsense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041834	0.93685	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000413509;ENST00000413380;ENST00000430454;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000441986;ENST00000456174;ENST00000524023;ENST00000341009	.	.	.	5.93	5.93	0.95920	.	0.000000	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.9728	20.3368	0.98748	0.0:1.0:0.0:0.0	.	.	.	.	X	102;105;60;60;29;60;60;60;88;60;60;60;29;29;29;60	.	ENSP00000262069:Q105X	Q	+	1	0	HDAC9	18591584	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.805000	0.96524	0.655000	0.94253	CAG	.		0.493	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
HERPUD2	64224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	35707133	35707133	+	Silent	SNP	A	A	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:35707133A>G	ENST00000396081.1	-	4	1209	c.405T>C	c.(403-405)ggT>ggC	p.G135G	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Silent_p.G135G	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	135	Ser-rich.				response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						CTGAGGAAGAACCCACAGCTA	0.398																																					p.G135G		.											.	HERPUD2-93	0			c.T405C						.						143.0	130.0	134.0					7																	35707133		2203	4300	6503	SO:0001819	synonymous_variant	64224	exon5			GGAAGAACCCACA	BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.405T>C	7.37:g.35707133A>G		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	179	111	NM_022373	0	0	9	38	29	A4D1Y8|Q9H6F9	Silent	SNP	ENST00000396081.1	37	CCDS5446.1																																																																																			.		0.398	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
ZAN	7455	bcgsc.ca	37	7	100350046	100350046	+	RNA	SNP	T	T	C	rs371312343		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:100350046T>C	ENST00000348028.3	+	0	2483				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CCAGAAAAACTCACCATCCCC	0.537																																					.													.	ZAN-142	0			.						.						158.0	177.0	171.0					7																	100350046		1838	4075	5913			7455	.			AAAAACTCACCAT	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350046T>C		Somatic	136	6		WXS	Illumina HiSeq	Phase_1	227	22	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	2.500	-0.315310	0.05422	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.74106	-0.81;0.11;-0.81	4.22	2.38	0.29361	.	.	.	.	.	T	0.50990	0.1648	N	0.05124	-0.11	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.34825	-0.9813	9	0.30854	T	0.27	.	8.1984	0.31411	0.0:0.7164:0.0:0.2836	.	773;773	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	773	ENSP00000445943:L773P;ENSP00000445091:L773P;ENSP00000444427:L773P	ENSP00000423579:L773P	L	+	2	0	ZAN	100187982	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.247000	0.08866	0.145000	0.18977	-0.128000	0.14901	CTC	.		0.537	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
MUC17	140453	broad.mit.edu	37	7	100681919	100681919	+	Missense_Mutation	SNP	C	C	T	rs200222893		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:100681919C>T	ENST00000306151.4	+	3	7286	c.7222C>T	c.(7222-7224)Ccg>Tcg	p.P2408S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2408	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGCACCATGCCGGTGGTCAG	0.512																																					p.P2408S													.	MUC17-95	0			c.C7222T						.						380.0	361.0	367.0					7																	100681919		2203	4300	6503	SO:0001583	missense	140453	exon3			ACCATGCCGGTGG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7222C>T	7.37:g.100681919C>T	ENSP00000302716:p.Pro2408Ser	Somatic	585	0		WXS	Illumina HiSeq	Phase_I	841	6	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	4.830	0.154397	0.09236	.	.	ENSG00000169876	ENST00000306151	T	0.03152	4.03	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.05456	0.0144	L	0.34521	1.04	0.09310	N	1	D	0.57571	0.98	P	0.59424	0.857	T	0.25082	-1.0142	9	0.07813	T	0.8	.	5.9248	0.19104	0.0:0.9993:0.0:7.0E-4	.	2408	Q685J3	MUC17_HUMAN	S	2408	ENSP00000302716:P2408S	ENSP00000302716:P2408S	P	+	1	0	MUC17	100468639	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-3.185000	0.00567	0.132000	0.18615	0.134000	0.15878	CCG	.		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
PCMTD1	115294	broad.mit.edu	37	8	52733204	52733204	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr8:52733204C>G	ENST00000360540.5	-	7	1187	c.781G>C	c.(781-783)Gat>Cat	p.D261H	PCMTD1_ENST00000544451.1_Missense_Mutation_p.D185H|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Missense_Mutation_p.D261H	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	261						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TGCATCTCATCATTTATGAAA	0.403																																					p.D261H													.	PCMTD1-68	0			c.G781C						.						88.0	92.0	91.0					8																	52733204		2203	4300	6503	SO:0001583	missense	115294	exon6			TCTCATCATTTAT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.781G>C	8.37:g.52733204C>G	ENSP00000353739:p.Asp261His	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	197	9	NM_052937	0	0	29	29	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278887	0.80692	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.42513	0.97;0.97;0.97	5.77	5.77	0.91146	.	0.053651	0.85682	D	0.000000	T	0.51176	0.1659	N	0.22421	0.69	0.58432	D	0.999999	P;D;B	0.69078	0.895;0.997;0.26	P;D;B	0.63192	0.498;0.912;0.104	T	0.50363	-0.8837	10	0.49607	T	0.09	-23.9815	19.9832	0.97338	0.0:1.0:0.0:0.0	.	131;185;261	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	H	261;185;261	ENSP00000353739:D261H;ENSP00000444026:D185H;ENSP00000428099:D261H	ENSP00000353739:D261H	D	-	1	0	PCMTD1	52895757	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.317000	0.65822	2.722000	0.93159	0.655000	0.94253	GAT	.		0.403	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
NSMAF	8439	broad.mit.edu	37	8	59498243	59498243	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr8:59498243G>T	ENST00000038176.3	-	30	2839	c.2627C>A	c.(2626-2628)gCa>gAa	p.A876E	NSMAF_ENST00000427130.2_Missense_Mutation_p.A907E	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	876					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				ACTGATTTTTGCTCCAAGGAG	0.448																																					p.A907E													.	NSMAF-91	0			c.C2720A						.						109.0	99.0	102.0					8																	59498243		2203	4300	6503	SO:0001583	missense	8439	exon30			ATTTTTGCTCCAA	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.2627C>A	8.37:g.59498243G>T	ENSP00000038176:p.Ala876Glu	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	125	5	NM_001144772	0	0	15	15	0	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.039039	0.35989	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.28895	1.59;1.59	5.64	3.74	0.42951	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.224726	0.46758	D	0.000264	T	0.21550	0.0519	N	0.22421	0.69	0.38053	D	0.935829	B;B	0.30361	0.277;0.03	B;B	0.29942	0.109;0.018	T	0.09596	-1.0667	9	.	.	.	.	15.672	0.77286	0.0:0.6781:0.3219:0.0	.	907;876	Q92636-2;Q92636	.;FAN_HUMAN	E	876;907	ENSP00000038176:A876E;ENSP00000411012:A907E	.	A	-	2	0	NSMAF	59660797	1.000000	0.71417	0.991000	0.47740	0.881000	0.50899	2.836000	0.48183	1.527000	0.49086	0.563000	0.77884	GCA	.		0.448	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
WWP1	11059	ucsc.edu	37	8	87392964	87392964	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr8:87392964C>A	ENST00000517970.1	+	4	387	c.80C>A	c.(79-81)gCc>gAc	p.A27D	WWP1_ENST00000349423.2_Intron|WWP1_ENST00000265428.4_Missense_Mutation_p.A27D|WWP1_ENST00000341922.2_Missense_Mutation_p.A27D|WWP1_ENST00000523863.1_3'UTR	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	27	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GTTTCTAGTGCCAAACTTAAA	0.338																																					p.A27D													.	WWP1-659	0			c.C80A						.						60.0	58.0	58.0					8																	87392964		2203	4300	6503	SO:0001583	missense	11059	exon4			CTAGTGCCAAACT	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.80C>A	8.37:g.87392964C>A	ENSP00000427793:p.Ala27Asp	Somatic	25	0		WXS	Illumina HiSeq		40	4	NM_007013	0	0	0	0	0	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	ENST00000517970.1	37	CCDS6242.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.780760	0.70222	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000436619	T;T;T	0.80994	-1.44;-1.44;-1.44	5.8	5.8	0.92144	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.91284	0.7252	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91473	0.5198	10	0.62326	D	0.03	.	20.0503	0.97624	0.0:1.0:0.0:0.0	.	27	Q9H0M0	WWP1_HUMAN	D	27	ENSP00000427793:A27D;ENSP00000265428:A27D;ENSP00000340564:A27D	ENSP00000265428:A27D	A	+	2	0	WWP1	87462080	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.926000	0.75835	2.736000	0.93811	0.591000	0.81541	GCC	.		0.338	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
TAF1L	138474	bcgsc.ca	37	9	32635283	32635283	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:32635283A>C	ENST00000242310.4	-	1	384	c.295T>G	c.(295-297)Tgg>Ggg	p.W99G	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	99					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTCCTAATCCACCCTTCATCA	0.522																																					p.W99G													.	TAF1L-870	0			c.T295G						.						235.0	223.0	227.0					9																	32635283		2203	4300	6503	SO:0001583	missense	138474	exon1			TAATCCACCCTTC	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.295T>G	9.37:g.32635283A>C	ENSP00000418379:p.Trp99Gly	Somatic	312	3		WXS	Illumina HiSeq	Phase_1	229	62	NM_153809	0	0	0	0	0	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.191108	0.38707	.	.	ENSG00000122728	ENST00000242310	T	0.08008	3.14	1.16	1.16	0.20824	.	0.000000	0.85682	D	0.000000	T	0.10208	0.0250	M	0.67953	2.075	0.42246	D	0.991958	P	0.38395	0.629	B	0.43331	0.416	T	0.13629	-1.0502	10	0.31617	T	0.26	.	3.0458	0.06153	0.7174:0.0:0.2826:0.0	.	99	Q8IZX4	TAF1L_HUMAN	G	99	ENSP00000418379:W99G	ENSP00000418379:W99G	W	-	1	0	TAF1L	32625283	1.000000	0.71417	0.951000	0.38953	0.358000	0.29455	2.430000	0.44766	0.505000	0.28104	0.329000	0.21502	TGG	.		0.522	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
RUSC2	9853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35560975	35560975	+	Silent	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:35560975G>A	ENST00000455600.1	+	11	4799	c.4230G>A	c.(4228-4230)ctG>ctA	p.L1410L	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1410						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CGGACTGGCTGAGCCTGGACA	0.662																																					p.L1410L		.											.	RUSC2-91	0			c.G4230A						.						33.0	39.0	37.0					9																	35560975		2203	4300	6503	SO:0001819	synonymous_variant	9853	exon11			CTGGCTGAGCCTG	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.4230G>A	9.37:g.35560975G>A		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	52	24	NM_014806	0	0	18	32	14	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	37	CCDS35008.1																																																																																			.		0.662	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
GAPVD1	26130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	128117063	128117063	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:128117063G>A	ENST00000495955.1	+	24	4044	c.3754G>A	c.(3754-3756)Gtc>Atc	p.V1252I	GAPVD1_ENST00000312123.9_Missense_Mutation_p.V1213I|GAPVD1_ENST00000470056.1_Missense_Mutation_p.V1207I|GAPVD1_ENST00000394083.2_Missense_Mutation_p.V1186I|GAPVD1_ENST00000297933.6_Missense_Mutation_p.V1234I|GAPVD1_ENST00000394104.2_Missense_Mutation_p.V1252I|GAPVD1_ENST00000265956.4_Missense_Mutation_p.V1226I|GAPVD1_ENST00000394105.2_Missense_Mutation_p.V1261I			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1252					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTTTACCACTGTCTGTGTGAG	0.423																																					p.V1261I		.											.	GAPVD1-93	0			c.G3781A						.						176.0	176.0	176.0					9																	128117063		2203	4300	6503	SO:0001583	missense	26130	exon23			ACCACTGTCTGTG		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.3754G>A	9.37:g.128117063G>A	ENSP00000419063:p.Val1252Ile	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	177	70	NM_015635	0	0	11	20	9	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.	.	.	.	.	.	.	.	.	.	G	27.7	4.856083	0.91355	.	.	ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000297933;ENST00000312123	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.63546	0.2520	L	0.47716	1.5	0.80722	D	1	P;P;P;P;P;P	0.39404	0.542;0.604;0.672;0.672;0.672;0.528	B;B;B;B;B;B	0.42282	0.213;0.205;0.382;0.382;0.382;0.382	T	0.62124	-0.6920	9	0.48119	T	0.1	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	1252;267;1207;1213;1234;1261	Q14C86;B3KTX2;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	GAPD1_HUMAN;.;.;.;.;.	I	1207;1261;1252;1226;1186;1252;1234;1213	.	ENSP00000265956:V1226I	V	+	1	0	GAPVD1	127156884	1.000000	0.71417	0.981000	0.43875	0.965000	0.64279	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GTC	.		0.423	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
ARRDC1	92714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	140508526	140508526	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:140508526C>A	ENST00000371421.4	+	5	542	c.478C>A	c.(478-480)Ctg>Atg	p.L160M	ARRDC1_ENST00000491911.1_3'UTR|C9orf37_ENST00000496793.1_5'Flank	NM_152285.2	NP_689498.1	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1	160						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		CTCCTACAAGCTGGTGAAGAC	0.637																																					p.L160M		.											.	ARRDC1-90	0			c.C478A						.						99.0	95.0	96.0					9																	140508526		2203	4300	6503	SO:0001583	missense	92714	exon5			TACAAGCTGGTGA	AJ420420	CCDS7049.1	9q34.3	2013-10-11			ENSG00000197070	ENSG00000197070			28633	protein-coding gene	gene with protein product	"""alpha-arrestin 1"""					23886940	Standard	XM_005266119		Approved	MGC40555	uc004cns.3	Q8N5I2	OTTHUMG00000020993	ENST00000371421.4:c.478C>A	9.37:g.140508526C>A	ENSP00000360475:p.Leu160Met	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	183	61	NM_152285	0	0	44	82	38		Missense_Mutation	SNP	ENST00000371421.4	37	CCDS7049.1	.	.	.	.	.	.	.	.	.	.	c	19.88	3.909911	0.72983	.	.	ENSG00000197070	ENST00000371421;ENST00000431925	T;T	0.53206	3.16;0.63	5.47	4.38	0.52667	Immunoglobulin E-set (1);	0.141252	0.49305	D	0.000154	T	0.67411	0.2890	M	0.76838	2.35	0.51767	D	0.999938	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66756	-0.5843	10	0.36615	T	0.2	-7.9494	14.2819	0.66219	0.0:0.9154:0.0:0.0846	.	49;177;160	Q59FD7;Q5T371;Q8N5I2	.;.;ARRD1_HUMAN	M	160;177	ENSP00000360475:L160M;ENSP00000406247:L177M	ENSP00000360475:L160M	L	+	1	2	ARRDC1	139628347	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.922000	0.40045	2.582000	0.87167	0.555000	0.69702	CTG	.		0.637	ARRDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055358.1	NM_152285	
SUPT20HL1	100130302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	24381817	24381817	+	IGR	SNP	G	G	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chrX:24381817G>T								AC004552.1 (14794 upstream) : PDK3 (101520 downstream)																							ACTTGCTAAAGGGTATCAGTC	0.537																																					p.G314W		.											.	.	0			c.G940T						.						141.0	117.0	125.0					X																	24381817		1568	3578	5146	SO:0001628	intergenic_variant	100130302	exon1			GCTAAAGGGTATC																													X.37:g.24381817G>T		Somatic	185	0		WXS	Illumina HiSeq	Phase_I	181	119	NM_001136234	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.537								
ZXDB	158586	hgsc.bcm.edu	37	X	57618845	57618845	+	Missense_Mutation	SNP	G	G	A	rs199513692		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chrX:57618845G>A	ENST00000374888.1	+	1	577	c.364G>A	c.(364-366)Gag>Aag	p.E122K		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.E122K(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						GGAGGAGGCCGAGGAGGGCCC	0.756																																					p.E122K		.											.	ZXDB-130	1	Substitution - Missense(1)	skin(1)	c.G364A						.						3.0	4.0	4.0					X																	57618845		1773	3669	5442	SO:0001583	missense	158586	exon1			GAGGCCGAGGAGG	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.364G>A	X.37:g.57618845G>A	ENSP00000364023:p.Glu122Lys	Somatic	9	2		WXS	Illumina HiSeq	Phase_I	18	6	NM_007157	0	0	0	0	0	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	8.440	0.850716	0.17034	.	.	ENSG00000198455	ENST00000374888	T	0.33865	1.39	2.93	2.93	0.34026	.	1.203730	0.05881	N	0.626423	T	0.25827	0.0629	L	0.27053	0.805	0.09310	N	0.999999	B	0.32071	0.355	B	0.19946	0.027	T	0.13710	-1.0499	10	0.28530	T	0.3	.	11.3184	0.49405	0.0:0.0:1.0:0.0	.	122	P98169	ZXDB_HUMAN	K	122	ENSP00000364023:E122K	ENSP00000364023:E122K	E	+	1	0	ZXDB	57635570	0.001000	0.12720	0.635000	0.29338	0.079000	0.17450	0.974000	0.29436	1.402000	0.46780	0.556000	0.70494	GAG	.		0.756	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
GLUD2	2747	ucsc.edu	37	X	120182120	120182120	+	Silent	SNP	C	C	T			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chrX:120182120C>T	ENST00000328078.1	+	1	659	c.582C>T	c.(580-582)acC>acT	p.T194T		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	194					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AGAACTATACCGAAAATGAAT	0.453																																					p.T194T													.	GLUD2-131	0			c.C582T						.						123.0	96.0	105.0					X																	120182120		2203	4300	6503	SO:0001819	synonymous_variant	2747	exon1			CTATACCGAAAAT	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.582C>T	X.37:g.120182120C>T		Somatic	112	0		WXS	Illumina HiSeq		92	2	NM_012084	0	0	2	2	0	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1																																																																																			.		0.453	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
CDHR5	53841	broad.mit.edu	37	11	618807	618807	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:618807delG	ENST00000358353.3	-	14	2074	c.1752delC	c.(1750-1752)cccfs	p.P584fs	IRF7_ENST00000397562.3_5'Flank|IRF7_ENST00000397570.1_5'Flank|IRF7_ENST00000330243.5_5'Flank|CDHR5_ENST00000397542.2_Frame_Shift_Del_p.P584fs|IRF7_ENST00000397574.2_5'Flank|CDHR5_ENST00000349570.7_Intron			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	584	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						TTCCCATACTGGGGGGCATCG	0.677																																					p.P584fs													.	CDHR5-90	0			c.1752delC						.						103.0	110.0	108.0					11																	618807		2203	4300	6503	SO:0001589	frameshift_variant	53841	exon13			CATACTGGGGGGC	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1752delC	11.37:g.618807delG	ENSP00000351118:p.Pro584fs	Somatic	289	0		WXS	Illumina HiSeq	Phase_I	254	7	NM_021924	0	0	0	0	0	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Frame_Shift_Del	DEL	ENST00000358353.3	37	CCDS7707.1																																																																																			.		0.677	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
PUS3	83480	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	125765906	125765922	+	Frame_Shift_Del	DEL	TCTCTTCAATGGTATTA	TCTCTTCAATGGTATTA	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	TCTCTTCAATGGTATTA	TCTCTTCAATGGTATTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr11:125765906_125765922delTCTCTTCAATGGTATTA	ENST00000530811.1	-	1	303_319	c.258_274delTAATACCATTGAAGAGA	c.(256-276)aataataccattgaagagaaafs	p.NNTIEE86fs	PUS3_ENST00000227474.3_Frame_Shift_Del_p.NNTIEE86fs|HYLS1_ENST00000356438.3_Intron|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000425380.2_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	86					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		TCAAACAGTTTCTCTTCAATGGTATTATTTGTGTTTT	0.447																																					p.86_92del		.											.	PUS3-91	0			c.258_274del						.																																			SO:0001589	frameshift_variant	83480	exon2			.	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.258_274delTAATACCATTGAAGAGA	11.37:g.125765906_125765922delTCTCTTCAATGGTATTA	ENSP00000432386:p.Asn86fs	Somatic	236	0		WXS	Illumina HiSeq	Phase_I	194	60	NM_031307	0	0	0	0	0	B2RAM0|Q96D17|Q96J23|Q96NB4	Frame_Shift_Del	DEL	ENST00000530811.1	37	CCDS8466.1																																																																																			.		0.447	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	NM_031307	
KRR1	11103	hgsc.bcm.edu	37	12	75900389	75900560	+	Splice_Site	DEL	CCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTA	CCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTA	-	rs35071517|rs371478640|rs200776725|rs140710432|rs201846221|rs562964328|rs398020160|rs201412928	byFrequency	TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	CCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTA	CCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr12:75900389_75900560delCCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTA	ENST00000229214.4	-	4	417	c.394delTAAATCTAGAATTACAGAGACTTTGCTTTGTTTGCATCAGTGTTAACCTATAACATCCCACCATCAAGTTTTCATATTTGTGCTTAGGTAACAATAGCGTGGGCCTGGAAAATGAATGTAATTGTAAAAAATGTTGATAATGTCTTCTTTTTTTTTTTTTTTTTGCAAAAGG	c.(394-396)taa>aa	p.*132fs	KRR1_ENST00000438169.2_Splice_Site_p.*132fs	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	132					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						ATTCGTACTGCCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTACCTGTTCAAA	0.331																																					p.132_132del		.											.	KRR1-92	0			c.394_394del						.																																			SO:0001630	splice_region_variant	11103	exon4			.	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.394-1TAAATCTAGAATTACAGAGACTTTGCTTTGTTTGCATCAGTGTTAACCTATAACATCCCACCATCAAGTTTTCATATTTGTGCTTAGGTAACAATAGCGTGGGCCTGGAAAATGAATGTAATTGTAAAAAATGTTGATAATGTCTTCTTTTTTTTTTTTTTTTTGCAAAAGG>-	12.37:g.75900389_75900560delCCTTTTGCAAAAAAAAAAAAAAAAAGAAGACATTATCAACATTTTTTACAATTACATTCATTTTCCAGGCCCACGCTATTGTTACCTAAGCACAAATATGAAAACTTGATGGTGGGATGTTATAGGTTAACACTGATGCAAACAAAGCAAAGTCTCTGTAATTCTAGATTTA		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	117	20	NM_007043	0	0	0	0	0	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Frame_Shift_Del	DEL	ENST00000229214.4	37	CCDS9012.1																																																																																			.		0.331	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405727.1	NM_007043	Frame_Shift_Del
SENP8	123228	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	72432229	72432229	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr15:72432229delG	ENST00000542035.2	+	2	598	c.265delG	c.(265-267)gccfs	p.A89fs	SENP8_ENST00000544411.1_Frame_Shift_Del_p.A89fs|RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000544171.1_Frame_Shift_Del_p.A89fs|SENP8_ENST00000340912.4_Frame_Shift_Del_p.A89fs	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	89	Protease.						cysteine-type peptidase activity (GO:0008234)			breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						TGTATTTTTAGCCATCAATGA	0.448																																					p.A89fs		.											.	SENP8-660	0			c.265delG						.						100.0	99.0	99.0					15																	72432229		2199	4297	6496	SO:0001589	frameshift_variant	123228	exon2			.	BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.265delG	15.37:g.72432229delG	ENSP00000446057:p.Ala89fs	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	114	53	NM_001166340	0	0	0	0	0	Q96QA4	Frame_Shift_Del	DEL	ENST00000542035.2	37	CCDS10240.1																																																																																			.		0.448	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420036.1	NM_145204	
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	3924472	3924472	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:3924472delT	ENST00000381638.2	-	45	7479	c.7355delA	c.(7354-7356)aagfs	p.K2452fs		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2452							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GGGGTCCAGCTTTTTCTGCTC	0.582																																					p.K2452fs		.											.	ZZEF1-93	0			c.7355delA						.						113.0	109.0	110.0					17																	3924472		2203	4300	6503	SO:0001589	frameshift_variant	23140	exon45			.	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7355delA	17.37:g.3924472delT	ENSP00000371051:p.Lys2452fs	Somatic	235	0		WXS	Illumina HiSeq	Phase_I	375	106	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Frame_Shift_Del	DEL	ENST00000381638.2	37	CCDS11043.1																																																																																			.		0.582	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
TRIM37	4591	broad.mit.edu;bcgsc.ca	37	17	57078973	57078974	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr17:57078973_57078974delTG	ENST00000262294.7	-	23	3056_3057	c.2797_2798delCA	c.(2797-2799)cagfs	p.Q933fs	TRIM37_ENST00000393066.3_Frame_Shift_Del_p.Q933fs|TRIM37_ENST00000376149.3_Intron|TRIM37_ENST00000393065.2_Frame_Shift_Del_p.Q899fs	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	933					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					ATCCGGGGGCTGTGTCATGACC	0.485									Mulibrey Nanism																												p.933_933del													.	TRIM37-660	0			c.2797_2798del						.																																			SO:0001589	frameshift_variant	4591	exon23	Familial Cancer Database	Perheentupa syndrome	GGGGGCTGTGTCA	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.2797_2798delCA	17.37:g.57078975_57078976delTG	ENSP00000262294:p.Gln933fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	188	20	NM_015294	0	0	0	0	0	Q7Z3E6|Q8IYF7|Q8WYF7	Frame_Shift_Del	DEL	ENST00000262294.7	37	CCDS32694.1																																																																																			.		0.485	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294	
SMCHD1	23347	broad.mit.edu	37	18	2666935	2666935	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr18:2666935delC	ENST00000320876.6	+	3	667	c.329delC	c.(328-330)gctfs	p.A110fs	SMCHD1_ENST00000261598.8_Frame_Shift_Del_p.A110fs	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	110					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CTACTGACAGCTACGAAAGAA	0.388																																					p.A110fs													.	SMCHD1-46	0			c.329delC						.						113.0	100.0	104.0					18																	2666935		1920	4143	6063	SO:0001589	frameshift_variant	23347	exon3			TGACAGCTACGAA	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.329delC	18.37:g.2666935delC	ENSP00000326603:p.Ala110fs	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	21	8	NM_015295	0	0	0	0	0	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Frame_Shift_Del	DEL	ENST00000320876.6	37	CCDS45822.1																																																																																			.		0.388	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
CABLES1	91768	broad.mit.edu	37	18	20716015	20716023	+	In_Frame_Del	DEL	GGCGCCGGC	GGCGCCGGC	-	rs201595073|rs139352344	byFrequency	TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	GGCGCCGGC	GGCGCCGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr18:20716015_20716023delGGCGCCGGC	ENST00000256925.7	+	1	289_297	c.289_297delGGCGCCGGC	c.(289-297)ggcgccggcdel	p.GAG97del	CABLES1_ENST00000400473.2_Intron|AC105247.1_ENST00000411067.1_RNA	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	97	Ala-rich.|Interacts with TDRD7. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ggccaagccgggcgccggcggcgcctgcg	0.785														1123	0.224241	0.2602	0.17	5008	,	,		3844	0.244		0.2048	False		,,,				2504	0.2137				p.97_99del													.	CABLES1-522	0			c.289_297del						.																																			SO:0001651	inframe_deletion	91768	exon1			AAGCCGGGCGCCG	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.289_297delGGCGCCGGC	18.37:g.20716015_20716023delGGCGCCGGC	ENSP00000256925:p.Gly97_Gly99del	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	9	7	NM_001100619	0	0	0	0	0	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	In_Frame_Del	DEL	ENST00000256925.7	37	CCDS42417.1																																																																																			.		0.785	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375	
HLA-B	3106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31323288	31323288	+	Frame_Shift_Del	DEL	G	G	-	rs74428022		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr6:31323288delG	ENST00000412585.2	-	4	729	c.701delC	c.(700-702)cctfs	p.P234fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	234	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GATCTCCGCAGGGTAGAAACC	0.587									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.P234fs		.											.	HLA-B-90	0			c.701delC						.						83.0	82.0	82.0					6																	31323288		2203	4298	6501	SO:0001589	frameshift_variant	3106	exon4	Familial Cancer Database	;Lichen Sclerosis, Familial	.	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.701delC	6.37:g.31323288delG	ENSP00000399168:p.Pro234fs	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	162	72	NM_005514	0	0	0	0	0	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.587	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
EPHB4	2050	broad.mit.edu;bcgsc.ca	37	7	100404084	100404104	+	In_Frame_Del	DEL	CATCACCTCCCACATCACAAT	CATCACCTCCCACATCACAAT	-	rs199910843		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	CATCACCTCCCACATCACAAT	CATCACCTCCCACATCACAAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:100404084_100404104delCATCACCTCCCACATCACAAT	ENST00000358173.3	-	14	2890_2910	c.2422_2442delATTGTGATGTGGGAGGTGATG	c.(2422-2442)attgtgatgtgggaggtgatgdel	p.IVMWEVM808del	EPHB4_ENST00000360620.3_In_Frame_Del_p.IVMWEVM808del	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	808	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCCAAATGACATCACCTCCCACATCACAATCCCGTAACTC	0.552																																					p.808_814del	GBM(200;2113 3072 25865 52728)												.	EPHB4-1446	0			c.2422_2442del						.																																			SO:0001651	inframe_deletion	2050	exon14			AAATGACATCACC	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2422_2442delATTGTGATGTGGGAGGTGATG	7.37:g.100404084_100404104delCATCACCTCCCACATCACAAT	ENSP00000350896:p.Ile808_Met814del	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	159	14	NM_004444	0	0	0	0	0	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	In_Frame_Del	DEL	ENST00000358173.3	37	CCDS5706.1																																																																																			.		0.552	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
TRIM14	9830	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	100862406	100862406	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr9:100862406delA	ENST00000341469.2	-	3	353	c.344delT	c.(343-345)ttcfs	p.F115fs	TRIM14_ENST00000375098.3_Frame_Shift_Del_p.F115fs|TRIM14_ENST00000342043.3_Frame_Shift_Del_p.F115fs	NM_014788.2	NP_055603.2	Q14142	TRI14_HUMAN	tripartite motif containing 14	115					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(62;0.0559)				GAGTTCAGTGAATTTCCCCTT	0.433																																					p.F115fs	Colon(14;460 597 13826 51781)	.											.	TRIM14-226	0			c.344delT						.						113.0	105.0	108.0					9																	100862406		2203	4300	6503	SO:0001589	frameshift_variant	9830	exon3			.	AF220130	CCDS6734.1	9q31.1	2011-04-20	2011-01-25		ENSG00000106785	ENSG00000106785		"""Tripartite motif containing / Tripartite motif containing"""	16283	protein-coding gene	gene with protein product		606556	"""tripartite motif-containing 14"""			11331580	Standard	XM_005252320		Approved	KIAA0129	uc004ayd.2	Q14142	OTTHUMG00000020339	ENST00000341469.2:c.344delT	9.37:g.100862406delA	ENSP00000344208:p.Phe115fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	111	52	NM_033219	0	0	0	0	0	A8K9W0|E7EQC4|F8W956|Q548W9|Q5TBQ8|Q6ZWL7|Q9BRD8|Q9C020	Frame_Shift_Del	DEL	ENST00000341469.2	37	CCDS6734.1																																																																																			.		0.433	TRIM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053350.1	NM_014788	
AMY1B	277	hgsc.bcm.edu	37	1	104231690	104231691	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr1:104231690_104231691insA	ENST00000330330.5	-	10	1529_1530	c.1235_1236insT	c.(1234-1236)ttcfs	p.F412fs	AMY1B_ENST00000370080.3_Frame_Shift_Ins_p.F412fs	NM_001008218.1	NP_001008219.1	P04745	AMY1_HUMAN	amylase, alpha 1B (salivary)	412					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		CTACATTGCGGAAATTAACCAT	0.356																																					p.F412fs		.											.	.	0			c.1236_1237insT						.																																			SO:0001589	frameshift_variant	278	exon10			.		CCDS30783.1	1p21	2012-10-02	2007-05-03		ENSG00000174876	ENSG00000174876	3.2.1.1		475	protein-coding gene	gene with protein product		104701	"""amylase, alpha 1B; salivary"""	AMY1			Standard	XM_005270758		Approved			P04745	OTTHUMG00000011021	ENST00000330330.5:c.1236dupT	1.37:g.104231693_104231693dupA	ENSP00000330484:p.Phe412fs	Somatic	315	0		WXS	Illumina HiSeq	Phase_I	357	54	NM_001008219	0	0	0	0	0	A6NJS5|A8K8H6|Q13763|Q5T083	Frame_Shift_Ins	INS	ENST00000330330.5	37	CCDS30783.1																																																																																			.		0.356	AMY1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030309.1	NM_001008218	
TMCO3	55002	bcgsc.ca	37	13	114188424	114188425	+	In_Frame_Ins	INS	-	-	TTTTTTTTTTTT	rs141899812		TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr13:114188424_114188425insTTTTTTTTTTTT	ENST00000434316.2	+	9	1767_1768	c.1408_1409insTTTTTTTTTTTT	c.(1408-1410)gtt>gTTTTTTTTTTTTtt	p.470_471insFFFF	TMCO3_ENST00000474393.1_3'UTR|TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	470						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			ACTAGCGGCGGTTTTTCTTTTA	0.406																																					p.V470delinsVFFFF													.	TMCO3-90	0			c.1408_1409insTTTTTTTTTTTT						.																																			SO:0001652	inframe_insertion	55002	exon9			GCGGCGGTTTTTC	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	Exception_encountered	13.37:g.114188424_114188425insTTTTTTTTTTTT	ENSP00000389399:p.Val470_Phe471insPhePhePhePhe	Somatic	117	0		WXS	Illumina HiSeq	Phase_1	123	9	NM_017905	0	0	0	0	0	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	In_Frame_Ins	INS	ENST00000434316.2	37	CCDS9537.1																																																																																			.		0.406	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
AP1G1	164	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	71768532	71768533	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr16:71768532_71768533insA	ENST00000299980.4	-	22	2787_2788	c.2346_2347insT	c.(2344-2349)attaaafs	p.K783fs	AP1G1_ENST00000393512.3_Frame_Shift_Ins_p.K786fs|AP1G1_ENST00000569748.1_Frame_Shift_Ins_p.K783fs|AP1G1_ENST00000433195.2_Frame_Shift_Ins_p.K806fs|AP1G1_ENST00000423132.2_Frame_Shift_Ins_p.K786fs|AP1G1_ENST00000564155.1_Frame_Shift_Ins_p.K208fs	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	783	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TTCAGAACTTTAATGACTTGTG	0.45																																					p.K786_V787delinsX		.											.	AP1G1-92	0			c.2356_2357insT						.																																			SO:0001589	frameshift_variant	164	exon23			.	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2347dupT	16.37:g.71768534_71768534dupA	ENSP00000299980:p.Lys783fs	Somatic	376	0		WXS	Illumina HiSeq	Phase_I	657	369	NM_001030007	0	0	0	0	0	O75709|O75842|Q9UG09|Q9Y3U4	Nonsense_Mutation	INS	ENST00000299980.4	37	CCDS32480.1																																																																																			.		0.450	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	29297095	29297096	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr2:29297095_29297096insA	ENST00000331664.5	-	1	31_32	c.32_33insT	c.(31-33)gtafs	p.V11fs		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	11					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CAACGCTGTTTACAAGGTCACT	0.45																																					p.V11fs		.											.	C2orf71-91	0			c.33_34insT						.																																			SO:0001589	frameshift_variant	388939	exon1			.		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.33dupT	2.37:g.29297096_29297096dupA	ENSP00000332809:p.Val11fs	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	93	48	NM_001029883	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000331664.5	37	CCDS42669.1																																																																																			.		0.450	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
RAD18	56852	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	8955405	8955406	+	Splice_Site	INS	-	-	TG			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr3:8955405_8955406insTG	ENST00000264926.2	-	8	1006		c.e8-1			NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase						DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		ATTTCAGCAGCTGTTAAAATAA	0.317								Rad6 pathway																													.		.											.	RAD18-663	0			c.890-1->CA						.																																			SO:0001630	splice_region_variant	56852	exon9			.		CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.890-1->CA	3.37:g.8955406_8955407dupTG		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	23	13	NM_020165	0	0	0	0	0	Q58F55|Q9NRT6	Splice_Site	INS	ENST00000264926.2	37	CCDS2571.1																																																																																			.		0.317	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165	Intron
TMEM184A	202915	broad.mit.edu	37	7	1586662	1586663	+	In_Frame_Ins	INS	-	-	GCC	rs3837151|rs3779607	byFrequency	TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr7:1586662_1586663insGCC	ENST00000297477.5	-	9	1483_1484	c.1167_1168insGGC	c.(1165-1170)cccagc>cccGGCagc	p.389_390PS>PGS	TMEM184A_ENST00000449955.1_5'Flank	NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	389			S -> G (in dbSNP:rs3779607). {ECO:0000269|PubMed:15489334}.		germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GAGCCGCCGCTGGGGTGGGTGC	0.703																																					p.S390delinsGS													.	TMEM184A-90	0			c.1168_1169insGGC						.			1912,2170		535,842,664						-3.6	0.0		dbSNP_132	17	3872,4214		1028,1816,1199	no	coding	TMEM184A	NM_001097620.1		1563,2658,1863	A1A1,A1R,RR		47.8852,46.8398,47.5345				5784,6384				SO:0001652	inframe_insertion	202915	exon9			CGCCGCTGGGGTG		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.1167_1168insGGC	7.37:g.1586662_1586663insGCC	ENSP00000297477:p.Pro389_Ser390insGly	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	85	11	NM_001097620	0	0	0	0	0	Q8TBQ6	In_Frame_Ins	INS	ENST00000297477.5	37	CCDS43537.1																																																																																			.		0.703	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
ABCC4	10257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	95886864	95886865	+	Splice_Site	DNP	CT	CT	AG			TCGA-A4-8515-01A-11D-2396-08	TCGA-A4-8515-10A-01D-2396-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d3ff544-d2cb-4e64-8f22-6ff73447d5d8	af2ca6b1-94ef-4660-8a55-522a8022d5b2	g.chr13:95886864_95886865CT>AG	ENST00000376887.4	-	4	644_645	c.530_531AG>CT	c.(529-531)aAG>aCT	p.K177T	ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000412704.1_Splice_Site_p.K177T|ABCC4_ENST00000536256.1_Intron|ABCC4_ENST00000431522.1_Splice_Site_p.K177T	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	177	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	TGTCACTTACCTTCCGATAAAT	0.391																																					p.K177T		.											.	ABCC4	0			c.A530C						.																																			SO:0001630	splice_region_variant	10257	exon4			CTTACCTTCCGAT	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.530_531delinsAG	13.37:g.95886864_95886865delinsAG		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	20.0		0	0	0	0	0	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	DNP	ENST00000376887.4	37	CCDS9474.1																																																																																			.		0.391	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	Missense_Mutation
