#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KDM1A	23028	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	23383993	23383993	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:23383993G>A	ENST00000356634.3	+	7	1096	c.947G>A	c.(946-948)cGa>cAa	p.R316Q	KDM1A_ENST00000400181.4_Missense_Mutation_p.R336Q|MIR4419A_ENST00000583845.1_RNA|KDM1A_ENST00000542151.1_Missense_Mutation_p.R336Q|RP1-184J9.2_ENST00000427154.1_RNA	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	316	Demethylase activity.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GTGGGTGGACGAGTTGCCACA	0.428																																					p.R336Q		.											.	KDM1A-206	0			c.G1007A						.						206.0	194.0	198.0					1																	23383993		2203	4300	6503	SO:0001583	missense	23028	exon8			GTGGACGAGTTGC	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.947G>A	1.37:g.23383993G>A	ENSP00000349049:p.Arg316Gln	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	113	6	NM_001009999	0	0	13	13	0	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	ENST00000356634.3	37	CCDS30627.1	.	.	.	.	.	.	.	.	.	.	G	36	5.777153	0.96929	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	D;D;D	0.97710	-4.5;-4.5;-4.5	5.48	5.48	0.80851	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.99196	0.9721	H	0.96269	3.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.984;0.991	D	0.99113	1.0847	10	0.87932	D	0	-9.5301	18.3409	0.90304	0.0:0.0:1.0:0.0	.	336;316	O60341-2;O60341	.;KDM1A_HUMAN	Q	316;336;336	ENSP00000349049:R316Q;ENSP00000383042:R336Q;ENSP00000439072:R336Q	ENSP00000349049:R316Q	R	+	2	0	KDM1A	23256580	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.634000	0.98435	2.572000	0.86782	0.585000	0.79938	CGA	.		0.428	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013	
GNL2	29889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38042060	38042060	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:38042060C>T	ENST00000373062.3	-	9	1105	c.1007G>A	c.(1006-1008)tGc>tAc	p.C336Y		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	336	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				AGCCACGTTGCAAACTTTCTT	0.423																																					p.C336Y		.											.	GNL2-91	0			c.G1007A						.						190.0	170.0	177.0					1																	38042060		2203	4300	6503	SO:0001583	missense	29889	exon9			ACGTTGCAAACTT	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1007G>A	1.37:g.38042060C>T	ENSP00000362153:p.Cys336Tyr	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	69	24	NM_013285	0	0	4	12	8	Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	CCDS421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.162979|5.162979	0.94727|0.94727	.|.	.|.	ENSG00000134697|ENSG00000134697	ENST00000538069|ENST00000373062;ENST00000545489	.|T	.|0.13538	.|2.58	6.14|6.14	6.14|6.14	0.99180|0.99180	.|GTP-binding domain, HSR1-related (1);	.|0.041714	.|0.85682	.|D	.|0.000000	T|T	0.55657|0.55657	0.1934|0.1934	H|H	0.96996|0.96996	3.92|3.92	0.80722|0.80722	D|D	1|1	.|D	.|0.65815	.|0.995	.|D	.|0.70016	.|0.967	T|T	0.69045|0.69045	-0.5249|-0.5249	5|10	.|0.87932	.|D	.|0	-7.4933|-7.4933	20.8597|20.8597	0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|336	.|Q13823	.|NOG2_HUMAN	T|Y	188|336;177	.|ENSP00000362153:C336Y	.|ENSP00000362153:C336Y	A|C	-|-	1|2	0|0	GNL2|GNL2	37814647|37814647	1.000000|1.000000	0.71417|0.71417	0.865000|0.865000	0.33974|0.33974	0.986000|0.986000	0.74619|0.74619	7.786000|7.786000	0.85741|0.85741	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCA|TGC	.		0.423	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
GLIS1	148979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	53995548	53995548	+	Silent	SNP	C	C	T	rs549794466		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:53995548C>T	ENST00000312233.2	-	4	1439	c.873G>A	c.(871-873)ccG>ccA	p.P291P		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						GGCACAGGTACGGCTTCTCGC	0.637																																					p.P291P		.											.	GLIS1-91	0			c.G873A						.						72.0	74.0	74.0					1																	53995548		2203	4300	6503	SO:0001819	synonymous_variant	148979	exon4			CAGGTACGGCTTC	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.873G>A	1.37:g.53995548C>T		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	52	27	NM_147193	0	0	0	9	9		Silent	SNP	ENST00000312233.2	37	CCDS582.1																																																																																			.		0.637	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
SAMD13	148418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	84768963	84768963	+	Missense_Mutation	SNP	G	G	T	rs556493054		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:84768963G>T	ENST00000370671.3	+	2	165	c.106G>T	c.(106-108)Gta>Tta	p.V36L	SAMD13_ENST00000370669.1_Missense_Mutation_p.V16L|SAMD13_ENST00000370670.2_Missense_Mutation_p.V16L|SAMD13_ENST00000394834.3_Missense_Mutation_p.V16L|SAMD13_ENST00000370668.3_Missense_Mutation_p.V16L|SAMD13_ENST00000370673.3_Missense_Mutation_p.V30L			Q5VXD3	SAM13_HUMAN	sterile alpha motif domain containing 13	36										lung(4)	4				all cancers(265;0.00667)|Epithelial(280;0.0219)|OV - Ovarian serous cystadenocarcinoma(397;0.136)		CTCTGTCGGTGTAAAAAAGTA	0.408																																					p.V30L		.											.	SAMD13-226	0			c.G88T						.						72.0	65.0	67.0					1																	84768963		2203	4300	6503	SO:0001583	missense	148418	exon2			GTCGGTGTAAAAA		CCDS30760.1, CCDS44166.1	1p31.1	2013-01-10			ENSG00000203943	ENSG00000203943		"""Sterile alpha motif (SAM) domain containing"""	24582	protein-coding gene	gene with protein product							Standard	NM_001010971		Approved		uc001djr.3	Q5VXD3	OTTHUMG00000009859	ENST00000370671.3:c.106G>T	1.37:g.84768963G>T	ENSP00000359705:p.Val36Leu	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	53	22	NM_001010971	0	0	0	0	0	B3KPW8|D3DT11|Q53AI4|Q5VXD2|Q5VXD4	Missense_Mutation	SNP	ENST00000370671.3	37		.	.	.	.	.	.	.	.	.	.	G	10.75	1.439172	0.25900	.	.	ENSG00000203943	ENST00000370673;ENST00000370671;ENST00000394834;ENST00000370669;ENST00000370668;ENST00000370670	.	.	.	5.34	5.34	0.76211	.	0.391477	0.25631	N	0.029344	T	0.18130	0.0435	N	0.24115	0.695	0.80722	D	1	B;B	0.32101	0.032;0.356	B;B	0.27608	0.023;0.081	T	0.06516	-1.0822	9	0.13470	T	0.59	-11.7208	10.4571	0.44557	0.0893:0.0:0.9107:0.0	.	36;30	Q5VXD3;Q5VXD3-2	SAM13_HUMAN;.	L	30;36;16;16;16;16	.	ENSP00000359702:V16L	V	+	1	0	SAMD13	84541551	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.486000	0.60286	2.657000	0.90304	0.655000	0.94253	GTA	.		0.408	SAMD13-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027243.1	NM_001010971	
CD58	965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	117078689	117078689	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:117078689T>C	ENST00000369489.5	-	3	592	c.526A>G	c.(526-528)Aag>Gag	p.K176E	CD58_ENST00000369487.3_Missense_Mutation_p.K176E|CD58_ENST00000457047.2_Missense_Mutation_p.K176E	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	176					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		TTTTCCATCTTAAAATATATA	0.353																																					p.K176E		.											.	CD58-90	0			c.A526G						.						115.0	111.0	112.0					1																	117078689		2203	4300	6503	SO:0001583	missense	965	exon3			CCATCTTAAAATA	BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.526A>G	1.37:g.117078689T>C	ENSP00000358501:p.Lys176Glu	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	48	16	NM_001144822	0	0	12	27	15	A8K7G5|Q5U053|Q6IB65|Q96KI9	Missense_Mutation	SNP	ENST00000369489.5	37	CCDS888.1	.	.	.	.	.	.	.	.	.	.	T	12.10	1.835666	0.32421	.	.	ENSG00000116815	ENST00000369489;ENST00000457047;ENST00000369487	T;T;T	0.41758	0.99;0.99;1.02	3.59	-6.97	0.01616	.	9.277070	0.00166	N	0.000001	T	0.07818	0.0196	L	0.29908	0.895	0.09310	N	1	P;B;P	0.50528	0.936;0.4;0.936	P;B;P	0.45167	0.472;0.118;0.472	T	0.41698	-0.9494	10	0.02654	T	1	.	2.2982	0.04155	0.1357:0.3744:0.2766:0.2133	.	176;176;176	P19256-3;B1AMW1;P19256	.;.;LFA3_HUMAN	E	176	ENSP00000358501:K176E;ENSP00000409080:K176E;ENSP00000358499:K176E	ENSP00000358499:K176E	K	-	1	0	CD58	116880212	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.440000	0.06888	-1.664000	0.01479	-0.290000	0.09829	AAG	.		0.353	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059036.1	NM_001779	
POGZ	23126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151381040	151381040	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:151381040G>A	ENST00000271715.2	-	14	2393	c.2079C>T	c.(2077-2079)tcC>tcT	p.S693S	POGZ_ENST00000368863.2_Silent_p.S598S|POGZ_ENST00000409503.1_Silent_p.S684S|POGZ_ENST00000361398.3_Silent_p.S640S|POGZ_ENST00000491586.1_Silent_p.S649S|POGZ_ENST00000540984.1_Silent_p.S55S|POGZ_ENST00000531094.1_Silent_p.S631S|POGZ_ENST00000392723.1_Silent_p.S640S	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	693					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCTGCCCTCGGGAAGCCCGGA	0.532																																					p.S693S		.											.	POGZ-93	0			c.C2079T						.						90.0	99.0	96.0					1																	151381040		2203	4300	6503	SO:0001819	synonymous_variant	23126	exon14			CCCTCGGGAAGCC	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2079C>T	1.37:g.151381040G>A		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	48	17	NM_015100	0	0	3	3	0	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Silent	SNP	ENST00000271715.2	37	CCDS997.1																																																																																			.		0.532	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
VHLL	391104	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156268771	156268771	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:156268771C>T	ENST00000339922.3	-	1	657	c.210G>A	c.(208-210)tgG>tgA	p.W70*		NM_001004319.2	NP_001004319.1	Q6RSH7	VHLL_HUMAN	von Hippel-Lindau tumor suppressor-like	70	Beta-domain.									endometrium(1)|lung(2)|ovary(1)	4	Hepatocellular(266;0.158)					AGTAGTTGAGCCACACAGGCA	0.597																																					p.W70X		.											.	VHLL-69	0			c.G210A						.						84.0	75.0	78.0					1																	156268771		2203	4300	6503	SO:0001587	stop_gained	391104	exon1			GTTGAGCCACACA			1q22	2013-09-24			ENSG00000189030	ENSG00000189030			30666	protein-coding gene	gene with protein product			"""VHL pseudogene"""	VHLP		14757845	Standard	NM_001004319		Approved	VLP	uc001fok.3	Q6RSH7	OTTHUMG00000024058	ENST00000339922.3:c.210G>A	1.37:g.156268771C>T	ENSP00000464258:p.Trp70*	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	63	17	NM_001004319	0	0	0	0	0	A1L4M4	Nonsense_Mutation	SNP	ENST00000339922.3	37																																																																																				.		0.597	VHLL-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000060590.3	NM_001004319	
CRB1	23418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	197237545	197237545	+	Start_Codon_SNP	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:197237545G>T	ENST00000367400.3	+	1	138	c.3G>T	c.(1-3)atG>atT	p.M1I	CRB1_ENST00000367399.2_Start_Codon_SNP_p.M1I|CRB1_ENST00000535699.1_Intron|CRB1_ENST00000538660.1_Start_Codon_SNP_p.M1I	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1					cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATAAGACCATGGCACTTAAGA	0.478																																					p.M1I		.											.	CRB1-161	0			c.G3T						.						199.0	181.0	187.0					1																	197237545		2203	4300	6503	SO:0001582	initiator_codon_variant	23418	exon1			GACCATGGCACTT		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3G>T	1.37:g.197237545G>T	ENSP00000356370:p.Met1Ile	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	72	25	NM_001257966	0	0	0	0	0	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.528554	0.44969	.	.	ENSG00000134376	ENST00000538660;ENST00000367400;ENST00000367399	D;D;D	0.86562	-1.96;-1.64;-2.14	5.4	5.4	0.78164	.	.	.	.	.	D	0.90082	0.6902	.	.	.	0.80722	D	1	P;P;P;P	0.41313	0.629;0.745;0.629;0.629	B;P;B;B	0.48704	0.382;0.587;0.382;0.382	D	0.91097	0.4911	8	0.87932	D	0	.	16.9551	0.86257	0.0:0.0:1.0:0.0	.	1;1;1;26	B7Z5T2;P82279-3;P82279;Q59H36	.;.;CRUM1_HUMAN;.	I	1	ENSP00000438091:M1I;ENSP00000356370:M1I;ENSP00000356369:M1I	ENSP00000356369:M1I	M	+	3	0	CRB1	195504168	1.000000	0.71417	0.854000	0.33618	0.577000	0.36160	5.834000	0.69361	2.526000	0.85167	0.650000	0.86243	ATG	.		0.478	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	Missense_Mutation
KLHL12	59349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	202866048	202866048	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:202866048G>A	ENST00000367261.3	-	7	1091	c.873C>T	c.(871-873)agC>agT	p.S291S	KLHL12_ENST00000367259.1_Silent_p.S24S|KLHL12_ENST00000435533.3_Silent_p.S329S	NM_021633.2	NP_067646.1	Q53G59	KLH12_HUMAN	kelch-like family member 12	291					COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|protein monoubiquitination (GO:0006513)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|ER to Golgi transport vesicle (GO:0030134)|Golgi membrane (GO:0000139)				NS(3)|breast(2)|endometrium(1)|large_intestine(1)|lung(6)|stomach(1)	14			BRCA - Breast invasive adenocarcinoma(75;0.166)			GAGACTGCTGGCTTCCAAAGC	0.473																																					p.S291S		.											.	KLHL12-522	0			c.C873T						.						201.0	210.0	207.0					1																	202866048		2203	4300	6503	SO:0001819	synonymous_variant	59349	exon7			CTGCTGGCTTCCA	AF190900	CCDS1429.1	1q32.1	2013-01-30	2013-01-30		ENSG00000117153	ENSG00000117153		"""Kelch-like"", ""BTB/POZ domain containing"""	19360	protein-coding gene	gene with protein product		614522	"""kelch-like 12 (Drosophila)"""			12477932	Standard	NM_021633		Approved	C3IP1	uc001gyo.1	Q53G59	OTTHUMG00000041385	ENST00000367261.3:c.873C>T	1.37:g.202866048G>A		Somatic	106	0		WXS	Illumina HiSeq	Phase_I	116	47	NM_021633	0	0	8	10	2	A6NEN8|B7Z7B8|Q9HBX5	Silent	SNP	ENST00000367261.3	37	CCDS1429.1																																																																																			.		0.473	KLHL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099151.1	NM_021633	
C4BPB	725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207271520	207271520	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:207271520C>A	ENST00000243611.5	+	5	823	c.529C>A	c.(529-531)Cag>Aag	p.Q177K	C4BPB_ENST00000367076.3_Missense_Mutation_p.Q176K|C4BPB_ENST00000367078.3_Missense_Mutation_p.Q177K|C4BPB_ENST00000470767.1_3'UTR|C4BPB_ENST00000391923.1_Missense_Mutation_p.Q177K	NM_000716.3	NP_000707.1	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta	177	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)				breast(2)|lung(1)|ovary(1)	4						CGTGCAGGAGCAGCAATGCGT	0.478																																					p.Q177K		.											.	C4BPB-91	0			c.C529A						.						167.0	146.0	153.0					1																	207271520		2203	4300	6503	SO:0001583	missense	725	exon6			CAGGAGCAGCAAT	L11245	CCDS1476.1, CCDS31005.1	1q32	2008-07-18	2001-11-28		ENSG00000123843	ENSG00000123843			1328	protein-coding gene	gene with protein product	"""complement component 4 binding protein, beta chain"", ""C4b binding protein, beta chain"""	120831	"""complement component 4-binding protein, beta"""	C4BP		2300577, 8325877	Standard	XM_005273255		Approved		uc001hfj.3	P20851	OTTHUMG00000036035	ENST00000243611.5:c.529C>A	1.37:g.207271520C>A	ENSP00000243611:p.Gln177Lys	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	78	26	NM_001017365	0	0	0	0	0	A5JYP8|D3DT81|Q5VVR0|Q9BS25	Missense_Mutation	SNP	ENST00000243611.5	37	CCDS1476.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.763769	0.31228	.	.	ENSG00000123843	ENST00000367078;ENST00000452902;ENST00000243611;ENST00000367076;ENST00000391923	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.0	3.07	0.35406	Complement control module (2);Sushi/SCR/CCP (3);	0.511839	0.16242	N	0.223086	T	0.60353	0.2262	M	0.62723	1.935	0.09310	N	0.999992	P;P	0.52170	0.951;0.939	P;P	0.52710	0.707;0.583	T	0.53788	-0.8389	10	0.02654	T	1	-3.3863	7.1729	0.25728	0.0:0.7347:0.1719:0.0935	.	177;176	P20851;P20851-2	C4BPB_HUMAN;.	K	177;177;177;176;177	ENSP00000356045:Q177K;ENSP00000392237:Q177K;ENSP00000243611:Q177K;ENSP00000356043:Q176K;ENSP00000375790:Q177K	ENSP00000243611:Q177K	Q	+	1	0	C4BPB	205338143	0.017000	0.18338	0.006000	0.13384	0.024000	0.10985	1.187000	0.32090	1.317000	0.45149	0.655000	0.94253	CAG	.		0.478	C4BPB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087847.2	NM_000716	
RPS6KC1	26750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	213251150	213251150	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:213251150T>C	ENST00000366960.3	+	3	404	c.254T>C	c.(253-255)aTa>aCa	p.I85T	RPS6KC1_ENST00000543354.1_5'UTR|RPS6KC1_ENST00000543470.1_5'UTR|RPS6KC1_ENST00000366959.3_Missense_Mutation_p.I73T|RPS6KC1_ENST00000490299.1_3'UTR	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	85	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GCTAAAGGAATAGTGTTTGGT	0.279																																					p.I85T		.											.	RPS6KC1-417	0			c.T254C						.						77.0	74.0	75.0					1																	213251150		2202	4294	6496	SO:0001583	missense	26750	exon3			AAGGAATAGTGTT	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.254T>C	1.37:g.213251150T>C	ENSP00000355927:p.Ile85Thr	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	84	44	NM_012424	0	0	0	0	0	B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Missense_Mutation	SNP	ENST00000366960.3	37	CCDS1513.1	.	.	.	.	.	.	.	.	.	.	T	1.213	-0.629208	0.03610	.	.	ENSG00000136643	ENST00000366960;ENST00000366959	T;T	0.38887	1.11;1.11	5.4	0.0644	0.14353	Phox homologous domain (5);	0.247652	0.39909	N	0.001239	T	0.15349	0.0370	N	0.10760	0.04	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.16722	0.016;0.016	T	0.32929	-0.9888	10	0.02654	T	1	1.7807	5.8179	0.18506	0.5179:0.0738:0.0:0.4083	.	85;73	Q96S38;B1APS8	KS6C1_HUMAN;.	T	85;73	ENSP00000355927:I85T;ENSP00000355926:I73T	ENSP00000355926:I73T	I	+	2	0	RPS6KC1	211317773	1.000000	0.71417	0.979000	0.43373	0.998000	0.95712	1.559000	0.36320	-0.258000	0.09446	0.533000	0.62120	ATA	.		0.279	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424	
TLR5	7100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223286361	223286361	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:223286361G>A	ENST00000540964.1	-	4	474	c.13C>T	c.(13-15)Ctg>Ttg	p.L5L	TLR5_ENST00000342210.6_Silent_p.L5L			O60602	TLR5_HUMAN	toll-like receptor 5	5					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		AGAAGGTCCAGGTGGTCTCCC	0.498																																					p.L5L		.											.	TLR5-525	0			c.C13T						.						37.0	38.0	38.0					1																	223286361		2203	4298	6501	SO:0001819	synonymous_variant	7100	exon6			GGTCCAGGTGGTC		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.13C>T	1.37:g.223286361G>A		Somatic	210	0		WXS	Illumina HiSeq	Phase_I	154	57	NM_003268	0	0	3	3	0	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Silent	SNP	ENST00000540964.1	37	CCDS31033.1																																																																																			.		0.498	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
PARG	8505	hgsc.bcm.edu;bcgsc.ca	37	10	51028292	51028292	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr10:51028292A>T	ENST00000402038.3	-	13	1239	c.1240T>A	c.(1240-1242)Tat>Aat	p.Y414N		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	899	A-domain.			F -> L (in Ref. 3; AAB61614). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		AAGGTGAAATAAACCACATCT	0.418																																					p.Y899N		.											.	PARG-948	0			c.T2695A						.						129.0	108.0	114.0					10																	51028292		692	1591	2283	SO:0001583	missense	8505	exon17			TGAAATAAACCAC	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.1240T>A	10.37:g.51028292A>T	ENSP00000384408:p.Tyr414Asn	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	77	22	NM_003631	0	0	3	3	0	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.5|28.5	4.922052|4.922052	0.92319|0.92319	.|.	.|.	ENSG00000227345|ENSG00000227345	ENST00000432127|ENST00000402038	.|.	.|.	.|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|.	.|.	.|.	.|.	D|D	0.84447|0.84447	0.5474|0.5474	M|M	0.87971|0.87971	2.92|2.92	.|.	.|.	.|.	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.97110	.|0.999;1.0;0.999;0.999;0.999;0.999;1.0	D|D	0.87072|0.87072	0.2160|0.2160	4|7	.|0.87932	.|D	.|0	-13.0842|-13.0842	16.5582|16.5582	0.84512|0.84512	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|817;899;450;167;414;439;899	.|Q86W56-2;Q86W56;A5YBK3;B4DHS4;Q5SQP4;B4DX76;Q0MQR4	.|.;PARG_HUMAN;.;.;.;.;.	L|N	114|414	.|.	.|ENSP00000384408:Y414N	F|Y	-|-	3|1	2|0	PARG|PARG	50698298|50698298	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.383000|8.383000	0.90157|0.90157	2.308000|2.308000	0.77769|0.77769	0.533000|0.533000	0.62120|0.62120	TTT|TAT	.		0.418	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
MGEA5	10724	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103552626	103552626	+	Silent	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr10:103552626A>G	ENST00000361464.3	-	12	2540	c.2145T>C	c.(2143-2145)taT>taC	p.Y715Y	MGEA5_ENST00000357797.5_Silent_p.Y648Y|MGEA5_ENST00000482611.1_5'UTR|MGEA5_ENST00000439817.1_Silent_p.Y662Y	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	715					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		GTCTGATAGTATAAACTTTGG	0.413																																					p.Y715Y													.	MGEA5-93	0			c.T2145C						.						149.0	147.0	148.0					10																	103552626		2203	4300	6503	SO:0001819	synonymous_variant	10724	exon12			GATAGTATAAACT	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.2145T>C	10.37:g.103552626A>G		Somatic	56	1		WXS	Illumina HiSeq	Phase_I	76	31	NM_012215	0	0	7	10	3	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Silent	SNP	ENST00000361464.3	37	CCDS7520.1																																																																																			.		0.413	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	112361757	112361757	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr10:112361757T>A	ENST00000361804.4	+	25	3052	c.2926T>A	c.(2926-2928)Tta>Ata	p.L976I		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	976					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CAACACAGAATTAAAGAAGTA	0.303																																					p.L976I		.											.	SMC3-92	0			c.T2926A						.						46.0	48.0	47.0					10																	112361757		2201	4300	6501	SO:0001583	missense	9126	exon25			ACAGAATTAAAGA	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2926T>A	10.37:g.112361757T>A	ENSP00000354720:p.Leu976Ile	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	47	9	NM_005445	0	0	10	19	9	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	T	18.65	3.669080	0.67814	.	.	ENSG00000108055	ENST00000361804	T	0.76839	-1.05	5.32	1.32	0.21799	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.80243	0.4587	M	0.75884	2.315	0.80722	D	1	D	0.62365	0.991	D	0.63283	0.913	T	0.78021	-0.2367	10	0.07175	T	0.84	.	6.5259	0.22301	0.0:0.5503:0.0:0.4497	.	976	Q9UQE7	SMC3_HUMAN	I	976	ENSP00000354720:L976I	ENSP00000354720:L976I	L	+	1	2	SMC3	112351747	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.542000	0.53625	0.427000	0.26145	0.477000	0.44152	TTA	.		0.303	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
RAB11FIP2	22841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	119798692	119798692	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr10:119798692C>A	ENST00000355624.3	-	3	1495	c.1056G>T	c.(1054-1056)gaG>gaT	p.E352D	RP11-354M20.3_ENST00000451610.2_RNA|RP11-354M20.3_ENST00000417968.4_RNA|RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.E352D	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	352					establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		TCTCCCTTTTCTCTCTTTTAT	0.353																																					p.E352D		.											.	RAB11FIP2-90	0			c.G1056T						.						150.0	161.0	157.0					10																	119798692		2202	4300	6502	SO:0001583	missense	22841	exon3			CCTTTTCTCTCTT	AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.1056G>T	10.37:g.119798692C>A	ENSP00000347839:p.Glu352Asp	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	57	17	NM_014904	0	0	1	2	1	A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	ENST00000355624.3	37	CCDS7602.1	.	.	.	.	.	.	.	.	.	.	C	9.205	1.029505	0.19512	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.66638	-0.21;-0.22	5.76	0.259	0.15583	.	0.171402	0.53938	D	0.000046	T	0.51584	0.1683	L	0.50333	1.59	0.44627	D	0.997603	B;B	0.16166	0.016;0.007	B;B	0.13407	0.009;0.004	T	0.27157	-1.0082	10	0.17369	T	0.5	-21.6296	6.802	0.23756	0.0:0.5332:0.1101:0.3567	.	352;352	Q3I768;Q7L804	.;RFIP2_HUMAN	D	352	ENSP00000347839:E352D;ENSP00000358200:E352D	ENSP00000347839:E352D	E	-	3	2	RAB11FIP2	119788682	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	1.171000	0.31896	0.067000	0.16545	-0.355000	0.07637	GAG	.		0.353	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050583.1	NM_014904	
OR51E1	143503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4674486	4674486	+	Missense_Mutation	SNP	G	G	A	rs148787592		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr11:4674486G>A	ENST00000396952.5	+	2	1380	c.730G>A	c.(730-732)Gtc>Atc	p.V244I	OR51E1_ENST00000530215.1_Intron	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V243I(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCACTTGCGTCTCTCATGT	0.498																																					p.V244I		.											.	OR51E1-114	1	Substitution - Missense(1)	large_intestine(1)	c.G730A						.	G	ILE/VAL	0,4402		0,0,2201	243.0	229.0	234.0		730	4.0	1.0	11	dbSNP_134	234	3,8593	3.0+/-9.4	0,3,4295	yes	missense	OR51E1	NM_152430.3	29	0,3,6496	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	244/319	4674486	3,12995	2201	4298	6499	SO:0001583	missense	143503	exon2			ACTTGCGTCTCTC	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.730G>A	11.37:g.4674486G>A	ENSP00000380155:p.Val244Ile	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	77	26	NM_152430	0	0	0	0	0	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	ENST00000396952.5	37	CCDS31358.2	.	.	.	.	.	.	.	.	.	.	G	9.642	1.139187	0.21205	0.0	3.49E-4	ENSG00000180785	ENST00000396952	T	0.37584	1.19	4.89	3.98	0.46160	GPCR, rhodopsin-like superfamily (1);	0.255092	0.27563	N	0.018809	T	0.18551	0.0445	N	0.20881	0.62	0.80722	D	1	P	0.43826	0.818	B	0.37239	0.244	T	0.05007	-1.0912	10	0.07644	T	0.81	.	9.4332	0.38624	0.1719:0.0:0.8281:0.0	.	243	Q8TCB6	O51E1_HUMAN	I	244	ENSP00000380155:V244I	ENSP00000380155:V244I	V	+	1	0	OR51E1	4631062	0.000000	0.05858	1.000000	0.80357	0.830000	0.47004	0.514000	0.22786	1.435000	0.47434	0.655000	0.94253	GTC	G|1.000;A|0.000		0.498	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347136.2	NM_152430	
ZDHHC5	25921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57466844	57466844	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr11:57466844G>A	ENST00000287169.3	+	11	3298	c.1936G>A	c.(1936-1938)Gtc>Atc	p.V646I	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.V593I	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	646					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CCAACCTGGTGTCTCTGAGAC	0.527																																					p.V646I		.											.	ZDHHC5-226	0			c.G1936A						.						60.0	62.0	61.0					11																	57466844		2201	4296	6497	SO:0001583	missense	25921	exon11			CCTGGTGTCTCTG	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1936G>A	11.37:g.57466844G>A	ENSP00000287169:p.Val646Ile	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	33	13	NM_015457	0	0	36	74	38	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	ENST00000287169.3	37	CCDS7965.1	.	.	.	.	.	.	.	.	.	.	G	8.863	0.947386	0.18356	.	.	ENSG00000156599	ENST00000527985;ENST00000287169	T;T	0.57436	0.4;1.41	5.83	5.83	0.93111	.	1.629370	0.03465	N	0.212746	T	0.55242	0.1908	N	0.11427	0.14	0.43043	D	0.994634	P	0.42584	0.784	P	0.55391	0.775	T	0.48525	-0.9028	10	0.08381	T	0.77	-21.3343	17.8915	0.88874	0.0:0.0:1.0:0.0	.	646	Q9C0B5	ZDHC5_HUMAN	I	593;646	ENSP00000432202:V593I;ENSP00000287169:V646I	ENSP00000287169:V646I	V	+	1	0	ZDHHC5	57223420	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.646000	0.46630	2.769000	0.95229	0.655000	0.94253	GTC	.		0.527	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1	NM_015457	
ARL2	402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64789247	64789247	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr11:64789247G>A	ENST00000246747.4	+	5	570	c.475G>A	c.(475-477)Gcc>Acc	p.A159T	ARL2_ENST00000533729.1_Missense_Mutation_p.A132T|RP11-399J13.3_ENST00000301886.3_Intron|ARL2_ENST00000529384.1_Missense_Mutation_p.A159T	NM_001667.3	NP_001658.2	P36404	ARL2_HUMAN	ADP-ribosylation factor-like 2	159					cell cycle (GO:0007049)|centrosome organization (GO:0051297)|GTP catabolic process (GO:0006184)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of GTPase activity (GO:0034260)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of microtubule polymerization (GO:0031116)|regulation of microtubule polymerization (GO:0031113)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|tubulin complex assembly (GO:0007021)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|GTPase inhibitor activity (GO:0005095)	p.A159T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	5						GGGCTGCAGCGCCGTCACCGG	0.627																																					p.A159T		.											.	ARL2-181	1	Substitution - Missense(1)	lung(1)	c.G475A						.						56.0	49.0	51.0					11																	64789247		2201	4297	6498	SO:0001583	missense	402	exon5			TGCAGCGCCGTCA	AF493888	CCDS8088.1, CCDS55770.1	11q13	2014-05-09			ENSG00000213465	ENSG00000213465		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	693	protein-coding gene	gene with protein product		601175				8415637, 9253601	Standard	NM_001667		Approved	ARFL2	uc001och.4	P36404	OTTHUMG00000165728	ENST00000246747.4:c.475G>A	11.37:g.64789247G>A	ENSP00000246747:p.Ala159Thr	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	25	12	NM_001667	0	0	203	404	201	G3V184|Q9BUK8	Missense_Mutation	SNP	ENST00000246747.4	37	CCDS8088.1	.	.	.	.	.	.	.	.	.	.	G	32	5.153338	0.94645	.	.	ENSG00000213465	ENST00000246747;ENST00000529384;ENST00000533729	D;D;D	0.91351	-2.83;-2.83;-2.83	4.5	4.5	0.54988	.	0.000000	0.85682	U	0.000000	D	0.96222	0.8768	H	0.94385	3.53	0.80722	D	1	D	0.71674	0.998	D	0.66196	0.942	D	0.97253	0.9899	10	0.87932	D	0	-17.1644	14.7471	0.69496	0.0:0.0:1.0:0.0	.	159	P36404	ARL2_HUMAN	T	159;159;132	ENSP00000246747:A159T;ENSP00000436021:A159T;ENSP00000432971:A132T	ENSP00000246747:A159T	A	+	1	0	ARL2	64545823	1.000000	0.71417	0.984000	0.44739	0.890000	0.51754	8.981000	0.93465	2.343000	0.79666	0.484000	0.47621	GCC	.		0.627	ARL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385963.1	NM_001667	
IL10RA	3587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117869943	117869943	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr11:117869943G>T	ENST00000227752.3	+	7	1444	c.1324G>T	c.(1324-1326)Gca>Tca	p.A442S	IL10RA_ENST00000545409.1_Missense_Mutation_p.A293S|IL10RA_ENST00000541785.1_Missense_Mutation_p.A422S|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	442					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		AGCTGCTGTGGCATTCCAGGG	0.637																																					p.A442S		.											.	IL10RA-91	0			c.G1324T						.						79.0	77.0	78.0					11																	117869943		2200	4296	6496	SO:0001583	missense	3587	exon7			GCTGTGGCATTCC	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.1324G>T	11.37:g.117869943G>T	ENSP00000227752:p.Ala442Ser	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	63	18	NM_001558	0	0	3	3	0	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007738	0.35415	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.24723	1.84;1.84;1.84	5.83	2.69	0.31865	.	4.801410	0.00447	N	0.000099	T	0.28566	0.0707	L	0.60455	1.87	0.09310	N	1	B;B	0.26845	0.161;0.1	B;B	0.23852	0.049;0.024	T	0.20605	-1.0270	10	0.41790	T	0.15	-4.9837	6.4798	0.22057	0.1701:0.1494:0.6805:0.0	.	422;442	F5GYV8;Q13651	.;I10R1_HUMAN	S	442;422;293;422	ENSP00000227752:A442S;ENSP00000441397:A422S;ENSP00000443019:A293S	ENSP00000227752:A442S	A	+	1	0	IL10RA	117375153	0.268000	0.24133	0.043000	0.18650	0.009000	0.06853	0.801000	0.27055	1.438000	0.47492	0.563000	0.77884	GCA	.		0.637	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
DOCK9	23348	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99481633	99481633	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr13:99481633G>A	ENST00000376460.1	-	43	4904	c.4824C>T	c.(4822-4824)agC>agT	p.S1608S	DOCK9-AS1_ENST00000439367.1_RNA|DOCK9_ENST00000339416.2_Silent_p.S1609S|DOCK9_ENST00000448493.2_3'UTR	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1609	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTCGGGCGTGCTGGCATAGG	0.582																																					.													.	DOCK9-90	0			.						.						74.0	73.0	73.0					13																	99481633		2078	4229	6307	SO:0001819	synonymous_variant	23348	.			GGGCGTGCTGGCA	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4824C>T	13.37:g.99481633G>A		Somatic	151	0		WXS	Illumina HiSeq	Phase_I	110	35	.	0	0	0	4	4	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	ENST00000376460.1	37	CCDS45062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.208|9.208	1.030269|1.030269	0.19512|0.19512	.|.	.|.	ENSG00000088387|ENSG00000088387	ENST00000419908|ENST00000400228	.|.	.|.	.|.	5.77|5.77	4.93|4.93	0.64822|0.64822	.|.	.|.	.|.	.|.	.|.	T|T	0.56906|0.56906	0.2017|0.2017	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.55872|0.55872	-0.8072|-0.8072	4|4	.|.	.|.	.|.	.|.	7.1809|7.1809	0.25772|0.25772	0.2836:0.0:0.7164:0.0|0.2836:0.0:0.7164:0.0	.|.	.|.	.|.	.|.	V|Y	26|196	.|.	.|.	A|H	-|-	2|1	0|0	DOCK9|DOCK9	98279634|98279634	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.771000|0.771000	0.43674|0.43674	2.620000|2.620000	0.46410|0.46410	1.567000|1.567000	0.49668|0.49668	0.655000|0.655000	0.94253|0.94253	GCA|CAC	.		0.582	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
FBXO33	254170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	39871674	39871674	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:39871674A>G	ENST00000298097.7	-	2	978	c.641T>C	c.(640-642)cTa>cCa	p.L214P	FBXO33_ENST00000554190.1_Intron	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	214					protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		TTGCTGTTGTAGAACACTTAT	0.308																																					p.L214P		.											.	FBXO33-658	0			c.T641C						.						100.0	92.0	95.0					14																	39871674		2203	4298	6501	SO:0001583	missense	254170	exon2			TGTTGTAGAACAC	BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.641T>C	14.37:g.39871674A>G	ENSP00000298097:p.Leu214Pro	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	20	6	NM_203301	0	0	0	0	0	Q6PIR2|Q86TR2|Q86YE0	Missense_Mutation	SNP	ENST00000298097.7	37	CCDS9677.1	.	.	.	.	.	.	.	.	.	.	A	13.87	2.366608	0.41902	.	.	ENSG00000165355	ENST00000298097	T	0.01279	5.06	6.08	6.08	0.98989	.	0.072360	0.56097	D	0.000025	T	0.02929	0.0087	L	0.32530	0.975	0.80722	D	1	P	0.50272	0.933	P	0.50440	0.641	T	0.69232	-0.5199	9	.	.	.	-1.7988	16.6438	0.85155	1.0:0.0:0.0:0.0	.	214	Q7Z6M2	FBX33_HUMAN	P	214	ENSP00000298097:L214P	.	L	-	2	0	FBXO33	38941425	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	8.486000	0.90451	2.333000	0.79357	0.533000	0.62120	CTA	.		0.308	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276769.2		
L2HGDH	79944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	50713788	50713788	+	Silent	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:50713788T>C	ENST00000267436.4	-	10	1777	c.1380A>G	c.(1378-1380)agA>agG	p.R460R	L2HGDH_ENST00000421284.3_Silent_p.R460R|L2HGDH_ENST00000261699.4_Intron			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	460					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)			kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					ATAATTCAAATCTTTGTTGTA	0.328																																					p.R460R		.											.	L2HGDH-92	0			c.A1380G						.						49.0	48.0	49.0					14																	50713788		2203	4300	6503	SO:0001819	synonymous_variant	79944	exon10			TTCAAATCTTTGT		CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.1380A>G	14.37:g.50713788T>C		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	103	38	NM_024884	0	0	1	1	0	Q9BRR1	Silent	SNP	ENST00000267436.4	37	CCDS9698.1																																																																																			.		0.328	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884	
MAP3K9	4293	broad.mit.edu	37	14	71199898	71199898	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:71199898T>G	ENST00000554752.2	-	11	2187	c.2188A>C	c.(2188-2190)Acc>Ccc	p.T730P	MAP3K9_ENST00000381250.4_Missense_Mutation_p.T707P|MAP3K9_ENST00000555993.2_Missense_Mutation_p.T744P|MAP3K9_ENST00000554146.1_Missense_Mutation_p.T458P|MAP3K9_ENST00000553414.1_Missense_Mutation_p.T463P	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	730					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		AGCTGAGGGGTACTCGTGGCC	0.652																																					p.T744P	GBM(114;411 1587 13539 28235 50070)												.	MAP3K9-546	0			c.A2230C						.						58.0	62.0	61.0					14																	71199898		2203	4300	6503	SO:0001583	missense	4293	exon12			GAGGGGTACTCGT	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.2188A>C	14.37:g.71199898T>G	ENSP00000451612:p.Thr730Pro	Somatic	43	3		WXS	Illumina HiSeq	Phase_I	18	5	NM_033141	0	0	0	0	0	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37		.	.	.	.	.	.	.	.	.	.	T	17.53	3.412471	0.62511	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	4.77	4.77	0.60923	.	0.219310	0.47093	D	0.000260	T	0.50752	0.1634	L	0.46157	1.445	0.35984	D	0.836233	D;P;D;D	0.76494	0.998;0.583;0.999;0.999	D;B;D;D	0.78314	0.953;0.263;0.95;0.991	T	0.55515	-0.8129	10	0.26408	T	0.33	.	14.4699	0.67509	0.0:0.0:0.0:1.0	.	458;730;744;463	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	P	730;744;463;707;458;446	ENSP00000451612:T730P;ENSP00000451038:T463P;ENSP00000370649:T707P;ENSP00000451921:T458P	ENSP00000005198:T744P	T	-	1	0	MAP3K9	70269651	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.682000	0.37628	2.007000	0.58848	0.459000	0.35465	ACC	.		0.652	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
VRTN	55237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	74824279	74824279	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:74824279T>A	ENST00000256362.4	+	2	1034	c.793T>A	c.(793-795)Tca>Aca	p.S265T		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	265					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GGCCCCACTCTCATCGCCGGC	0.637																																					p.S265T		.											.	VRTN-155	0			c.T793A						.						39.0	39.0	39.0					14																	74824279		2203	4300	6503	SO:0001583	missense	55237	exon2			CCACTCTCATCGC	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.793T>A	14.37:g.74824279T>A	ENSP00000256362:p.Ser265Thr	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	47	18	NM_018228	0	0	0	0	0	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.670536	0.00758	.	.	ENSG00000133980	ENST00000256362	T	0.42131	0.98	4.34	2.42	0.29668	.	0.896444	0.09544	N	0.787929	T	0.20047	0.0482	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.12837	0.008	T	0.27191	-1.0081	10	0.18276	T	0.48	0.001	5.0154	0.14333	0.0:0.5664:0.2316:0.202	.	265	Q9H8Y1	VRTN_HUMAN	T	265	ENSP00000256362:S265T	ENSP00000256362:S265T	S	+	1	0	VRTN	73894032	0.614000	0.27017	0.014000	0.15608	0.005000	0.04900	2.793000	0.47845	0.762000	0.33152	-0.337000	0.08149	TCA	.		0.637	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
GALC	2581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	88412007	88412007	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:88412007A>C	ENST00000261304.2	-	14	1666	c.1560T>G	c.(1558-1560)atT>atG	p.I520M	GALC_ENST00000393569.2_Missense_Mutation_p.I494M|GALC_ENST00000544807.2_Missense_Mutation_p.I464M|GALC_ENST00000393568.4_Missense_Mutation_p.I497M	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	520					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CAGGGTCTTCAATATTTGTAA	0.398																																					p.I520M		.											.	GALC-90	0			c.T1560G						.						88.0	87.0	87.0					14																	88412007		1838	4079	5917	SO:0001583	missense	2581	exon14			GTCTTCAATATTT	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.1560T>G	14.37:g.88412007A>C	ENSP00000261304:p.Ile520Met	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	39	10	NM_000153	0	0	4	4	0	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Missense_Mutation	SNP	ENST00000261304.2	37	CCDS9878.2	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.451307	0.01080	.	.	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000539620;ENST00000393568	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	5.51	-11.0	0.00169	.	2.091110	0.01473	N	0.016351	D	0.85796	0.5780	N	0.12746	0.255	0.09310	N	1	B;B;B;B	0.11235	0.004;0.001;0.002;0.001	B;B;B;B	0.15052	0.007;0.012;0.012;0.012	T	0.76288	-0.3014	10	0.46703	T	0.11	4.0145	13.9406	0.64052	0.283:0.3027:0.4142:0.0	.	464;497;494;520	P54803-5;E7EPA4;P54803-4;P54803	.;.;.;GALC_HUMAN	M	520;464;494;309;497	ENSP00000261304:I520M;ENSP00000437513:I464M;ENSP00000377199:I494M;ENSP00000377198:I497M	ENSP00000261304:I520M	I	-	3	3	GALC	87481760	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.299000	0.01139	-6.093000	0.00006	-2.649000	0.00149	ATT	.		0.398	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2		
CALM1	801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	90870815	90870815	+	Silent	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:90870815C>T	ENST00000356978.4	+	5	626	c.378C>T	c.(376-378)atC>atT	p.I126I	CALM1_ENST00000447653.3_Silent_p.I127I|CALM1_ENST00000553542.1_Silent_p.I90I|RP11-471B22.2_ENST00000555853.1_RNA|CALM1_ENST00000544280.2_Silent_p.I90I	NM_006888.4	NP_008819.1	P62158	CALM_HUMAN	calmodulin 1 (phosphorylase kinase, delta)	126	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	10		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	ATGAAATGATCAGAGAAGCAG	0.388																																					p.I126I		.											.	CALM1-90	0			c.C378T						.						135.0	127.0	130.0					14																	90870815		2203	4300	6503	SO:0001819	synonymous_variant	801	exon5			AATGATCAGAGAA		CCDS9892.1	14q32.11	2013-02-25			ENSG00000198668	ENSG00000198668	2.7.11.19	"""EF-hand domain containing"", ""Endogenous ligands"""	1442	protein-coding gene	gene with protein product	"""prepro-calmodulin 1"""	114180		CALML2		6385987	Standard	NM_006888		Approved	CAMI, PHKD, DD132	uc001xyl.2	P62158	OTTHUMG00000171044	ENST00000356978.4:c.378C>T	14.37:g.90870815C>T		Somatic	173	0		WXS	Illumina HiSeq	Phase_I	149	38	NM_006888	0	0	173	287	114	P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Silent	SNP	ENST00000356978.4	37	CCDS9892.1																																																																																			.		0.388	CALM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411346.1		
ATP10A	57194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	25981205	25981205	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr15:25981205G>A	ENST00000356865.6	-	3	849	c.738C>T	c.(736-738)tgC>tgT	p.C246C	RNA5SP390_ENST00000410191.1_RNA	NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	246					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ATACTCACATGCAGCCGCGAA	0.448																																					p.C246C		.											.	ATP10A-139	0			c.C738T						.						148.0	100.0	116.0					15																	25981205		2203	4300	6503	SO:0001819	synonymous_variant	57194	exon3			TCACATGCAGCCG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.738C>T	15.37:g.25981205G>A		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	99	38	NM_024490	0	0	0	0	0	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																			.		0.448	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
SECISBP2L	9728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	49293279	49293279	+	Silent	SNP	A	A	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr15:49293279A>C	ENST00000559471.1	-	15	2306	c.2043T>G	c.(2041-2043)gtT>gtG	p.V681V	SECISBP2L_ENST00000559122.1_5'UTR|SECISBP2L_ENST00000261847.3_Silent_p.V636V	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	681							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						CTTTACAAAGAACCTGATTAC	0.338																																					p.V681V		.											.	SECISBP2L-136	0			c.T2043G						.						60.0	54.0	56.0					15																	49293279		2197	4295	6492	SO:0001819	synonymous_variant	9728	exon15			ACAAAGAACCTGA	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.2043T>G	15.37:g.49293279A>C		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	42	16	NM_001193489	0	0	1	1	0	Q8N767	Silent	SNP	ENST00000559471.1	37	CCDS53942.1																																																																																			.		0.338	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
ARL2BP	23568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57283687	57283687	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr16:57283687G>T	ENST00000219204.3	+	4	486	c.216G>T	c.(214-216)ttG>ttT	p.L72F	RP11-407G23.4_ENST00000562409.1_RNA|RP11-407G23.3_ENST00000564376.1_RNA|ARL2BP_ENST00000562023.1_Intron	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	72					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						AGATTTCTTTGGTAGAAAAAT	0.423																																					p.L72F		.											.	ARL2BP-90	0			c.G216T						.						126.0	128.0	127.0					16																	57283687		2198	4300	6498	SO:0001583	missense	23568	exon4			TTCTTTGGTAGAA	AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.216G>T	16.37:g.57283687G>T	ENSP00000219204:p.Leu72Phe	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	50	7	NM_012106	0	0	0	1	1	B3KQJ5|Q504R0	Missense_Mutation	SNP	ENST00000219204.3	37	CCDS10776.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139821	0.56936	.	.	ENSG00000102931	ENST00000219204	T	0.54071	0.59	5.95	2.95	0.34219	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.127524	0.37095	U	0.002259	T	0.70360	0.3215	M	0.88310	2.945	0.80722	D	1	D;D	0.71674	0.998;0.991	D;D	0.70716	0.97;0.934	T	0.68372	-0.5426	10	0.62326	D	0.03	-7.9781	5.1654	0.15082	0.2858:0.0:0.5774:0.1368	.	40;72	B4DQD8;Q9Y2Y0	.;AR2BP_HUMAN	F	72	ENSP00000219204:L72F	ENSP00000219204:L72F	L	+	3	2	ARL2BP	55841188	1.000000	0.71417	0.996000	0.52242	0.684000	0.39900	2.160000	0.42348	0.418000	0.25898	0.655000	0.94253	TTG	.		0.423	ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257334.2	NM_012106	
KCTD11	147040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7256621	7256621	+	Silent	SNP	C	C	T	rs79616684		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:7256621C>T	ENST00000333751.3	+	1	1414	c.360C>T	c.(358-360)gaC>gaT	p.D120D	TMEM95_ENST00000330767.4_5'Flank|TMEM95_ENST00000576060.1_5'Flank|RP11-542C16.1_ENST00000572417.1_RNA|TMEM95_ENST00000389982.4_5'Flank	NM_001002914.2	NP_001002914.1	Q693B1	KCD11_HUMAN	potassium channel tetramerization domain containing 11	120					cell cycle (GO:0007049)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)				kidney(1)|large_intestine(2)|lung(1)	4		Prostate(122;0.157)				TCCAGGTGGACACCTTCCGAG	0.627																																					p.D120D		.											.	KCTD11-90	0			c.C360T						.						89.0	72.0	78.0					17																	7256621		2203	4300	6503	SO:0001819	synonymous_variant	147040	exon1			GGTGGACACCTTC	AK056227	CCDS32545.1	17p13.2	2013-06-20	2013-06-20	2003-11-26	ENSG00000213859	ENSG00000213859			21302	protein-coding gene	gene with protein product		609848	"""chromosome 17 open reading frame 36"", ""potassium channel tetramerisation domain containing 11"""	C17orf36		12186855, 21472142	Standard	NM_001002914		Approved	REN, KCASH1	uc002gge.4	Q693B1	OTTHUMG00000132061	ENST00000333751.3:c.360C>T	17.37:g.7256621C>T		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	62	17	NM_001002914	0	0	34	42	8	B3KPE0	Silent	SNP	ENST00000333751.3	37	CCDS32545.1																																																																																			C|0.500;T|0.500		0.627	KCTD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255084.2	NM_001002914	
PEX12	5193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33904481	33904481	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:33904481A>C	ENST00000225873.4	-	2	863	c.256T>G	c.(256-258)Ttt>Gtt	p.F86V	RP11-1094M14.11_ENST00000592381.1_lincRNA	NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	86					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAGCCGTAAAAGTTTTCAGAA	0.423																																					p.F86V		.											.	PEX12-90	0			c.T256G						.						149.0	167.0	161.0					17																	33904481		2203	4300	6503	SO:0001583	missense	5193	exon2			CGTAAAAGTTTTC	U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.256T>G	17.37:g.33904481A>C	ENSP00000225873:p.Phe86Val	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	37	11	NM_000286	0	0	1	4	3	B2R6M2	Missense_Mutation	SNP	ENST00000225873.4	37	CCDS11296.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.845090	0.91197	.	.	ENSG00000108733	ENST00000424525;ENST00000225873	D	0.85171	-1.95	5.63	5.63	0.86233	Pex, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93093	0.7801	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94107	0.7367	10	0.72032	D	0.01	-21.3132	15.0234	0.71650	1.0:0.0:0.0:0.0	.	86	O00623	PEX12_HUMAN	V	86	ENSP00000225873:F86V	ENSP00000225873:F86V	F	-	1	0	PEX12	30928594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.736000	0.74811	2.142000	0.66516	0.528000	0.53228	TTT	.		0.423	PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256489.2	NM_000286	
CDC6	990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38447445	38447445	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:38447445A>G	ENST00000209728.4	+	3	785	c.314A>G	c.(313-315)aAg>aGg	p.K105R		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	105					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						CTGACAATTAAGTCTCCTAGC	0.398																																					p.K105R		.											.	CDC6-662	0			c.A314G						.						121.0	110.0	114.0					17																	38447445		2203	4300	6503	SO:0001583	missense	990	exon3			CAATTAAGTCTCC	U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.314A>G	17.37:g.38447445A>G	ENSP00000209728:p.Lys105Arg	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	120	14	NM_001254	0	0	0	0	0	Q8TB30	Missense_Mutation	SNP	ENST00000209728.4	37	CCDS11365.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.819366	0.32145	.	.	ENSG00000094804	ENST00000209728	T	0.51071	0.72	5.52	4.25	0.50352	.	0.245750	0.38959	N	0.001502	T	0.36166	0.0957	M	0.63428	1.95	0.22666	N	0.998871	B	0.14805	0.011	B	0.10450	0.005	T	0.24476	-1.0159	10	0.09338	T	0.73	-12.0983	4.517	0.11939	0.7131:0.0:0.1193:0.1676	.	105	Q99741	CDC6_HUMAN	R	105	ENSP00000209728:K105R	ENSP00000209728:K105R	K	+	2	0	CDC6	35700971	0.007000	0.16637	0.979000	0.43373	0.951000	0.60555	0.662000	0.25038	2.227000	0.72691	0.454000	0.30748	AAG	.		0.398	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257129.1		
HDAC5	10014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42160014	42160014	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:42160014G>C	ENST00000393622.2	-	20	2877	c.2546C>G	c.(2545-2547)gCc>gGc	p.A849G	HDAC5_ENST00000336057.5_Missense_Mutation_p.A764G|HDAC5_ENST00000586802.1_Missense_Mutation_p.A849G|HDAC5_ENST00000225983.6_Missense_Mutation_p.A850G	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	849	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		TGCGGTGATGGCTACAGAGTT	0.592																																					p.A850G		.											.	HDAC5-227	0			c.C2549G						.						104.0	91.0	95.0					17																	42160014		2203	4300	6503	SO:0001583	missense	10014	exon20			GTGATGGCTACAG	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.2546C>G	17.37:g.42160014G>C	ENSP00000377244:p.Ala849Gly	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	176	51	NM_001015053	0	0	32	43	11	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	ENST00000393622.2	37	CCDS45696.1	.	.	.	.	.	.	.	.	.	.	G	32	5.172286	0.94807	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.74737	-0.87;-0.87;-0.87	4.98	4.98	0.66077	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.89093	0.6617	M	0.91818	3.245	0.80722	D	1	D;D;P;B	0.69078	0.987;0.997;0.512;0.235	D;D;P;P	0.87578	0.976;0.998;0.511;0.744	D	0.91712	0.5382	10	0.87932	D	0	-14.2335	17.0238	0.86440	0.0:0.0:1.0:0.0	.	764;849;850;849	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	G	850;849;764	ENSP00000225983:A850G;ENSP00000377244:A849G;ENSP00000337290:A764G	ENSP00000225983:A850G	A	-	2	0	HDAC5	39515540	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.842000	0.99487	2.317000	0.78254	0.561000	0.74099	GCC	.		0.592	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
USP32	84669	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58288852	58288852	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:58288852C>A	ENST00000300896.4	-	20	2397	c.2203G>T	c.(2203-2205)Ggt>Tgt	p.G735C	USP32_ENST00000592339.1_Missense_Mutation_p.G405C	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	735	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TTGCTTAGACCTGTGGCTCCC	0.413																																					p.G735C													.	USP32-704	0			c.G2203T						.						174.0	161.0	165.0					17																	58288852		2202	4300	6502	SO:0001583	missense	84669	exon20			TTAGACCTGTGGC	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.2203G>T	17.37:g.58288852C>A	ENSP00000300896:p.Gly735Cys	Somatic	189	1		WXS	Illumina HiSeq	Phase_I	221	70	NM_032582	0	0	1	1	0	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667058	0.88251	.	.	ENSG00000170832	ENST00000300896	D	0.88741	-2.42	5.39	5.39	0.77823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.96321	0.8800	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97241	0.9891	10	0.87932	D	0	.	19.1546	0.93504	0.0:1.0:0.0:0.0	.	735	Q8NFA0	UBP32_HUMAN	C	735	ENSP00000300896:G735C	ENSP00000300896:G735C	G	-	1	0	USP32	55643634	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.770000	0.85390	2.537000	0.85549	0.655000	0.94253	GGT	.		0.413	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
NOL11	25926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65739904	65739904	+	Missense_Mutation	SNP	G	G	A	rs370393293		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:65739904G>A	ENST00000253247.4	+	18	2204	c.2089G>A	c.(2089-2091)Gag>Aag	p.E697K	NOL11_ENST00000535137.1_Missense_Mutation_p.E515K|SNORA38B_ENST00000363524.1_RNA	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	697					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAGTTTTCGGGAGCTACAGAA	0.299																																					p.E697K		.											.	NOL11-90	0			c.G2089A						.	G	LYS/GLU	0,4404		0,0,2202	45.0	49.0	47.0		2089	4.2	1.0	17		47	1,8595	1.2+/-3.3	0,1,4297	no	missense	NOL11	NM_015462.3	56	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	697/720	65739904	1,12999	2202	4298	6500	SO:0001583	missense	25926	exon18			TTTCGGGAGCTAC	AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.2089G>A	17.37:g.65739904G>A	ENSP00000253247:p.Glu697Lys	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	36	9	NM_015462	0	0	55	85	30	B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	ENST00000253247.4	37	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954162	0.73902	0.0	1.16E-4	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.48836	0.8	5.27	4.25	0.50352	.	0.057766	0.64402	D	0.000002	T	0.51686	0.1689	M	0.74258	2.255	0.50813	D	0.999891	P	0.48294	0.908	B	0.44224	0.444	T	0.59994	-0.7349	10	0.56958	D	0.05	-20.9764	13.8316	0.63384	0.0:0.1531:0.8468:0.0	.	697	Q9H8H0	NOL11_HUMAN	K	697;515	ENSP00000253247:E697K	ENSP00000253247:E697K	E	+	1	0	NOL11	63170366	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.909000	0.63314	2.626000	0.88956	0.655000	0.94253	GAG	.		0.299	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462	
LGALS3BP	3959	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76967786	76967786	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr17:76967786T>C	ENST00000262776.3	-	6	1938	c.1630A>G	c.(1630-1632)Att>Gtt	p.I544V	LGALS3BP_ENST00000591778.1_3'UTR	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	544					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GCACTGGGAATCGCAGCCTTC	0.612											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I544V	GBM(89;1105 1755 18102 21513)												.	LGALS3BP-515	0			c.A1630G						.						75.0	70.0	71.0					17																	76967786		2203	4300	6503	SO:0001583	missense	3959	exon6			TGGGAATCGCAGC	L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.1630A>G	17.37:g.76967786T>C	ENSP00000262776:p.Ile544Val	Somatic	88	1	1172	WXS	Illumina HiSeq	Phase_I	62	8	NM_005567	1	1	1545	2323	776	Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Missense_Mutation	SNP	ENST00000262776.3	37	CCDS11759.1	.	.	.	.	.	.	.	.	.	.	T	8.701	0.909734	0.17833	.	.	ENSG00000108679	ENST00000262776;ENST00000536190	T	0.01455	4.87	3.52	-1.89	0.07689	.	0.725701	0.11232	N	0.585521	T	0.01730	0.0055	L	0.43152	1.355	0.21386	N	0.999705	B	0.09022	0.002	B	0.06405	0.002	T	0.43065	-0.9414	10	0.33141	T	0.24	-20.4235	5.8589	0.18734	0.0:0.1105:0.5287:0.3609	.	544	Q08380	LG3BP_HUMAN	V	544;532	ENSP00000262776:I544V	ENSP00000262776:I544V	I	-	1	0	LGALS3BP	74479381	0.000000	0.05858	0.003000	0.11579	0.045000	0.14185	-0.750000	0.04808	-0.411000	0.07530	0.459000	0.35465	ATT	.		0.612	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437785.3	NM_005567	
THOC1	9984	bcgsc.ca	37	18	254346	254346	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:254346A>G	ENST00000261600.6	-	8	537	c.530T>C	c.(529-531)tTg>tCg	p.L177S	THOC1_ENST00000582313.1_5'UTR	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	177					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CTGACTCTGCAAGTTAAGACC	0.363																																					p.L177S													.	THOC1-91	0			c.T530C						.						73.0	63.0	66.0					18																	254346		1857	4074	5931	SO:0001583	missense	9984	exon8			CTCTGCAAGTTAA	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.530T>C	18.37:g.254346A>G	ENSP00000261600:p.Leu177Ser	Somatic	19	0		WXS	Illumina HiSeq	Phase_1	18	4	NM_005131	0	0	0	0	0	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	37	CCDS45820.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.333686	0.81801	.	.	ENSG00000079134	ENST00000261600	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.80696	0.4672	M	0.79926	2.475	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.83306	-0.0025	9	0.87932	D	0	-9.0323	16.3947	0.83586	1.0:0.0:0.0:0.0	.	177;177	Q96FV9-2;Q96FV9	.;THOC1_HUMAN	S	177	.	ENSP00000261600:L177S	L	-	2	0	THOC1	244346	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.962000	0.93254	2.272000	0.75746	0.459000	0.35465	TTG	.		0.363	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
TTR	7276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	29178601	29178601	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:29178601A>G	ENST00000237014.3	+	4	584	c.407A>G	c.(406-408)tAt>tGt	p.Y136C		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	136	Thyroid hormone binding.		Y -> S (in AMYL-TTR; amyloid polyneuropathy). {ECO:0000269|PubMed:10627135}.|Y -> V (requires 2 nucleotide substitutions). {ECO:0000269|PubMed:3675594}.		extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCCTACTCCTATTCCACCACG	0.552																																					p.Y136C		.											.	TTR-91	0			c.A407G	GRCh37	CM971541	TTR	M		.						80.0	67.0	72.0					18																	29178601		2203	4300	6503	SO:0001583	missense	7276	exon4			ACTCCTATTCCAC	M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.407A>G	18.37:g.29178601A>G	ENSP00000237014:p.Tyr136Cys	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	78	21	NM_000371	0	0	0	0	0	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Missense_Mutation	SNP	ENST00000237014.3	37	CCDS11899.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089090	0.55968	.	.	ENSG00000118271	ENST00000237014;ENST00000432547;ENST00000541025	D	0.98120	-4.73	6.08	3.5	0.40072	Transthyretin, conserved site (1);Transthyretin/hydroxyisourate hydrolase, superfamily (4);	0.246709	0.42294	D	0.000722	D	0.98957	0.9645	H	0.96301	3.8	0.52501	D	0.999955	D	0.89917	1.0	D	0.87578	0.998	D	0.98496	1.0612	10	0.87932	D	0	-18.6558	10.7142	0.46002	0.7084:0.0:0.0:0.2916	.	136	P02766	TTHY_HUMAN	C	136;173;128	ENSP00000237014:Y136C	ENSP00000237014:Y136C	Y	+	2	0	TTR	27432599	0.995000	0.38212	0.908000	0.35775	0.474000	0.32979	3.175000	0.50855	2.333000	0.79357	0.482000	0.46254	TAT	.		0.552	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254948.1	NM_000371	
C18orf21	83608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	33558958	33558958	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:33558958C>G	ENST00000592875.1	+	5	1298	c.652C>G	c.(652-654)Ctt>Gtt	p.L218V	C18orf21_ENST00000333234.5_Missense_Mutation_p.L130V	NM_031446.4	NP_113634.3	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21	218										endometrium(1)|kidney(1)|large_intestine(1)|skin(2)	5						GAAGGGTGGACTTTTAAAATA	0.308																																					p.L218V		.											.	C18orf21-90	0			c.C652G						.						50.0	54.0	53.0					18																	33558958		2202	4300	6502	SO:0001583	missense	83608	exon5			GGTGGACTTTTAA	BC025950	CCDS11916.2, CCDS56064.1, CCDS74212.1	18q12.2	2004-05-05			ENSG00000141428	ENSG00000141428			28802	protein-coding gene	gene with protein product						12477932	Standard	NM_031446		Approved	PNAS-131, PNAS-124, HsT3108	uc002kzc.3	Q32NC0	OTTHUMG00000128531	ENST00000592875.1:c.652C>G	18.37:g.33558958C>G	ENSP00000465517:p.Leu218Val	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	54	17	NM_031446	0	0	16	25	9	Q6GW03|Q9BXV6|Q9BXW2	Missense_Mutation	SNP	ENST00000592875.1	37	CCDS11916.2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697544	0.48307	.	.	ENSG00000141428	ENST00000333234;ENST00000269194	.	.	.	5.34	1.6	0.23607	.	.	.	.	.	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.18741	0.03	B	0.21151	0.033	T	0.20405	-1.0276	8	0.87932	D	0	.	3.9349	0.09301	0.1694:0.5002:0.0:0.3305	.	218	Q32NC0	CR021_HUMAN	V	218;130	.	ENSP00000269194:L130V	L	+	1	0	C18orf21	31812956	0.136000	0.22515	0.033000	0.17914	0.167000	0.22549	-0.006000	0.12833	0.641000	0.30601	0.655000	0.94253	CTT	.		0.308	C18orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250364.1	NM_031446	
MYO5B	4645	broad.mit.edu	37	18	47511190	47511190	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:47511190C>A	ENST00000285039.7	-	8	1143	c.844G>T	c.(844-846)Gca>Tca	p.A282S		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	282	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AAGTCCTCTGCACTTGCTGTG	0.502																																					p.A282S													.	MYO5B-72	0			c.G844T						.						81.0	83.0	82.0					18																	47511190		1992	4174	6166	SO:0001583	missense	4645	exon8			CCTCTGCACTTGC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.844G>T	18.37:g.47511190C>A	ENSP00000285039:p.Ala282Ser	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	124	5	NM_001080467	0	0	0	0	0	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550068	0.86127	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.95482	-3.72	5.51	4.62	0.57501	Myosin head, motor domain (2);	0.058279	0.64402	N	0.000002	D	0.96941	0.9001	M	0.84156	2.68	0.80722	D	1	B;P	0.37370	0.239;0.592	P;B	0.50537	0.643;0.304	D	0.96566	0.9419	10	0.48119	T	0.1	.	15.1015	0.72279	0.143:0.857:0.0:0.0	.	281;282	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	S	282;281	ENSP00000285039:A282S	ENSP00000285039:A282S	A	-	1	0	MYO5B	45765188	1.000000	0.71417	0.033000	0.17914	0.216000	0.24613	5.990000	0.70595	1.278000	0.44430	0.561000	0.74099	GCA	.		0.502	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
TSHZ1	10194	hgsc.bcm.edu;bcgsc.ca	37	18	72999468	72999468	+	Silent	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:72999468C>A	ENST00000580243.1	+	2	2454	c.2106C>A	c.(2104-2106)gcC>gcA	p.A702A	TSHZ1_ENST00000322038.5_Silent_p.A657A			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	702					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CTGGGAAGGCCAAAAAGGAGG	0.547																																					p.A657A		.											.	TSHZ1-90	0			c.C1971A						.						99.0	88.0	92.0					18																	72999468		2203	4300	6503	SO:0001819	synonymous_variant	10194	exon2			GAAGGCCAAAAAG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2106C>A	18.37:g.72999468C>A		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	102	35	NM_005786	0	0	2	2	0	O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	37																																																																																				.		0.547	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
SUGP1	57794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19427332	19427332	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:19427332C>G	ENST00000247001.5	-	2	452	c.105G>C	c.(103-105)caG>caC	p.Q35H	SUGP1_ENST00000334782.5_Missense_Mutation_p.Q35H|SUGP1_ENST00000585763.1_5'UTR	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	35					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						TGAGCTCTTCCTGGTGAAGGA	0.517																																					p.Q35H		.											.	SUGP1-91	0			c.G105C						.						137.0	103.0	114.0					19																	19427332		2203	4300	6503	SO:0001583	missense	57794	exon2			CTCTTCCTGGTGA	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.105G>C	19.37:g.19427332C>G	ENSP00000247001:p.Gln35His	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	99	30	NM_172231	0	0	7	7	0	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	ENST00000247001.5	37	CCDS12399.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.460953	0.63513	.	.	ENSG00000105705	ENST00000247001;ENST00000535070;ENST00000334782	T	0.54279	0.58	4.88	-3.34	0.04943	.	0.000000	0.85682	D	0.000000	T	0.64832	0.2634	M	0.73962	2.25	0.50039	D	0.999841	D	0.71674	0.998	D	0.79784	0.993	T	0.67237	-0.5721	10	0.87932	D	0	.	10.2244	0.43216	0.0:0.2929:0.0:0.7071	.	35	Q8IWZ8	SUGP1_HUMAN	H	35	ENSP00000247001:Q35H	ENSP00000247001:Q35H	Q	-	3	2	SUGP1	19288332	0.067000	0.21026	0.993000	0.49108	0.968000	0.65278	-1.275000	0.02817	-0.260000	0.09418	-0.258000	0.10820	CAG	.		0.517	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460128.4	NM_021164	
ZNF569	148266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	37904781	37904781	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:37904781T>C	ENST00000316950.6	-	6	1336	c.779A>G	c.(778-780)cAt>cGt	p.H260R	ZNF569_ENST00000392150.2_Missense_Mutation_p.H101R|ZNF569_ENST00000392149.2_Missense_Mutation_p.H260R	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATTCTTTGATGTCTAATGAG	0.313																																					p.H260R		.											.	ZNF569-154	0			c.A779G						.						74.0	81.0	79.0					19																	37904781		2203	4299	6502	SO:0001583	missense	148266	exon6			CTTTGATGTCTAA	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.779A>G	19.37:g.37904781T>C	ENSP00000325018:p.His260Arg	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	17	9	NM_152484	0	0	0	2	2	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.145205	0.57044	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	D;D	0.86865	-2.18;-2.18	3.8	2.75	0.32379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38897	N	0.001523	D	0.93265	0.7854	M	0.92555	3.32	0.42876	D	0.994154	D;D	0.76494	0.999;0.999	D;D	0.62955	0.909;0.909	D	0.92892	0.6332	10	0.87932	D	0	.	9.5174	0.39113	0.0:0.0:0.1787:0.8213	.	101;260	Q17RR6;Q5MCW4	.;ZN569_HUMAN	R	260;101	ENSP00000325018:H260R;ENSP00000375993:H101R	ENSP00000325018:H260R	H	-	2	0	ZNF569	42596621	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.150000	0.50662	0.597000	0.29811	0.482000	0.46254	CAT	.		0.313	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
RABAC1	10567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42461228	42461228	+	Silent	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:42461228G>T	ENST00000222008.6	-	4	508	c.411C>A	c.(409-411)ggC>ggA	p.G137G	RABAC1_ENST00000601891.1_Intron|RABAC1_ENST00000601078.1_Silent_p.G43G	NM_006423.2	NP_006414.2	Q9UI14	PRAF1_HUMAN	Rab acceptor 1 (prenylated)	137						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	identical protein binding (GO:0042802)			central_nervous_system(1)|kidney(1)|prostate(1)	3						GGAAGGAGATGCCTCCAGCCA	0.642																																					p.G137G		.											.	RABAC1-90	0			c.C411A						.						77.0	75.0	76.0					19																	42461228		2203	4300	6503	SO:0001819	synonymous_variant	10567	exon4			GGAGATGCCTCCA	AJ133534	CCDS12593.1	19q13.2	2012-09-20			ENSG00000105404	ENSG00000105404			9794	protein-coding gene	gene with protein product	"""PRA1 domain family 1"", ""prenylated Rab acceptor 1"""	604925				10329441, 10751420	Standard	NM_006423		Approved	PRA1, PRAF1, YIP3	uc002osf.3	Q9UI14		ENST00000222008.6:c.411C>A	19.37:g.42461228G>T		Somatic	281	0		WXS	Illumina HiSeq	Phase_I	143	54	NM_006423	0	2	189	325	134	Q7Z4Y2|Q9Y3R1	Silent	SNP	ENST00000222008.6	37	CCDS12593.1																																																																																			.		0.642	RABAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463388.1	NM_006423	
CCDC155	147872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49920441	49920441	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:49920441G>A	ENST00000447857.3	+	19	1670	c.1465G>A	c.(1465-1467)Gcc>Acc	p.A489T		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	489						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						ACTCCAGCAAGCCCTGGTGCC	0.652																																					p.A489T		.											.	CCDC155-69	0			c.G1465A						.						23.0	26.0	25.0					19																	49920441		1938	4124	6062	SO:0001583	missense	147872	exon19			CAGCAAGCCCTGG		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1465G>A	19.37:g.49920441G>A	ENSP00000404220:p.Ala489Thr	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	42	19	NM_144688	0	0	0	0	0	Q96MC3	Missense_Mutation	SNP	ENST00000447857.3	37	CCDS46140.1	.	.	.	.	.	.	.	.	.	.	g	16.07	3.019479	0.54576	.	.	ENSG00000161609	ENST00000447857	T	0.57595	0.39	3.88	3.88	0.44766	.	0.000000	0.46758	D	0.000279	T	0.68824	0.3043	M	0.72118	2.19	0.28879	N	0.89453	D;D	0.67145	0.996;0.996	D;D	0.79784	0.993;0.993	T	0.65179	-0.6231	10	0.87932	D	0	-7.7039	12.1446	0.54016	0.0:0.0:1.0:0.0	.	489;489	C9JGW3;Q8N6L0	.;CC155_HUMAN	T	489	ENSP00000404220:A489T	ENSP00000404220:A489T	A	+	1	0	CCDC155	54612253	0.984000	0.35163	0.893000	0.35052	0.131000	0.20780	4.606000	0.61126	2.123000	0.65237	0.444000	0.29173	GCC	.		0.652	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688	
AP2A1	160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	50285918	50285918	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:50285918A>G	ENST00000359032.5	+	4	410	c.410A>G	c.(409-411)aAc>aGc	p.N137S	AP2A1_ENST00000600199.1_3'UTR|AP2A1_ENST00000354293.5_Missense_Mutation_p.N137S	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	137					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		TGCATCGCCAACGTGGGCAGC	0.657																																					p.N137S		.											.	AP2A1-92	0			c.A410G						.						32.0	33.0	32.0					19																	50285918		2157	4257	6414	SO:0001583	missense	160	exon4			TCGCCAACGTGGG	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.410A>G	19.37:g.50285918A>G	ENSP00000351926:p.Asn137Ser	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	30	12	NM_130787	0	0	9	27	18	Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	ENST00000359032.5	37	CCDS46148.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527703	0.64860	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.23950	1.88;1.88	5.54	5.54	0.83059	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.32133	0.0819	M	0.65975	2.015	0.80722	D	1	B;B	0.24533	0.025;0.105	B;B	0.28465	0.029;0.09	T	0.08617	-1.0713	10	0.52906	T	0.07	.	14.6526	0.68808	1.0:0.0:0.0:0.0	.	137;137	O95782-2;O95782	.;AP2A1_HUMAN	S	137	ENSP00000346246:N137S;ENSP00000351926:N137S	ENSP00000346246:N137S	N	+	2	0	AP2A1	54977730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.309000	0.96252	2.103000	0.63969	0.455000	0.32223	AAC	.		0.657	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
ZNF880	400713	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52887363	52887363	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:52887363C>T	ENST00000422689.2	+	4	545	c.530C>T	c.(529-531)gCa>gTa	p.A177V		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	177					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						GAACAAAAAGCACAAATAAGG	0.343																																					p.A177V													.	.	0			c.C530T						.						55.0	50.0	52.0					19																	52887363		692	1591	2283	SO:0001583	missense	400713	exon4			AAAAAGCACAAAT	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.530C>T	19.37:g.52887363C>T	ENSP00000406318:p.Ala177Val	Somatic	57	1		WXS	Illumina HiSeq	Phase_I	52	14	NM_001145434	0	0	0	0	0	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.692822	0.00731	.	.	ENSG00000221923	ENST00000422689	T	0.06142	3.34	1.46	-0.918	0.10482	.	.	.	.	.	T	0.02083	0.0065	N	0.02213	-0.635	0.09310	N	1	B	0.14805	0.011	B	0.15870	0.014	T	0.48658	-0.9016	8	.	.	.	.	4.5796	0.12252	0.0:0.3557:0.0:0.6443	.	177	Q6PDB4	ZN880_HUMAN	V	177	ENSP00000406318:A177V	.	A	+	2	0	ZNF880	57579175	0.032000	0.19561	0.010000	0.14722	0.007000	0.05969	-0.961000	0.03845	-0.035000	0.13691	-0.269000	0.10298	GCA	.		0.343	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
TRIB2	28951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	12858616	12858616	+	Silent	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:12858616C>A	ENST00000405331.3	+	1	253	c.183C>A	c.(181-183)atC>atA	p.I61I	RP11-333O1.1_ENST00000569860.1_lincRNA|TRIB2_ENST00000155926.4_Silent_p.I61I|TRIB2_ENST00000381465.2_Intron					tribbles pseudokinase 2											breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTCTTGTATCGGGAAATACT	0.577											OREG0014450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I61I		.											.	TRIB2-333	0			c.C183A						.						74.0	78.0	76.0					2																	12858616		2203	4300	6503	SO:0001819	synonymous_variant	28951	exon1			TTGTATCGGGAAA	AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000405331.3:c.183C>A	2.37:g.12858616C>A		Somatic	97	0	683	WXS	Illumina HiSeq	Phase_I	73	29	NM_021643	0	0	3	4	1		Silent	SNP	ENST00000405331.3	37																																																																																				.		0.577	TRIB2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000323585.1	NM_021643	
IL1RL2	8808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	102805602	102805602	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:102805602G>A	ENST00000264257.2	+	3	251	c.125G>A	c.(124-126)tGt>tAt	p.C42Y	IL1RL2_ENST00000441515.2_Intron|IL1RL2_ENST00000539491.1_Missense_Mutation_p.C42Y|IL1RL2_ENST00000481806.1_Intron	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	42	Ig-like C2-type 1.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						GCTTTTAATTGTACATTCCCT	0.358																																					p.C42Y		.											.	IL1RL2-92	0			c.G125A						.						90.0	89.0	89.0					2																	102805602		2203	4300	6503	SO:0001583	missense	8808	exon3			TTAATTGTACATT	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.125G>A	2.37:g.102805602G>A	ENSP00000264257:p.Cys42Tyr	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	49	18	NM_003854	0	0	0	0	0	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	ENST00000264257.2	37	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676325	0.67928	.	.	ENSG00000115598	ENST00000264257;ENST00000421464;ENST00000539491	D;D;D	0.94537	-3.45;-3.45;-3.45	5.86	4.94	0.65067	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.274660	0.40908	D	0.000981	D	0.96448	0.8841	M	0.78637	2.42	0.45867	D	0.998726	D	0.55800	0.973	P	0.62560	0.904	D	0.95878	0.8896	10	0.59425	D	0.04	.	13.5643	0.61807	0.0:0.1562:0.8438:0.0	.	42	Q9HB29	ILRL2_HUMAN	Y	42	ENSP00000264257:C42Y;ENSP00000387611:C42Y;ENSP00000442184:C42Y	ENSP00000264257:C42Y	C	+	2	0	IL1RL2	102172034	0.992000	0.36948	0.966000	0.40874	0.967000	0.64934	3.468000	0.53086	2.937000	0.99478	0.650000	0.86243	TGT	.		0.358	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
R3HDM1	23518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	136393707	136393707	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:136393707G>T	ENST00000264160.4	+	11	1227	c.857G>T	c.(856-858)aGa>aTa	p.R286I	R3HDM1_ENST00000409606.1_Missense_Mutation_p.R286I|R3HDM1_ENST00000410054.1_Missense_Mutation_p.R230I|R3HDM1_ENST00000329971.3_Missense_Mutation_p.R242I|R3HDM1_ENST00000409478.1_Missense_Mutation_p.R242I	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	286	SUZ. {ECO:0000255|PROSITE- ProRule:PRU01009}.						poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		ATAGAAGAAAGAGAAGAAGAG	0.343																																					p.R286I		.											.	R3HDM1-91	0			c.G857T						.						150.0	164.0	159.0					2																	136393707		2203	4300	6503	SO:0001583	missense	23518	exon11			AAGAAAGAGAAGA	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.857G>T	2.37:g.136393707G>T	ENSP00000264160:p.Arg286Ile	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	84	26	NM_015361	0	0	0	0	0	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	ENST00000264160.4	37	CCDS2177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.500931|4.500931	0.85176|0.85176	.|.	.|.	ENSG00000048991|ENSG00000048991	ENST00000456040|ENST00000422577;ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606	.|D;D;D;D;D	.|0.82526	.|-1.62;-1.62;-1.62;-1.62;-1.62	5.58|5.58	4.7|4.7	0.59300|0.59300	.|SUZ domain (1);	.|0.151795	.|0.64402	.|D	.|0.000020	.|D	.|0.90745	.|0.7095	M|M	0.79475|0.79475	2.455|2.455	0.48395|0.48395	D|D	0.999647|0.999647	.|D;D;D;D	.|0.89917	.|1.0;1.0;0.999;1.0	.|D;D;D;D	.|0.91635	.|0.997;0.999;0.998;0.999	.|D	.|0.92028	.|0.5631	.|10	.|0.87932	.|D	.|0	-12.4326|-12.4326	15.055|15.055	0.71908|0.71908	0.0685:0.0:0.9315:0.0|0.0685:0.0:0.9315:0.0	.|.	.|242;286;230;286	.|G5E9G8;E9PBB4;E9PG42;Q15032	.|.;.;.;R3HD1_HUMAN	X|I	269|242;242;286;242;230;286	.|ENSP00000386457:R242I;ENSP00000264160:R286I;ENSP00000331396:R242I;ENSP00000386877:R230I;ENSP00000387010:R286I	.|ENSP00000264160:R286I	E|R	+|+	1|2	0|0	R3HDM1|R3HDM1	136110177|136110177	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.821000|0.821000	0.46438|0.46438	7.981000|7.981000	0.88123|0.88123	1.501000|1.501000	0.48654|0.48654	-0.126000|-0.126000	0.14955|0.14955	GAG|AGA	.		0.343	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	
SCN1A	6323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	166848746	166848746	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:166848746A>T	ENST00000303395.4	-	26	5038	c.5039T>A	c.(5038-5040)gTc>gAc	p.V1680D	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.V1669D|SCN1A_ENST00000409050.1_Missense_Mutation_p.V1652D|SCN1A_ENST00000423058.2_Missense_Mutation_p.V1680D			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1680					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GATGAACATGACTAGGAAGAG	0.478																																					p.V1680D		.											.	SCN1A-147	0			c.T5039A						.						178.0	164.0	169.0					2																	166848746		2203	4300	6503	SO:0001583	missense	6323	exon26			AACATGACTAGGA	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5039T>A	2.37:g.166848746A>T	ENSP00000303540:p.Val1680Asp	Somatic	314	0		WXS	Illumina HiSeq	Phase_I	268	89	NM_001165963	0	0	0	0	0	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.331387	0.81690	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98926	-5.24;-5.24;-5.24;-5.24	5.41	5.41	0.78517	.	0.000000	0.53938	D	0.000051	D	0.99423	0.9796	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98389	1.0562	10	0.87932	D	0	.	15.4593	0.75342	1.0:0.0:0.0:0.0	.	1669	P35498-2	.	D	1680;1680;1669;1652	ENSP00000407030:V1680D;ENSP00000303540:V1680D;ENSP00000364554:V1669D;ENSP00000386312:V1652D	ENSP00000303540:V1680D	V	-	2	0	SCN1A	166556992	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.106000	0.94253	2.049000	0.60858	0.528000	0.53228	GTC	.		0.478	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
NFE2L2	4780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178098806	178098806	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:178098806G>T	ENST00000397062.3	-	2	793	c.239C>A	c.(238-240)aCa>aAa	p.T80K	NFE2L2_ENST00000464747.1_Missense_Mutation_p.T64K|NFE2L2_ENST00000446151.2_Missense_Mutation_p.T64K|NFE2L2_ENST00000397063.4_Missense_Mutation_p.T64K|NFE2L2_ENST00000423513.1_Missense_Mutation_p.T64K	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	80					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T80K(3)|p.T80R(2)|p.T80I(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AAATTCACCTGTCTCTTCATC	0.443			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.T80K		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2-90	6	Substitution - Missense(6)	lung(2)|oesophagus(2)|upper_aerodigestive_tract(1)|endometrium(1)	c.C239A						.						146.0	145.0	145.0					2																	178098806		1901	4109	6010	SO:0001583	missense	4780	exon2			TCACCTGTCTCTT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.239C>A	2.37:g.178098806G>T	ENSP00000380252:p.Thr80Lys	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	65	20	NM_006164	0	0	13	19	6	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264788	0.80358	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.997;0.994;0.999;0.997	T	0.69087	-0.5238	10	0.87932	D	0	.	19.9976	0.97389	0.0:0.0:1.0:0.0	.	64;64;64;80	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	K	64;80;64;64;64;64;64	ENSP00000380253:T64K;ENSP00000380252:T80K;ENSP00000411575:T64K;ENSP00000391590:T64K;ENSP00000400073:T64K;ENSP00000412191:T64K;ENSP00000410015:T64K	ENSP00000380252:T80K	T	-	2	0	NFE2L2	177807052	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.229000	0.95273	2.737000	0.93849	0.563000	0.77884	ACA	.		0.443	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
CHPF	79586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220404816	220404816	+	Silent	SNP	A	A	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:220404816A>T	ENST00000243776.6	-	4	1865	c.1617T>A	c.(1615-1617)gcT>gcA	p.A539A	CHPF_ENST00000535926.1_Silent_p.A377A	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	539	Ala-rich.				carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGGCTGCCGCAGCATCACCAG	0.657																																					p.A539A		.											.	CHPF-90	0			c.T1617A						.						15.0	15.0	15.0					2																	220404816		2197	4292	6489	SO:0001819	synonymous_variant	79586	exon4			TGCCGCAGCATCA	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1617T>A	2.37:g.220404816A>T		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	18	9	NM_024536	0	1	96	143	46	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Silent	SNP	ENST00000243776.6	37	CCDS2443.1																																																																																			.		0.657	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238259816	238259816	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:238259816C>G	ENST00000295550.4	-	27	7225	c.6773G>C	c.(6772-6774)gGt>gCt	p.G2258A	COL6A3_ENST00000346358.4_Missense_Mutation_p.G2058A|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2057A|COL6A3_ENST00000409809.1_Missense_Mutation_p.G2052A|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1651A|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2052A	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2258	Collagen-like 4.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCCAGGAGCACCAGCGGCACC	0.572																																					p.G2258A		.											.	COL6A3-526	0			c.G6773C						.						102.0	83.0	89.0					2																	238259816		2203	4300	6503	SO:0001583	missense	1293	exon27			GGAGCACCAGCGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6773G>C	2.37:g.238259816C>G	ENSP00000295550:p.Gly2258Ala	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	93	28	NM_004369	0	0	0	0	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558422	0.27827	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.97850	-4.16;-4.16;-4.57;-4.16;-4.57;-4.16	5.42	5.42	0.78866	.	0.000000	0.56097	D	0.000040	D	0.99372	0.9779	H	0.99238	4.48	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.999;0.998	D	0.98306	1.0521	10	0.87932	D	0	.	17.4191	0.87510	0.0:1.0:0.0:0.0	.	1651;1651;2052;2258	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	A	2258;2057;2052;1651;2052;2058	ENSP00000295550:G2258A;ENSP00000315609:G2057A;ENSP00000315873:G2052A;ENSP00000418285:G1651A;ENSP00000386844:G2052A;ENSP00000295546:G2058A	ENSP00000295550:G2258A	G	-	2	0	COL6A3	237924555	0.999000	0.42202	0.110000	0.21437	0.435000	0.31806	5.960000	0.70348	2.543000	0.85770	0.650000	0.86243	GGT	.		0.572	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
ILKAP	80895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	239093869	239093869	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:239093869A>G	ENST00000254654.3	-	6	660	c.485T>C	c.(484-486)tTt>tCt	p.F162S		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	162	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		CTGTGCAGCAAATTTTGAGGC	0.353																																					p.F162S		.											.	ILKAP-118	0			c.T485C						.						110.0	104.0	106.0					2																	239093869		2203	4300	6503	SO:0001583	missense	80895	exon6			GCAGCAAATTTTG	AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.485T>C	2.37:g.239093869A>G	ENSP00000254654:p.Phe162Ser	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	125	33	NM_030768	0	0	19	34	15	B3KM39	Missense_Mutation	SNP	ENST00000254654.3	37	CCDS2526.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082008	0.76528	.	.	ENSG00000132323	ENST00000254654;ENST00000457149	T;T	0.18810	2.19;2.19	5.86	5.86	0.93980	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.48768	0.1518	M	0.87617	2.895	0.80722	D	1	D	0.61080	0.989	D	0.67103	0.949	T	0.55425	-0.8143	10	0.66056	D	0.02	-4.2693	10.9192	0.47154	0.8595:0.0:0.0:0.1405	.	162	Q9H0C8	ILKAP_HUMAN	S	162;160	ENSP00000254654:F162S;ENSP00000395301:F160S	ENSP00000254654:F162S	F	-	2	0	ILKAP	238758608	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.341000	0.52151	2.241000	0.73720	0.528000	0.53228	TTT	.		0.353	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768	
JAG1	182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	10639160	10639160	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr20:10639160T>G	ENST00000254958.5	-	4	1165	c.650A>C	c.(649-651)aAc>aCc	p.N217T	JAG1_ENST00000423891.2_Missense_Mutation_p.N58T	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	217	DSL. {ECO:0000255|PROSITE- ProRule:PRU00377}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GCAAGTTTTGTTGCCATTCTG	0.493									Alagille Syndrome																												p.N217T		.											.	JAG1-1273	0			c.A650C						.						126.0	119.0	121.0					20																	10639160		2203	4300	6503	SO:0001583	missense	182	exon4	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GTTTTGTTGCCAT	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.650A>C	20.37:g.10639160T>G	ENSP00000254958:p.Asn217Thr	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	58	25	NM_000214	0	0	1	2	1	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463155	0.84425	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.96011	-3.88;-3.88	5.58	5.58	0.84498	Delta/Serrate/lag-2 (DSL) protein (3);	0.000000	0.85682	D	0.000000	D	0.95382	0.8501	L	0.50333	1.59	0.80722	D	1	D	0.52996	0.957	P	0.51833	0.681	D	0.95419	0.8505	10	0.54805	T	0.06	.	15.7475	0.77958	0.0:0.0:0.0:1.0	.	217	P78504	JAG1_HUMAN	T	217;58	ENSP00000254958:N217T;ENSP00000389519:N58T	ENSP00000254958:N217T	N	-	2	0	JAG1	10587160	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.124000	0.65301	0.460000	0.39030	AAC	.		0.493	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
LAMA5	3911	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60908164	60908164	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr20:60908164G>A	ENST00000252999.3	-	26	3330	c.3264C>T	c.(3262-3264)atC>atT	p.I1088I	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1088	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CCGTGCAGGTGATCAGTGGCG	0.716																																					p.I1088I													.	LAMA5-93	0			c.C3264T						.						12.0	14.0	13.0					20																	60908164		2185	4270	6455	SO:0001819	synonymous_variant	3911	exon26			GCAGGTGATCAGT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3264C>T	20.37:g.60908164G>A		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	15	8	NM_005560	0	0	3	3	0	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																			.		0.716	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
MYT1	4661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62851117	62851117	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr20:62851117A>G	ENST00000328439.1	+	13	2387	c.2023A>G	c.(2023-2025)Aaa>Gaa	p.K675E	MYT1_ENST00000360149.4_Missense_Mutation_p.K377E|MYT1_ENST00000536311.1_Missense_Mutation_p.K702E	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GAGCATGCACAAACACCGCAA	0.557																																					p.K675E	GBM(59;481 1041 20555 21139 33705)	.											.	MYT1-704	0			c.A2023G						.						107.0	99.0	102.0					20																	62851117		2203	4300	6503	SO:0001583	missense	4661	exon13			ATGCACAAACACC	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2023A>G	20.37:g.62851117A>G	ENSP00000327465:p.Lys675Glu	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	174	67	NM_004535	0	0	0	0	0	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049072	0.75846	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.59083	0.29;0.29;0.29	5.75	5.75	0.90469	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.74344	0.3704	M	0.73598	2.24	0.58432	D	0.999999	D;D;P	0.55800	0.971;0.973;0.716	P;P;P	0.61874	0.641;0.895;0.487	T	0.77816	-0.2447	10	0.87932	D	0	-17.2533	16.0591	0.80826	1.0:0.0:0.0:0.0	.	702;675;377	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	E	377;675;702	ENSP00000353269:K377E;ENSP00000327465:K675E;ENSP00000442412:K702E	ENSP00000327465:K675E	K	+	1	0	MYT1	62321561	1.000000	0.71417	0.598000	0.28837	0.888000	0.51559	8.826000	0.92034	2.185000	0.69588	0.533000	0.62120	AAA	.		0.557	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
DYRK1A	1859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	38884349	38884349	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr21:38884349G>A	ENST00000398960.2	+	11	1882	c.1807G>A	c.(1807-1809)Ggt>Agt	p.G603S	DYRK1A_ENST00000455387.2_Missense_Mutation_p.G375S|DYRK1A_ENST00000339659.4_Missense_Mutation_p.G594S|DYRK1A_ENST00000338785.3_3'UTR	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	603					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TCATCACCATGGTAACAGTTC	0.502																																					p.G603S	Melanoma(114;464 1602 31203 43785 45765)	.											.	DYRK1A-792	0			c.G1807A						.						115.0	98.0	104.0					21																	38884349		2203	4300	6503	SO:0001583	missense	1859	exon11			CACCATGGTAACA	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1807G>A	21.37:g.38884349G>A	ENSP00000381932:p.Gly603Ser	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	129	45	NM_001396	0	0	1	5	4	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	ENST00000398960.2	37	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221682	0.58560	.	.	ENSG00000157540	ENST00000339659;ENST00000398960;ENST00000455387	T;T;T	0.55760	0.5;0.5;1.09	5.21	5.21	0.72293	.	0.298408	0.32459	N	0.006064	T	0.52725	0.1752	N	0.14661	0.345	0.53688	D	0.999979	D;D	0.60575	0.98;0.988	P;D	0.65010	0.855;0.931	T	0.44329	-0.9335	10	0.08599	T	0.76	.	18.785	0.91951	0.0:0.0:1.0:0.0	.	603;594	Q13627;Q13627-2	DYR1A_HUMAN;.	S	594;603;375	ENSP00000340373:G594S;ENSP00000381932:G603S;ENSP00000407854:G375S	ENSP00000340373:G594S	G	+	1	0	DYRK1A	37806219	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.746000	0.74866	2.434000	0.82447	0.655000	0.94253	GGT	.		0.502	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396	
ABHD5	51099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	43744053	43744053	+	Silent	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr3:43744053T>C	ENST00000458276.2	+	3	603	c.480T>C	c.(478-480)gcT>gcC	p.A160A		NM_016006.4	NP_057090.2	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	160					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|negative regulation of sequestering of triglyceride (GO:0010891)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|lysophosphatidic acid acyltransferase activity (GO:0042171)			kidney(3)|large_intestine(2)|liver(2)|lung(5)|ovary(1)|skin(1)	14		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)		TCTTGGCTGCTGCTTACTCGC	0.468																																					p.A160A		.											.	ABHD5-91	0			c.T480C						.						205.0	195.0	198.0					3																	43744053		2203	4300	6503	SO:0001819	synonymous_variant	51099	exon3			GGCTGCTGCTTAC	AF007132	CCDS2711.1	3p21.33	2012-05-16			ENSG00000011198	ENSG00000011198		"""Abhydrolase domain containing"""	21396	protein-coding gene	gene with protein product		604780				11590543, 18606822	Standard	NM_016006		Approved	CGI-58, NCIE2	uc003cmx.3	Q8WTS1	OTTHUMG00000133039	ENST00000458276.2:c.480T>C	3.37:g.43744053T>C		Somatic	188	0		WXS	Illumina HiSeq	Phase_I	199	46	NM_016006	0	0	2	5	3	B2R9K0|Q9Y369	Silent	SNP	ENST00000458276.2	37	CCDS2711.1																																																																																			.		0.468	ABHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256644.2	NM_016006	
LMOD3	56203	broad.mit.edu	37	3	69168646	69168646	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr3:69168646A>G	ENST00000420581.2	-	2	1039	c.860T>C	c.(859-861)tTc>tCc	p.F287S	LMOD3_ENST00000489031.1_Missense_Mutation_p.F287S|LMOD3_ENST00000475434.1_Missense_Mutation_p.F287S	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	287						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		GGCTAAACTGAATGTTTTGAT	0.398																																					p.F287S													.	LMOD3-23	0			c.T860C						.						199.0	180.0	186.0					3																	69168646		1979	4166	6145	SO:0001583	missense	56203	exon2			AAACTGAATGTTT	AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.860T>C	3.37:g.69168646A>G	ENSP00000414670:p.Phe287Ser	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	81	3	NM_198271	0	0	0	0	0	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Missense_Mutation	SNP	ENST00000420581.2	37	CCDS46862.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.948944	0.73787	.	.	ENSG00000163380	ENST00000420581;ENST00000489031;ENST00000475434	T;T;T	0.19250	2.16;2.16;2.16	5.69	5.69	0.88448	.	0.091186	0.85682	D	0.000000	T	0.49474	0.1559	M	0.83483	2.645	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.56117	-0.8032	10	0.87932	D	0	-22.5676	15.9592	0.79914	1.0:0.0:0.0:0.0	.	287	Q0VAK6	LMOD3_HUMAN	S	287	ENSP00000414670:F287S;ENSP00000417210:F287S;ENSP00000418645:F287S	ENSP00000414670:F287S	F	-	2	0	LMOD3	69251336	1.000000	0.71417	0.997000	0.53966	0.887000	0.51463	9.339000	0.96797	2.180000	0.69256	0.482000	0.46254	TTC	.		0.398	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352138.1	XM_067529	
TRMT10C	54931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101284214	101284214	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr3:101284214C>T	ENST00000309922.6	+	2	743	c.589C>T	c.(589-591)Cag>Tag	p.Q197*		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	197	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										GAAGGGTGCCCAGGCCATGCA	0.398																																					p.Q197X		.											.	.	0			c.C589T						.						103.0	95.0	97.0					3																	101284214		1849	4094	5943	SO:0001587	stop_gained	54931	exon2			GGTGCCCAGGCCA	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.589C>T	3.37:g.101284214C>T	ENSP00000312356:p.Gln197*	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	50	16	NM_017819	0	0	15	22	7	Q9NRG5|Q9NX54|Q9Y596	Nonsense_Mutation	SNP	ENST00000309922.6	37	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956006	0.92726	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	.	.	.	5.96	5.96	0.96718	.	0.120526	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-25.6056	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	X	197	.	ENSP00000312356:Q197X	Q	+	1	0	RG9MTD1	102766904	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.736000	0.68597	2.832000	0.97577	0.655000	0.94253	CAG	.		0.398	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
KIAA1407	57577	broad.mit.edu	37	3	113684200	113684200	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr3:113684200G>A	ENST00000295878.3	-	17	2759	c.2613C>T	c.(2611-2613)atC>atT	p.I871I		NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	871										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						TGATCCAGAGGATCCTCCTTT	0.343																																					p.I871I													.	KIAA1407-92	0			c.C2613T						.						60.0	65.0	63.0					3																	113684200		2203	4300	6503	SO:0001819	synonymous_variant	57577	exon17			CCAGAGGATCCTC	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2613C>T	3.37:g.113684200G>A		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	16	3	NM_020817	0	0	1	1	0	B4DYL1|Q9P2E0	Silent	SNP	ENST00000295878.3	37	CCDS2977.1																																																																																			.		0.343	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
MUC4	4585	bcgsc.ca	37	3	195513470	195513470	+	Missense_Mutation	SNP	G	G	C	rs577584155	byFrequency	TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr3:195513470G>C	ENST00000463781.3	-	2	5440	c.4981C>G	c.(4981-4983)Cac>Gac	p.H1661D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1661D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.587													.|||	6	0.00119808	0.0	0.0	5008	,	,		20843	0.004		0.001	False		,,,				2504	0.001				p.H1661D													.	MUC4-90	0			c.C4981G						.						26.0	31.0	30.0					3																	195513470		688	1578	2266	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4981C>G	3.37:g.195513470G>C	ENSP00000417498:p.His1661Asp	Somatic	967	22		WXS	Illumina HiSeq	Phase_1	1145	39	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.588	-0.529937	0.04112	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31247	1.57;1.5	0.595	-0.659	0.11424	.	.	.	.	.	T	0.16685	0.0401	N	0.08118	0	0.09310	N	1	P	0.44006	0.824	P	0.46208	0.507	T	0.17077	-1.0381	7	.	.	.	.	.	.	.	.	1661	E7ESK3	.	D	1661	ENSP00000417498:H1661D;ENSP00000420243:H1661D	.	H	-	1	0	MUC4	196997865	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	-4.994000	0.00162	-0.175000	0.10725	-1.880000	0.00545	CAC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LRCH3	84859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	197592302	197592302	+	Missense_Mutation	SNP	C	C	G	rs201375313		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr3:197592302C>G	ENST00000425562.2	+	16	1725	c.1725C>G	c.(1723-1725)gaC>gaG	p.D575E	LRCH3_ENST00000334859.4_Missense_Mutation_p.D575E|LRCH3_ENST00000414675.2_Missense_Mutation_p.D523E|LRCH3_ENST00000441090.2_Missense_Mutation_p.D421E|LRCH3_ENST00000438796.2_Missense_Mutation_p.D575E|LRCH3_ENST00000536618.1_Missense_Mutation_p.D170E			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	575						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		AGAGTGATGACAGACCTAATG	0.274																																					p.D575E		.											.	LRCH3-91	0			c.C1725G						.						39.0	38.0	39.0					3																	197592302		2203	4300	6503	SO:0001583	missense	84859	exon16			TGATGACAGACCT	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1725C>G	3.37:g.197592302C>G	ENSP00000393579:p.Asp575Glu	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	154	41	NM_032773	0	0	0	0	0	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	37		.	.	.	.	.	.	.	.	.	.	C	4.270	0.049197	0.08243	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562;ENST00000536618;ENST00000452660;ENST00000433298	T;T;T;T;T;T;T;T	0.46451	2.09;1.5;2.1;2.36;2.11;0.89;0.87;0.97	4.97	2.98	0.34508	.	0.475028	0.22270	N	0.062279	T	0.26340	0.0643	L	0.29908	0.895	0.20563	N	0.999887	B;B;B;B;P	0.37663	0.102;0.058;0.056;0.033;0.604	B;B;B;B;B	0.33042	0.028;0.012;0.029;0.008;0.157	T	0.07539	-1.0767	10	0.31617	T	0.26	-1.0728	8.8539	0.35217	0.0:0.8043:0.0:0.1957	.	421;523;575;575;575	E9PD99;B4E0T7;Q96II8-2;Q96II8;Q96II8-3	.;.;.;LRCH3_HUMAN;.	E	575;421;523;575;575;170;86;48	ENSP00000399751:D575E;ENSP00000394609:D421E;ENSP00000394965:D523E;ENSP00000334375:D575E;ENSP00000393579:D575E;ENSP00000439083:D170E;ENSP00000395309:D86E;ENSP00000400164:D48E	ENSP00000334375:D575E	D	+	3	2	LRCH3	199076699	1.000000	0.71417	0.975000	0.42487	0.064000	0.16182	0.457000	0.21875	0.390000	0.25115	-0.480000	0.04831	GAC	C|0.999;T|0.001		0.274	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773	
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	44450334	44450334	+	Silent	SNP	A	A	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr4:44450334A>T	ENST00000360029.3	-	1	490	c.207T>A	c.(205-207)acT>acA	p.T69T	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	69	BTB.				protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TGCTGGCCAAAGTACTGTCCG	0.677										HNSCC(17;0.042)																											p.T69T		.											.	KCTD8-92	0			c.T207A						.						24.0	21.0	22.0					4																	44450334		2191	4278	6469	SO:0001819	synonymous_variant	386617	exon1			GGCCAAAGTACTG	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.207T>A	4.37:g.44450334A>T		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	33	16	NM_198353	0	0	0	0	0	A2RU39	Silent	SNP	ENST00000360029.3	37	CCDS3467.1																																																																																			.		0.677	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
AFF1	4299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	88053423	88053423	+	Splice_Site	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr4:88053423C>T	ENST00000307808.6	+	18	3573	c.3153C>T	c.(3151-3153)tgC>tgT	p.C1051C	AFF1_ENST00000544085.1_Splice_Site_p.C689C|AFF1_ENST00000395146.4_Splice_Site_p.C1058C	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	1051					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TTGTTCATAGCATGCGTTGCC	0.393																																					p.C1058C		.											.	AFF1-289	0			c.C3174T						.						118.0	107.0	111.0					4																	88053423		2203	4300	6503	SO:0001630	splice_region_variant	4299	exon19			TCATAGCATGCGT	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.3153-1C>T	4.37:g.88053423C>T		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	118	34	NM_001166693	0	0	0	0	0	B4DTU1|E9PBM3	Silent	SNP	ENST00000307808.6	37	CCDS3616.1																																																																																			.		0.393	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	Silent
ADH4	127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	100057629	100057629	+	Silent	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr4:100057629G>T	ENST00000265512.7	-	5	644	c.570C>A	c.(568-570)atC>atA	p.I190I	ADH4_ENST00000508393.1_Silent_p.I209I|ADH4_ENST00000423445.1_Silent_p.I209I|RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000505590.1_Silent_p.I209I	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	190					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		TGGCATTGTTGATTGCAGCCC	0.388																																					p.I190I		.											.	ADH4-228	0			c.C570A						.						162.0	144.0	150.0					4																	100057629		2203	4300	6503	SO:0001819	synonymous_variant	127	exon5			ATTGTTGATTGCA	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.570C>A	4.37:g.100057629G>T		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	45	14	NM_000670	0	0	0	0	0	A8K470|B4DIE7|C9J4A9|Q8TCD7	Silent	SNP	ENST00000265512.7	37	CCDS34032.1																																																																																			.		0.388	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123109188	123109188	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr4:123109188A>T	ENST00000264501.4	+	9	1139	c.766A>T	c.(766-768)Aat>Tat	p.N256Y	KIAA1109_ENST00000455637.1_Missense_Mutation_p.N256Y|KIAA1109_ENST00000388738.3_Missense_Mutation_p.N256Y			Q2LD37	K1109_HUMAN	KIAA1109	256					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAAGCTTGAAAATGTTCGAGT	0.313																																					p.N256Y		.											.	KIAA1109-80	0			c.A766T						.						103.0	94.0	97.0					4																	123109188		1842	4093	5935	SO:0001583	missense	84162	exon7			CTTGAAAATGTTC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.766A>T	4.37:g.123109188A>T	ENSP00000264501:p.Asn256Tyr	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	19	6	NM_015312	0	0	0	0	0	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.3|24.3	4.519360|4.519360	0.85495|0.85495	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000424425|ENST00000264501;ENST00000388738;ENST00000455637	.|D;D;D	.|0.95272	.|-3.66;-3.66;-3.66	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|7739.210000	.|0.00604	.|U	.|0.000398	D|D	0.97204|0.97204	0.9086|0.9086	L|L	0.55213|0.55213	1.73|1.73	0.80722|0.80722	D|D	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.80764	.|0.994	D|D	0.87444|0.87444	0.2397|0.2397	5|10	.|0.87932	.|D	.|0	.|.	15.4917|15.4917	0.75611|0.75611	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|256	.|Q2LD37	.|K1109_HUMAN	I|Y	88|256	.|ENSP00000264501:N256Y;ENSP00000373390:N256Y;ENSP00000389925:N256Y	.|ENSP00000264501:N256Y	K|N	+|+	2|1	0|0	KIAA1109|KIAA1109	123328638|123328638	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.232000|9.232000	0.95325|0.95325	2.065000|2.065000	0.61736|0.61736	0.459000|0.459000	0.35465|0.35465	AAA|AAT	.		0.313	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
SMARCA5	8467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	144457751	144457751	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr4:144457751A>C	ENST00000283131.3	+	11	1877	c.1415A>C	c.(1414-1416)tAt>tCt	p.Y472S		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	472					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GGTCCACCTTATACAACAGAT	0.398																																					p.Y472S		.											.	SMARCA5-227	0			c.A1415C						.						102.0	95.0	97.0					4																	144457751		2203	4300	6503	SO:0001583	missense	8467	exon11			CACCTTATACAAC	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1415A>C	4.37:g.144457751A>C	ENSP00000283131:p.Tyr472Ser	Somatic	351	0		WXS	Illumina HiSeq	Phase_I	327	128	NM_003601	0	0	5	8	3		Missense_Mutation	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.668376	0.88348	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	T	0.75050	-0.9	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.85720	0.5762	M	0.88906	2.99	0.80722	D	1	P	0.44380	0.834	P	0.53912	0.737	D	0.87814	0.2633	10	0.56958	D	0.05	-21.194	15.7551	0.78018	1.0:0.0:0.0:0.0	.	472	O60264	SMCA5_HUMAN	S	472;415;415	ENSP00000283131:Y472S	ENSP00000283131:Y472S	Y	+	2	0	SMARCA5	144677201	1.000000	0.71417	0.977000	0.42913	0.985000	0.73830	9.231000	0.95317	2.192000	0.70111	0.533000	0.62120	TAT	.		0.398	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
FAM149A	25854	broad.mit.edu;bcgsc.ca	37	4	187093141	187093141	+	Nonstop_Mutation	SNP	A	A	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr4:187093141A>T	ENST00000356371.5	+	14	2322	c.2322A>T	c.(2320-2322)tgA>tgT	p.*774C	FAM149A_ENST00000389354.5_Nonstop_Mutation_p.*483C|FAM149A_ENST00000502970.1_Nonstop_Mutation_p.*483C|FAM149A_ENST00000227065.4_Nonstop_Mutation_p.*483C|FAM149A_ENST00000514153.1_Nonstop_Mutation_p.*483C|FAM149A_ENST00000503432.1_Nonstop_Mutation_p.*483C			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	0										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		TGACATCTTGAAACCACCTCA	0.423																																					p.X483C													.	FAM149A-90	0			c.A1449T						.						98.0	93.0	95.0					4																	187093141		2203	4300	6503	SO:0001578	stop_lost	25854	exon13			ATCTTGAAACCAC	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.2322A>T	4.37:g.187093141A>T	ENSP00000348732:p.*774Cysext*33	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	63	6	NM_001006655	0	0	95	104	9	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	ENST00000356371.5	37		.	.	.	.	.	.	.	.	.	.	A	16.11	3.030830	0.54790	.	.	ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354;ENST00000502894	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1839	0.65592	1.0:0.0:0.0:0.0	.	.	.	.	C	483;774;483;483;483;483;34	.	.	X	+	3	0	FAM149A	187330135	0.994000	0.37717	0.566000	0.28421	0.429000	0.31625	3.642000	0.54367	2.183000	0.69458	0.528000	0.53228	TGA	.		0.423	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
CDH6	1004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	31294229	31294229	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:31294229C>A	ENST00000265071.2	+	3	654	c.389C>A	c.(388-390)gCt>gAt	p.A130D	CDH6_ENST00000514738.1_Missense_Mutation_p.A75D	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	130	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CGAGCTCAAGCTATAAACAGA	0.458																																					p.A130D		.											.	CDH6-159	0			c.C389A						.						128.0	127.0	127.0					5																	31294229		2203	4300	6503	SO:0001583	missense	1004	exon3			CTCAAGCTATAAA	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.389C>A	5.37:g.31294229C>A	ENSP00000265071:p.Ala130Asp	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	68	21	NM_004932	0	0	7	16	9	A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436456	0.83885	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.71934	-0.61;-0.61	5.77	5.77	0.91146	Cadherin (4);Cadherin-like (1);	0.096902	0.64402	D	0.000001	D	0.90964	0.7159	H	0.98089	4.145	0.53688	D	0.999972	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93441	0.6794	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	130;130	P55285;P55285-2	CADH6_HUMAN;.	D	75;130	ENSP00000424843:A75D;ENSP00000265071:A130D	ENSP00000265071:A130D	A	+	2	0	CDH6	31329986	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	3.261000	0.51530	2.885000	0.99019	0.655000	0.94253	GCT	.		0.458	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
DTWD2	285605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	118183873	118183873	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:118183873C>T	ENST00000510708.1	-	5	671	c.638G>A	c.(637-639)cGg>cAg	p.R213Q	DTWD2_ENST00000515439.3_Missense_Mutation_p.R117Q|DTWD2_ENST00000304058.4_Missense_Mutation_p.R147Q	NM_173666.2	NP_775937.1	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2	213										breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)	13		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)		CGGCTGCATCCGAATTACATA	0.318																																					p.R213Q		.											.	DTWD2-90	0			c.G638A						.						67.0	64.0	65.0					5																	118183873		2202	4300	6502	SO:0001583	missense	285605	exon5			TGCATCCGAATTA		CCDS34216.1	5q23.1	2008-02-05			ENSG00000169570	ENSG00000169570			19334	protein-coding gene	gene with protein product							Standard	NM_173666		Approved	FLJ33977	uc003ksa.3	Q8NBA8	OTTHUMG00000162956	ENST00000510708.1:c.638G>A	5.37:g.118183873C>T	ENSP00000425048:p.Arg213Gln	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	136	41	NM_173666	0	0	1	1	0		Missense_Mutation	SNP	ENST00000510708.1	37	CCDS34216.1	.	.	.	.	.	.	.	.	.	.	C	33	5.223594	0.95139	.	.	ENSG00000169570	ENST00000304058;ENST00000510708;ENST00000515439	.	.	.	5.36	5.36	0.76844	DTW (1);	0.000000	0.85682	D	0.000000	D	0.86134	0.5860	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89151	0.3523	9	0.87932	D	0	-25.3975	18.6918	0.91586	0.0:1.0:0.0:0.0	.	213	Q8NBA8	DTWD2_HUMAN	Q	147;213;117	.	ENSP00000302892:R147Q	R	-	2	0	DTWD2	118211772	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.267000	0.78462	2.511000	0.84671	0.455000	0.32223	CGG	.		0.318	DTWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371167.2	NM_173666	
FAM13B	51306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137346798	137346798	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:137346798C>G	ENST00000033079.3	-	6	1040	c.589G>C	c.(589-591)Gtg>Ctg	p.V197L	FAM13B_ENST00000420893.2_Missense_Mutation_p.V197L|FAM13B_ENST00000425075.2_Missense_Mutation_p.V79L	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	197	Glu-rich.|Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						ATCCTGCTCACTATTTCTTGC	0.338																																					p.V197L		.											.	.	0			c.G589C						.						155.0	147.0	150.0					5																	137346798		2203	4300	6503	SO:0001583	missense	51306	exon6			TGCTCACTATTTC	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.589G>C	5.37:g.137346798C>G	ENSP00000033079:p.Val197Leu	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	31	18	NM_001101800	0	0	0	0	0	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818248	0.90790	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.41400	1.0;2.01;1.0	5.59	5.59	0.84812	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.58495	0.2126	L	0.40543	1.245	0.80722	D	1	D;D;P	0.67145	0.996;0.996;0.461	D;D;B	0.77557	0.987;0.99;0.299	T	0.57476	-0.7805	10	0.54805	T	0.06	-6.8245	19.5907	0.95509	0.0:1.0:0.0:0.0	.	79;197;197	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	L	197;79;197	ENSP00000033079:V197L;ENSP00000394669:V79L;ENSP00000388521:V197L	ENSP00000033079:V197L	V	-	1	0	FAM13B	137374697	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.005000	0.63972	2.640000	0.89533	0.655000	0.94253	GTG	.		0.338	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
KIAA0141	9812	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	141316790	141316790	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:141316790A>C	ENST00000432126.2	+	11	1311	c.1177A>C	c.(1177-1179)Att>Ctt	p.I393L	KIAA0141_ENST00000194118.4_Missense_Mutation_p.I393L	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	393					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACCTTGGAATTTGCTATGA	0.517																																					p.I393L													.	KIAA0141-91	0			c.A1177C						.						169.0	162.0	165.0					5																	141316790		2203	4300	6503	SO:0001583	missense	9812	exon11			CTTGGAATTTGCT	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.1177A>C	5.37:g.141316790A>C	ENSP00000396225:p.Ile393Leu	Somatic	74	1		WXS	Illumina HiSeq	Phase_I	88	30	NM_001142603	0	0	10	16	6	Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	37	CCDS4268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.90|13.90	2.374638|2.374638	0.42105|0.42105	.|.	.|.	ENSG00000081791|ENSG00000081791	ENST00000507481|ENST00000432126;ENST00000194118	.|T;T	.|0.48836	.|0.8;0.8	5.6|5.6	4.45|4.45	0.53987|0.53987	.|Tetratricopeptide-like helical (1);	.|0.241061	.|0.39083	.|N	.|0.001473	T|T	0.42787|0.42787	0.1218|0.1218	N|N	0.24115|0.24115	0.695|0.695	0.29115|0.29115	N|N	0.880593|0.880593	.|D	.|0.61697	.|0.99	.|P	.|0.60886	.|0.88	T|T	0.26395|0.26395	-1.0104|-1.0104	5|10	.|0.10636	.|T	.|0.68	-10.6493|-10.6493	7.4726|7.4726	0.27357|0.27357	0.9061:0.0:0.0939:0.0|0.9061:0.0:0.0939:0.0	.|.	.|393	.|Q14154	.|DELE_HUMAN	D|L	94|393	.|ENSP00000396225:I393L;ENSP00000194118:I393L	.|ENSP00000194118:I393L	E|I	+|+	3|1	2|0	KIAA0141|KIAA0141	141296974|141296974	0.967000|0.967000	0.33354|0.33354	0.997000|0.997000	0.53966|0.53966	0.971000|0.971000	0.66376|0.66376	1.697000|1.697000	0.37784|0.37784	2.140000|2.140000	0.66376|0.66376	0.533000|0.533000	0.62120|0.62120	GAA|ATT	.		0.517	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
FAM71B	153745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156590131	156590131	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:156590131G>A	ENST00000302938.4	-	2	1240	c.1145C>T	c.(1144-1146)aCc>aTc	p.T382I		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	382						nucleus (GO:0005634)		p.T382N(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACACTTGCTGGTCGTAATACT	0.572																																					p.T382I		.											.	FAM71B-96	1	Substitution - Missense(1)	lung(1)	c.C1145T						.						47.0	49.0	48.0					5																	156590131		2203	4300	6503	SO:0001583	missense	153745	exon2			TTGCTGGTCGTAA		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1145C>T	5.37:g.156590131G>A	ENSP00000305596:p.Thr382Ile	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	51	11	NM_130899	0	0	0	0	0	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673011	0.47781	.	.	ENSG00000170613	ENST00000302938	T	0.18960	2.18	3.83	2.95	0.34219	.	0.314558	0.23165	N	0.051186	T	0.37598	0.1009	M	0.78801	2.425	0.09310	N	1	D	0.62365	0.991	P	0.57101	0.813	T	0.13548	-1.0505	10	0.72032	D	0.01	-18.4181	9.0093	0.36131	0.0:0.0:0.781:0.219	.	382	Q8TC56	FA71B_HUMAN	I	382	ENSP00000305596:T382I	ENSP00000305596:T382I	T	-	2	0	FAM71B	156522709	0.045000	0.20229	0.011000	0.14972	0.002000	0.02628	2.344000	0.44010	1.174000	0.42811	0.561000	0.74099	ACC	.		0.572	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
JARID2	3720	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	15512476	15512476	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:15512476T>C	ENST00000341776.2	+	14	3234	c.2990T>C	c.(2989-2991)gTg>gCg	p.V997A	JARID2_ENST00000397311.3_Missense_Mutation_p.V825A	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	997	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GGGATCAAGGTGCACAGGACC	0.612																																					p.V997A													.	JARID2-228	0			c.T2990C						.						156.0	118.0	131.0					6																	15512476		2203	4300	6503	SO:0001583	missense	3720	exon14			TCAAGGTGCACAG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2990T>C	6.37:g.15512476T>C	ENSP00000341280:p.Val997Ala	Somatic	152	2		WXS	Illumina HiSeq	Phase_I	124	39	NM_004973	0	0	3	6	3	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.763511	0.89932	.	.	ENSG00000008083	ENST00000341776;ENST00000397311	T;T	0.75260	-0.92;-0.92	4.88	4.88	0.63580	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.82926	0.5143	M	0.76838	2.35	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.86039	0.1518	10	0.87932	D	0	-13.9821	14.7676	0.69651	0.0:0.0:0.0:1.0	.	997	Q92833	JARD2_HUMAN	A	997;825	ENSP00000341280:V997A;ENSP00000380478:V825A	ENSP00000341280:V997A	V	+	2	0	JARID2	15620455	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.983000	0.88140	1.945000	0.56424	0.413000	0.27773	GTG	.		0.612	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
EHMT2	10919	hgsc.bcm.edu;bcgsc.ca	37	6	31852467	31852467	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:31852467G>A	ENST00000375537.4	-	20	2564	c.2558C>T	c.(2557-2559)aCc>aTc	p.T853I	EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375530.4_Missense_Mutation_p.T819I|EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000395728.3_Missense_Mutation_p.T910I|EHMT2_ENST00000375528.4_Missense_Mutation_p.T876I	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	853					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						GTGCAGGGGGGTGTCCCCATG	0.647																																					p.T853I		.											.	EHMT2-91	0			c.C2558T						.						39.0	33.0	36.0					6																	31852467		1511	2709	4220	SO:0001583	missense	10919	exon20			AGGGGGGTGTCCC	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2558C>T	6.37:g.31852467G>A	ENSP00000364687:p.Thr853Ile	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	68	28	NM_006709	0	0	13	13	0	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175053	0.78564	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.14	5.14	0.70334	Ankyrin repeat-containing domain (3);	0.055749	0.64402	D	0.000001	D	0.94245	0.8152	H	0.97829	4.085	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.81914	0.99;0.983;0.995;0.995	D	0.96314	0.9231	10	0.87932	D	0	.	17.3716	0.87380	0.0:0.0:1.0:0.0	.	876;819;853;674	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	I	910;876;819;853;674	ENSP00000379078:T910I;ENSP00000364678:T876I;ENSP00000364680:T819I;ENSP00000364687:T853I	ENSP00000364678:T876I	T	-	2	0	EHMT2	31960446	1.000000	0.71417	0.978000	0.43139	0.313000	0.28021	9.634000	0.98435	2.396000	0.81511	0.555000	0.69702	ACC	.		0.647	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
TNXB	7148	broad.mit.edu	37	6	32029470	32029470	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:32029470G>T	ENST00000375244.3	-	21	7397	c.7196C>A	c.(7195-7197)aCa>aAa	p.T2399K	TNXB_ENST00000375247.2_Missense_Mutation_p.T2399K			P22105	TENX_HUMAN	tenascin XB	2459	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCTGGGTTCTGTGGGGCTGGG	0.637																																					p.T2399K													.	TNXB-90	0			c.C7196A						.						46.0	56.0	53.0					6																	32029470		1184	2505	3689	SO:0001583	missense	7148	exon21			GGTTCTGTGGGGC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.7196C>A	6.37:g.32029470G>T	ENSP00000364393:p.Thr2399Lys	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	22	3	NM_019105	0	0	2	2	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	6.173	0.400107	0.11696	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.61392	0.24;0.11	3.69	2.81	0.32909	.	0.983616	0.08303	N	0.966524	T	0.35770	0.0943	M	0.84219	2.685	0.21553	N	0.999642	B	0.28419	0.211	B	0.30782	0.12	T	0.46652	-0.9176	10	0.10111	T	0.7	.	7.1853	0.25797	0.1256:0.0:0.8744:0.0	.	2399	P22105-3	.	K	2399	ENSP00000364393:T2399K;ENSP00000364396:T2399K	ENSP00000364393:T2399K	T	-	2	0	TNXB	32137448	0.001000	0.12720	0.643000	0.29450	0.077000	0.17291	0.359000	0.20233	0.877000	0.35895	0.585000	0.79938	ACA	.		0.637	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
C6orf222	389384	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	36294405	36294405	+	Silent	SNP	G	G	C	rs140796295		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:36294405G>C	ENST00000437635.2	-	5	1095	c.918C>G	c.(916-918)tcC>tcG	p.S306S		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	306										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						TGGCCTCCTCGGAGCCGTGTT	0.567																																					p.S306S													.	C6orf222-93	0			c.C918G						.						145.0	156.0	152.0					6																	36294405		2203	4300	6503	SO:0001819	synonymous_variant	389384	exon5			CTCCTCGGAGCCG		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.918C>G	6.37:g.36294405G>C		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	65	23	NM_001010903	0	0	0	0	0	B2RTY8	Silent	SNP	ENST00000437635.2	37	CCDS34439.1																																																																																			G|1.000;A|0.000		0.567	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
PTCRA	171558	broad.mit.edu	37	6	42893185	42893185	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:42893185G>A	ENST00000304672.1	+	4	692	c.611G>A	c.(610-612)gGa>gAa	p.G204E	PTCRA_ENST00000441198.1_Missense_Mutation_p.G179E|PTCRA_ENST00000446507.1_Missense_Mutation_p.G97E	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha	204					negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GAGACTGGGGGACGAGAGGCC	0.746																																					p.G219E													.	PTCRA-92	0			c.G656A						.						9.0	10.0	9.0					6																	42893185		2117	4116	6233	SO:0001583	missense	171558	exon4			CTGGGGGACGAGA	AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.611G>A	6.37:g.42893185G>A	ENSP00000304447:p.Gly204Glu	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_001243168	0	0	0	0	0	Q5TFZ7	Missense_Mutation	SNP	ENST00000304672.1	37	CCDS4874.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447346	0.25987	.	.	ENSG00000171611	ENST00000304672;ENST00000441198;ENST00000446507	T;T;T	0.58506	1.07;1.03;0.33	3.85	-0.363	0.12556	.	4.595490	0.00447	N	0.000093	T	0.18593	0.0446	N	0.24115	0.695	0.09310	N	1	P;B;B	0.37101	0.582;0.192;0.077	B;B;B	0.28709	0.093;0.029;0.017	T	0.14952	-1.0454	10	0.66056	D	0.02	.	4.8129	0.13353	0.211:0.3295:0.4595:0.0	.	97;179;204	Q6ISU1-2;Q6ISU1-3;Q6ISU1	.;.;PTCRA_HUMAN	E	204;179;97	ENSP00000304447:G204E;ENSP00000409550:G179E;ENSP00000392288:G97E	ENSP00000304447:G204E	G	+	2	0	PTCRA	43001163	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.075000	0.14686	-0.234000	0.09782	-0.140000	0.14226	GGA	.		0.746	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040565.2	NM_138296	
CUL9	23113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43184050	43184050	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:43184050T>C	ENST00000252050.4	+	31	6175	c.6091T>C	c.(6091-6093)Tcc>Ccc	p.S2031P	CUL9_ENST00000372647.2_Missense_Mutation_p.S2003P|CUL9_ENST00000354495.3_Missense_Mutation_p.S1921P|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2031					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TTTGGCTCATTCCCACTGGGG	0.602																																					p.S2031P		.											.	CUL9-529	0			c.T6091C						.						51.0	43.0	46.0					6																	43184050		2203	4300	6503	SO:0001583	missense	23113	exon31			GCTCATTCCCACT	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.6091T>C	6.37:g.43184050T>C	ENSP00000252050:p.Ser2031Pro	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	58	18	NM_015089	0	0	5	16	11	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	T	18.17	3.563689	0.65651	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.04156	3.69;3.69;3.69	5.82	3.11	0.35812	.	0.282909	0.37809	N	0.001923	T	0.01835	0.0058	L	0.36672	1.1	0.28092	N	0.93174	P;P;P	0.38642	0.467;0.641;0.641	B;B;B	0.38562	0.26;0.276;0.276	T	0.41161	-0.9524	10	0.54805	T	0.06	-12.2048	9.9765	0.41786	0.1212:0.0:0.1122:0.7665	.	1921;2003;2031	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	P	2031;1921;2003	ENSP00000252050:S2031P;ENSP00000346490:S1921P;ENSP00000361730:S2003P	ENSP00000252050:S2031P	S	+	1	0	CUL9	43292028	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.643000	0.46604	1.001000	0.39076	0.533000	0.62120	TCC	.		0.602	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
COL10A1	1300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	116441541	116441541	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:116441541G>T	ENST00000327673.4	-	2	2145	c.1738C>A	c.(1738-1740)Cag>Aag	p.Q580K	AL121963.1_ENST00000430695.1_5'Flank|COL10A1_ENST00000243222.4_Missense_Mutation_p.Q580K|NT5DC1_ENST00000319550.4_Intron			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	580	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TCATAATGCTGTTGCCTGTTA	0.398																																					p.Q580K		.											.	COL10A1-90	0			c.C1738A						.						96.0	98.0	97.0					6																	116441541		2203	4300	6503	SO:0001583	missense	1300	exon3			AATGCTGTTGCCT		CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.1738C>A	6.37:g.116441541G>T	ENSP00000327368:p.Gln580Lys	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	78	21	NM_000493	0	0	0	0	0	A1L4P2	Missense_Mutation	SNP	ENST00000327673.4	37	CCDS5105.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829889	0.32329	.	.	ENSG00000123500	ENST00000243222;ENST00000327673	D;D	0.85556	-2.0;-2.0	4.74	2.88	0.33553	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.188788	0.47455	D	0.000223	T	0.56366	0.1980	L	0.41415	1.275	0.40364	D	0.97927	B	0.06786	0.001	B	0.08055	0.003	T	0.53767	-0.8392	10	0.02654	T	1	.	9.3923	0.38381	0.0:0.1413:0.5663:0.2925	.	580	Q03692	COAA1_HUMAN	K	580	ENSP00000243222:Q580K;ENSP00000327368:Q580K	ENSP00000243222:Q580K	Q	-	1	0	COL10A1	116548234	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	2.258000	0.43249	0.487000	0.27698	0.455000	0.32223	CAG	.		0.398	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041926.1		
SCAF8	22828	bcgsc.ca	37	6	155143508	155143508	+	Missense_Mutation	SNP	G	G	T	rs372358045	byFrequency	TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:155143508G>T	ENST00000367178.3	+	16	2467	c.1891G>T	c.(1891-1893)Gca>Tca	p.A631S	SCAF8_ENST00000417268.1_Missense_Mutation_p.A631S|SCAF8_ENST00000367186.4_Missense_Mutation_p.A697S|RNU6-824P_ENST00000363724.1_RNA	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	631					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						CACAACCCAGGCAGAGGTTTT	0.428																																					p.A631S													.	SCAF8-91	0			c.G1891T						.						165.0	162.0	163.0					6																	155143508		2203	4300	6503	SO:0001583	missense	22828	exon16			ACCCAGGCAGAGG	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1891G>T	6.37:g.155143508G>T	ENSP00000356146:p.Ala631Ser	Somatic	83	0		WXS	Illumina HiSeq	Phase_1	78	4	NM_014892	0	0	1	1	0	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	37	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140142	0.37825	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.46451	0.89;0.89;0.87	5.68	2.91	0.33838	.	0.487974	0.19428	N	0.114517	T	0.07234	0.0183	N	0.21448	0.665	0.33934	D	0.642455	B;B;B;B	0.30824	0.141;0.296;0.141;0.172	B;B;B;B	0.19946	0.019;0.027;0.019;0.015	T	0.16364	-1.0405	10	0.18276	T	0.48	.	0.8618	0.01194	0.2464:0.1737:0.4012:0.1787	.	676;697;709;631	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	S	631;631;697	ENSP00000356146:A631S;ENSP00000413098:A631S;ENSP00000356154:A697S	ENSP00000356146:A631S	A	+	1	0	SCAF8	155185200	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.714000	0.25808	0.742000	0.32697	0.650000	0.86243	GCA	.		0.428	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
SBDS	51119	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	66456178	66456178	+	Silent	SNP	G	G	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr7:66456178G>C	ENST00000246868.2	-	4	753	c.570C>G	c.(568-570)ctC>ctG	p.L190L		NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	190					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						TCAGTGGCTTGAGCTTTTCTT	0.368			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																												p.L190L		.	yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Shwachman-Bodian-Diamond syndrome protein		L	.	SBDS-523	0			c.C570G						.						142.0	119.0	127.0					7																	66456178		2203	4300	6503	SO:0001819	synonymous_variant	51119	exon4	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	TGGCTTGAGCTTT	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.570C>G	7.37:g.66456178G>C		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	95	20	NM_016038	0	0	83	109	26	A8K0P4|Q96FX0|Q9NV53	Silent	SNP	ENST00000246868.2	37	CCDS5537.1																																																																																			.		0.368	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251746.2	NM_016038	
CLDN12	9069	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	90042282	90042282	+	Missense_Mutation	SNP	A	A	T	rs76988207	byFrequency	TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr7:90042282A>T	ENST00000287916.4	+	3	579	c.292A>T	c.(292-294)Atg>Ttg	p.M98L	CLDN12_ENST00000535571.1_Missense_Mutation_p.M98L|CLDN12_ENST00000394605.2_Missense_Mutation_p.M98L|CTB-13L3.1_ENST00000480135.1_RNA	NM_001185073.2|NM_012129.4	NP_001172002.1|NP_036261.1	P56749	CLD12_HUMAN	claudin 12	98					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)	15						GCTGATCGCCATGGGTGCCCT	0.557																																					p.M98L													.	CLDN12-90	0			c.A292T						.						185.0	160.0	168.0					7																	90042282		2203	4300	6503	SO:0001583	missense	9069	exon3			ATCGCCATGGGTG	AJ250713	CCDS5618.1	7q21	2008-07-18			ENSG00000157224	ENSG00000157224		"""Claudins"""	2034	protein-coding gene	gene with protein product		611232					Standard	NM_001185072		Approved		uc003ukr.3	P56749	OTTHUMG00000156612	ENST00000287916.4:c.292A>T	7.37:g.90042282A>T	ENSP00000287916:p.Met98Leu	Somatic	196	1		WXS	Illumina HiSeq	Phase_I	267	55	NM_012129	0	0	6	6	0	D6W5Q4|Q7LDZ0	Missense_Mutation	SNP	ENST00000287916.4	37	CCDS5618.1	.	.	.	.	.	.	.	.	.	.	A	10.39	1.335687	0.24253	.	.	ENSG00000157224	ENST00000422604;ENST00000416322;ENST00000496677;ENST00000287916;ENST00000535571;ENST00000394604;ENST00000394605;ENST00000427904	T;T;T;T;T;T;T	0.75260	-0.39;-0.63;-0.63;-0.63;-0.42;-0.63;-0.92	4.6	2.29	0.28610	.	0.396822	0.31963	N	0.006783	T	0.44414	0.1292	N	0.08118	0	0.25692	N	0.985671	B	0.02656	0.0	B	0.01281	0.0	T	0.24941	-1.0146	10	0.07030	T	0.85	-14.4012	4.7572	0.13090	0.5684:0.0:0.4316:0.0	.	98	P56749	CLD12_HUMAN	L	98	ENSP00000411399:M98L;ENSP00000419053:M98L;ENSP00000287916:M98L;ENSP00000443476:M98L;ENSP00000378102:M98L;ENSP00000378103:M98L;ENSP00000391062:M98L	ENSP00000287916:M98L	M	+	1	0	CLDN12	89880218	0.030000	0.19436	0.993000	0.49108	0.893000	0.52053	0.297000	0.19101	0.912000	0.36772	0.402000	0.26972	ATG	A|0.998;G|0.002		0.557	CLDN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059221.1	NM_012129	
ZSCAN25	221785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99219063	99219063	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr7:99219063T>A	ENST00000394152.2	+	5	782	c.455T>A	c.(454-456)aTc>aAc	p.I152N	ZSCAN25_ENST00000334715.3_Missense_Mutation_p.I152N|ZSCAN25_ENST00000262941.6_Missense_Mutation_p.I152N|ZSCAN25_ENST00000466948.1_Intron	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	152					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAGCCAGGCATCCAGCTGGGG	0.592																																					p.I152N		.											.	.	0			c.T455A						.						73.0	71.0	72.0					7																	99219063		2203	4300	6503	SO:0001583	missense	221785	exon5			CAGGCATCCAGCT	AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.455T>A	7.37:g.99219063T>A	ENSP00000377708:p.Ile152Asn	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	169	66	NM_145115	0	0	9	11	2	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Missense_Mutation	SNP	ENST00000394152.2	37	CCDS5671.2	.	.	.	.	.	.	.	.	.	.	T	13.88	2.370520	0.42003	.	.	ENSG00000197037	ENST00000394152;ENST00000334715;ENST00000262941	T;T;T	0.08896	3.1;3.1;3.04	5.08	5.08	0.68730	.	0.491076	0.17227	N	0.182081	T	0.06962	0.0177	N	0.24115	0.695	0.32243	N	0.572403	P;P	0.37276	0.589;0.454	B;B	0.37888	0.26;0.133	T	0.18053	-1.0349	10	0.26408	T	0.33	-10.0218	11.8202	0.52235	0.0:0.0:0.0:1.0	.	152;152	Q6NSZ9-2;Q6NSZ9	.;ZN498_HUMAN	N	152	ENSP00000377708:I152N;ENSP00000334800:I152N;ENSP00000262941:I152N	ENSP00000262941:I152N	I	+	2	0	ZNF498	99056999	0.009000	0.17119	0.884000	0.34674	0.768000	0.43524	1.283000	0.33237	2.210000	0.71456	0.533000	0.62120	ATC	.		0.592	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
AASS	10157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	121769482	121769482	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr7:121769482G>A	ENST00000393376.1	-	2	415	c.320C>T	c.(319-321)gCa>gTa	p.A107V	AASS_ENST00000417368.2_Missense_Mutation_p.A107V|AASS_ENST00000473553.1_Intron			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	107	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						GGAGAAAAATGCATAAGTCTT	0.348																																					p.A107V		.											.	AASS-92	0			c.C320T						.						59.0	61.0	60.0					7																	121769482		2202	4300	6502	SO:0001583	missense	10157	exon3			AAAAATGCATAAG	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.320C>T	7.37:g.121769482G>A	ENSP00000377040:p.Ala107Val	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	50	18	NM_005763	0	0	0	0	0	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	.	13.69	2.312716	0.40895	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	T;T	0.74737	-0.87;-0.87	5.39	5.39	0.77823	Alanine dehydrogenase/PNT, N-terminal (1);	0.096191	0.64402	D	0.000001	T	0.63674	0.2531	N	0.20483	0.58	0.80722	D	1	B	0.32526	0.374	B	0.38225	0.268	T	0.59434	-0.7455	10	0.06365	T	0.9	-20.188	19.4914	0.95050	0.0:0.0:1.0:0.0	.	107	Q9UDR5	AASS_HUMAN	V	107	ENSP00000377040:A107V;ENSP00000403768:A107V	ENSP00000351834:A107V	A	-	2	0	AASS	121556718	1.000000	0.71417	0.929000	0.37066	0.990000	0.78478	9.799000	0.99117	2.681000	0.91329	0.655000	0.94253	GCA	.		0.348	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
VIPR2	7434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	158828654	158828654	+	Silent	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr7:158828654T>C	ENST00000262178.2	-	8	983	c.798A>G	c.(796-798)ttA>ttG	p.L266L	VIPR2_ENST00000377633.3_Silent_p.L250L|VIPR2_ENST00000402066.1_Silent_p.L407L	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	266					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CGGTGTCTTCTAAGTAGAGCC	0.597																																					p.L266L	Pancreas(154;1876 1931 2329 17914 20079)	.											.	VIPR2-91	0			c.A798G						.						81.0	60.0	67.0					7																	158828654		2203	4300	6503	SO:0001819	synonymous_variant	7434	exon8			GTCTTCTAAGTAG	CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.798A>G	7.37:g.158828654T>C		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	144	68	NM_003382	0	0	0	0	0	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Silent	SNP	ENST00000262178.2	37	CCDS5950.1																																																																																			.		0.597	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382	
MSR1	4481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	16021617	16021617	+	Silent	SNP	A	A	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr8:16021617A>G	ENST00000262101.5	-	5	895	c.774T>C	c.(772-774)gaT>gaC	p.D258D	MSR1_ENST00000536385.1_Silent_p.D32D|MSR1_ENST00000355282.2_Silent_p.D258D|MSR1_ENST00000445506.2_Silent_p.D276D|MSR1_ENST00000381998.4_Silent_p.D258D|MSR1_ENST00000350896.3_Silent_p.D258D			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	258					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		AATGTTCCCAATCTTTCAGTC	0.303																																					p.D258D		.											.	MSR1-91	0			c.T774C						.						168.0	150.0	156.0					8																	16021617		2203	4299	6502	SO:0001819	synonymous_variant	4481	exon5			TTCCCAATCTTTC	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.774T>C	8.37:g.16021617A>G		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	55	13	NM_138715	0	0	0	0	0	D3DSP3|O60505|P21759|Q45F10	Silent	SNP	ENST00000262101.5	37	CCDS5995.1																																																																																			.		0.303	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
EYA1	2138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	72182014	72182014	+	Silent	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr8:72182014G>A	ENST00000340726.3	-	11	1650	c.1011C>T	c.(1009-1011)caC>caT	p.H337H	EYA1_ENST00000388742.4_Silent_p.H337H|EYA1_ENST00000303824.7_Silent_p.H331H|EYA1_ENST00000419131.1_Silent_p.H332H|EYA1_ENST00000388740.3_Silent_p.H304H|EYA1_ENST00000388741.2_Silent_p.H303H|EYA1_ENST00000388743.2_Silent_p.H336H	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	337					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TAAGCAAGGAGTGGAAAACAA	0.403																																					p.H337H		.											.	EYA1-652	0			c.C1011T						.						172.0	156.0	161.0					8																	72182014		2203	4300	6503	SO:0001819	synonymous_variant	2138	exon11			CAAGGAGTGGAAA	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1011C>T	8.37:g.72182014G>A		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	110	33	NM_000503	0	0	0	0	0	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Silent	SNP	ENST00000340726.3	37	CCDS34906.1																																																																																			.		0.403	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
FER1L6	654463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	124989660	124989660	+	Nonsense_Mutation	SNP	C	C	T	rs535471573		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr8:124989660C>T	ENST00000522917.1	+	10	1080	c.874C>T	c.(874-876)Cga>Tga	p.R292*	FER1L6_ENST00000399018.1_Nonsense_Mutation_p.R292*	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	292	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TTTTTAGGGGCGAACCACAGT	0.478													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21723	0.0		0.0	False		,,,				2504	0.0				p.R292X		.											.	FER1L6-100	0			c.C874T						.						128.0	126.0	127.0					8																	124989660		2043	4204	6247	SO:0001587	stop_gained	654463	exon10			TAGGGGCGAACCA	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.874C>T	8.37:g.124989660C>T	ENSP00000428280:p.Arg292*	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	124	46	NM_001039112	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	38	7.224901	0.98146	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	5.53	1.04	0.20106	.	0.091536	0.44688	U	0.000426	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	16.3285	0.82997	0.4563:0.5437:0.0:0.0	.	.	.	.	X	292	.	ENSP00000381982:R292X	R	+	1	2	FER1L6	125058841	0.002000	0.14202	0.996000	0.52242	0.952000	0.60782	0.481000	0.22260	0.264000	0.21851	-0.268000	0.10319	CGA	.		0.478	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
GLDC	2731	broad.mit.edu	37	9	6536187	6536187	+	Silent	SNP	C	C	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:6536187C>A	ENST00000321612.6	-	23	2865	c.2715G>T	c.(2713-2715)gtG>gtT	p.V905V		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	905					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	CAGTGGGCTCCACCATGAGGG	0.577																																					p.V905V													.	GLDC-92	0			c.G2715T						.						40.0	33.0	36.0					9																	6536187		2203	4300	6503	SO:0001819	synonymous_variant	2731	exon23			GGGCTCCACCATG	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2715G>T	9.37:g.6536187C>A		Somatic	114	1		WXS	Illumina HiSeq	Phase_I	135	5	NM_000170	0	0	230	230	0	Q2M2F8	Silent	SNP	ENST00000321612.6	37	CCDS34987.1																																																																																			.		0.577	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
PRUNE2	158471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	79325026	79325026	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:79325026G>A	ENST00000376718.3	-	8	2287	c.2164C>T	c.(2164-2166)Cag>Tag	p.Q722*	PRUNE2_ENST00000428286.1_Nonsense_Mutation_p.Q363*	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	722					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGTTCAGGCTGACCAAATTCA	0.458																																					p.Q722X		.											.	PRUNE2-157	0			c.C2164T						.						54.0	49.0	51.0					9																	79325026		1568	3582	5150	SO:0001587	stop_gained	158471	exon8			CAGGCTGACCAAA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2164C>T	9.37:g.79325026G>A	ENSP00000365908:p.Gln722*	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	69	36	NM_015225	0	0	0	0	0	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Nonsense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.95|13.95	2.388631|2.388631	0.42308|0.42308	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	.|.	.|.	.|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.000000|.	0.50627|.	D|.	0.000114|.	.|T	.|0.72128	.|0.3422	.|.	.|.	.|.	0.46149|0.46149	D|D	0.998894|0.998894	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69217	.|-0.5203	.|4	0.38643|.	T|.	0.18|.	-6.3717|-6.3717	15.6992|15.6992	0.77528|0.77528	0.0:0.1355:0.8645:0.0|0.0:0.1355:0.8645:0.0	.|.	.|.	.|.	.|.	X|L	722;363;721|43	.|.	ENSP00000365908:Q722X|.	Q|S	-|-	1|2	0|0	PRUNE2|PRUNE2	78514846|78514846	0.736000|0.736000	0.28164|0.28164	0.024000|0.024000	0.17045|0.17045	0.138000|0.138000	0.21146|0.21146	2.887000|2.887000	0.48586|0.48586	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	CAG|TCA	.		0.458	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
WNK2	65268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	96079890	96079890	+	Missense_Mutation	SNP	C	C	T	rs377748076		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:96079890C>T	ENST00000297954.4	+	29	6716	c.6716C>T	c.(6715-6717)cCg>cTg	p.P2239L	WNK2_ENST00000349097.3_Missense_Mutation_p.P1851L|WNK2_ENST00000471076.1_3'UTR|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000427277.2_Missense_Mutation_p.P1814L|WNK2_ENST00000395477.2_Missense_Mutation_p.P2202L|WNK2_ENST00000356055.3_3'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2239					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						GGAGCCGCCCCGACCCTGTCC	0.667																																					p.P2202L		.											.	WNK2-765	0			c.C6605T						.	A	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	52.0	44.0	47.0		6605	2.6	0.0	9		47	0,8596		0,0,4298	no	missense	WNK2	NM_006648.3	98	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign	2202/2218	96079890	1,13001	2203	4298	6501	SO:0001583	missense	65268	exon28			CCGCCCCGACCCT	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6716C>T	9.37:g.96079890C>T	ENSP00000297954:p.Pro2239Leu	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	18	5	NM_006648	0	0	4	15	11	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	6.441|6.441	0.449533|0.449533	0.12223|0.12223	2.27E-4|2.27E-4	0.0|0.0	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277|ENST00000432730;ENST00000448251	T;T;T;T|.	0.74842|.	-0.77;-0.88;-0.2;-0.01|.	5.73|5.73	2.64|2.64	0.31445|0.31445	.|.	0.398049|.	0.21391|.	N|.	0.075314|.	T|.	0.37073|.	0.0990|.	L|L	0.48642|0.48642	1.525|1.525	0.21967|0.21967	N|N	0.999449|0.999449	P;B;B;B|.	0.38195|.	0.622;0.066;0.108;0.255|.	B;B;B;B|.	0.32393|.	0.145;0.008;0.012;0.024|.	T|.	0.24977|.	-1.0145|.	10|.	0.87932|.	D|.	0|.	.|.	5.2308|5.2308	0.15420|0.15420	0.1562:0.6551:0.0:0.1887|0.1562:0.6551:0.0:0.1887	.|.	2202;1693;2202;2239|.	Q9Y3S1-2;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;WNK2_HUMAN|.	L|X	2239;2202;1851;1814|2198;999	ENSP00000297954:P2239L;ENSP00000378860:P2202L;ENSP00000297876:P1851L;ENSP00000411181:P1814L|.	ENSP00000297954:P2239L|.	P|R	+|+	2|1	0|2	WNK2|WNK2	95119711|95119711	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.006000|0.006000	0.05464|0.05464	0.676000|0.676000	0.25247|0.25247	0.229000|0.229000	0.21039|0.21039	-0.127000|-0.127000	0.14921|0.14921	CCG|CGA	.		0.667	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
TDRD7	23424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	100227199	100227199	+	Silent	SNP	T	T	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:100227199T>G	ENST00000355295.4	+	8	1813	c.1518T>G	c.(1516-1518)ccT>ccG	p.P506P	TDRD7_ENST00000422139.2_Silent_p.P432P	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	506					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				GTAAGAATCCTAAGATCACAC	0.458																																					p.P506P		.											.	TDRD7-93	0			c.T1518G						.						115.0	106.0	109.0					9																	100227199		2203	4300	6503	SO:0001819	synonymous_variant	23424	exon8			GAATCCTAAGATC	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.1518T>G	9.37:g.100227199T>G		Somatic	134	0		WXS	Illumina HiSeq	Phase_I	126	27	NM_014290	0	0	7	8	1	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Silent	SNP	ENST00000355295.4	37	CCDS6725.1																																																																																			.		0.458	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290	
ZBTB6	10773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125673886	125673886	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:125673886T>C	ENST00000373659.3	-	2	554	c.466A>G	c.(466-468)Aat>Gat	p.N156D		NM_006626.5	NP_006617.1	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	11						TTATCAGAATTTTCATCTTCA	0.338																																					p.N156D		.											.	ZBTB6-90	0			c.A466G						.						57.0	57.0	57.0					9																	125673886		2203	4300	6503	SO:0001583	missense	10773	exon2			CAGAATTTTCATC	X82018	CCDS6846.1	9q33.1-q33.3	2013-01-08	2006-04-10	2006-04-10	ENSG00000186130	ENSG00000186130		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16764	protein-coding gene	gene with protein product		605976	"""zinc finger protein 482"""	ZNF482		7958847	Standard	NM_006626		Approved	ZID	uc004bnh.4	Q15916	OTTHUMG00000020628	ENST00000373659.3:c.466A>G	9.37:g.125673886T>C	ENSP00000362763:p.Asn156Asp	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	24	6	NM_006626	0	0	0	0	0	A8K8N6	Missense_Mutation	SNP	ENST00000373659.3	37	CCDS6846.1	.	.	.	.	.	.	.	.	.	.	T	1.533	-0.543782	0.04053	.	.	ENSG00000186130	ENST00000373659	T	0.09073	3.02	5.96	3.54	0.40534	.	1.010830	0.07908	N	0.973873	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.47129	-0.9141	10	0.10902	T	0.67	.	6.968	0.24632	0.0:0.0766:0.2858:0.6376	.	156	Q15916	ZBTB6_HUMAN	D	156	ENSP00000362763:N156D	ENSP00000362763:N156D	N	-	1	0	ZBTB6	124713707	0.001000	0.12720	0.992000	0.48379	0.995000	0.86356	0.967000	0.29344	0.460000	0.27045	0.533000	0.62120	AAT	.		0.338	ZBTB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053962.1	NM_006626	
NDOR1	27158	broad.mit.edu	37	9	140110791	140110791	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:140110791C>G	ENST00000344894.5	+	14	1800	c.1717C>G	c.(1717-1719)Ctc>Gtc	p.L573V	NDOR1_ENST00000427047.2_3'UTR|NDOR1_ENST00000458322.2_Missense_Mutation_p.L566V|NDOR1_ENST00000371521.4_Missense_Mutation_p.L582V	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GGAGGGTGGACTCTGCAGCCC	0.672																																					p.L582V													.	NDOR1-90	0			c.C1744G						.						53.0	57.0	56.0					9																	140110791		2203	4300	6503	SO:0001583	missense	27158	exon14			GGTGGACTCTGCA	BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1717C>G	9.37:g.140110791C>G	ENSP00000343344:p.Leu573Val	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	25	5	NM_001144026	0	0	4	7	3		Missense_Mutation	SNP	ENST00000344894.5	37	CCDS7036.1	.	.	.	.	.	.	.	.	.	.	C	8.893	0.954486	0.18431	.	.	ENSG00000188566	ENST00000458322;ENST00000371521;ENST00000344894	T;T;T	0.78595	-1.19;-1.19;-1.19	4.06	4.06	0.47325	.	0.157147	0.45361	D	0.000369	T	0.74245	0.3691	L	0.58510	1.815	0.80722	D	1	B;B;B	0.27971	0.124;0.196;0.105	B;B;B	0.33799	0.082;0.17;0.055	T	0.70285	-0.4914	10	0.21540	T	0.41	0.2597	13.7542	0.62926	0.0:1.0:0.0:0.0	.	566;582;573	D3YTG6;Q9UHB4-2;Q9UHB4	.;.;NDOR1_HUMAN	V	566;582;573	ENSP00000389905:L566V;ENSP00000360576:L582V;ENSP00000343344:L573V	ENSP00000343344:L573V	L	+	1	0	NDOR1	139230612	0.822000	0.29219	0.970000	0.41538	0.122000	0.20287	1.362000	0.34148	2.109000	0.64355	0.561000	0.74099	CTC	.		0.672	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254704.1	NM_014434	
SLC35A2	7355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	48762075	48762075	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chrX:48762075G>A	ENST00000247138.5	-	4	1114	c.1111C>T	c.(1111-1113)Ccg>Tcg	p.P371S	SLC35A2_ENST00000376515.3_Missense_Mutation_p.T150I|SLC35A2_ENST00000445167.2_Missense_Mutation_p.T174I|SLC35A2_ENST00000413561.2_Missense_Mutation_p.P310S|SLC35A2_ENST00000452555.2_Missense_Mutation_p.P399S|SLC35A2_ENST00000376521.1_Missense_Mutation_p.P371S|SLC35A2_ENST00000376529.3_Missense_Mutation_p.T174I	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	371					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						GACAGCTGCGGTGGTGGTGGC	0.652																																					p.P371S		.											.	SLC35A2-193	0			c.C1111T						.						40.0	34.0	36.0					X																	48762075		2203	4300	6503	SO:0001583	missense	7355	exon4			GCTGCGGTGGTGG	D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.1111C>T	X.37:g.48762075G>A	ENSP00000247138:p.Pro371Ser	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	23	13	NM_001042498	0	0	0	13	13	A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Missense_Mutation	SNP	ENST00000247138.5	37	CCDS14311.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.494|7.494	0.651284|0.651284	0.14516|0.14516	.|.	.|.	ENSG00000102100|ENSG00000102100	ENST00000247138;ENST00000376521;ENST00000413561;ENST00000452555|ENST00000376529;ENST00000445167;ENST00000376515	T;T;T;T|.	0.42131|.	0.98;0.99;0.99;1.0|.	3.67|3.67	0.966|0.966	0.19667|0.19667	.|.	1.403590|.	0.04571|.	N|.	0.393258|.	T|T	0.16342|0.16342	0.0393|0.0393	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;D;B;B|B	0.54601|0.02656	0.003;0.0;0.967;0.002;0.001|0.0	B;B;P;B;B|B	0.62382|0.08055	0.003;0.0;0.901;0.001;0.001|0.003	T|T	0.29941|0.29941	-0.9995|-0.9995	10|8	0.32370|0.13470	T|T	0.25|0.59	-0.5438|-0.5438	3.4371|3.4371	0.07449|0.07449	0.3602:0.1976:0.4422:0.0|0.3602:0.1976:0.4422:0.0	.|.	310;399;384;371;371|174	B4DE11;E7EW45;B4DE15;P78381-2;P78381|P78381-3	.;.;.;.;S35A2_HUMAN|.	S|I	371;371;310;399|174;174;150	ENSP00000247138:P371S;ENSP00000365704:P371S;ENSP00000393233:P310S;ENSP00000416002:P399S|.	ENSP00000247138:P371S|ENSP00000365698:T150I	P|T	-|-	1|2	0|0	SLC35A2|SLC35A2	48647019|48647019	0.169000|0.169000	0.23002|0.23002	0.010000|0.010000	0.14722|0.14722	0.354000|0.354000	0.29330|0.29330	0.674000|0.674000	0.25218|0.25218	0.064000|0.064000	0.16427|0.16427	-0.881000|-0.881000	0.02953|0.02953	CCG|ACC	.		0.652	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060790.1	NM_005660	
LPAR4	2846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	78011381	78011381	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chrX:78011381C>T	ENST00000435339.3	+	2	1401	c.1015C>T	c.(1015-1017)Cct>Tct	p.P339S		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	339					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						GACTGAAACACCTTTGACCAC	0.403																																					p.P339S		.											.	LPAR4-133	0			c.C1015T						.						151.0	134.0	140.0					X																	78011381		2203	4300	6503	SO:0001583	missense	2846	exon2			GAAACACCTTTGA	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.1015C>T	X.37:g.78011381C>T	ENSP00000408205:p.Pro339Ser	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	66	47	NM_005296	0	0	0	0	0	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	C	8.708	0.911460	0.17833	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.70631	-0.5;-0.5	4.26	4.26	0.50523	.	0.407810	0.24314	N	0.039618	T	0.41259	0.1151	N	0.08118	0	0.38155	D	0.938872	B	0.34103	0.437	B	0.30401	0.115	T	0.50890	-0.8774	10	0.02654	T	1	.	8.4939	0.33117	0.0:0.8889:0.0:0.1111	.	339	Q99677	LPAR4_HUMAN	S	339	ENSP00000408205:P339S;ENSP00000362398:P339S	ENSP00000362398:P339S	P	+	1	0	LPAR4	77898037	0.970000	0.33590	1.000000	0.80357	0.927000	0.56198	1.463000	0.35277	1.961000	0.56991	0.422000	0.28245	CCT	.		0.403	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296	
ERRFI1	54206	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	8074134	8074135	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr1:8074134_8074135delAG	ENST00000377482.5	-	4	747_748	c.524_525delCT	c.(523-525)actfs	p.T175fs	ERRFI1_ENST00000469499.1_3'UTR|ERRFI1_ENST00000474874.1_Intron|ERRFI1_ENST00000467067.1_3'UTR	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	175					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		TATCTGAGCTAGTTAGGAATTC	0.48																																					p.175_175del		.											.	ERRFI1-91	0			c.524_525del						.																																			SO:0001589	frameshift_variant	54206	exon4			.	BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.524_525delCT	1.37:g.8074134_8074135delAG	ENSP00000366702:p.Thr175fs	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	99	41	NM_018948	0	0	0	0	0	B2RDX9|Q9NTG9|Q9UD05	Frame_Shift_Del	DEL	ENST00000377482.5	37	CCDS94.1																																																																																			.		0.480	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003617.1	NM_018948	
PARG	8505	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	51028288	51028288	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr10:51028288delA	ENST00000402038.3	-	13	1243	c.1244delT	c.(1243-1245)ttcfs	p.F415fs		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	900	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		CCCAAAGGTGAAATAAACCAC	0.423																																					p.F900fs		.											.	PARG-948	0			c.2699delT						.						139.0	114.0	122.0					10																	51028288		692	1591	2283	SO:0001589	frameshift_variant	8505	exon17			.	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.1244delT	10.37:g.51028288delA	ENSP00000384408:p.Phe415fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	75	21	NM_003631	0	0	0	0	0	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Frame_Shift_Del	DEL	ENST00000402038.3	37																																																																																				.		0.423	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	70446307	70446307	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr10:70446307delG	ENST00000373644.4	+	11	5456	c.5247delG	c.(5245-5247)cagfs	p.Q1749fs		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1749					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GTTTCACTCAGCCTGTTCCCC	0.507																																					p.Q1749fs		.											.	TET1-663	0			c.5247delG						.						104.0	105.0	105.0					10																	70446307		2203	4300	6503	SO:0001589	frameshift_variant	80312	exon11			.	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5247delG	10.37:g.70446307delG	ENSP00000362748:p.Gln1749fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	136	44	NM_030625	0	0	0	0	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Frame_Shift_Del	DEL	ENST00000373644.4	37	CCDS7281.1																																																																																			.		0.507	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
TAS2R14	50840	broad.mit.edu;bcgsc.ca	37	12	11091488	11091488	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr12:11091488delA	ENST00000537503.1	-	1	374	c.319delT	c.(319-321)tatfs	p.Y107fs	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_023922.1	NP_076411.1	Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14	107					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						TTGAGAAAATAAAAAGTACCG	0.368																																					p.Y107fs													.	TAS2R14-90	0			c.319delT						.						47.0	49.0	48.0					12																	11091488		2201	4300	6501	SO:0001589	frameshift_variant	50840	exon1			GAAAATAAAAAGT	AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000537503.1:c.319delT	12.37:g.11091488delA	ENSP00000441949:p.Tyr107fs	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	13	5	NM_023922	0	0	0	0	0	Q645X3	Frame_Shift_Del	DEL	ENST00000537503.1	37	CCDS8637.1																																																																																			.		0.368	TAS2R14-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370194.4	NM_023922	
NAB2	4665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	57486863	57486863	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr12:57486863delC	ENST00000300131.3	+	5	1539	c.1161delC	c.(1159-1161)cacfs	p.H387fs	NAB2_ENST00000342556.6_Frame_Shift_Del_p.H387fs|NAB2_ENST00000357680.4_3'UTR	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	387					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AACAGAGTCACCCTGAAATCC	0.622																																					p.H387fs		.											.	NAB2-92	0			c.1161delC						.						108.0	118.0	115.0					12																	57486863		2203	4300	6503	SO:0001589	frameshift_variant	4665	exon5			.	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.1161delC	12.37:g.57486863delC	ENSP00000300131:p.His387fs	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	54	19	NM_005967	0	0	0	0	0	B2RAK3|O76006|Q14797	Frame_Shift_Del	DEL	ENST00000300131.3	37	CCDS8930.1																																																																																			.		0.622	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
SLC25A15	10166	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	41381598	41381598	+	Splice_Site	DEL	A	A	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr13:41381598delA	ENST00000338625.4	+	5	857	c.621delA	c.(619-621)tta>tt	p.L207fs	SLC25A15_ENST00000478827.1_3'UTR	NM_014252.3	NP_055067.1	Q9Y619	ORNT1_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15	207					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|L-ornithine transmembrane transport (GO:1903352)|mitochondrial ornithine transport (GO:0000066)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	L-ornithine transmembrane transporter activity (GO:0000064)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|stomach(1)|urinary_tract(1)	14		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.48e-08)|Epithelial(112;7.51e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000191)|GBM - Glioblastoma multiforme(144;0.00231)|BRCA - Breast invasive adenocarcinoma(63;0.0704)	L-Ornithine(DB00129)	AAGATGAATTAGGTAAATGTG	0.473																																					p.L207fs		.											.	SLC25A15-226	0			c.621delA						.						129.0	122.0	124.0					13																	41381598		2203	4300	6503	SO:0001630	splice_region_variant	10166	exon5			.	AF112968	CCDS9373.1	13q14	2013-05-22			ENSG00000102743	ENSG00000102743		"""Solute carriers"""	10985	protein-coding gene	gene with protein product	"""ornithine transporter 1"""	603861		ORNT1, HHH		10369256	Standard	NM_014252		Approved	ORC1, D13S327	uc001uxn.3	Q9Y619	OTTHUMG00000016776	ENST00000338625.4:c.622+1A>-	13.37:g.41381598delA		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	63	29	NM_014252	0	0	0	0	0	Q5VZD8|Q9HC45	Frame_Shift_Del	DEL	ENST00000338625.4	37	CCDS9373.1																																																																																			.		0.473	SLC25A15-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276149.2	NM_014252	Frame_Shift_Del
CLEC14A	161198	broad.mit.edu	37	14	38724899	38724899	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:38724899delA	ENST00000342213.2	-	1	675	c.329delT	c.(328-330)ttgfs	p.L110fs		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	110	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GAAACCCCGCAAAGGCTCGTT	0.692																																					p.L110fs													.	CLEC14A-94	0			c.329delT						.						19.0	25.0	23.0					14																	38724899		2191	4281	6472	SO:0001589	frameshift_variant	161198	exon1			CCCCGCAAAGGCT		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.329delT	14.37:g.38724899delA	ENSP00000353013:p.Leu110fs	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_175060	0	0	0	0	0	Q695G9|Q6PWT6|Q8N5V5	Frame_Shift_Del	DEL	ENST00000342213.2	37	CCDS9667.1																																																																																			.		0.692	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
ADAM20	8748	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	70990728	70990729	+	Frame_Shift_Del	DEL	CT	CT	-	rs112672973		TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr14:70990728_70990729delCT	ENST00000256389.3	-	2	1140_1141	c.896_897delAG	c.(895-897)gagfs	p.E299fs	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	249	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TTACATCAACCTCCAAAGGATG	0.347																																					p.299_299del		.											.	ADAM20-226	0			c.896_897del						.																																			SO:0001589	frameshift_variant	8748	exon2			.	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.896_897delAG	14.37:g.70990728_70990729delCT	ENSP00000256389:p.Glu299fs	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	44	13	NM_003814	0	0	0	0	0	Q6GTZ1|Q9UKJ9	Frame_Shift_Del	DEL	ENST00000256389.3	37	CCDS32111.1																																																																																			.		0.347	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2		
TEX9	374618	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	56686956	56686956	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr15:56686956delA	ENST00000352903.2	+	9	776	c.752delA	c.(751-753)gaafs	p.E251fs	TEX9_ENST00000537232.1_Frame_Shift_Del_p.E176fs|RP11-48G14.2_ENST00000564401.1_lincRNA|TEX9_ENST00000561221.2_Frame_Shift_Del_p.E251fs|TEX9_ENST00000558083.2_Frame_Shift_Del_p.E176fs|TEX9_ENST00000560582.1_Frame_Shift_Del_p.E7fs	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	251										cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TCTCAAGTAGAAAAATACAAA	0.303																																					p.E251fs		.											.	TEX9-90	0			c.752delA						.						46.0	50.0	49.0					15																	56686956		2191	4284	6475	SO:0001589	frameshift_variant	374618	exon9			.	BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.752delA	15.37:g.56686956delA	ENSP00000342169:p.Glu251fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	85	29	NM_198524	0	0	0	0	0	B4DH73	Frame_Shift_Del	DEL	ENST00000352903.2	37	CCDS10157.1																																																																																			.		0.303	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255048.2	NM_198524	
IRGQ	126298	broad.mit.edu	37	19	44099300	44099300	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:44099300delG	ENST00000602269.1	-	1	376	c.191delC	c.(190-192)ccafs	p.P65fs	ZNF576_ENST00000525771.1_5'Flank|IRGQ_ENST00000422989.1_Frame_Shift_Del_p.P65fs|ZNF576_ENST00000533118.1_5'Flank|ZNF576_ENST00000529930.1_5'Flank|IRGQ_ENST00000601520.1_5'Flank|SRRM5_ENST00000526798.1_5'Flank|ZNF576_ENST00000528387.1_5'Flank|ZNF576_ENST00000391965.2_5'Flank|ZNF576_ENST00000336564.4_5'Flank|L34079.2_ENST00000594374.1_5'Flank|SRRM5_ENST00000607544.1_5'Flank			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	65										endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CGCTGCGGGTGGGCAGCTCAG	0.721																																					p.P64fs													.	IRGQ-92	0			c.191delC						.						6.0	7.0	7.0					19																	44099300		2116	4172	6288	SO:0001589	frameshift_variant	126298	exon2			GCGGGTGGGCAGC	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.191delC	19.37:g.44099300delG	ENSP00000472250:p.Pro65fs	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	5	2	NM_001007561	0	0	0	0	0	B2RNP3	Frame_Shift_Del	DEL	ENST00000602269.1	37	CCDS33040.1																																																																																			.		0.721	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
FAM117B	150864	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	203560690	203560690	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr2:203560690delG	ENST00000392238.2	+	2	688	c.688delG	c.(688-690)gctfs	p.A230fs	FAM117B_ENST00000303116.6_5'UTR			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	230										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						ACCGTATCTTGCTGGACACTG	0.483																																					p.A230fs		.											.	FAM117B-91	0			c.688delG						.						86.0	75.0	79.0					2																	203560690		2203	4300	6503	SO:0001589	frameshift_variant	150864	exon2			.	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.688delG	2.37:g.203560690delG	ENSP00000376071:p.Ala230fs	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	92	32	NM_173511	0	0	0	0	0	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Frame_Shift_Del	DEL	ENST00000392238.2	37	CCDS33362.2																																																																																			.		0.483	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
CTCFL	140690	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	56098141	56098141	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr20:56098141delT	ENST00000608263.1	-	2	1398	c.737delA	c.(736-738)aatfs	p.N246fs	CTCFL_ENST00000433949.3_Frame_Shift_Del_p.N41fs|CTCFL_ENST00000481655.2_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000429804.3_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000422869.2_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000243914.3_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000423479.3_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000608440.1_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000539382.1_Frame_Shift_Del_p.N41fs|CTCFL_ENST00000432255.2_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000609232.1_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000608158.1_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000608425.1_Frame_Shift_Del_p.N246fs|CTCFL_ENST00000371196.2_Frame_Shift_Del_p.N246fs	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	246					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			CTTTCTTTGATTTTTTGTAGA	0.398																																					p.N246fs		.											.	CTCFL-292	0			c.737delA						.						197.0	176.0	183.0					20																	56098141		2202	4300	6502	SO:0001589	frameshift_variant	140690	exon2			.		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.737delA	20.37:g.56098141delT	ENSP00000476783:p.Asn246fs	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	72	24	NM_001269044	0	0	0	0	0	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Frame_Shift_Del	DEL	ENST00000608263.1	37	CCDS13459.1																																																																																			.		0.398	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
PCDHB10	56126	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140572491	140572494	+	Frame_Shift_Del	DEL	AGTC	AGTC	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	AGTC	AGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:140572491_140572494delAGTC	ENST00000239446.4	+	1	550_553	c.366_369delAGTC	c.(364-369)agagtcfs	p.RV122fs		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	122	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGAGCTGAGAGTCAGGGATATAA	0.422																																					p.122_123del		.											.	PCDHB10-92	0			c.366_369del						.																																			SO:0001589	frameshift_variant	56126	exon1			.	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.366_369delAGTC	5.37:g.140572491_140572494delAGTC	ENSP00000239446:p.Arg122fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	182	54	NM_018930	0	0	0	0	0	Q96T99	Frame_Shift_Del	DEL	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.422	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
EHMT2	10919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31852462	31852462	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr6:31852462delG	ENST00000375537.4	-	20	2569	c.2563delC	c.(2563-2565)ctgfs	p.L855fs	EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375530.4_Frame_Shift_Del_p.L821fs|EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000395728.3_Frame_Shift_Del_p.L912fs|EHMT2_ENST00000375528.4_Frame_Shift_Del_p.L878fs	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	855					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						GCGATGTGCAGGGGGGTGTCC	0.657																																					p.L855fs		.											.	EHMT2-91	0			c.2563delC						.						39.0	34.0	36.0					6																	31852462		1511	2708	4219	SO:0001589	frameshift_variant	10919	exon20			.	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2563delC	6.37:g.31852462delG	ENSP00000364687:p.Leu855fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	66	27	NM_006709	0	0	0	0	0	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Frame_Shift_Del	DEL	ENST00000375537.4	37	CCDS4725.1																																																																																			.		0.657	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
ODF2	4957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	131250301	131250301	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:131250301delG	ENST00000434106.3	+	14	1896	c.1533delG	c.(1531-1533)ctgfs	p.L511fs	ODF2_ENST00000546203.1_Frame_Shift_Del_p.L492fs|ODF2_ENST00000372807.5_Frame_Shift_Del_p.L506fs|ODF2_ENST00000448249.3_Frame_Shift_Del_p.L430fs|ODF2_ENST00000393533.2_Frame_Shift_Del_p.L511fs|ODF2_ENST00000444119.2_Frame_Shift_Del_p.L487fs|ODF2_ENST00000393527.3_Frame_Shift_Del_p.L487fs|ODF2_ENST00000372814.3_Frame_Shift_Del_p.L555fs|ODF2_ENST00000604420.1_Frame_Shift_Del_p.L511fs|ODF2_ENST00000372791.3_Frame_Shift_Del_p.L492fs|ODF2_ENST00000351030.3_Frame_Shift_Del_p.L506fs	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	511					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						ATGAGAGGCTGAAGGTTCGCA	0.587																																					p.L575fs		.											.	ODF2-69	0			c.1725delG						.						72.0	63.0	66.0					9																	131250301		2203	4300	6503	SO:0001589	frameshift_variant	4957	exon14			.	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1533delG	9.37:g.131250301delG	ENSP00000403453:p.Leu511fs	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	46	16	NM_153435	0	0	0	0	0	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Frame_Shift_Del	DEL	ENST00000434106.3	37	CCDS56588.1																																																																																			.		0.587	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
TSHZ1	10194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	72999467	72999468	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:72999467_72999468insA	ENST00000580243.1	+	2	2453_2454	c.2105_2106insA	c.(2104-2109)gccaaafs	p.K703fs	TSHZ1_ENST00000322038.5_Frame_Shift_Ins_p.K658fs			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	703					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ACTGGGAAGGCCAAAAAGGAGG	0.55																																					p.A657fs		.											.	TSHZ1-90	0			c.1970_1971insA						.																																			SO:0001589	frameshift_variant	10194	exon2			.	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	Exception_encountered	18.37:g.72999467_72999468insA	ENSP00000464391:p.Lys703fs	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	103	31	NM_005786	0	0	0	0	0	O60534|Q4LE29|Q53EU4	Frame_Shift_Ins	INS	ENST00000580243.1	37																																																																																				.		0.550	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
TSHZ1	10194	hgsc.bcm.edu	37	18	72999471	72999472	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr18:72999471_72999472insA	ENST00000580243.1	+	2	2457_2458	c.2109_2110insA	c.(2110-2112)aagfs	p.K704fs	TSHZ1_ENST00000322038.5_Frame_Shift_Ins_p.K659fs			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	704					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GGAAGGCCAAAAAGGAGGGACC	0.545																																					p.K658fs		.											.	TSHZ1-90	0			c.1974_1975insA						.																																			SO:0001589	frameshift_variant	10194	exon2			.	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2111dupA	18.37:g.72999473_72999473dupA	ENSP00000464391:p.Lys704fs	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	103	25	NM_005786	0	0	0	0	0	O60534|Q4LE29|Q53EU4	Frame_Shift_Ins	INS	ENST00000580243.1	37																																																																																				.		0.545	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
SMARCB1	6598	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	24175838	24175839	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr22:24175838_24175839insTT	ENST00000263121.7	+	8	1262_1263	c.1066_1067insTT	c.(1066-1068)ctgfs	p.L356fs	SMARCB1_ENST00000344921.6_Frame_Shift_Ins_p.L365fs|SMARCB1_ENST00000407422.3_Frame_Shift_Ins_p.L347fs|SMARCB1_ENST00000407082.3_Frame_Shift_Ins_p.L310fs|DERL3_ENST00000464023.1_5'Flank	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	356					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				GCTGGAGACTCTGACAGACGCT	0.629			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.L356fs		.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	SMARCB1-2699	3	Unknown(2)|Deletion - In frame(1)	central_nervous_system(3)	c.1066_1067insTT						.																																			SO:0001589	frameshift_variant	6598	exon8			.	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	Exception_encountered	22.37:g.24175838_24175839insTT	ENSP00000263121:p.Leu356fs	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	90	24	NM_003073	0	0	0	0	0	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Frame_Shift_Ins	INS	ENST00000263121.7	37	CCDS13817.1																																																																																			.		0.629	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
CLK4	57396	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	178030682	178030683	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr5:178030682_178030683insT	ENST00000316308.4	-	13	1549_1550	c.1381_1382insA	c.(1381-1383)actfs	p.T461fs		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	461	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		AATTCTTTGAGTTGGATCATAT	0.342																																					p.T461fs		.											.	CLK4-359	0			c.1382_1383insA						.																																			SO:0001589	frameshift_variant	57396	exon13			.	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.1382dupA	5.37:g.178030684_178030684dupT	ENSP00000316948:p.Thr461fs	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	61	30	NM_020666	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000316308.4	37	CCDS4437.1																																																																																			.		0.342	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
ZNF567	163081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37210700	37210701	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr19:37210700_37210701TC>AT	ENST00000536254.2	+	6	1296_1297	c.1074_1075TC>AT	c.(1072-1077)acTCac>acATac	p.H359Y	ZNF567_ENST00000360729.4_Missense_Mutation_p.H328Y|ZNF567_ENST00000392163.2_Missense_Mutation_p.H328Y|ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000588311.1_Missense_Mutation_p.H328Y|ZNF567_ENST00000585696.1_Missense_Mutation_p.H328Y			Q8N184	ZN567_HUMAN	zinc finger protein 567	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ATCAGAGAACTCACACGGGAGA	0.455																																					p.H359Y		.											.	ZNF567-90	0			c.C982T						.																																			SO:0001583	missense	163081	exon4			AGAACTCACACGG	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		Exception_encountered	19.37:g.37210700_37210701delinsAT	ENSP00000441838:p.His359Tyr	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	32.0	NM_152603	0	0	0	0	0	B3KX49|Q6N044	Missense_Mutation	DNP	ENST00000536254.2	37																																																																																				.		0.455	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30038228	30038229	+	Missense_Mutation	DNP	CT	CT	AC			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr22:30038228_30038229CT>AC	ENST00000338641.4	+	4	842_843	c.401_402CT>AC	c.(400-402)cCT>cAC	p.P134H	NF2_ENST00000413209.2_Missense_Mutation_p.P134H|NF2_ENST00000353887.4_Missense_Mutation_p.P51H|NF2_ENST00000397789.3_Missense_Mutation_p.P134H|NF2_ENST00000347330.5_Missense_Mutation_p.P51H|NF2_ENST00000403999.3_Missense_Mutation_p.P134H|NF2_ENST00000403435.1_Missense_Mutation_p.P134H|NF2_ENST00000334961.7_Missense_Mutation_p.P51H|NF2_ENST00000361676.4_Missense_Mutation_p.P92H|NF2_ENST00000361452.4_Missense_Mutation_p.P93H|NF2_ENST00000361166.4_Missense_Mutation_p.P134H	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	134	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.V122_K149del(5)|p.?(3)|p.L127_P134del(1)|p.K123fs*2(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						ATCTACTGCCCTCCTGAGGCTT	0.47			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.P134H		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	10	Deletion - In frame(6)|Unknown(3)|Deletion - Frameshift(1)	soft_tissue(8)|large_intestine(1)|stomach(1)	c.T402C						.																																			SO:0001583	missense	4771	exon4	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	CTGCCCTCCTGAG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	Exception_encountered	22.37:g.30038228_30038229delinsAC	ENSP00000344666:p.Pro134His	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	20.0	NM_000268	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation	DNP	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.470	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
CTNNAL1	8727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	111761412	111761413	+	Missense_Mutation	DNP	AT	AT	CC			TCGA-B1-A47M-01A-11D-A25F-10	TCGA-B1-A47M-10A-01D-A25F-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8fb7fcac-6c1d-40c2-9309-b53821cbef30	68d9e30c-356a-4fd1-a9e9-6e535a0a963d	g.chr9:111761412_111761413AT>CC	ENST00000325551.4	-	2	351_352	c.265_266AT>GG	c.(265-267)ATa>GGa	p.I89G	CTNNAL1_ENST00000374593.4_Missense_Mutation_p.I89G|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.I89G|CTNNAL1_ENST00000325580.6_Missense_Mutation_p.I89G	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	89					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		TTCATTGGCTATAGCTTCTCCT	0.356																																					p.I89G		.											.	CTNNAL1-228	0			c.A265G						.																																			SO:0001583	missense	8727	exon2			TGGCTATAGCTTC	AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.265_266delinsCC	9.37:g.111761412_111761413delinsCC	ENSP00000320434:p.Ile89Gly	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	14.0	NM_003798	0	0	0	0	0	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	DNP	ENST00000325551.4	37	CCDS6775.1																																																																																			.		0.356	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
