#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11273603	11273603	+	Silent	SNP	G	G	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:11273603G>C	ENST00000361445.4	-	21	3214	c.3138C>G	c.(3136-3138)acC>acG	p.T1046T		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1046					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCTGAATTGAGGTGTTCATGA	0.458																																					p.T1046T		.											.	MTOR-1439	0			c.C3138G						.						97.0	98.0	98.0					1																	11273603		2203	4300	6503	SO:0001819	synonymous_variant	2475	exon21			AATTGAGGTGTTC	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3138C>G	1.37:g.11273603G>C		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	187	71	NM_004958	0	0	2	4	2	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	CCDS127.1																																																																																			.		0.458	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	19490300	19490300	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:19490300C>G	ENST00000375254.3	-	34	4749	c.4722G>C	c.(4720-4722)aaG>aaC	p.K1574N	UBR4_ENST00000375226.2_Missense_Mutation_p.K1574N|UBR4_ENST00000375217.2_Missense_Mutation_p.K1574N|UBR4_ENST00000375267.2_Missense_Mutation_p.K1574N	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1574					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAACTACATTCTTCTGTGACA	0.403																																					p.K1574N		.											.	UBR4-612	0			c.G4722C						.						191.0	172.0	178.0					1																	19490300		2203	4300	6503	SO:0001583	missense	23352	exon34			TACATTCTTCTGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4722G>C	1.37:g.19490300C>G	ENSP00000364403:p.Lys1574Asn	Somatic	214	0		WXS	Illumina HiSeq	Phase_I	175	70	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698108	0.68386	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.15	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.73273	0.3566	L	0.39898	1.24	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.73040	-0.4108	10	0.49607	T	0.09	.	12.9635	0.58472	0.0:0.9263:0.0:0.0737	.	1574	Q5T4S7	UBR4_HUMAN	N	1574;1574;1574;1574;284;790	ENSP00000364403:K1574N;ENSP00000364416:K1574N;ENSP00000364365:K1574N;ENSP00000364374:K1574N;ENSP00000404897:K284N	ENSP00000364365:K1574N	K	-	3	2	UBR4	19362887	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.411000	0.59781	2.674000	0.91012	0.655000	0.94253	AAG	.		0.403	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
EPHA8	2046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22927186	22927186	+	Silent	SNP	A	A	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:22927186A>T	ENST00000166244.3	+	14	2493	c.2421A>T	c.(2419-2421)ccA>ccT	p.P807P		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	807	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGACGGCCCCAGAGGCCATCG	0.682																																					p.P807P		.											.	EPHA8-1380	0			c.A2421T						.						58.0	61.0	60.0					1																	22927186		2203	4299	6502	SO:0001819	synonymous_variant	2046	exon14			GGCCCCAGAGGCC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2421A>T	1.37:g.22927186A>T		Somatic	249	0		WXS	Illumina HiSeq	Phase_I	225	82	NM_020526	0	0	0	0	0	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	37	CCDS225.1																																																																																			.		0.682	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
MCOLN3	55283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	85487988	85487988	+	Missense_Mutation	SNP	C	C	A	rs375444573		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:85487988C>A	ENST00000370589.2	-	10	1243	c.1191G>T	c.(1189-1191)aaG>aaT	p.K397N	MCOLN3_ENST00000341115.4_Missense_Mutation_p.K341N|MCOLN3_ENST00000474447.1_5'UTR|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	397					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		TTACGTTGTACTTTGCAAAGA	0.433																																					p.K397N		.											.	MCOLN3-91	0			c.G1191T						.						85.0	78.0	81.0					1																	85487988		2203	4300	6503	SO:0001583	missense	55283	exon10			GTTGTACTTTGCA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.1191G>T	1.37:g.85487988C>A	ENSP00000359621:p.Lys397Asn	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	52	19	NM_018298	0	0	0	0	0	Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	37	CCDS701.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319843	0.41096	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370588;ENST00000341115	T;T	0.69926	-0.44;-0.44	5.74	4.78	0.61160	Polycystin cation channel, PKD1/PKD2 (1);	0.088648	0.85682	D	0.000000	T	0.40645	0.1125	L	0.41710	1.295	0.48830	D	0.999718	B;B	0.27625	0.076;0.183	B;B	0.29077	0.043;0.098	T	0.42949	-0.9421	10	0.41790	T	0.15	-17.9811	9.0071	0.36117	0.0:0.7676:0.0:0.2324	.	341;397	Q8TDD5-2;Q8TDD5	.;MCLN3_HUMAN	N	397;397;341;341	ENSP00000359621:K397N;ENSP00000342698:K341N	ENSP00000304843:K397N	K	-	3	2	MCOLN3	85260576	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	1.405000	0.34635	1.307000	0.44944	0.655000	0.94253	AAG	.		0.433	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
GBP1	2633	broad.mit.edu	37	1	89528891	89528891	+	Silent	SNP	G	G	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:89528891G>T	ENST00000370473.4	-	2	246	c.27C>A	c.(25-27)ggC>ggA	p.G9G		NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	9	GTPase domain (Globular).				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.G9G(1)		endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		GGCACATTGGGCCTGTCATGT	0.468																																					p.G9G													.	GBP1-92	1	Substitution - coding silent(1)	endometrium(1)	c.C27A						.						119.0	110.0	113.0					1																	89528891		2203	4300	6503	SO:0001819	synonymous_variant	2633	exon2			CATTGGGCCTGTC	BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.27C>A	1.37:g.89528891G>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	193	9	NM_002053	0	0	34	34	0	D3DT26|Q5T8M1	Silent	SNP	ENST00000370473.4	37	CCDS718.1																																																																																			.		0.468	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3	NM_002053	
PIGR	5284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207105906	207105906	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:207105906C>A	ENST00000356495.4	-	8	2086	c.1903G>T	c.(1903-1905)Gga>Tga	p.G635*	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	635					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CTGGAGCTTCCACCTTGTTCC	0.617																																					p.G635X		.											.	PIGR-92	0			c.G1903T						.						46.0	47.0	47.0					1																	207105906		2203	4300	6503	SO:0001587	stop_gained	5284	exon8			AGCTTCCACCTTG		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1903G>T	1.37:g.207105906C>A	ENSP00000348888:p.Gly635*	Somatic	149	1		WXS	Illumina HiSeq	Phase_I	158	66	NM_002644	0	0	321	342	21	Q68D81|Q8IZY7	Nonsense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695601	0.88830	.	.	ENSG00000162896	ENST00000356495	.	.	.	4.98	0.946	0.19549	.	0.594424	0.16002	N	0.234264	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-7.615	1.477	0.02428	0.1369:0.415:0.1336:0.3145	.	.	.	.	X	635	.	ENSP00000348888:G635X	G	-	1	0	PIGR	205172529	0.000000	0.05858	0.020000	0.16555	0.025000	0.11179	-0.769000	0.04710	0.019000	0.15079	0.561000	0.74099	GGA	.		0.617	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
CD46	4179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207940508	207940508	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:207940508C>A	ENST00000358170.2	+	6	980	c.824C>A	c.(823-825)aCt>aAt	p.T275N	CD46_ENST00000357714.1_Missense_Mutation_p.T275N|CD46_ENST00000441839.2_Missense_Mutation_p.T275N|CD46_ENST00000367041.1_Missense_Mutation_p.T275N|CD46_ENST00000360212.2_Missense_Mutation_p.T275N|CD46_ENST00000322875.4_Missense_Mutation_p.T275N|CD46_ENST00000367042.1_Missense_Mutation_p.T275N|CD46_ENST00000322918.5_Missense_Mutation_p.T275N|CD46_ENST00000361067.1_Missense_Mutation_p.T275N|CD46_ENST00000354848.1_Missense_Mutation_p.T275N|CD46_ENST00000480003.1_Missense_Mutation_p.T275N|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000367047.1_Missense_Mutation_p.T212N	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	275	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						AGTAACAGTACTTGGGATCCC	0.358																																					p.T275N		.											.	CD46-963	0			c.C824A						.						110.0	105.0	107.0					1																	207940508		2203	4300	6503	SO:0001583	missense	4179	exon6			ACAGTACTTGGGA	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.824C>A	1.37:g.207940508C>A	ENSP00000350893:p.Thr275Asn	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	60	23	NM_172352	0	0	127	216	89	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	ENST00000358170.2	37	CCDS1485.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142222	0.57044	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000367047;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	T;T;T;T;T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.05	-4.14	0.03892	Complement control module (2);Sushi/SCR/CCP (3);	1.003600	0.08033	N	0.993895	T	0.68815	0.3042	M	0.69463	2.115	0.09310	N	1	P;B;D;P;B;D;B;D;P;P;P;D;D;D	0.63880	0.582;0.253;0.993;0.582;0.253;0.969;0.395;0.979;0.582;0.836;0.582;0.961;0.961;0.975	B;B;P;B;B;D;B;P;B;B;B;D;D;D	0.75020	0.2;0.141;0.869;0.2;0.141;0.974;0.227;0.831;0.2;0.32;0.2;0.961;0.961;0.985	T	0.60647	-0.7222	10	0.72032	D	0.01	.	1.9531	0.03370	0.4968:0.2102:0.1229:0.1701	.	275;275;275;275;275;275;275;275;275;275;275;275;275;275	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	N	275;275;275;275;275;275;275;212;275;275;275;275	ENSP00000350893:T275N;ENSP00000346912:T275N;ENSP00000314664:T275N;ENSP00000356009:T275N;ENSP00000356008:T275N;ENSP00000350346:T275N;ENSP00000313875:T275N;ENSP00000356014:T212N;ENSP00000413543:T275N;ENSP00000354358:T275N;ENSP00000353342:T275N;ENSP00000418471:T275N	ENSP00000313875:T275N	T	+	2	0	CD46	206007131	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.614000	0.05604	-0.469000	0.06911	0.655000	0.94253	ACT	.		0.358	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088588.3	NM_172361	
RBM34	23029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235318245	235318245	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:235318245T>A	ENST00000408888.3	-	4	778	c.548A>T	c.(547-549)aAt>aTt	p.N183I	RBM34_ENST00000366606.3_Missense_Mutation_p.N178I			P42696	RBM34_HUMAN	RNA binding motif protein 34	183						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			AGTTCTCTCATTCTTTAATCT	0.328																																					p.N183I		.											.	RBM34-46	0			c.A548T						.						159.0	139.0	145.0					1																	235318245		1826	4086	5912	SO:0001583	missense	23029	exon4			CTCTCATTCTTTA		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.548A>T	1.37:g.235318245T>A	ENSP00000386226:p.Asn183Ile	Somatic	288	0		WXS	Illumina HiSeq	Phase_I	266	90	NM_001161533	0	0	7	20	13	A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	T	18.53	3.643590	0.67244	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000447801	T;T;T	0.75154	-0.91;-0.91;0.96	5.87	5.87	0.94306	Nucleotide-binding, alpha-beta plait (1);	0.236119	0.48767	D	0.000162	D	0.85225	0.5648	M	0.76328	2.33	0.80722	D	1	D;B	0.89917	1.0;0.431	D;B	0.81914	0.995;0.186	D	0.85305	0.1075	10	0.45353	T	0.12	-17.2719	14.8054	0.69952	0.0:0.0:0.0:1.0	.	183;183	P42696-2;P42696	.;RBM34_HUMAN	I	183;178;181	ENSP00000386226:N183I;ENSP00000355565:N178I;ENSP00000400000:N181I	ENSP00000355565:N178I	N	-	2	0	RBM34	233384868	0.999000	0.42202	0.998000	0.56505	0.918000	0.54935	4.345000	0.59360	2.371000	0.80710	0.533000	0.62120	AAT	.		0.328	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014	
FMN2	56776	hgsc.bcm.edu	37	1	240371661	240371661	+	Silent	SNP	A	A	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:240371661A>C	ENST00000319653.9	+	5	3779	c.3549A>C	c.(3547-3549)ggA>ggC	p.G1183G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1183	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTGGAGTGGGAATACCTCCTC	0.682																																					p.G1183G		.											.	FMN2-145	0			c.A3549C						.						15.0	16.0	16.0					1																	240371661		2200	4294	6494	SO:0001819	synonymous_variant	56776	exon5			AGTGGGAATACCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3549A>C	1.37:g.240371661A>C		Somatic	44	1		WXS	Illumina HiSeq	Phase_I	32	3	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.682	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ECD	11319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	74896486	74896486	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr10:74896486T>G	ENST00000372979.4	-	13	1886	c.1680A>C	c.(1678-1680)aaA>aaC	p.K560N	ECD_ENST00000454759.2_Missense_Mutation_p.K517N|ECD_ENST00000430082.2_Missense_Mutation_p.K593N	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	560					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					TGGTGAAACTTTTGCTGATGC	0.418																																					p.K593N		.											.	ECD-91	0			c.A1779C						.						221.0	194.0	203.0					10																	74896486		2203	4300	6503	SO:0001583	missense	11319	exon14			GAAACTTTTGCTG	BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.1680A>C	10.37:g.74896486T>G	ENSP00000362070:p.Lys560Asn	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	179	75	NM_001135752	0	0	32	48	16	C9JX46|E9PAW8	Missense_Mutation	SNP	ENST00000372979.4	37	CCDS7321.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.034517	0.75617	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759	T;T;T	0.19669	2.13;2.13;2.13	5.66	3.37	0.38596	.	0.091325	0.85682	D	0.000000	T	0.34048	0.0884	M	0.64997	1.995	0.47037	D	0.999297	D;D;P	0.60575	0.978;0.988;0.51	P;P;P	0.60286	0.872;0.872;0.493	T	0.03597	-1.1021	10	0.40728	T	0.16	-2.9522	7.962	0.30076	0.0:0.1669:0.0:0.8331	.	517;593;560	E9PAW8;C9JX46;O95905	.;.;SGT1_HUMAN	N	560;593;517	ENSP00000362070:K560N;ENSP00000401566:K593N;ENSP00000395786:K517N	ENSP00000362070:K560N	K	-	3	2	ECD	74566492	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.537000	0.36083	0.981000	0.38548	0.533000	0.62120	AAA	.		0.418	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048606.1	NM_007265	
COX15	1355	hgsc.bcm.edu	37	10	101491791	101491791	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr10:101491791A>C	ENST00000016171.5	-	1	66	c.16T>G	c.(16-18)Ttt>Gtt	p.F6V	CUTC_ENST00000493385.1_Intron|CUTC_ENST00000370476.5_5'Flank|COX15_ENST00000370483.5_Missense_Mutation_p.F6V			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	6					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		AACGGCGGAAAGAGCAATCGC	0.607																																					p.F6V		.											.	COX15-227	0			c.T16G						.						48.0	36.0	40.0					10																	101491791		2203	4300	6503	SO:0001583	missense	1355	exon1			GCGGAAAGAGCAA	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.16T>G	10.37:g.101491791A>C	ENSP00000016171:p.Phe6Val	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	56	18	NM_078470	0	0	9	11	2	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	ENST00000016171.5	37	CCDS7482.1	.	.	.	.	.	.	.	.	.	.	A	6.792	0.515219	0.12944	.	.	ENSG00000014919	ENST00000370483;ENST00000016171	.	.	.	4.58	0.265	0.15612	.	0.865040	0.09787	N	0.755882	T	0.23054	0.0557	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21621	-1.0240	9	0.27785	T	0.31	1.4857	3.7279	0.08481	0.4456:0.2267:0.3277:0.0	.	6;6	Q7KZN9-2;Q7KZN9	.;COX15_HUMAN	V	6	.	ENSP00000016171:F6V	F	-	1	0	COX15	101481781	0.005000	0.15991	0.002000	0.10522	0.186000	0.23388	-0.083000	0.11286	-0.100000	0.12241	0.454000	0.30748	TTT	.		0.607	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
E2F8	79733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	19251275	19251275	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr11:19251275A>T	ENST00000527884.1	-	10	1851	c.1619T>A	c.(1618-1620)cTg>cAg	p.L540Q	E2F8_ENST00000250024.4_Missense_Mutation_p.L540Q|RP11-428C19.4_ENST00000527978.1_RNA	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	540					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CGTTGGGCTCAGGCCTTGGGG	0.582																																					p.L540Q		.											.	E2F8-91	0			c.T1619A						.						116.0	110.0	112.0					11																	19251275		2199	4293	6492	SO:0001583	missense	79733	exon10			GGGCTCAGGCCTT		CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.1619T>A	11.37:g.19251275A>T	ENSP00000434199:p.Leu540Gln	Somatic	448	0		WXS	Illumina HiSeq	Phase_I	410	146	NM_001256372	0	0	0	0	0	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	ENST00000527884.1	37	CCDS7849.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.208327	0.39003	.	.	ENSG00000129173	ENST00000527884;ENST00000396159;ENST00000250024	T;T	0.19669	2.13;2.13	5.63	3.22	0.36961	.	0.443233	0.22737	N	0.056245	T	0.17323	0.0416	M	0.62723	1.935	0.38602	D	0.950684	P	0.37955	0.612	B	0.34722	0.188	T	0.13737	-1.0498	10	0.66056	D	0.02	-1.4647	1.4873	0.02450	0.4262:0.2981:0.1324:0.1433	.	540	A0AVK6	E2F8_HUMAN	Q	540	ENSP00000434199:L540Q;ENSP00000250024:L540Q	ENSP00000250024:L540Q	L	-	2	0	E2F8	19207851	0.981000	0.34729	1.000000	0.80357	0.949000	0.60115	1.281000	0.33214	0.376000	0.24707	0.533000	0.62120	CTG	.		0.582	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387830.1	NM_024680	
QSER1	79832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	32954930	32954930	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr11:32954930C>A	ENST00000399302.2	+	4	2074	c.1739C>A	c.(1738-1740)tCa>tAa	p.S580*	QSER1_ENST00000527788.1_Nonsense_Mutation_p.S341*	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	580										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TCTCTTGAGTCATCAACCCAA	0.398																																					p.S580X		.											.	QSER1-95	0			c.C1739A						.						82.0	77.0	79.0					11																	32954930		1869	4115	5984	SO:0001587	stop_gained	79832	exon4			TTGAGTCATCAAC	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.1739C>A	11.37:g.32954930C>A	ENSP00000382241:p.Ser580*	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	48	14	NM_001076786	0	0	0	0	0	Q6ZU30|Q6ZUR5	Nonsense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281137	0.80692	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	.	.	.	5.01	5.01	0.66863	.	0.480260	0.19152	N	0.121422	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6645	0.91485	0.0:1.0:0.0:0.0	.	.	.	.	X	580;341;341	.	ENSP00000078652:S341X	S	+	2	0	QSER1	32911506	0.999000	0.42202	0.049000	0.19019	0.007000	0.05969	5.597000	0.67577	2.496000	0.84212	0.591000	0.81541	TCA	.		0.398	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
MADD	8567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47304129	47304129	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr11:47304129T>G	ENST00000311027.5	+	9	1832	c.1667T>G	c.(1666-1668)cTt>cGt	p.L556R	MADD_ENST00000395344.3_Missense_Mutation_p.L556R|MADD_ENST00000402192.2_Missense_Mutation_p.L556R|MADD_ENST00000395336.3_Missense_Mutation_p.L556R|MADD_ENST00000406482.1_Missense_Mutation_p.L556R|MADD_ENST00000342922.4_Missense_Mutation_p.L556R|MADD_ENST00000489415.1_3'UTR|MADD_ENST00000407859.3_Missense_Mutation_p.L556R|MADD_ENST00000402799.1_Missense_Mutation_p.L556R|MADD_ENST00000349238.3_Missense_Mutation_p.L556R	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GAATGGATCCTTAACCCCACC	0.537																																					p.L556R		.											.	MADD-682	0			c.T1667G						.						69.0	53.0	58.0					11																	47304129		2201	4298	6499	SO:0001583	missense	8567	exon9			GGATCCTTAACCC	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.1667T>G	11.37:g.47304129T>G	ENSP00000310933:p.Leu556Arg	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	137	50	NM_130474	0	0	3	11	8		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.010292	0.93346	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.08896	3.16;3.05;3.05;3.14;3.15;3.04;3.06;3.15;3.16	5.77	5.77	0.91146	dDENN (1);	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.91635	0.995;0.997;0.998;0.991;0.991;0.991;0.997;0.999;0.999;0.999	T	0.00686	-1.1610	10	0.87932	D	0	-13.2301	16.383	0.83481	0.0:0.0:0.0:1.0	.	556;556;556;556;556;556;556;556;556;556	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	R	556	ENSP00000343902:L556R;ENSP00000385585:L556R;ENSP00000384435:L556R;ENSP00000304505:L556R;ENSP00000310933:L556R;ENSP00000384204:L556R;ENSP00000378753:L556R;ENSP00000378745:L556R;ENSP00000384287:L556R	ENSP00000310933:L556R	L	+	2	0	MADD	47260705	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.628000	0.83189	2.326000	0.78906	0.533000	0.62120	CTT	.		0.537	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
PIK3C2G	5288	hgsc.bcm.edu;broad.mit.edu	37	12	18658292	18658292	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr12:18658292G>A	ENST00000266497.5	+	22	3135	c.3097G>A	c.(3097-3099)Gac>Aac	p.D1033N	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.D1074N|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.D1033N			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1033	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				GGGAGTATGTGACCGTCACAA	0.393																																					p.D1033N		.											.	PIK3C2G-1312	0			c.G3097A						.						129.0	112.0	117.0					12																	18658292		1934	4151	6085	SO:0001583	missense	5288	exon23			GTATGTGACCGTC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3097G>A	12.37:g.18658292G>A	ENSP00000266497:p.Asp1033Asn	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	11	7	NM_004570	0	0	0	0	0	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018323	0.93404	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	D;D;D	0.94897	-3.55;-3.55;-3.55	4.47	4.47	0.54385	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.127925	0.51477	D	0.000089	D	0.98105	0.9375	H	0.95043	3.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98863	1.0763	10	0.87932	D	0	-20.5375	17.403	0.87465	0.0:0.0:1.0:0.0	.	1073;1074;1033	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	N	1033;1033;1074	ENSP00000404845:D1033N;ENSP00000266497:D1033N;ENSP00000445381:D1074N	ENSP00000266497:D1033N	D	+	1	0	PIK3C2G	18549559	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.524000	0.98036	2.771000	0.95319	0.650000	0.86243	GAC	.		0.393	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
PDZRN4	29951	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	41585335	41585335	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr12:41585335C>T	ENST00000402685.2	+	2	732	c.724C>T	c.(724-726)Cga>Tga	p.R242*		NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	242	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TATAGGAGGTCGACCAAATCA	0.303																																					p.R242X		.											.	PDZRN4-296	0			c.C724T						.						97.0	90.0	92.0					12																	41585335		1568	3576	5144	SO:0001587	stop_gained	29951	exon2			GGAGGTCGACCAA	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.724C>T	12.37:g.41585335C>T	ENSP00000384197:p.Arg242*	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	105	34	NM_001164595	0	0	0	0	0	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	C	37	6.538183	0.97646	.	.	ENSG00000165966	ENST00000402685	.	.	.	4.48	2.64	0.31445	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2118	0.37322	0.0:0.8273:0.0:0.1727	.	.	.	.	X	242	.	ENSP00000384197:R242X	R	+	1	2	PDZRN4	39871602	0.791000	0.28800	0.992000	0.48379	0.995000	0.86356	1.196000	0.32198	0.591000	0.29711	0.563000	0.77884	CGA	.		0.303	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
ACAD10	80724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112184083	112184083	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr12:112184083C>A	ENST00000313698.4	+	14	2406	c.2251C>A	c.(2251-2253)Ccc>Acc	p.P751T	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_Missense_Mutation_p.P353T|ACAD10_ENST00000455480.2_Missense_Mutation_p.P782T	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	751						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						CCTGTATGCCCCCGAGGTACC	0.473																																					p.P782T		.											.	ACAD10-92	0			c.C2344A						.						106.0	103.0	104.0					12																	112184083		2203	4300	6503	SO:0001583	missense	80724	exon15			TATGCCCCCGAGG	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2251C>A	12.37:g.112184083C>A	ENSP00000325137:p.Pro751Thr	Somatic	265	0		WXS	Illumina HiSeq	Phase_I	339	89	NM_001136538	0	0	0	2	2	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.408994	0.62399	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000455480;ENST00000515283;ENST00000313698	D;D;D	0.99660	-6.32;-6.32;-6.32	5.29	3.43	0.39272	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.378699	0.25436	N	0.030684	D	0.99629	0.9864	H	0.97732	4.065	0.80722	D	1	D;B;B	0.53462	0.96;0.209;0.298	P;B;B	0.57057	0.812;0.396;0.141	D	0.98657	1.0682	10	0.87932	D	0	.	9.228	0.37418	0.1463:0.776:0.0:0.0777	.	782;751;751	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	T	353;751;782;144;751	ENSP00000376411:P353T;ENSP00000389813:P782T;ENSP00000325137:P751T	ENSP00000325137:P751T	P	+	1	0	ACAD10	110668466	0.071000	0.21146	0.012000	0.15200	0.965000	0.64279	1.166000	0.31834	0.708000	0.31955	0.561000	0.74099	CCC	.		0.473	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
TMEM132D	121256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	130184819	130184819	+	Silent	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr12:130184819C>G	ENST00000422113.2	-	2	830	c.504G>C	c.(502-504)ctG>ctC	p.L168L	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	168					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CAAAGACCCTCAGGCACGGCA	0.662																																					p.L168L		.											.	TMEM132D-106	0			c.G504C						.						18.0	20.0	20.0					12																	130184819		2203	4299	6502	SO:0001819	synonymous_variant	121256	exon2			GACCCTCAGGCAC	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.504G>C	12.37:g.130184819C>G		Somatic	96	0		WXS	Illumina HiSeq	Phase_I	103	57	NM_133448	0	0	0	0	0	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1																																																																																			.		0.662	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
SLC46A3	283537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	29287510	29287510	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr13:29287510A>G	ENST00000266943.6	-	3	736	c.367T>C	c.(367-369)Tat>Cat	p.Y123H	SLC46A3_ENST00000380814.4_Missense_Mutation_p.Y123H	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	123					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		AAGGCAAAATAGCAAAGCAAA	0.408																																					p.Y123H		.											.	SLC46A3-69	0			c.T367C						.						74.0	67.0	69.0					13																	29287510		2203	4300	6503	SO:0001583	missense	283537	exon3			CAAAATAGCAAAG		CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.367T>C	13.37:g.29287510A>G	ENSP00000266943:p.Tyr123His	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	54	13	NM_181785	0	0	36	57	21	Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Missense_Mutation	SNP	ENST00000266943.6	37	CCDS9332.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182467	0.78677	.	.	ENSG00000139508	ENST00000266943;ENST00000380814	T;T	0.80994	-1.44;-1.44	6.17	5.0	0.66597	Major facilitator superfamily domain, general substrate transporter (1);	0.059964	0.64402	D	0.000002	D	0.88123	0.6352	M	0.74881	2.28	0.42496	D	0.992918	D;B;B	0.89917	1.0;0.36;0.413	D;B;B	0.79784	0.993;0.139;0.219	D	0.87590	0.2490	10	0.42905	T	0.14	-22.8055	12.1889	0.54257	0.9341:0.0:0.0659:0.0	.	48;123;123	B5MEH0;Q7Z3Q1-2;Q7Z3Q1	.;.;S46A3_HUMAN	H	123	ENSP00000266943:Y123H;ENSP00000370192:Y123H	ENSP00000266943:Y123H	Y	-	1	0	SLC46A3	28185510	1.000000	0.71417	0.981000	0.43875	0.958000	0.62258	6.725000	0.74752	1.160000	0.42584	0.533000	0.62120	TAT	.		0.408	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276111.1	NM_181785	
BRCA2	675	hgsc.bcm.edu	37	13	32913098	32913098	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr13:32913098A>G	ENST00000380152.3	+	11	4839	c.4606A>G	c.(4606-4608)Aag>Gag	p.K1536E	BRCA2_ENST00000544455.1_Missense_Mutation_p.K1536E			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1536	Interaction with POLH.|Required for stimulation of POLH DNA polymerization activity.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TAAAATTGCAAAGGAATCTTT	0.388			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.K1536E	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2-3153	0			c.A4606G						.						51.0	55.0	53.0					13																	32913098		2202	4299	6501	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	ATTGCAAAGGAAT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4606A>G	13.37:g.32913098A>G	ENSP00000369497:p.Lys1536Glu	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_000059	0	0	0	0	0	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.662988	0.29515	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.68479	-0.33;-0.33	5.74	4.54	0.55810	.	0.251014	0.35013	N	0.003510	T	0.64735	0.2625	M	0.62723	1.935	0.25827	N	0.984216	P	0.47034	0.889	P	0.50896	0.653	T	0.55224	-0.8174	10	0.16896	T	0.51	.	3.9056	0.09180	0.6124:0.2054:0.1823:0.0	.	1536	P51587	BRCA2_HUMAN	E	1536	ENSP00000369497:K1536E;ENSP00000439902:K1536E	ENSP00000369497:K1536E	K	+	1	0	BRCA2	31811098	0.956000	0.32656	0.377000	0.26055	0.488000	0.33401	1.874000	0.39568	0.979000	0.38497	0.460000	0.39030	AAG	.		0.388	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
ATP7B	540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	52548108	52548108	+	Silent	SNP	A	A	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr13:52548108A>T	ENST00000242839.4	-	2	1404	c.1248T>A	c.(1246-1248)gcT>gcA	p.A416A	ATP7B_ENST00000418097.2_Silent_p.A416A|ATP7B_ENST00000400366.3_Silent_p.A305A|ATP7B_ENST00000448424.2_Silent_p.A416A|ATP7B_ENST00000542656.1_Silent_p.A384A|ATP7B_ENST00000344297.5_Silent_p.A416A|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000400370.3_Silent_p.A416A	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	416	HMA 4. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGTCTTCTATAGCAGCTCTGA	0.458									Wilson disease																												p.A416A		.											.	ATP7B-92	0			c.T1248A						.						100.0	98.0	98.0					13																	52548108		1934	4142	6076	SO:0001819	synonymous_variant	540	exon2	Familial Cancer Database		TTCTATAGCAGCT	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1248T>A	13.37:g.52548108A>T		Somatic	201	0		WXS	Illumina HiSeq	Phase_I	245	90	NM_000053	0	0	2	6	4	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Silent	SNP	ENST00000242839.4	37	CCDS41892.1																																																																																			.		0.458	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
RNF219	79596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	79190506	79190506	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr13:79190506T>A	ENST00000282003.6	-	6	1448	c.1390A>T	c.(1390-1392)Aca>Tca	p.T464S	RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	464	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		CAAAATCCTGTCTTTGGGGAA	0.333																																					p.T464S		.											.	RNF219-135	0			c.A1390T						.						38.0	40.0	39.0					13																	79190506		2203	4298	6501	SO:0001583	missense	79596	exon6			ATCCTGTCTTTGG	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1390A>T	13.37:g.79190506T>A	ENSP00000282003:p.Thr464Ser	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	58	25	NM_024546	0	0	5	9	4	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	37	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.813748	0.32053	.	.	ENSG00000152193	ENST00000282003	T	0.13778	2.56	5.86	3.32	0.38043	.	0.182284	0.39475	N	0.001352	T	0.03959	0.0111	N	0.03608	-0.345	0.26073	N	0.9812	B	0.10296	0.003	B	0.08055	0.003	T	0.36841	-0.9731	10	0.10902	T	0.67	-12.2367	1.5693	0.02612	0.3186:0.0903:0.1164:0.4747	.	464	Q5W0B1	RN219_HUMAN	S	464	ENSP00000282003:T464S	ENSP00000282003:T464S	T	-	1	0	RNF219	78088507	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	1.424000	0.34848	1.050000	0.40346	0.533000	0.62120	ACA	.		0.333	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
PSME2	5721	ucsc.edu	37	14	24613239	24613239	+	Splice_Site	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr14:24613239C>T	ENST00000216802.5	-	9	1137		c.e9-1		EMC9_ENST00000558200.1_5'Flank|EMC9_ENST00000419198.2_5'Flank|EMC9_ENST00000216799.4_5'Flank|EMC9_ENST00000560403.1_5'Flank|PSME2_ENST00000560410.1_Splice_Site|PSME2_ENST00000471700.2_Intron|RNF31_ENST00000559275.1_5'Flank	NM_002818.2	NP_002809.2	Q9UL46	PSME2_HUMAN	proteasome (prosome, macropain) activator subunit 2 (PA28 beta)						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)				endometrium(1)|lung(3)|prostate(2)	6				GBM - Glioblastoma multiforme(265;0.00839)		TGAGAAGTACCTGCCAGAAGC	0.552																																					.													.	PSME2-90	0			c.498-1G>A						.						118.0	117.0	118.0					14																	24613239		2203	4300	6503	SO:0001630	splice_region_variant	5721	exon10			AAGTACCTGCCAG		CCDS9614.1	14q11.2	2010-03-10			ENSG00000100911	ENSG00000100911		"""Proteasome (prosome, macropain) subunits"""	9569	protein-coding gene	gene with protein product		602161				7789512	Standard	NM_002818		Approved	PA28beta	uc001wmj.3	Q9UL46	OTTHUMG00000028797	ENST00000216802.5:c.498-1G>A	14.37:g.24613239C>T		Somatic	269	0		WXS	Illumina HiSeq		420	1	NM_002818	0	0	3	3	0	Q15129	Splice_Site	SNP	ENST00000216802.5	37	CCDS9614.1	.	.	.	.	.	.	.	.	.	.	C	16.48	3.135818	0.56936	.	.	ENSG00000100911	ENST00000216802	.	.	.	4.83	3.93	0.45458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.307	0.32049	0.0:0.8955:0.0:0.1045	.	.	.	.	.	-1	.	.	.	-	.	.	PSME2	23683079	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.639000	0.67868	2.675000	0.91044	0.555000	0.69702	.	.		0.552	PSME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071918.3	NM_002818	Intron
KHNYN	23351	hgsc.bcm.edu	37	14	24910963	24910963	+	IGR	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr14:24910963C>G	ENST00000251343.5	+	0	6225				SDR39U1_ENST00000555561.1_5'Flank|SDR39U1_ENST00000555365.1_5'UTR|SDR39U1_ENST00000399395.3_Missense_Mutation_p.R82P|SDR39U1_ENST00000554698.1_Intron|SDR39U1_ENST00000553930.1_5'UTR|SDR39U1_ENST00000399390.1_5'Flank|SDR39U1_ENST00000538105.2_Intron			O15037	KHNYN_HUMAN	KH and NYN domain containing								RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						GGTCTCTAGGCGGCTGCCGAT	0.498																																					p.R82P		.											.	SDR39U1-46	0			c.G245C						.						48.0	39.0	42.0					14																	24910963		1856	4091	5947	SO:0001628	intergenic_variant	56948	exon4			TCTAGGCGGCTGC	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037			14.37:g.24910963C>G		Somatic	84	0		WXS	Illumina HiSeq	Phase_I	74	6	NM_020195	0	0	0	0	0	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	ENST00000251343.5	37	CCDS32058.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024548	0.93518	.	.	ENSG00000100445	ENST00000399395;ENST00000336353	D	0.93426	-3.22	5.46	5.46	0.80206	NAD(P)-binding domain (1);	0.222455	0.46145	D	0.000301	D	0.96972	0.9011	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97373	0.9977	10	0.87932	D	0	-11.9991	17.1594	0.86800	0.0:1.0:0.0:0.0	.	82;108	Q9NRG7-2;Q9NRG7	.;D39U1_HUMAN	P	82;108	ENSP00000382327:R82P	ENSP00000336854:R108P	R	-	2	0	SDR39U1	23980803	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.215000	0.77966	2.714000	0.92807	0.655000	0.94253	CGC	.		0.498	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1		
SPINT1	6692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41146021	41146021	+	Silent	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr15:41146021C>T	ENST00000344051.4	+	5	1089	c.855C>T	c.(853-855)ggC>ggT	p.G285G	SPINT1_ENST00000562057.1_Silent_p.G285G|SPINT1_ENST00000431806.1_Silent_p.G285G			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	285	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GCTGCTTGGGCAACAAGAACA	0.572																																					p.G285G		.											.	SPINT1-91	0			c.C855T						.						120.0	128.0	125.0					15																	41146021		2203	4300	6503	SO:0001819	synonymous_variant	6692	exon5			CTTGGGCAACAAG		CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.855C>T	15.37:g.41146021C>T		Somatic	391	0		WXS	Illumina HiSeq	Phase_I	317	106	NM_181642	0	1	53	99	45	Q7Z7D2	Silent	SNP	ENST00000344051.4	37	CCDS10067.1																																																																																			.		0.572	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252359.2	NM_003710	
TP53BP1	7158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	43724401	43724401	+	Silent	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr15:43724401G>A	ENST00000263801.3	-	17	3903	c.3651C>T	c.(3649-3651)ctC>ctT	p.L1217L	TP53BP1_ENST00000382039.3_Silent_p.L1222L|TP53BP1_ENST00000382044.4_Silent_p.L1222L|TP53BP1_ENST00000450115.2_Silent_p.L1222L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1217					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CCTGGCTATGGAGCGACTCTG	0.483								Other conserved DNA damage response genes																													p.L1222L		.											.	TP53BP1-294	0			c.C3666T						.						137.0	112.0	121.0					15																	43724401		2201	4298	6499	SO:0001819	synonymous_variant	7158	exon17			GCTATGGAGCGAC	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3651C>T	15.37:g.43724401G>A		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	37	13	NM_001141980	0	0	0	0	0	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	ENST00000263801.3	37	CCDS10096.1																																																																																			.		0.483	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
CGNL1	84952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	57730838	57730838	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr15:57730838C>G	ENST00000281282.5	+	2	719	c.641C>G	c.(640-642)aCa>aGa	p.T214R		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	214	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		TCTGGTGTGACAGCTATTCGT	0.517																																					p.T214R		.											.	CGNL1-100	0			c.C641G						.						132.0	132.0	132.0					15																	57730838		2192	4292	6484	SO:0001583	missense	84952	exon3			GTGTGACAGCTAT	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.641C>G	15.37:g.57730838C>G	ENSP00000281282:p.Thr214Arg	Somatic	625	1		WXS	Illumina HiSeq	Phase_I	467	169	NM_001252335	0	0	2	3	1	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	C	5.347	0.249277	0.10130	.	.	ENSG00000128849	ENST00000281282	T	0.76968	-1.06	4.98	4.04	0.47022	.	0.178508	0.26851	N	0.022178	T	0.70124	0.3188	L	0.51422	1.61	0.30026	N	0.813928	B	0.27625	0.183	B	0.19666	0.026	T	0.69495	-0.5130	10	0.56958	D	0.05	-12.3608	10.9213	0.47167	0.4244:0.5756:0.0:0.0	.	214	Q0VF96	CGNL1_HUMAN	R	214	ENSP00000281282:T214R	ENSP00000281282:T214R	T	+	2	0	CGNL1	55518130	0.432000	0.25554	0.389000	0.26208	0.182000	0.23217	1.535000	0.36061	1.275000	0.44379	0.650000	0.86243	ACA	.		0.517	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79058483	79058483	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr15:79058483A>G	ENST00000388820.4	-	19	3980	c.3770T>C	c.(3769-3771)gTg>gCg	p.V1257A	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1257					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CAGCTCCGCCACGTCAGGACT	0.682																																					p.V1257A		.											.	ADAMTS7-226	0			c.T3770C						.						18.0	20.0	19.0					15																	79058483		2190	4284	6474	SO:0001583	missense	11173	exon19			TCCGCCACGTCAG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3770T>C	15.37:g.79058483A>G	ENSP00000373472:p.Val1257Ala	Somatic	138	2		WXS	Illumina HiSeq	Phase_I	94	7	NM_014272	0	0	13	13	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	a	0.108	-1.142767	0.01728	.	.	ENSG00000136378	ENST00000388820	T	0.58358	0.34	4.07	-1.67	0.08238	.	3.059830	0.01144	N	0.006277	T	0.30417	0.0764	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14671	-1.0464	10	0.07644	T	0.81	.	4.9595	0.14059	0.4676:0.0:0.3876:0.1449	.	1257	Q9UKP4	ATS7_HUMAN	A	1257	ENSP00000373472:V1257A	ENSP00000373472:V1257A	V	-	2	0	ADAMTS7	76845538	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.896000	0.04114	-0.238000	0.09724	0.387000	0.25754	GTG	.		0.682	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
MCTP2	55784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	94841734	94841734	+	Silent	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr15:94841734C>T	ENST00000357742.4	+	1	240	c.240C>T	c.(238-240)agC>agT	p.S80S	MCTP2_ENST00000451018.3_Silent_p.S80S|MCTP2_ENST00000543482.1_Silent_p.S80S|MCTP2_ENST00000331706.4_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	80					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CGGTGCCCAGCAGTCTGTCCA	0.587																																					p.S80S		.											.	MCTP2-93	0			c.C240T						.						60.0	62.0	62.0					15																	94841734		2197	4298	6495	SO:0001819	synonymous_variant	55784	exon1			GCCCAGCAGTCTG	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.240C>T	15.37:g.94841734C>T		Somatic	359	0		WXS	Illumina HiSeq	Phase_I	261	80	NM_001159643	0	0	1	1	0	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	ENST00000357742.4	37	CCDS32338.1																																																																																			.		0.587	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
KIAA0556	23247	broad.mit.edu	37	16	27786370	27786370	+	Missense_Mutation	SNP	C	C	T	rs372682821		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr16:27786370C>T	ENST00000261588.4	+	24	4433	c.4414C>T	c.(4414-4416)Cgg>Tgg	p.R1472W		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1472						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CAGTGATGGCCGGCACATGTG	0.687																																					p.R1472W													.	KIAA0556-141	0			c.C4414T						.	C	TRP/ARG	0,4394		0,0,2197	65.0	56.0	59.0		4414	1.0	1.0	16		59	1,8599	1.2+/-3.3	0,1,4299	no	missense	KIAA0556	NM_015202.2	101	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1472/1619	27786370	1,12993	2197	4300	6497	SO:0001583	missense	23247	exon24			GATGGCCGGCACA	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.4414C>T	16.37:g.27786370C>T	ENSP00000261588:p.Arg1472Trp	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	175	4	NM_015202	0	0	14	14	0	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442453	0.63067	0.0	1.16E-4	ENSG00000047578	ENST00000261588	T	0.15372	2.43	4.78	1.04	0.20106	.	0.000000	0.64402	D	0.000001	T	0.41627	0.1167	M	0.82630	2.6	0.47547	D	0.99945	D	0.89917	1.0	D	0.81914	0.995	T	0.35773	-0.9775	10	0.87932	D	0	-35.2725	12.3331	0.55051	0.5839:0.4161:0.0:0.0	.	1472	O60303	K0556_HUMAN	W	1472	ENSP00000261588:R1472W	ENSP00000261588:R1472W	R	+	1	2	KIAA0556	27693871	0.990000	0.36364	0.995000	0.50966	0.882000	0.50991	1.006000	0.29847	-0.096000	0.12329	-0.823000	0.03104	CGG	.		0.687	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
FANCA	2175	hgsc.bcm.edu	37	16	89883000	89883000	+	Missense_Mutation	SNP	G	G	C	rs76275444	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr16:89883000G>C	ENST00000389301.3	-	1	54	c.24C>G	c.(22-24)aaC>aaG	p.N8K	FANCA_ENST00000563673.1_Missense_Mutation_p.N8K|FANCA_ENST00000389302.3_Missense_Mutation_p.N8K|FANCA_ENST00000534992.1_Missense_Mutation_p.N8K|FANCA_ENST00000543736.1_Missense_Mutation_p.N8K|FANCA_ENST00000568369.1_Missense_Mutation_p.N8K	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	8			N -> K (in FA; unknown pathological significance; dbSNP:rs76275444).		DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CCGAGGCGGAGTTCGGGACCC	0.786			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				g|||	250	0.0499201	0.1823	0.013	5008	,	,		7756	0.0		0.0	False		,,,				2504	0.0				p.N8K		.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA-1130	0			c.C24G						.		LYS/ASN,LYS/ASN	326,2924		2,322,1301	2.0	3.0	3.0		24,24	-8.4	0.0	16	dbSNP_131	3	2,7018		0,2,3508	no	missense,missense	FANCA	NM_000135.2,NM_001018112.1	94,94	2,324,4809	CC,CG,GG		0.0285,10.0308,3.1938	benign,benign	8/1456,8/298	89883000	328,9942	1625	3510	5135	SO:0001583	missense	2175	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GGCGGAGTTCGGG	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.24C>G	16.37:g.89883000G>C	ENSP00000373952:p.Asn8Lys	Somatic	2	1		WXS	Illumina HiSeq	Phase_I	8	4	NM_000135	0	0	1	1	0	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	68	0.031135531135531136	62	0.12601626016260162	6	0.016574585635359115	0	0.0	0	0.0	G	9.405	1.078943	0.20227	0.100308	2.85E-4	ENSG00000187741	ENST00000389301;ENST00000389302;ENST00000534992;ENST00000543736	D;T;T;T	0.83914	-1.78;0.2;0.19;0.19	4.22	-8.45	0.00946	.	2.015170	0.03142	N	0.166706	T	0.00845	0.0028	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.16396	0.008;0.017;0.017;0.006;0.008	B;B;B;B;B	0.17433	0.004;0.018;0.018;0.01;0.004	T	0.41124	-0.9526	10	0.05959	T	0.93	0.155	2.6799	0.05090	0.3526:0.3821:0.157:0.1083	.	8;8;8;8;8	B4DRI7;Q0VAP4;A0PJU8;F5H8D5;O15360	.;.;.;.;FANCA_HUMAN	K	8	ENSP00000373952:N8K;ENSP00000373953:N8K;ENSP00000443675:N8K;ENSP00000443409:N8K	ENSP00000373952:N8K	N	-	3	2	FANCA	88410501	0.000000	0.05858	0.000000	0.03702	0.112000	0.19704	-1.977000	0.01495	-1.966000	0.01009	0.187000	0.17357	AAC	G|0.032;C|0.968		0.786	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
SLC43A2	124935	hgsc.bcm.edu	37	17	1494129	1494129	+	Missense_Mutation	SNP	G	G	A	rs145755178		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:1494129G>A	ENST00000301335.5	-	9	1133	c.1045C>T	c.(1045-1047)Ctc>Ttc	p.L349F	SLC43A2_ENST00000412517.3_Missense_Mutation_p.L212F|SLC43A2_ENST00000571650.1_Missense_Mutation_p.L349F|SLC43A2_ENST00000382147.4_Missense_Mutation_p.L349F|SLC43A2_ENST00000574274.1_5'Flank	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	349					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		AGGAACTTGAGGATGTTGTTC	0.642													g|||	1	0.000199681	0.0008	0.0	5008	,	,		16419	0.0		0.0	False		,,,				2504	0.0				p.L349F		.											.	SLC43A2-91	0			c.C1045T						.	-	PHE/LEU	6,4308		0,6,2151	49.0	42.0	44.0		1045	5.7	1.0	17	dbSNP_134	44	0,8474		0,0,4237	no	missense	SLC43A2	NM_152346.1	22	0,6,6388	AA,AG,GG		0.0,0.1391,0.0469	probably-damaging	349/570	1494129	6,12782	2157	4237	6394	SO:0001583	missense	124935	exon9			ACTTGAGGATGTT	BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.1045C>T	17.37:g.1494129G>A	ENSP00000301335:p.Leu349Phe	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	6	3	NM_152346	0	0	73	126	53	B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Missense_Mutation	SNP	ENST00000301335.5	37	CCDS11006.1	.	.	.	.	.	.	.	.	.	.	g	36	5.644218	0.96704	0.001391	0.0	ENSG00000167703	ENST00000301335;ENST00000382147;ENST00000412517	T;T;D	0.82984	0.35;0.35;-1.67	5.69	5.69	0.88448	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.89332	0.6685	L	0.55743	1.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.983;0.998;0.995;0.996	D	0.86314	0.1688	10	0.28530	T	0.3	-0.3735	19.8001	0.96502	0.0:0.0:1.0:0.0	.	212;349;349;349	B7Z6X9;Q8N370-2;Q8N370;Q8N370-3	.;.;LAT4_HUMAN;.	F	349;349;212	ENSP00000301335:L349F;ENSP00000371582:L349F;ENSP00000408284:L212F	ENSP00000301335:L349F	L	-	1	0	SLC43A2	1440879	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.632000	0.83247	2.678000	0.91216	0.556000	0.70494	CTC	G|1.000;A|0.000		0.642	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206717.4	NM_152346	
ZNF594	84622	ucsc.edu	37	17	5085331	5085331	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:5085331T>G	ENST00000399604.4	-	1	2361	c.2221A>C	c.(2221-2223)Acc>Ccc	p.T741P	ZNF594_ENST00000575779.1_Missense_Mutation_p.T741P			Q96JF6	ZN594_HUMAN	zinc finger protein 594	741					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TTGCTGAAGGTTTTCTCACAT	0.443																																					p.T741P													.	ZNF594-71	0			c.A2221C						.						205.0	211.0	209.0					17																	5085331		2088	4237	6325	SO:0001583	missense	84622	exon2			TGAAGGTTTTCTC	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.2221A>C	17.37:g.5085331T>G	ENSP00000382513:p.Thr741Pro	Somatic	246	0		WXS	Illumina HiSeq		298	3	NM_032530	0	0	23	30	7	Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	37	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	T	11.04	1.521063	0.27211	.	.	ENSG00000180626	ENST00000399604	T	0.16324	2.35	1.04	-2.08	0.07254	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13543	0.0328	L	0.61387	1.9	0.09310	N	0.999994	B	0.30179	0.271	B	0.14023	0.01	T	0.18023	-1.0350	9	0.62326	D	0.03	.	4.1321	0.10154	0.3047:0.0:0.0:0.6953	.	741	Q96JF6	ZN594_HUMAN	P	741	ENSP00000382513:T741P	ENSP00000382513:T741P	T	-	1	0	ZNF594	5026055	0.001000	0.12720	0.016000	0.15963	0.324000	0.28378	0.026000	0.13599	-0.614000	0.05687	0.248000	0.18094	ACC	.		0.443	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
CDRT4	284040	broad.mit.edu	37	17	15341130	15341130	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:15341130C>T	ENST00000312177.6	-	4	696	c.416G>A	c.(415-417)cGc>cAc	p.R139H	CDRT4_ENST00000519354.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_3'UTR	NM_001204477.1	NP_001191406.1	Q8N9R6	CDRT4_HUMAN	CMT1A duplicated region transcript 4	139										endometrium(3)|skin(1)	4				UCEC - Uterine corpus endometrioid carcinoma (92;0.0874)		CATAGGCTTGCGGGCAAAGAT	0.488																																					p.R140H													.	CDRT4-90	0			c.G419A						.						103.0	85.0	91.0					17																	15341130		2203	4300	6503	SO:0001583	missense	284040	exon4			GGCTTGCGGGCAA	BC029542	CCDS73995.1	17p12	2011-09-28			ENSG00000239704	ENSG00000239704			14383	protein-coding gene	gene with protein product						11381029	Standard	NM_001204477		Approved	FLJ36674	uc002gop.2	Q8N9R6	OTTHUMG00000059070	ENST00000312177.6:c.416G>A	17.37:g.15341130C>T	ENSP00000310031:p.Arg139His	Somatic	53	1		WXS	Illumina HiSeq	Phase_I	153	6	NM_001204477	0	0	26	26	0	A8MSL9|Q8IZ19	Missense_Mutation	SNP	ENST00000312177.6	37		.	.	.	.	.	.	.	.	.	.	C	12.34	1.909356	0.33721	.	.	ENSG00000239704	ENST00000520956;ENST00000312177	T	0.38077	1.16	4.98	1.88	0.25563	.	0.505891	0.16231	N	0.223586	T	0.50137	0.1598	M	0.64997	1.995	0.09310	N	1	D	0.89917	1.0	D	0.68039	0.955	T	0.32322	-0.9911	10	0.72032	D	0.01	-8.4552	7.1563	0.25639	0.0:0.7191:0.0:0.2809	.	139	Q8N9R6	CDRT4_HUMAN	H	140;139	ENSP00000310031:R139H	ENSP00000310031:R139H	R	-	2	0	CDRT4	15281855	0.709000	0.27886	0.009000	0.14445	0.110000	0.19582	0.383000	0.20651	0.284000	0.22305	-0.145000	0.13849	CGC	C|1.000;T|0.000		0.488	CDRT4-001	KNOWN	non_canonical_conserved|non_canonical_other|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000130383.7	NM_173622	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	819	126		WXS	Illumina HiSeq		914	120	NM_145301	0	0	14	72	58	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29220728	29220728	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:29220728T>G	ENST00000321990.4	+	21	5235	c.4857T>G	c.(4855-4857)aaT>aaG	p.N1619K		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1619					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAGGAAACAATCCAGAGACAA	0.393																																					p.N1619K		.											.	ATAD5-93	0			c.T4857G						.						82.0	91.0	88.0					17																	29220728		2203	4300	6503	SO:0001583	missense	79915	exon21			AAACAATCCAGAG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4857T>G	17.37:g.29220728T>G	ENSP00000313171:p.Asn1619Lys	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	126	28	NM_024857	0	0	2	4	2	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.522716	0.00149	.	.	ENSG00000176208	ENST00000321990	T	0.06218	3.33	4.7	-1.39	0.08997	.	7.549810	0.00481	N	0.000125	T	0.04998	0.0134	L	0.39898	1.24	0.09310	N	1	B	0.15473	0.013	B	0.08055	0.003	T	0.32025	-0.9922	10	0.07325	T	0.83	.	2.0379	0.03544	0.2113:0.3553:0.099:0.3344	.	1619	Q96QE3	ATAD5_HUMAN	K	1619	ENSP00000313171:N1619K	ENSP00000313171:N1619K	N	+	3	2	ATAD5	26244854	0.000000	0.05858	0.027000	0.17364	0.126000	0.20510	-1.140000	0.03210	-0.300000	0.08895	-0.326000	0.08463	AAT	.		0.393	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
TANC2	26115	hgsc.bcm.edu;broad.mit.edu	37	17	61466867	61466867	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:61466867C>A	ENST00000424789.2	+	15	2795	c.2791C>A	c.(2791-2793)Ctg>Atg	p.L931M	AC015923.1_ENST00000431604.1_RNA|RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.L931M	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	931					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						AGCAGGGTACCTGAGCATTGT	0.537																																					p.L931M		.											.	TANC2-24	0			c.C2791A						.						31.0	31.0	31.0					17																	61466867		2010	4178	6188	SO:0001583	missense	26115	exon15			GGGTACCTGAGCA	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.2791C>A	17.37:g.61466867C>A	ENSP00000387593:p.Leu931Met	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	57	28	NM_025185	0	0	0	0	0	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	37	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	C	8.463	0.855695	0.17106	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.68765	-0.35;-0.35	5.17	5.17	0.71159	Ankyrin repeat-containing domain (4);	0.063998	0.64402	D	0.000005	T	0.62998	0.2474	L	0.50333	1.59	0.51767	D	0.999933	B;B;B	0.28128	0.082;0.118;0.201	B;B;B	0.31390	0.036;0.091;0.129	T	0.58989	-0.7538	10	0.14656	T	0.56	.	18.698	0.91610	0.0:1.0:0.0:0.0	.	931;841;931	Q9HCD6-2;D3DU10;Q9HCD6	.;.;TANC2_HUMAN	M	931	ENSP00000374171:L931M;ENSP00000387593:L931M	ENSP00000374171:L931M	L	+	1	2	TANC2	58820599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.060000	0.57477	2.401000	0.81631	0.555000	0.69702	CTG	.		0.537	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
SLC16A6	9120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	66270212	66270212	+	Splice_Site	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr17:66270212C>A	ENST00000327268.4	-	4	397		c.e4-1		SLC16A6_ENST00000580666.1_Splice_Site|ARSG_ENST00000448504.2_Intron	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6						monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GCGAGGGGAGCTGCCGGGAAA	0.547																																					.		.											.	SLC16A6-90	0			c.233-1G>T						.						63.0	58.0	59.0					17																	66270212		2203	4300	6503	SO:0001630	splice_region_variant	9120	exon4			GGGGAGCTGCCGG	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.233-1G>T	17.37:g.66270212C>A		Somatic	98	1		WXS	Illumina HiSeq	Phase_I	102	43	NM_004694	0	0	0	3	3	Q6P1X3	Splice_Site	SNP	ENST00000327268.4	37	CCDS11675.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290906	0.59976	.	.	ENSG00000108932	ENST00000327268	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0512	0.93046	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC16A6	63781807	1.000000	0.71417	0.991000	0.47740	0.414000	0.31173	7.232000	0.78116	2.735000	0.93741	0.655000	0.94253	.	.		0.547	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694	Intron
PTPRM	5797	bcgsc.ca	37	18	7567847	7567847	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr18:7567847T>A	ENST00000332175.8	+	1	1068	c.31T>A	c.(31-33)Ttg>Atg	p.L11M	PTPRM_ENST00000400060.4_Missense_Mutation_p.L11M|PTPRM_ENST00000580170.1_Missense_Mutation_p.L11M	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	11					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CCTGGCGACTTTGGCCGGACT	0.766																																					p.L11M													.	PTPRM-228	0			c.T31A						.						55.0	56.0	56.0					18																	7567847		2203	4300	6503	SO:0001583	missense	5797	exon1			GCGACTTTGGCCG	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.31T>A	18.37:g.7567847T>A	ENSP00000331418:p.Leu11Met	Somatic	157	0		WXS	Illumina HiSeq	Phase_1	120	44	NM_001105244	0	0	1	1	0	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.934033	0.52866	.	.	ENSG00000173482	ENST00000332175;ENST00000400060	T;T	0.39056	1.1;1.1	3.47	3.47	0.39725	.	0.140255	0.29328	N	0.012476	T	0.29976	0.0750	L	0.38175	1.15	0.80722	D	1	B;B	0.28324	0.207;0.207	B;B	0.21708	0.036;0.036	T	0.16012	-1.0417	10	0.66056	D	0.02	.	8.2616	0.31788	0.0:0.0:0.2016:0.7984	.	11;11	A7MBN1;P28827	.;PTPRM_HUMAN	M	11	ENSP00000331418:L11M;ENSP00000382933:L11M	ENSP00000331418:L11M	L	+	1	2	PTPRM	7557847	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	1.565000	0.36386	1.228000	0.43614	0.254000	0.18369	TTG	.		0.766	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
TAF4B	6875	broad.mit.edu	37	18	23895311	23895311	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr18:23895311G>C	ENST00000269142.5	+	10	2949	c.1951G>C	c.(1951-1953)Gat>Cat	p.D651H	TAF4B_ENST00000578121.1_Missense_Mutation_p.D656H	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	651					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			GTCATGTAAAGATGAACCATT	0.373																																					p.D651H													.	TAF4B-71	0			c.G1951C						.						71.0	66.0	67.0					18																	23895311		1850	4092	5942	SO:0001583	missense	6875	exon10			TGTAAAGATGAAC	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.1951G>C	18.37:g.23895311G>C	ENSP00000269142:p.Asp651His	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	108	3	NM_005640	0	0	1	1	0	Q29YA4|Q29YA5	Missense_Mutation	SNP	ENST00000269142.5	37	CCDS42421.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990909	0.54041	.	.	ENSG00000141384	ENST00000418698;ENST00000269142	T	0.33438	1.41	5.91	5.91	0.95273	Transcription initiation factor TFIID component TAF4 (1);	0.293009	0.37669	N	0.001992	T	0.60869	0.2302	M	0.82823	2.61	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.67900	0.954;0.89	T	0.61520	-0.7046	10	0.52906	T	0.07	-3.6472	20.2983	0.98569	0.0:0.0:1.0:0.0	.	651;656	Q92750;A4PBF7	TAF4B_HUMAN;.	H	654;651	ENSP00000269142:D651H	ENSP00000269142:D651H	D	+	1	0	TAF4B	22149309	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.802000	0.96397	0.655000	0.94253	GAT	.		0.373	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
SALL3	27164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	76754972	76754972	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr18:76754972T>C	ENST00000537592.2	+	2	2981	c.2981T>C	c.(2980-2982)aTc>aCc	p.I994T	SALL3_ENST00000575389.2_Intron|SALL3_ENST00000536229.3_Intron	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	994					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCGTTGGAAATCCACTACCGC	0.562																																					p.I994T		.											.	SALL3-155	0			c.T2981C						.						61.0	61.0	61.0					18																	76754972		2203	4300	6503	SO:0001583	missense	27164	exon2			TGGAAATCCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2981T>C	18.37:g.76754972T>C	ENSP00000441823:p.Ile994Thr	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	86	33	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890593	0.33348	.	.	ENSG00000256463	ENST00000537592	T	0.07114	3.22	5.15	5.15	0.70609	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000142	T	0.10809	0.0264	N	0.12637	0.245	0.80722	D	1	P	0.50819	0.939	P	0.53988	0.739	T	0.22695	-1.0209	10	0.56958	D	0.05	-22.1664	14.9958	0.71431	0.0:0.0:0.0:1.0	.	994	Q9BXA9	SALL3_HUMAN	T	994	ENSP00000441823:I994T	ENSP00000299466:I994T	I	+	2	0	SALL3	74855960	1.000000	0.71417	0.961000	0.40146	0.689000	0.40095	4.390000	0.59646	1.943000	0.56356	0.379000	0.24179	ATC	.		0.562	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2191111	2191111	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:2191111C>G	ENST00000398665.3	+	5	401	c.365C>G	c.(364-366)cCc>cGc	p.P122R		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	122	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGACCGACCCCGAGAAGCTC	0.602																																					p.P122R		.											.	DOT1L-132	0			c.C365G						.						70.0	80.0	77.0					19																	2191111		2112	4210	6322	SO:0001583	missense	84444	exon5			CCGACCCCGAGAA	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.365C>G	19.37:g.2191111C>G	ENSP00000381657:p.Pro122Arg	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	116	41	NM_032482	0	0	0	1	1	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.003702	0.93287	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000452696	T;T	0.23754	1.89;1.89	4.75	4.75	0.60458	.	0.053872	0.85682	D	0.000000	T	0.58552	0.2130	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68800	-0.5313	10	0.87932	D	0	-14.6108	16.8009	0.85614	0.0:1.0:0.0:0.0	.	122	Q8TEK3-2	.	R	122;122;98	ENSP00000381657:P122R;ENSP00000404284:P98R	ENSP00000221482:P122R	P	+	2	0	DOT1L	2142111	1.000000	0.71417	0.943000	0.38184	0.962000	0.63368	7.246000	0.78247	2.193000	0.70182	0.555000	0.69702	CCC	.		0.602	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2216711	2216711	+	Silent	SNP	G	G	A	rs377506676		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:2216711G>A	ENST00000398665.3	+	20	2391	c.2355G>A	c.(2353-2355)ctG>ctA	p.L785L	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	785					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGGCACCTGAGCCAGGACC	0.692																																					p.L785L		.											.	DOT1L-132	0			c.G2355A						.	G		0,4116		0,0,2058	25.0	30.0	29.0		2355	1.9	1.0	19		29	1,8349		0,1,4174	no	coding-synonymous	DOT1L	NM_032482.2		0,1,6232	AA,AG,GG		0.012,0.0,0.0080		785/1538	2216711	1,12465	2058	4175	6233	SO:0001819	synonymous_variant	84444	exon20			GCACCTGAGCCAG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2355G>A	19.37:g.2216711G>A		Somatic	134	1		WXS	Illumina HiSeq	Phase_I	105	41	NM_032482	0	0	6	10	4	O60379|Q96JL1	Silent	SNP	ENST00000398665.3	37	CCDS42460.1																																																																																			.		0.692	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
SLC25A23	79085	hgsc.bcm.edu	37	19	6444308	6444308	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:6444308A>G	ENST00000301454.4	-	9	1182	c.1076T>C	c.(1075-1077)cTg>cCg	p.L359P	SLC25A23_ENST00000601760.1_5'Flank|SLC25A23_ENST00000414491.2_Missense_Mutation_p.L120P|SLC25A23_ENST00000334510.5_Missense_Mutation_p.L359P	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	359					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CCAGTTCTTCAGAGTCTGGAG	0.607																																					p.L359P		.											.	SLC25A23-92	0			c.T1076C						.						39.0	40.0	39.0					19																	6444308		2203	4300	6503	SO:0001583	missense	79085	exon9			TTCTTCAGAGTCT	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.1076T>C	19.37:g.6444308A>G	ENSP00000301454:p.Leu359Pro	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_024103	0	0	0	0	0	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.314992	0.81358	.	.	ENSG00000125648	ENST00000264088;ENST00000422102;ENST00000301454;ENST00000414491;ENST00000334510	T;T;T;T	0.80994	-1.44;-1.44;-1.34;-1.44	4.93	4.93	0.64822	Mitochondrial carrier domain (2);	0.000000	0.64402	D	0.000010	D	0.92971	0.7763	H	0.97440	4.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	D	0.95055	0.8190	10	0.87932	D	0	-15.6387	13.5424	0.61681	1.0:0.0:0.0:0.0	.	120;359	E7ESZ5;Q9BV35	.;SCMC3_HUMAN	P	406;60;359;120;359	ENSP00000264088:L406P;ENSP00000301454:L359P;ENSP00000408814:L120P;ENSP00000334537:L359P	ENSP00000264088:L406P	L	-	2	0	SLC25A23	6395308	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.848000	0.92172	1.852000	0.53769	0.379000	0.24179	CTG	.		0.607	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
ZNF136	7695	broad.mit.edu;ucsc.edu	37	19	12297631	12297631	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:12297631G>T	ENST00000343979.4	+	4	578	c.438G>T	c.(436-438)tgG>tgT	p.W146C	ZNF136_ENST00000398616.2_Missense_Mutation_p.W80C	NM_003437.3	NP_003428.1	P52737	ZN136_HUMAN	zinc finger protein 136	146					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|biliary_tract(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	18						ACCAGTGTTGGAAACCCTTCA	0.408																																					p.W146C													.	ZNF136-92	0			c.G438T						.						115.0	101.0	106.0					19																	12297631		2203	4300	6503	SO:0001583	missense	7695	exon4			GTGTTGGAAACCC	U09367	CCDS32916.1	19p13.2	2013-01-08	2006-06-13		ENSG00000196646	ENSG00000196646		"""Zinc fingers, C2H2-type"", ""-"""	12920	protein-coding gene	gene with protein product		604078	"""zinc finger protein 136 (clone pHZ-20)"""			7557990	Standard	NM_003437		Approved	pHZ-20	uc002mti.3	P52737	OTTHUMG00000156429	ENST00000343979.4:c.438G>T	19.37:g.12297631G>T	ENSP00000344162:p.Trp146Cys	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	15	5	NM_003437	0	0	2	7	5		Missense_Mutation	SNP	ENST00000343979.4	37	CCDS32916.1	.	.	.	.	.	.	.	.	.	.	G	8.925	0.961999	0.18583	.	.	ENSG00000196646	ENST00000439995;ENST00000343979;ENST00000398616	T;T;T	0.06449	3.8;3.41;3.3	1.41	-2.82	0.05787	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02727	0.0082	N	0.05124	-0.11	0.09310	N	1	D	0.53462	0.96	B	0.43728	0.429	T	0.28870	-1.0030	8	.	.	.	.	3.1392	0.06450	0.3723:0.0:0.3444:0.2832	.	146	P52737	ZN136_HUMAN	C	80;146;80	ENSP00000388759:W80C;ENSP00000344162:W146C;ENSP00000381617:W80C	.	W	+	3	0	ZNF136	12158631	0.165000	0.22948	0.000000	0.03702	0.050000	0.14768	-0.202000	0.09451	-1.474000	0.01879	-0.140000	0.14226	TGG	.		0.408	ZNF136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344151.2	NM_003437	
SLC1A6	6511	broad.mit.edu	37	19	15067457	15067457	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:15067457C>T	ENST00000221742.3	-	6	1007	c.1000G>A	c.(1000-1002)Gtc>Atc	p.V334I	SLC1A6_ENST00000600144.1_Intron|SLC1A6_ENST00000430939.2_Missense_Mutation_p.V270I	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	334					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.V334I(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CCCCCCAGGACGGCCATGTCT	0.582																																					p.V334I													.	SLC1A6-186	1	Substitution - Missense(1)	pancreas(1)	c.G1000A						.						130.0	114.0	120.0					19																	15067457		2203	4300	6503	SO:0001583	missense	6511	exon6			CCAGGACGGCCAT		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1000G>A	19.37:g.15067457C>T	ENSP00000221742:p.Val334Ile	Somatic	206	0		WXS	Illumina HiSeq	Phase_I	142	4	NM_005071	0	0	0	0	0	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	c	10.37	1.332150	0.24167	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	T;T	0.58940	0.3;0.34	3.99	3.99	0.46301	.	0.353602	0.29159	N	0.012978	T	0.52773	0.1755	L	0.39020	1.185	0.34985	D	0.754498	P;B	0.45957	0.869;0.041	P;B	0.45913	0.497;0.028	T	0.67051	-0.5768	10	0.51188	T	0.08	-23.2893	13.9426	0.64064	0.0:1.0:0.0:0.0	.	270;334	E7EV13;P48664	.;EAA4_HUMAN	I	270;334	ENSP00000409386:V270I;ENSP00000221742:V334I	ENSP00000221742:V334I	V	-	1	0	SLC1A6	14928457	0.934000	0.31675	0.408000	0.26446	0.839000	0.47603	1.813000	0.38962	2.238000	0.73509	0.609000	0.83330	GTC	.		0.582	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
CASP14	23581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15164633	15164633	+	Silent	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:15164633C>T	ENST00000427043.3	+	4	575	c.267C>T	c.(265-267)caC>caT	p.H89H	CASP14_ENST00000221740.1_Silent_p.H89H|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	89					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						TCATGGCTCACGGGAGGGAAG	0.552																																					p.H89H		.											.	CASP14-230	0			c.C267T						.						95.0	83.0	87.0					19																	15164633		2203	4300	6503	SO:0001819	synonymous_variant	23581	exon4			GGCTCACGGGAGG		CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.267C>T	19.37:g.15164633C>T		Somatic	281	0		WXS	Illumina HiSeq	Phase_I	244	35	NM_012114	0	0	0	0	0	O95823|Q3SYC9	Silent	SNP	ENST00000427043.3	37	CCDS12323.1																																																																																			.		0.552	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	
NWD1	284434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16918705	16918705	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:16918705G>A	ENST00000552788.1	+	16	4045	c.4045G>A	c.(4045-4047)Gag>Aag	p.E1349K	NWD1_ENST00000339803.6_Missense_Mutation_p.E1214K|NWD1_ENST00000379808.3_Missense_Mutation_p.E1349K|NWD1_ENST00000549814.1_Missense_Mutation_p.E1307K|NWD1_ENST00000524140.2_Missense_Mutation_p.E1349K|NWD1_ENST00000523826.1_Missense_Mutation_p.E1143K			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1349							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCAGCTGCCCGAGACCCTCTC	0.567																																					p.E1349K		.											.	NWD1-7	0			c.G4045A						.						152.0	131.0	138.0					19																	16918705		2203	4300	6503	SO:0001583	missense	284434	exon18			CTGCCCGAGACCC	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4045G>A	19.37:g.16918705G>A	ENSP00000447224:p.Glu1349Lys	Somatic	475	0		WXS	Illumina HiSeq	Phase_I	404	153	NM_001007525	0	0	0	0	0	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	G	12.61	1.989439	0.35131	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.57907	0.45;0.44;0.45;0.37;0.43;0.44	4.95	3.91	0.45181	WD40 repeat-like-containing domain (1);	0.427481	0.20913	N	0.083440	T	0.24509	0.0594	L	0.27053	0.805	0.09310	N	1	P;B;B	0.45078	0.85;0.145;0.089	B;B;B	0.25140	0.058;0.039;0.017	T	0.14952	-1.0454	10	0.09843	T	0.71	-19.7004	6.6582	0.22998	0.1992:0.0:0.8008:0.0	.	1349;1349;1214	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	K	1214;1349;1307;1349;1143;1349;1214	ENSP00000428579:E1349K;ENSP00000447548:E1307K;ENSP00000369136:E1349K;ENSP00000428955:E1143K;ENSP00000447224:E1349K;ENSP00000340159:E1214K	ENSP00000340159:E1214K	E	+	1	0	NWD1	16779705	0.274000	0.24191	0.991000	0.47740	0.505000	0.33919	1.839000	0.39220	2.282000	0.76494	0.655000	0.94253	GAG	.		0.567	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
FCGBP	8857	hgsc.bcm.edu	37	19	40395978	40395978	+	Silent	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:40395978G>A	ENST00000221347.6	-	15	7426	c.7419C>T	c.(7417-7419)ggC>ggT	p.G2473G		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2473	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			ACACGCAGGTGCCCATGAAGT	0.657																																					p.G2473G		.											.	FCGBP-98	0			c.C7419T						.						110.0	88.0	96.0					19																	40395978		2180	3903	6083	SO:0001819	synonymous_variant	8857	exon15			GCAGGTGCCCATG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7419C>T	19.37:g.40395978G>A		Somatic	271	1		WXS	Illumina HiSeq	Phase_I	248	41	NM_003890	0	0	9	9	0	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.657	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF285	26974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44896570	44896570	+	Missense_Mutation	SNP	C	C	G	rs144077949	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:44896570C>G	ENST00000330997.4	-	3	140	c.76G>C	c.(76-78)Gat>Cat	p.D26H	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.D26H|CTC-512J12.4_ENST00000588655.1_RNA|ZNF285_ENST00000591679.1_Missense_Mutation_p.D33H	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	26	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TGGGCTTTATCCAATAGTGCC	0.453																																					p.D26H		.											.	ZNF285-94	0			c.G76C						.						149.0	132.0	138.0					19																	44896570		2203	4300	6503	SO:0001583	missense	26974	exon3			CTTTATCCAATAG	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.76G>C	19.37:g.44896570C>G	ENSP00000333595:p.Asp26His	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	74	33	NM_152354	0	0	1	1	0	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405340	0.62288	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T;T	0.06142	3.34;4.17	3.07	1.89	0.25635	Krueppel-associated box (4);	.	.	.	.	T	0.23054	0.0557	M	0.88310	2.945	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.984	T	0.09640	-1.0665	9	0.87932	D	0	.	3.2985	0.06974	0.2577:0.5999:0.0:0.1424	.	50;26	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	H	49;26	ENSP00000439431:D49H;ENSP00000333595:D26H	ENSP00000333595:D26H	D	-	1	0	ZNF285	49588410	0.829000	0.29322	0.154000	0.22540	0.897000	0.52465	1.205000	0.32308	1.738000	0.51689	0.449000	0.29647	GAT	C|0.997;T|0.003		0.453	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
EML2	24139	hgsc.bcm.edu	37	19	46142624	46142624	+	Missense_Mutation	SNP	A	A	C	rs201822741	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:46142624A>C	ENST00000245925.3	-	1	61	c.11T>G	c.(10-12)tTt>tGt	p.F4C	EML2_ENST00000536630.1_Intron|MIR330_ENST00000362196.1_RNA|EML2_ENST00000587152.1_Intron|EML2_ENST00000589876.1_Missense_Mutation_p.F4C|AC006132.1_ENST00000593161.1_5'Flank	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	4					negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CCCAGCTCCAAAGCTACTCAT	0.726													A|||	48	0.00958466	0.0325	0.0072	5008	,	,		12182	0.0		0.0	False		,,,				2504	0.0				p.F4C		.											.	EML2-154	0			c.T11G						.		,,CYS/PHE	90,4006		0,90,1958	15.0	17.0	16.0		,,11	4.6	1.0	19	dbSNP_134	16	1,8033		0,1,4016	yes	intron,intron,missense	EML2	NM_001193268.1,NM_001193269.1,NM_012155.2	,,205	0,91,5974	CC,CA,AA		0.0124,2.1973,0.7502	,,	,,4/650	46142624	91,12039	2048	4017	6065	SO:0001583	missense	24139	exon1			GCTCCAAAGCTAC	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.11T>G	19.37:g.46142624A>C	ENSP00000245925:p.Phe4Cys	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	11	4	NM_012155	0	0	0	1	1	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	CCDS12670.1	13	0.005952380952380952	8	0.016260162601626018	4	0.011049723756906077	0	0.0	1	0.0013192612137203166	A	14.61	2.585437	0.46110	0.021973	1.24E-4	ENSG00000125746	ENST00000245925	T	0.26067	1.76	4.58	4.58	0.56647	.	1.865290	0.03249	U	0.181627	T	0.26666	0.0652	L	0.29908	0.895	0.80722	D	1	D;B	0.76494	0.999;0.118	D;B	0.74674	0.984;0.053	T	0.03034	-1.1080	10	0.59425	D	0.04	44.314	10.2951	0.43618	1.0:0.0:0.0:0.0	.	4;4	B7Z918;O95834	.;EMAL2_HUMAN	C	4	ENSP00000245925:F4C	ENSP00000245925:F4C	F	-	2	0	EML2	50834464	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.633000	0.54295	1.932000	0.55993	0.454000	0.30748	TTT	A|0.994;C|0.006		0.726	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	
DHDH	27294	hgsc.bcm.edu;broad.mit.edu	37	19	49438360	49438360	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:49438360C>T	ENST00000221403.2	+	2	234	c.194C>T	c.(193-195)cCg>cTg	p.P65L	DHDH_ENST00000522614.1_Missense_Mutation_p.P65L|DHDH_ENST00000523250.1_Missense_Mutation_p.P65L	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	65					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GCCAAGGACCCGAGCGTGGGT	0.692																																					p.P65L		.											.	DHDH-90	0			c.C194T						.						23.0	18.0	20.0					19																	49438360		2196	4293	6489	SO:0001583	missense	27294	exon2			AGGACCCGAGCGT	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.194C>T	19.37:g.49438360C>T	ENSP00000221403:p.Pro65Leu	Somatic	30	1		WXS	Illumina HiSeq	Phase_I	10	6	NM_014475	0	0	0	0	0		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670182	0.88348	.	.	ENSG00000104808	ENST00000221403;ENST00000523250;ENST00000522614	T;T;T	0.26067	1.76;1.76;1.76	4.84	4.84	0.62591	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.106296	0.64402	D	0.000004	T	0.61652	0.2364	H	0.97240	3.965	0.80722	D	1	D	0.61697	0.99	P	0.57776	0.827	T	0.76567	-0.2912	10	0.72032	D	0.01	-28.9182	15.844	0.78874	0.0:1.0:0.0:0.0	.	65	Q9UQ10	DHDH_HUMAN	L	65	ENSP00000221403:P65L;ENSP00000428935:P65L;ENSP00000428672:P65L	ENSP00000221403:P65L	P	+	2	0	DHDH	54130172	1.000000	0.71417	0.967000	0.41034	0.785000	0.44390	6.706000	0.74649	2.678000	0.91216	0.455000	0.32223	CCG	.		0.692	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
ZNF665	79788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53669370	53669370	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr19:53669370C>G	ENST00000600412.1	-	2	293	c.178G>C	c.(178-180)Gct>Cct	p.A60P	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Missense_Mutation_p.A125P			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	60					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TCACGTTGAGCTCTTCTACCA	0.388																																					p.A125P		.											.	ZNF665-70	0			c.G373C						.						118.0	124.0	122.0					19																	53669370		2073	4226	6299	SO:0001583	missense	79788	exon4			GTTGAGCTCTTCT		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.178G>C	19.37:g.53669370C>G	ENSP00000469154:p.Ala60Pro	Somatic	271	0		WXS	Illumina HiSeq	Phase_I	196	64	NM_024733	0	0	0	1	1	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37		.	.	.	.	.	.	.	.	.	.	C	7.108	0.575466	0.13623	.	.	ENSG00000197497	ENST00000396424	T	0.08370	3.1	2.4	-0.298	0.12814	.	.	.	.	.	T	0.04588	0.0125	N	0.17082	0.46	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.44267	-0.9339	9	0.24483	T	0.36	.	6.4255	0.21768	0.1793:0.4658:0.3549:0.0	.	125	Q9H7R5-2	.	P	125	ENSP00000379702:A125P	ENSP00000379702:A125P	A	-	1	0	ZNF665	58361182	0.000000	0.05858	0.003000	0.11579	0.034000	0.12701	0.042000	0.13949	0.315000	0.23110	0.543000	0.68304	GCT	.		0.388	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
HADHA	3030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	26459821	26459821	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:26459821G>C	ENST00000380649.3	-	4	345	c.216C>G	c.(214-216)ttC>ttG	p.F72L	HADHA_ENST00000457468.2_Intron|HADHA_ENST00000461025.1_5'Flank	NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	72					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAACTTCTGAGAACTCTGAAT	0.403																																					p.F72L		.											.	HADHA-91	0			c.C216G						.						102.0	99.0	100.0					2																	26459821		2203	4300	6503	SO:0001583	missense	3030	exon4			TTCTGAGAACTCT	D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.216C>G	2.37:g.26459821G>C	ENSP00000370023:p.Phe72Leu	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	246	82	NM_000182	0	0	61	118	57	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000380649.3	37	CCDS1721.1	.	.	.	.	.	.	.	.	.	.	G	5.697	0.313101	0.10789	.	.	ENSG00000084754	ENST00000380649	T	0.57907	0.37	5.78	1.36	0.22044	Crotonase, core (1);	0.277100	0.45126	N	0.000390	T	0.26011	0.0634	N	0.12831	0.26	0.80722	D	1	B	0.02656	0.0	B	0.11329	0.006	T	0.07790	-1.0754	10	0.07990	T	0.79	-24.6945	7.1425	0.25564	0.2509:0.1413:0.6078:0.0	.	72	P40939	ECHA_HUMAN	L	72	ENSP00000370023:F72L	ENSP00000370023:F72L	F	-	3	2	HADHA	26313325	0.026000	0.19158	0.266000	0.24541	0.047000	0.14425	0.239000	0.18023	0.351000	0.24027	0.591000	0.81541	TTC	.		0.403	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214051.1	NM_000182	
GTF3C2	2976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27565920	27565920	+	Silent	SNP	G	G	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:27565920G>T	ENST00000359541.2	-	3	771	c.342C>A	c.(340-342)ccC>ccA	p.P114P	AC109828.1_ENST00000590383.1_RNA|AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000589853.1_RNA|GTF3C2_ENST00000264720.3_Silent_p.P114P			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	114					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAGGCTGTTGGGGCCTTTTGG	0.537																																					p.V114V		.											.	GTF3C2-92	0			c.T342A						.						94.0	89.0	91.0					2																	27565920		2203	4300	6503	SO:0001819	synonymous_variant	2976	exon4			CTGTTGGGGCCTT	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.342C>A	2.37:g.27565920G>T		Somatic	331	1		WXS	Illumina HiSeq	Phase_I	227	78	NM_001521	0	0	31	31	0	D6W557|Q16632|Q9BWI7	Silent	SNP	ENST00000359541.2	37	CCDS1749.1																																																																																			.		0.537	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
EML4	27436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	42488420	42488420	+	Silent	SNP	T	T	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:42488420T>C	ENST00000318522.5	+	4	760	c.498T>C	c.(496-498)gcT>gcC	p.A166A	EML4_ENST00000402711.2_Intron|EML4_ENST00000401738.3_Silent_p.A166A	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	166					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						GCAAGAATGCTACTCCCACCA	0.423			T	ALK	NSCLC																																p.A166A		.		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	.	EML4-3734	0			c.T498C						.						166.0	164.0	165.0					2																	42488420		2203	4300	6503	SO:0001819	synonymous_variant	27436	exon4			GAATGCTACTCCC	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.498T>C	2.37:g.42488420T>C		Somatic	165	1		WXS	Illumina HiSeq	Phase_I	115	31	NM_019063	0	0	0	0	0	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Silent	SNP	ENST00000318522.5	37	CCDS1807.1																																																																																			.		0.423	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063	
HAAO	23498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	42994588	42994588	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:42994588G>C	ENST00000294973.6	-	10	905	c.850C>G	c.(850-852)Ccc>Gcc	p.P284A		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						CACCCCAGGGGCTTCTTGCAG	0.617																																					p.P284A		.											.	HAAO-91	0			c.C850G						.						38.0	38.0	38.0					2																	42994588		2203	4300	6503	SO:0001583	missense	23498	exon10			CCAGGGGCTTCTT	Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.850C>G	2.37:g.42994588G>C	ENSP00000294973:p.Pro284Ala	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	67	11	NM_012205	0	0	27	43	16		Missense_Mutation	SNP	ENST00000294973.6	37	CCDS33187.1	.	.	.	.	.	.	.	.	.	.	g	10.57	1.385999	0.25031	.	.	ENSG00000162882	ENST00000294973	T	0.30182	1.54	4.83	1.94	0.25998	.	0.156970	0.42682	N	0.000678	T	0.24275	0.0588	L	0.55743	1.74	0.45791	D	0.998671	B	0.06786	0.001	B	0.01281	0.0	T	0.06320	-1.0833	10	0.44086	T	0.13	.	5.3274	0.15915	0.1974:0.1834:0.6193:0.0	.	284	P46952	3HAO_HUMAN	A	284	ENSP00000294973:P284A	ENSP00000294973:P284A	P	-	1	0	HAAO	42848092	0.924000	0.31332	0.996000	0.52242	0.700000	0.40528	1.053000	0.30442	0.449000	0.26747	0.550000	0.68814	CCC	.		0.617	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325948.2		
EDAR	10913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109527287	109527287	+	Silent	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:109527287C>T	ENST00000258443.2	-	8	1105	c.675G>A	c.(673-675)ccG>ccA	p.P225P	EDAR_ENST00000409271.1_Silent_p.P257P|EDAR_ENST00000376651.1_Silent_p.P257P	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	225					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						CGCTCTTCCCCGGGTGGCTGG	0.647																																					p.P225P		.											.	EDAR-92	0			c.G675A						.						59.0	58.0	58.0					2																	109527287		2203	4300	6503	SO:0001819	synonymous_variant	10913	exon8			CTTCCCCGGGTGG	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.675G>A	2.37:g.109527287C>T		Somatic	207	1		WXS	Illumina HiSeq	Phase_I	150	48	NM_022336	0	0	1	5	4	B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Silent	SNP	ENST00000258443.2	37	CCDS2081.1																																																																																			.		0.647	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253595.1		
BIN1	274	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	127818193	127818193	+	Intron	SNP	C	C	G	rs117721706	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:127818193C>G	ENST00000316724.5	-	11	1269				BIN1_ENST00000351659.3_Intron|BIN1_ENST00000352848.3_Missense_Mutation_p.R263P|BIN1_ENST00000409400.1_Intron|BIN1_ENST00000466111.1_Intron|BIN1_ENST00000393040.3_Intron|BIN1_ENST00000259238.4_Missense_Mutation_p.R263P|BIN1_ENST00000376113.2_Missense_Mutation_p.R263P|BIN1_ENST00000348750.4_Intron|BIN1_ENST00000346226.3_Intron|BIN1_ENST00000393041.3_Intron|BIN1_ENST00000357970.3_Intron	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1						cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TCTGCGCAGCCGCGAAAACAG	0.632																																					p.R263P		.											.	BIN1-655	0			c.G788C						.						120.0	112.0	114.0					2																	127818193		2203	4300	6503	SO:0001627	intron_variant	274	exon10			CGCAGCCGCGAAA	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.858-1462G>C	2.37:g.127818193C>G		Somatic	183	0		WXS	Illumina HiSeq	Phase_I	143	47	NM_139346	0	0	0	0	0	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Missense_Mutation	SNP	ENST00000316724.5	37	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387780	0.61956	.	.	ENSG00000136717	ENST00000376113;ENST00000259238;ENST00000352848	T;T;T	0.56611	0.45;0.47;0.53	4.72	4.72	0.59763	.	.	.	.	.	T	0.68559	0.3014	.	.	.	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.75484	0.986;0.986;0.986	T	0.66031	-0.6024	8	0.29301	T	0.29	.	14.976	0.71273	0.0:1.0:0.0:0.0	.	263;263;263	O00499-8;O00499-11;O00499-10	.;.;.	P	263	ENSP00000365281:R263P;ENSP00000259238:R263P;ENSP00000315284:R263P	ENSP00000259238:R263P	R	-	2	0	BIN1	127534663	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.415000	0.52700	2.337000	0.79520	0.561000	0.74099	CGG	C|0.992;T|0.008		0.632	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
ORC2	4999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	201790595	201790595	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:201790595C>A	ENST00000234296.2	-	13	1360	c.1111G>T	c.(1111-1113)Gat>Tat	p.D371Y	RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	371					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TCTAGCTGATCCAGTATACTG	0.348																																					p.D371Y		.											.	ORC2-209	0			c.G1111T						.						154.0	148.0	150.0					2																	201790595		2203	4300	6503	SO:0001583	missense	4999	exon13			GCTGATCCAGTAT		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1111G>T	2.37:g.201790595C>A	ENSP00000234296:p.Asp371Tyr	Somatic	213	1		WXS	Illumina HiSeq	Phase_I	218	79	NM_006190	0	0	3	3	0	Q13204|Q53TX5	Missense_Mutation	SNP	ENST00000234296.2	37	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273726	0.80580	.	.	ENSG00000115942	ENST00000234296	T	0.45276	0.9	5.34	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.68329	0.2989	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.75178	-0.3409	10	0.72032	D	0.01	-18.2187	14.1557	0.65417	0.0:0.9274:0.0:0.0726	.	371;371	B4DYU9;Q13416	.;ORC2_HUMAN	Y	371	ENSP00000234296:D371Y	ENSP00000234296:D371Y	D	-	1	0	ORC2	201498840	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	7.050000	0.76620	1.396000	0.46663	0.585000	0.79938	GAT	.		0.348	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
HELZ2	85441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62193087	62193087	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr20:62193087T>C	ENST00000467148.1	-	12	6772	c.6703A>G	c.(6703-6705)Aga>Gga	p.R2235G	HELZ2_ENST00000427522.2_Missense_Mutation_p.R1666G	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2235	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TCCATCCTTCTCAGGAGCAGT	0.667																																					p.R2235G		.											.	.	0			c.A6703G						.						28.0	28.0	28.0					20																	62193087		2195	4295	6490	SO:0001583	missense	85441	exon13			TCCTTCTCAGGAG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6703A>G	20.37:g.62193087T>C	ENSP00000417401:p.Arg2235Gly	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	63	23	NM_001037335	0	0	2	2	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	T	8.870	0.949007	0.18356	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.81821	-1.54;-1.54	2.96	1.78	0.24846	ATPase, AAA+ type, core (1);	1.202560	0.05584	N	0.573417	T	0.76772	0.4034	L	0.41124	1.26	0.29383	N	0.863141	B;B	0.29270	0.24;0.122	B;B	0.39027	0.288;0.19	T	0.68161	-0.5482	10	0.66056	D	0.02	-9.3242	4.3793	0.11286	0.0:0.1118:0.2045:0.6837	.	2235;1666	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	G	1666;2235	ENSP00000393257:R1666G;ENSP00000417401:R2235G	ENSP00000393257:R1666G	R	-	1	2	RP4-697K14.7	61663531	0.466000	0.25823	0.958000	0.39756	0.288000	0.27193	0.564000	0.23563	0.497000	0.27926	0.402000	0.26972	AGA	.		0.667	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
LSS	4047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47626684	47626684	+	Splice_Site	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr21:47626684T>G	ENST00000397728.3	-	16	1546		c.e16-2		LSS_ENST00000522411.1_Splice_Site|LSS_ENST00000457828.2_Splice_Site|LSS_ENST00000356396.4_Splice_Site	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)						cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					GTTCAGCAGCTGAAATCACAG	0.582																																					.	Pancreas(114;955 2313 34923 50507)	.											.	LSS-90	0			c.1468-2A>C						.						71.0	60.0	64.0					21																	47626684		2203	4300	6503	SO:0001630	splice_region_variant	4047	exon17			AGCAGCTGAAATC	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1468-2A>C	21.37:g.47626684T>G		Somatic	175	0		WXS	Illumina HiSeq	Phase_I	154	59	NM_001001438	0	0	0	3	3	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Splice_Site	SNP	ENST00000397728.3	37	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.674567	0.47781	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4665	0.75406	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LSS	46451112	1.000000	0.71417	0.974000	0.42286	0.221000	0.24807	7.752000	0.85141	2.206000	0.71126	0.533000	0.62120	.	.		0.582	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		Intron
ARSA	410	broad.mit.edu	37	22	51063617	51063617	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr22:51063617T>G	ENST00000547307.1	-	8	1885	c.1480A>C	c.(1480-1482)Acc>Ccc	p.T494P	ARSA_ENST00000610191.1_5'Flank|ARSA_ENST00000547805.1_Missense_Mutation_p.T494P|ARSA_ENST00000395621.3_Missense_Mutation_p.T496P|ARSA_ENST00000216124.5_Missense_Mutation_p.T496P|ARSA_ENST00000395619.3_Missense_Mutation_p.T496P|ARSA_ENST00000356098.5_Missense_Mutation_p.T496P|ARSA_ENST00000453344.2_Missense_Mutation_p.T410P			P15289	ARSA_HUMAN	arylsulfatase A	494					autophagy (GO:0006914)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum lumen (GO:0005788)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|cerebroside-sulfatase activity (GO:0004098)|sulfuric ester hydrolase activity (GO:0008484)			endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|skin(1)	9		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)|Suramin(DB04786)	GGGCGGGGGGTGCAGCCAGGA	0.692																																					p.T496P													.	ARSA-92	0			c.A1486C						.						10.0	12.0	11.0					22																	51063617		2187	4283	6470	SO:0001583	missense	410	exon9			GGGGGGTGCAGCC	X52150	CCDS14100.1, CCDS46736.1, CCDS14100.2	22q13.33	2013-09-19			ENSG00000100299	ENSG00000100299	3.1.6.8	"""Arylsulfatase family"""	713	protein-coding gene	gene with protein product	"""metachromatic leucodystrophy"""	607574				15772092	Standard	NM_000487		Approved		uc003bmz.5	P15289	OTTHUMG00000150180	ENST00000547307.1:c.1480A>C	22.37:g.51063617T>G	ENSP00000448440:p.Thr494Pro	Somatic	49	13		WXS	Illumina HiSeq	Phase_I	31	7	NM_001085426	0	0	79	84	5	B2RCA6|B7XD04|F8WCC8|Q6ICI5|Q96CJ0	Missense_Mutation	SNP	ENST00000547307.1	37		.	.	.	.	.	.	.	.	.	.	T	4.511	0.094745	0.08681	.	.	ENSG00000100299	ENST00000356098;ENST00000216124;ENST00000547307;ENST00000547805;ENST00000395621;ENST00000453344;ENST00000395619	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.14	2.81	0.32909	Alkaline-phosphatase-like, core domain (1);	0.521500	0.22127	N	0.064257	T	0.77772	0.4180	N	0.19112	0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.63550	-0.6612	10	0.30854	T	0.27	.	7.1636	0.25677	0.1435:0.0:0.1486:0.7079	.	494	P15289	ARSA_HUMAN	P	496;496;494;494;496;410;496	ENSP00000348406:T496P;ENSP00000216124:T496P;ENSP00000448440:T494P;ENSP00000448932:T494P;ENSP00000378983:T496P;ENSP00000412542:T410P;ENSP00000378981:T496P	ENSP00000216124:T496P	T	-	1	0	ARSA	49410483	0.258000	0.24033	0.134000	0.22075	0.008000	0.06430	1.796000	0.38794	0.876000	0.35872	0.260000	0.18958	ACC	.		0.692	ARSA-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000487	
TRNT1	51095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	3189651	3189651	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr3:3189651G>C	ENST00000251607.6	+	8	1220	c.1118G>C	c.(1117-1119)tGt>tCt	p.C373S	TRNT1_ENST00000280591.6_Missense_Mutation_p.C353S	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	373					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		GGAGAGCACTGTCTCCTAAAG	0.438																																					p.C373S		.											.	TRNT1-90	0			c.G1118C						.						118.0	110.0	113.0					3																	3189651		2203	4300	6503	SO:0001583	missense	51095	exon8			AGCACTGTCTCCT	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.1118G>C	3.37:g.3189651G>C	ENSP00000251607:p.Cys373Ser	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	20	8	NM_182916	0	0	14	20	6	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	ENST00000251607.6	37	CCDS2561.2	.	.	.	.	.	.	.	.	.	.	G	9.399	1.077394	0.20227	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.39229	1.09;1.11	5.24	2.0	0.26442	.	1.262890	0.05220	N	0.508422	T	0.22085	0.0532	N	0.08118	0	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19910	-1.0291	10	0.17832	T	0.49	-3.7877	5.7122	0.17941	0.1687:0.3466:0.4847:0.0	.	353;373	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	S	373;353	ENSP00000251607:C373S;ENSP00000280591:C353S	ENSP00000251607:C373S	C	+	2	0	TRNT1	3164651	0.026000	0.19158	0.010000	0.14722	0.971000	0.66376	2.269000	0.43346	1.168000	0.42723	0.655000	0.94253	TGT	.		0.438	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
OSBPL10	114884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	31774841	31774841	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr3:31774841G>A	ENST00000396556.2	-	6	1125	c.1003C>T	c.(1003-1005)Ctt>Ttt	p.L335F	OSBPL10_ENST00000438237.2_Missense_Mutation_p.L271F|OSBPL10_ENST00000467647.1_5'UTR	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	335					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		AAAGAGCCAAGTGTCCCATTT	0.473																																					p.L335F		.											.	OSBPL10-69	0			c.C1003T						.						166.0	156.0	159.0					3																	31774841		2203	4300	6503	SO:0001583	missense	114884	exon6			AGCCAAGTGTCCC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1003C>T	3.37:g.31774841G>A	ENSP00000379804:p.Leu335Phe	Somatic	318	0		WXS	Illumina HiSeq	Phase_I	285	80	NM_017784	0	0	5	16	11	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.285363	0.40394	.	.	ENSG00000144645	ENST00000396556;ENST00000438237;ENST00000428241	T;T;T	0.52983	1.87;2.22;0.64	5.66	2.21	0.28008	.	0.326770	0.33075	N	0.005319	T	0.41328	0.1154	M	0.68952	2.095	0.45076	D	0.998091	B;B;B	0.19445	0.036;0.005;0.001	B;B;B	0.15870	0.014;0.005;0.005	T	0.30621	-0.9972	10	0.52906	T	0.07	-1.9596	6.3688	0.21469	0.2078:0.138:0.6542:0.0	.	271;335;103	B4E212;Q9BXB5;Q59ED9	.;OSB10_HUMAN;.	F	335;271;143	ENSP00000379804:L335F;ENSP00000406124:L271F;ENSP00000399200:L143F	ENSP00000379804:L335F	L	-	1	0	OSBPL10	31749845	0.602000	0.26916	0.675000	0.29917	0.982000	0.71751	0.776000	0.26704	0.470000	0.27294	0.555000	0.69702	CTT	.		0.473	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142274792	142274792	+	Silent	SNP	A	A	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr3:142274792A>T	ENST00000350721.4	-	10	2389	c.2268T>A	c.(2266-2268)tcT>tcA	p.S756S	ATR_ENST00000383101.3_Silent_p.S692S	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	756					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTTTTAGTTGAGAAGATGAAC	0.368								Other conserved DNA damage response genes																													p.S756S		.											.	ATR-1139	0			c.T2268A						.						118.0	119.0	119.0					3																	142274792		2203	4300	6503	SO:0001819	synonymous_variant	545	exon10			TAGTTGAGAAGAT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2268T>A	3.37:g.142274792A>T		Somatic	178	0		WXS	Illumina HiSeq	Phase_I	128	42	NM_001184	0	0	2	2	0	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			.		0.368	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
CRYGS	1427	broad.mit.edu	37	3	186256498	186256498	+	Missense_Mutation	SNP	C	C	T	rs201717880		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr3:186256498C>T	ENST00000392499.2	-	4	863	c.524G>A	c.(523-525)cGc>cAc	p.R175H	CRYGS_ENST00000307944.5_Missense_Mutation_p.R175H	NM_017541.2	NP_060011.1	P22914	CRBS_HUMAN	crystallin, gamma S	175	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|morphogenesis of an epithelium (GO:0002009)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	11	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		CTCCACAATGCGGCGGAAAGA	0.547																																					p.R175H													.	CRYGS-90	0			c.G524A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	67.0	64.0	65.0		524	5.8	1.0	3		65	0,8600		0,0,4300	no	missense	CRYGS	NM_017541.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	175/179	186256498	1,13005	2203	4300	6503	SO:0001583	missense	1427	exon3			ACAATGCGGCGGA		CCDS3275.1	3q27.3	2013-02-14			ENSG00000213139	ENSG00000213139			2417	protein-coding gene	gene with protein product	"""crystallin, gamma 8"""	123730		CRYG8			Standard	NM_017541		Approved		uc003fqe.3	P22914	OTTHUMG00000156615	ENST00000392499.2:c.524G>A	3.37:g.186256498C>T	ENSP00000376287:p.Arg175His	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	217	4	NM_017541	0	0	6	6	0	B2RAF8	Missense_Mutation	SNP	ENST00000392499.2	37	CCDS3275.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913335	0.92178	2.27E-4	0.0	ENSG00000213139	ENST00000392499;ENST00000307944	T;T	0.78364	-1.17;-1.17	5.76	5.76	0.90799	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.081544	0.49916	U	0.000130	D	0.88948	0.6576	M	0.88775	2.98	0.52099	D	0.999945	D	0.63880	0.993	D	0.64144	0.922	D	0.90435	0.4427	10	0.72032	D	0.01	.	15.4519	0.75279	0.0:1.0:0.0:0.0	.	175	P22914	CRBS_HUMAN	H	175	ENSP00000376287:R175H;ENSP00000312099:R175H	ENSP00000312099:R175H	R	-	2	0	CRYGS	187739192	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.626000	0.67777	2.721000	0.93114	0.563000	0.77884	CGC	C|0.999;T|0.001		0.547	CRYGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344784.1	NM_017541	
SLC26A1	10861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	985220	985220	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:985220G>A	ENST00000361661.2	-	3	649	c.272C>T	c.(271-273)tCa>tTa	p.S91L	IDUA_ENST00000247933.4_Intron|SLC26A1_ENST00000398516.2_Missense_Mutation_p.S91L|IDUA_ENST00000453894.1_Intron|SLC26A1_ENST00000513138.1_5'Flank|SLC26A1_ENST00000398520.2_Missense_Mutation_p.S91L	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	91					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGCCAGCAATGAGTAGGCGAT	0.632																																					p.S91L		.											.	SLC26A1-91	0			c.C272T						.						105.0	99.0	101.0					4																	985220		2203	4300	6503	SO:0001583	missense	10861	exon2			AGCAATGAGTAGG	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.272C>T	4.37:g.985220G>A	ENSP00000354721:p.Ser91Leu	Somatic	257	0		WXS	Illumina HiSeq	Phase_I	228	82	NM_022042	0	0	0	0	0	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000361661.2	37	CCDS33934.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559905	0.65538	.	.	ENSG00000145217	ENST00000398520;ENST00000361661;ENST00000398516	D;D;D	0.92495	-3.05;-3.05;-3.05	5.18	5.18	0.71444	.	0.226096	0.46758	D	0.000276	D	0.96993	0.9018	M	0.93763	3.455	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.72338	0.977;0.969	D	0.98001	1.0360	10	0.87932	D	0	.	16.1549	0.81657	0.0:0.0:1.0:0.0	.	91;91	Q9H2B4;Q96BK0	S26A1_HUMAN;.	L	91	ENSP00000381532:S91L;ENSP00000354721:S91L;ENSP00000381528:S91L	ENSP00000354721:S91L	S	-	2	0	SLC26A1	975220	0.998000	0.40836	0.985000	0.45067	0.336000	0.28762	2.673000	0.46858	2.402000	0.81655	0.313000	0.20887	TCA	.		0.632	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
ACOX3	8310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	8417674	8417674	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:8417674C>T	ENST00000356406.5	-	3	274	c.197G>A	c.(196-198)gGa>gAa	p.G66E	ACOX3_ENST00000413009.2_Missense_Mutation_p.G66E|ACOX3_ENST00000503233.1_Missense_Mutation_p.G66E	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	66					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						CAGATCGGCTCCAGGGGAACG	0.483																																					p.G66E		.											.	ACOX3-90	0			c.G197A						.						71.0	67.0	68.0					4																	8417674		2203	4300	6503	SO:0001583	missense	8310	exon3			TCGGCTCCAGGGG	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.197G>A	4.37:g.8417674C>T	ENSP00000348775:p.Gly66Glu	Somatic	231	0		WXS	Illumina HiSeq	Phase_I	197	74	NM_001101667	0	0	3	7	4	Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	37	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	C	9.453	1.091143	0.20471	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233	T;T;T	0.41758	0.99;0.99;0.99	5.39	-0.535	0.11879	Acyl-CoA dehydrogenase/oxidase (1);	0.611319	0.16430	N	0.214753	T	0.21509	0.0518	L	0.31664	0.95	0.38700	D	0.952962	B;B	0.16166	0.016;0.01	B;B	0.17433	0.018;0.005	T	0.33007	-0.9885	10	0.02654	T	1	-6.3195	6.2369	0.20768	0.0:0.5193:0.1203:0.3604	.	66;66	O15254-2;O15254	.;ACOX3_HUMAN	E	66	ENSP00000413994:G66E;ENSP00000348775:G66E;ENSP00000421625:G66E	ENSP00000348775:G66E	G	-	2	0	ACOX3	8468574	0.730000	0.28100	0.000000	0.03702	0.001000	0.01503	1.878000	0.39608	-0.212000	0.10109	-0.145000	0.13849	GGA	.		0.483	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4		
GPR125	166647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	22390249	22390249	+	Missense_Mutation	SNP	C	C	G	rs76872619	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:22390249C>G	ENST00000334304.5	-	19	3314	c.3045G>C	c.(3043-3045)ttG>ttC	p.L1015F	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1015					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				AAGAAACAGCCAAAGCCCCAA	0.443																																					p.L1015F		.											.	GPR125-91	0			c.G3045C						.						99.0	100.0	99.0					4																	22390249		2203	4300	6503	SO:0001583	missense	166647	exon19			AACAGCCAAAGCC	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3045G>C	4.37:g.22390249C>G	ENSP00000334952:p.Leu1015Phe	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	144	57	NM_145290	0	0	68	125	57	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184403	0.38609	.	.	ENSG00000152990	ENST00000334304	T	0.57107	0.42	5.94	5.94	0.96194	GPCR, family 2-like (1);	0.113047	0.64402	D	0.000011	T	0.52256	0.1723	L	0.58428	1.81	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.22753	0.041;0.007	T	0.43972	-0.9358	10	0.40728	T	0.16	-0.1446	15.9022	0.79387	0.1359:0.8641:0.0:0.0	.	872;1015	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	F	1015	ENSP00000334952:L1015F	ENSP00000334952:L1015F	L	-	3	2	GPR125	21999347	1.000000	0.71417	0.987000	0.45799	0.924000	0.55760	3.534000	0.53568	2.807000	0.96579	0.650000	0.86243	TTG	C|1.000;T|0.000		0.443	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
AASDH	132949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57248668	57248668	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:57248668A>T	ENST00000205214.6	-	3	506	c.326T>A	c.(325-327)aTc>aAc	p.I109N	AASDH_ENST00000434343.2_5'UTR|AASDH_ENST00000513376.1_Missense_Mutation_p.I9N|AASDH_ENST00000602986.1_Intron|AASDH_ENST00000451613.1_Missense_Mutation_p.I109N|AASDH_ENST00000502617.1_Missense_Mutation_p.I109N|AASDH_ENST00000510762.1_Intron	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	109					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TTCAACAAGGATATACTTTAG	0.323																																					p.I109N		.											.	AASDH-94	0			c.T326A						.						47.0	48.0	48.0					4																	57248668		2203	4300	6503	SO:0001583	missense	132949	exon3			ACAAGGATATACT	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.326T>A	4.37:g.57248668A>T	ENSP00000205214:p.Ile109Asn	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	45	16	NM_181806	0	0	1	1	0	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	37	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611899	0.87258	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000451613;ENST00000502617	T;T;T;T	0.66638	0.83;-0.22;0.83;0.83	5.88	5.88	0.94601	AMP-dependent synthetase/ligase (1);	0.289492	0.43919	D	0.000514	T	0.81093	0.4751	M	0.78049	2.395	0.25673	N	0.985874	D;D;D;D	0.65815	0.989;0.991;0.995;0.991	P;D;P;P	0.63957	0.87;0.92;0.902;0.873	T	0.76408	-0.2970	10	0.87932	D	0	-4.2072	15.9439	0.79779	1.0:0.0:0.0:0.0	.	109;109;109;109	Q4L235-4;B4E2K0;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	N	109;9;109;109	ENSP00000205214:I109N;ENSP00000423760:I9N;ENSP00000409656:I109N;ENSP00000421171:I109N	ENSP00000205214:I109N	I	-	2	0	AASDH	56943425	1.000000	0.71417	0.864000	0.33941	0.979000	0.70002	6.594000	0.74104	2.250000	0.74265	0.533000	0.62120	ATC	.		0.323	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
ABCG2	9429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89039327	89039327	+	Silent	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:89039327A>G	ENST00000237612.3	-	7	1320	c.775T>C	c.(775-777)Ttg>Ctg	p.L259L	ABCG2_ENST00000515655.1_Silent_p.L259L	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	259	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	CCTGAGGCCAATAAGGTGAGG	0.433																																					p.L259L		.											.	ABCG2-90	0			c.T775C						.						127.0	115.0	119.0					4																	89039327		2203	4300	6503	SO:0001819	synonymous_variant	9429	exon7			AGGCCAATAAGGT	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.775T>C	4.37:g.89039327A>G		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	86	32	NM_004827	0	0	3	3	0	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Silent	SNP	ENST00000237612.3	37	CCDS3628.1																																																																																			.		0.433	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
NDST4	64579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	115767018	115767018	+	Silent	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:115767018G>A	ENST00000264363.2	-	10	2754	c.2076C>T	c.(2074-2076)atC>atT	p.I692I		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	692	Heparan sulfate N-sulfotransferase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GGTCAATGAGGATGGTGATGA	0.433																																					p.I692I		.											.	NDST4-94	0			c.C2076T						.						135.0	126.0	129.0					4																	115767018		2203	4300	6503	SO:0001819	synonymous_variant	64579	exon10			AATGAGGATGGTG	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.2076C>T	4.37:g.115767018G>A		Somatic	135	0		WXS	Illumina HiSeq	Phase_I	128	51	NM_022569	0	0	0	0	0	Q2KHM8	Silent	SNP	ENST00000264363.2	37	CCDS3706.1																																																																																			.		0.433	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
ASB5	140458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	177136796	177136796	+	Silent	SNP	T	T	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:177136796T>C	ENST00000296525.3	-	7	1058	c.945A>G	c.(943-945)caA>caG	p.Q315Q	ASB5_ENST00000512254.1_Silent_p.Q262Q	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	315	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		GCAGCTGGAGTTGTGGGATAA	0.368																																					p.Q315Q		.											.	ASB5-228	0			c.A945G						.						119.0	109.0	113.0					4																	177136796		2203	4300	6503	SO:0001819	synonymous_variant	140458	exon7			CTGGAGTTGTGGG	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.945A>G	4.37:g.177136796T>C		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	56	16	NM_080874	0	0	0	0	0	Q8N7B5	Silent	SNP	ENST00000296525.3	37	CCDS3827.1																																																																																			.		0.368	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1		
FAM149A	25854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	187077186	187077186	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr4:187077186A>G	ENST00000356371.5	+	7	1289	c.1289A>G	c.(1288-1290)cAg>cGg	p.Q430R	FAM149A_ENST00000502970.1_Missense_Mutation_p.Q139R|FAM149A_ENST00000389354.5_Missense_Mutation_p.Q139R|FAM149A_ENST00000514829.1_3'UTR|FAM149A_ENST00000514153.1_Missense_Mutation_p.Q139R|FAM149A_ENST00000503432.1_Missense_Mutation_p.Q139R|FAM149A_ENST00000227065.4_Missense_Mutation_p.Q139R			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	430										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		AAACCAGCTCAGCCCGGTAGG	0.433																																					p.Q139R		.											.	FAM149A-90	0			c.A416G						.						103.0	96.0	98.0					4																	187077186		2203	4300	6503	SO:0001583	missense	25854	exon6			CAGCTCAGCCCGG	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1289A>G	4.37:g.187077186A>G	ENSP00000348732:p.Gln430Arg	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	114	41	NM_001006655	0	0	50	89	39	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	ENST00000356371.5	37		.	.	.	.	.	.	.	.	.	.	A	8.579	0.881917	0.17467	.	.	ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	T;T;T;T;T;T	0.11169	2.81;2.8;2.81;2.81;2.81;2.81	5.46	-10.9	0.00192	.	1.583490	0.03252	N	0.182041	T	0.03263	0.0095	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.08055	0.002;0.003;0.001	T	0.34004	-0.9846	10	0.12766	T	0.61	0.1667	2.1131	0.03708	0.3:0.2092:0.3344:0.1565	.	430;430;139	A5PLN7-3;A5PLN7;B4DHZ9	.;F149A_HUMAN;.	R	139;430;139;139;139;139	ENSP00000426835:Q139R;ENSP00000348732:Q430R;ENSP00000227065:Q139R;ENSP00000427155:Q139R;ENSP00000424380:Q139R;ENSP00000374005:Q139R	ENSP00000227065:Q139R	Q	+	2	0	FAM149A	187314180	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.206000	0.03011	-1.534000	0.01743	-0.343000	0.07986	CAG	.		0.433	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
LIFR	3977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	38504185	38504185	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:38504185T>C	ENST00000263409.4	-	10	1492	c.1330A>G	c.(1330-1332)Att>Gtt	p.I444V	LIFR_ENST00000453190.2_Missense_Mutation_p.I444V|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	444	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					GTTGAATTAATATCCTTCACT	0.269			T	PLAG1	salivary adenoma																																p.I444V	Melanoma(13;4 730 6426 9861 34751)	.		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	LIFR-1173	0			c.A1330G						.						54.0	59.0	58.0					5																	38504185		2201	4295	6496	SO:0001583	missense	3977	exon10			AATTAATATCCTT	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1330A>G	5.37:g.38504185T>C	ENSP00000263409:p.Ile444Val	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	57	18	NM_002310	0	0	0	0	0	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	T	3.712	-0.059335	0.07317	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.56103	0.48;0.48	5.65	-2.44	0.06502	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.807977	0.11218	N	0.587055	T	0.34164	0.0888	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30534	-0.9975	10	0.11794	T	0.64	-5.8891	11.1796	0.48620	0.0:0.4564:0.0:0.5436	.	444	P42702	LIFR_HUMAN	V	444	ENSP00000263409:I444V;ENSP00000398368:I444V	ENSP00000263409:I444V	I	-	1	0	LIFR	38539942	0.638000	0.27225	0.525000	0.27900	0.996000	0.88848	0.083000	0.14871	-0.426000	0.07360	0.528000	0.53228	ATT	.		0.269	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
RICTOR	253260	broad.mit.edu	37	5	38953603	38953603	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:38953603C>G	ENST00000357387.3	-	28	2780	c.2750G>C	c.(2749-2751)tGg>tCg	p.W917S	RICTOR_ENST00000296782.5_Missense_Mutation_p.W917S|RICTOR_ENST00000503698.1_5'Flank	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.W917L(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AATTTCTTCCCACTTATCCAA	0.284																																					p.W917S													.	RICTOR-849	1	Substitution - Missense(1)	lung(1)	c.G2750C						.						108.0	118.0	115.0					5																	38953603		2201	4292	6493	SO:0001583	missense	253260	exon28			TCTTCCCACTTAT		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2750G>C	5.37:g.38953603C>G	ENSP00000349959:p.Trp917Ser	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	14	3	NM_152756	0	0	3	4	1		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144587	0.37825	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.62105	0.05;0.05	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71221	0.3314	L	0.39633	1.23	0.80722	D	1	B;D	0.76494	0.019;0.999	B;D	0.83275	0.06;0.996	T	0.73132	-0.4079	10	0.87932	D	0	-6.6249	13.2617	0.60108	0.0:0.9169:0.0:0.0831	.	917;917	Q6R327;Q6R327-3	RICTR_HUMAN;.	S	917	ENSP00000349959:W917S;ENSP00000296782:W917S	ENSP00000296782:W917S	W	-	2	0	RICTOR	38989360	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.058000	0.57463	2.668000	0.90789	0.591000	0.81541	TGG	.		0.284	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
C5orf34	375444	ucsc.edu	37	5	43490825	43490825	+	Silent	SNP	C	C	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:43490825C>A	ENST00000306862.2	-	11	1962	c.1587G>T	c.(1585-1587)gtG>gtT	p.V529V	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	529										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					TTACTGTTGTCACATATCTAA	0.318																																					p.V529V													.	C5orf34-153	0			c.G1587T						.						77.0	73.0	75.0					5																	43490825		2203	4300	6503	SO:0001819	synonymous_variant	375444	exon11			TGTTGTCACATAT	AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.1587G>T	5.37:g.43490825C>A		Somatic	41	0		WXS	Illumina HiSeq		35	4	NM_198566	0	0	0	0	0		Silent	SNP	ENST00000306862.2	37	CCDS3946.1																																																																																			.		0.318	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253843.1	NM_198566	
PCDHGA4	56111	hgsc.bcm.edu	37	5	140735218	140735218	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:140735218A>G	ENST00000571252.1	+	1	451	c.451A>G	c.(451-453)Aga>Gga	p.R151G	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	151	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGGGGCAAGATTTCCTCT	0.453																																					p.R151G		.											.	.	0			c.A451G						.						68.0	70.0	70.0					5																	140735218		1883	4114	5997	SO:0001583	missense	56111	exon1			GGGGCAAGATTTC	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.451A>G	5.37:g.140735218A>G	ENSP00000458570:p.Arg151Gly	Somatic	110	2		WXS	Illumina HiSeq	Phase_I	79	22	NM_018917	0	0	0	0	0	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.453	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
SLC36A3	285641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150660717	150660717	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:150660717G>T	ENST00000335230.3	-	9	1413	c.1002C>A	c.(1000-1002)taC>taA	p.Y334*	SLC36A3_ENST00000377713.3_Nonsense_Mutation_p.Y375*	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	334						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCCGATAGAGTACATCAGCT	0.522																																					p.Y375X		.											.	SLC36A3-93	0			c.C1125A						.						222.0	171.0	188.0					5																	150660717		2203	4300	6503	SO:0001587	stop_gained	285641	exon10			GATAGAGTACATC	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1002C>A	5.37:g.150660717G>T	ENSP00000334750:p.Tyr334*	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	198	75	NM_001145017	0	0	0	0	0	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Nonsense_Mutation	SNP	ENST00000335230.3	37	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	G	39	7.569738	0.98365	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	.	.	.	4.06	1.12	0.20585	.	0.196500	0.45361	D	0.000367	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.071	7.6369	0.28272	0.4739:0.0:0.5261:0.0	.	.	.	.	X	334;375	.	ENSP00000334750:Y334X	Y	-	3	2	SLC36A3	150640910	1.000000	0.71417	0.967000	0.41034	0.964000	0.63967	1.720000	0.38022	0.092000	0.17331	0.561000	0.74099	TAC	.		0.522	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
RGS14	10636	hgsc.bcm.edu;broad.mit.edu	37	5	176797996	176797996	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:176797996G>T	ENST00000408923.3	+	11	1406	c.1218G>T	c.(1216-1218)aaG>aaT	p.K406N		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	406	Necessary for interaction with RABGEF1. {ECO:0000250}.|RBD 2. {ECO:0000255|PROSITE- ProRule:PRU00262}.				cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTGGAGAAGCACGGCTTGA	0.751																																					p.K406N	NSCLC(47;353 1896 28036)	.											.	RGS14-226	0			c.G1218T						.						10.0	12.0	11.0					5																	176797996		1750	3841	5591	SO:0001583	missense	10636	exon11			GGAGAAGCACGGC	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1218G>T	5.37:g.176797996G>T	ENSP00000386229:p.Lys406Asn	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	49	16	NM_006480	0	0	6	7	1	O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	ENST00000408923.3	37	CCDS43405.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.43|13.43	2.234827|2.234827	0.39498|0.39498	.|.	.|.	ENSG00000169220|ENSG00000169220	ENST00000408923;ENST00000336477|ENST00000511890	T|.	0.63417|.	-0.04|.	4.96|4.96	2.0|2.0	0.26442|0.26442	Raf-like Ras-binding (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61060|0.61060	0.2317|0.2317	M|M	0.71206|0.71206	2.165|2.165	0.42256|0.42256	D|D	0.991993|0.991993	D;D;D|.	0.89917|.	1.0;1.0;0.995|.	D;D;D|.	0.97110|.	1.0;0.999;0.951|.	T|T	0.57940|0.57940	-0.7724|-0.7724	10|5	0.87932|.	D|.	0|.	-28.6256|-28.6256	5.8726|5.8726	0.18812|0.18812	0.3015:0.0:0.5635:0.135|0.3015:0.0:0.5635:0.135	.|.	177;254;406|.	B3KUX0;O43566-5;O43566|.	.;.;RGS14_HUMAN|.	N|I	406;187|277	ENSP00000386229:K406N|.	ENSP00000336864:K187N|.	K|S	+|+	3|2	2|0	RGS14|RGS14	176730602|176730602	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.033000|0.033000	0.12548|0.12548	1.059000|1.059000	0.30517|0.30517	0.704000|0.704000	0.31869|0.31869	-0.225000|-0.225000	0.12378|0.12378	AAG|AGC	.		0.751	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
SQSTM1	8878	hgsc.bcm.edu	37	5	179248068	179248068	+	Silent	SNP	C	C	T	rs11548639		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:179248068C>T	ENST00000389805.4	+	1	310	c.132C>T	c.(130-132)tgC>tgT	p.C44C	SQSTM1_ENST00000376929.3_Intron|SQSTM1_ENST00000360718.5_5'Flank|SQSTM1_ENST00000510187.1_Silent_p.C44C|SQSTM1_ENST00000402874.3_5'UTR	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	44	Interaction with LCK.|Interaction with PRKCZ and dimerization. {ECO:0000250}.|OPR.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGGGACCCTGCGAGCGGCTGC	0.771																																					p.C44C		.											.	SQSTM1-92	0			c.C132T						.						3.0	4.0	3.0					5																	179248068		1580	3507	5087	SO:0001819	synonymous_variant	8878	exon1			ACCCTGCGAGCGG	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.132C>T	5.37:g.179248068C>T		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	15	7	NM_003900	0	0	12	20	8	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Silent	SNP	ENST00000389805.4	37	CCDS34317.1																																																																																			.		0.771	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1		
OR11A1	26531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	29395381	29395381	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr6:29395381T>G	ENST00000377149.1	-	5	510	c.38A>C	c.(37-39)gAa>gCa	p.E13A	OR11A1_ENST00000377148.1_Missense_Mutation_p.E13A|OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Missense_Mutation_p.E13A			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GAGGACAAATTCAGTAATAGT	0.398																																					p.E13A		.											.	OR11A1-23	0			c.A38C						.						67.0	65.0	66.0					6																	29395381		1509	2709	4218	SO:0001583	missense	26531	exon1			ACAAATTCAGTAA		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.38A>C	6.37:g.29395381T>G	ENSP00000366354:p.Glu13Ala	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	98	34	NM_013937	0	0	0	0	0	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	ENST00000377149.1	37	CCDS34363.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.118839	0.56505	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.01119	5.31;5.31;5.31	3.66	2.48	0.30137	.	0.000000	0.33290	U	0.005076	T	0.00998	0.0033	M	0.88512	2.96	0.09310	N	1	P	0.34977	0.478	B	0.38327	0.271	T	0.41928	-0.9481	10	0.54805	T	0.06	-0.4728	5.5487	0.17079	0.0:0.2499:0.0:0.7501	.	13	Q9GZK7	O11A1_HUMAN	A	13	ENSP00000366353:E13A;ENSP00000366354:E13A;ENSP00000366352:E13A	ENSP00000366352:E13A	E	-	2	0	OR11A1	29503360	0.004000	0.15560	0.093000	0.20910	0.716000	0.41182	0.571000	0.23669	0.465000	0.27167	0.327000	0.21459	GAA	.		0.398	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1		
PNPLA1	285848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	36269817	36269817	+	Missense_Mutation	SNP	G	G	A	rs182227800		TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr6:36269817G>A	ENST00000394571.2	+	6	955	c.955G>A	c.(955-957)Gat>Aat	p.D319N	PNPLA1_ENST00000388715.3_Missense_Mutation_p.D224N|PNPLA1_ENST00000312917.5_Missense_Mutation_p.D233N	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	319					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						TCCCAAAGGGGATGGAAGGGG	0.572											OREG0017382	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		19080	0.001		0.0	False		,,,				2504	0.0				p.D319N		.											.	PNPLA1-137	0			c.G955A						.						94.0	95.0	95.0					6																	36269817		2203	4300	6503	SO:0001583	missense	285848	exon6			AAAGGGGATGGAA		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.955G>A	6.37:g.36269817G>A	ENSP00000378072:p.Asp319Asn	Somatic	217	0	861	WXS	Illumina HiSeq	Phase_I	169	61	NM_001145717	0	0	0	0	0	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	37	CCDS54997.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.08	1.829459	0.32329	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.29917	1.82;1.82;1.55;1.55	5.54	2.28	0.28536	.	51.883400	0.00166	N	0.000000	T	0.07324	0.0185	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.002;0.005	B;B	0.10450	0.004;0.005	T	0.16424	-1.0403	10	0.30078	T	0.28	-1.3164	3.422	0.07397	0.26:0.2173:0.5227:0.0	.	319;233	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	N	224;233;320;319	ENSP00000373367:D224N;ENSP00000321116:D233N;ENSP00000391868:D320N;ENSP00000378072:D319N	ENSP00000321116:D233N	D	+	1	0	PNPLA1	36377795	0.000000	0.05858	0.001000	0.08648	0.112000	0.19704	0.380000	0.20602	0.680000	0.31366	0.650000	0.86243	GAT	G|0.999;A|0.000		0.572	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
SEPT7	989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	35912377	35912377	+	Splice_Site	SNP	G	G	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr7:35912377G>A	ENST00000435235.1	+	4	650		c.e4+1		SEPT7_ENST00000399035.3_Splice_Site|SEPT7_ENST00000494488.2_Splice_Site|SEPT7_ENST00000469679.2_Splice_Site|SEPT7_ENST00000475109.1_Splice_Site|SEPT7_ENST00000399034.2_Splice_Site|SEPT7_ENST00000350320.6_Splice_Site			Q16181	SEPT7_HUMAN	septin 7						cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						ATAGTAATTGGTAAGAAGGGT	0.388																																					.		.											.	.	0			c.374+1G>A						.						134.0	127.0	129.0					7																	35912377		1851	4091	5942	SO:0001630	splice_region_variant	989	exon4			TAATTGGTAAGAA	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.218+1G>A	7.37:g.35912377G>A		Somatic	34	0		WXS	Illumina HiSeq	Phase_I	35	13	NM_001011553	0	0	0	12	12	Q52M76|Q6NX50	Splice_Site	SNP	ENST00000435235.1	37		.	.	.	.	.	.	.	.	.	.	g	24.0	4.477060	0.84640	.	.	ENSG00000122545	ENST00000435235;ENST00000399034;ENST00000350320;ENST00000469679;ENST00000399035;ENST00000537785;ENST00000493670;ENST00000494488	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0851	0.89455	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEPT7	35878902	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.695000	0.98691	2.338000	0.79540	0.574000	0.79327	.	.		0.388	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	Intron
ZNF777	27153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149129443	149129443	+	Silent	SNP	C	C	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr7:149129443C>T	ENST00000247930.4	-	6	2243	c.1920G>A	c.(1918-1920)gaG>gaA	p.E640E		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	640					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TGCTGTCGCACTCGGGGCACT	0.652																																					p.E640E		.											.	ZNF777-136	0			c.G1920A						.						90.0	106.0	100.0					7																	149129443		2182	4272	6454	SO:0001819	synonymous_variant	27153	exon6			GTCGCACTCGGGG	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1920G>A	7.37:g.149129443C>T		Somatic	366	1		WXS	Illumina HiSeq	Phase_I	515	202	NM_015694	0	0	15	20	5	Q8N2R2|Q8N659	Silent	SNP	ENST00000247930.4	37	CCDS43675.1																																																																																			.		0.652	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
CA9	768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35674197	35674197	+	Nonsense_Mutation	SNP	G	G	T	rs201260414	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr9:35674197G>T	ENST00000378357.4	+	1	345	c.241G>T	c.(241-243)Gag>Tag	p.E81*	RN7SL22P_ENST00000471800.2_RNA	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	81	Proteoglycan-like (PG).				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.G79_P84delGEEDLP(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	ACCCGGAGAGGAGGATCTACC	0.557																																					p.E81X		.											.	CA9-95	1	Deletion - In frame(1)	urinary_tract(1)	c.G241T						.						56.0	54.0	55.0					9																	35674197		2203	4300	6503	SO:0001587	stop_gained	768	exon1			GGAGAGGAGGATC	X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.241G>T	9.37:g.35674197G>T	ENSP00000367608:p.Glu81*	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	84	23	NM_001216	0	0	1	1	0	Q5T4R1	Nonsense_Mutation	SNP	ENST00000378357.4	37	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325846	0.41197	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	.	.	.	1.05	1.05	0.20165	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	3.3335	0.07093	0.3182:0.0:0.6818:0.0	.	.	.	.	X	81	.	ENSP00000367608:E81X	E	+	1	0	CA9	35664197	0.004000	0.15560	0.010000	0.14722	0.014000	0.08584	1.197000	0.32211	0.121000	0.18284	0.123000	0.15791	GAG	.		0.557	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	
AGTPBP1	23287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	88201776	88201776	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr9:88201776T>A	ENST00000357081.3	-	22	3147	c.3003A>T	c.(3001-3003)caA>caT	p.Q1001H	AGTPBP1_ENST00000432218.1_Intron|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.Q961H|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.Q1013H			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1001					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CAGCCAAGTATTGCAACAGCC	0.388																																					p.Q961H		.											.	AGTPBP1-158	0			c.A2883T						.						135.0	122.0	126.0					9																	88201776		2203	4300	6503	SO:0001583	missense	23287	exon22			CAAGTATTGCAAC	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.3003A>T	9.37:g.88201776T>A	ENSP00000349592:p.Gln1001His	Somatic	163	1		WXS	Illumina HiSeq	Phase_I	110	38	NM_015239	0	0	10	16	6	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	37		.	.	.	.	.	.	.	.	.	.	T	15.79	2.937535	0.52972	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109	T;T;T	0.11604	2.76;2.76;2.76	5.24	-1.34	0.09143	Peptidase M14, carboxypeptidase A (1);	0.055490	0.64402	D	0.000001	T	0.18800	0.0451	L	0.44542	1.39	0.80722	D	1	P;D;P	0.89917	0.616;1.0;0.485	B;D;B	0.81914	0.236;0.995;0.43	T	0.00242	-1.1885	10	0.23891	T	0.37	-11.4782	11.3569	0.49621	0.0:0.4688:0.0:0.5312	.	1013;1001;961	Q9UPW5-3;Q9UPW5;Q9UPW5-2	.;CBPC1_HUMAN;.	H	1001;961;1013	ENSP00000349592:Q1001H;ENSP00000365251:Q961H;ENSP00000365277:Q1013H	ENSP00000349592:Q1001H	Q	-	3	2	AGTPBP1	87391596	0.850000	0.29656	0.595000	0.28798	0.714000	0.41099	0.041000	0.13927	-0.637000	0.05516	-0.242000	0.12053	CAA	.		0.388	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
LONRF3	79836	hgsc.bcm.edu	37	X	118109101	118109101	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chrX:118109101G>T	ENST00000371628.3	+	1	389	c.358G>T	c.(358-360)Gcg>Tcg	p.A120S	LONRF3_ENST00000422289.2_5'Flank|LONRF3_ENST00000304778.7_Missense_Mutation_p.A120S	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	120							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GCAAGGCGAGGCGCTGGCGCC	0.731																																					p.A120S		.											.	LONRF3-289	0			c.G358T						.						2.0	3.0	3.0					X																	118109101		1637	3395	5032	SO:0001583	missense	79836	exon1			GGCGAGGCGCTGG	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.358G>T	X.37:g.118109101G>T	ENSP00000360690:p.Ala120Ser	Somatic	7	0		WXS	Illumina HiSeq	Phase_I	8	7	NM_001031855	0	0	0	0	0	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	CCDS35374.1	.	.	.	.	.	.	.	.	.	.	G	3.593	-0.083174	0.07141	.	.	ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628	T;T;T	0.80738	-1.41;-1.41;-1.17	4.27	3.38	0.38709	.	1.631660	0.03606	N	0.234137	T	0.65544	0.2701	N	0.08118	0	0.80722	D	1	B;B	0.23249	0.082;0.062	B;B	0.24394	0.053;0.024	T	0.41052	-0.9530	10	0.09590	T	0.72	-3.3969	10.5187	0.44905	0.0:0.1987:0.8013:0.0	.	120;120	Q496Y0-2;Q496Y0	.;LONF3_HUMAN	S	120	ENSP00000360691:A120S;ENSP00000307732:A120S;ENSP00000360690:A120S	ENSP00000307732:A120S	A	+	1	0	LONRF3	117993129	0.999000	0.42202	0.063000	0.19743	0.011000	0.07611	1.162000	0.31786	0.786000	0.33708	0.529000	0.55759	GCG	.		0.731	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
ZMYM6	9204	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	35457962	35457962	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr1:35457962delT	ENST00000357182.4	-	15	2246	c.2019delA	c.(2017-2019)aaafs	p.K673fs	ZMYM6_ENST00000373340.2_Frame_Shift_Del_p.K673fs|ZMYM6_ENST00000487874.1_Frame_Shift_Del_p.K673fs|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	673					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				AAGATGGAAATTTCATAGCAT	0.383																																					p.K673fs		.											.	ZMYM6-93	0			c.2019delA						.						150.0	142.0	145.0					1																	35457962		2203	4300	6503	SO:0001589	frameshift_variant	9204	exon15			.	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.2019delA	1.37:g.35457962delT	ENSP00000349708:p.Lys673fs	Somatic	196	0		WXS	Illumina HiSeq	Phase_I	165	54	NM_007167	0	0	0	0	0	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Frame_Shift_Del	DEL	ENST00000357182.4	37	CCDS387.2																																																																																			.		0.383	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
A2ML1	144568	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	9006738	9006738	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr12:9006738delA	ENST00000299698.7	+	21	2785	c.2605delA	c.(2605-2607)actfs	p.T869fs	A2ML1_ENST00000539547.1_Frame_Shift_Del_p.T378fs	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CATTAACTTTACTATTAGTAC	0.468																																					p.T869fs		.											.	A2ML1-93	0			c.2605delA						.						55.0	56.0	56.0					12																	9006738		1864	4095	5959	SO:0001589	frameshift_variant	144568	exon21			.	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.2605delA	12.37:g.9006738delA	ENSP00000299698:p.Thr869fs	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	134	72	NM_144670	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000299698.7	37	CCDS8596.2																																																																																			.		0.468	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
ST20	400410	hgsc.bcm.edu;bcgsc.ca	37	15	80191469	80191474	+	Splice_Site	DEL	TATGAG	TATGAG	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	TATGAG	TATGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr15:80191469_80191474delTATGAG	ENST00000478497.1	-	3	725		c.e3-2		MTHFS_ENST00000258874.3_5'Flank|ST20_ENST00000562759.1_Splice_Site|ST20-MTHFS_ENST00000479961.1_Intron|ST20_ENST00000485386.1_Splice_Site|ST20-MTHFS_ENST00000494999.1_Intron|MTHFS_ENST00000559722.1_5'Flank	NM_001100879.1	NP_001094349.1	Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						GCCATTTTCCTATGAGAGAATAAATT	0.311																																					.		.											.	ST20-68	0			.						.																																			SO:0001630	splice_region_variant	400410	.			.	AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000478497.1:c.46-2CTCATA>-	15.37:g.80191469_80191474delTATGAG		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	38	11	.	0	0	0	0	0		Splice_Site	DEL	ENST00000478497.1	37	CCDS42067.1																																																																																			.		0.311	ST20-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416728.2		Intron
PTPRM	5797	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	7567846	7567846	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr18:7567846delT	ENST00000332175.8	+	1	1067	c.30delT	c.(28-30)actfs	p.T10fs	PTPRM_ENST00000400060.4_Frame_Shift_Del_p.T10fs|PTPRM_ENST00000580170.1_Frame_Shift_Del_p.T10fs	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	10					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GCCTGGCGACTTTGGCCGGAC	0.766																																					p.T10fs		.											.	PTPRM-228	0			c.30delT						.						56.0	56.0	56.0					18																	7567846		2203	4300	6503	SO:0001589	frameshift_variant	5797	exon1			.	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.30delT	18.37:g.7567846delT	ENSP00000331418:p.Thr10fs	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	129	46	NM_001105244	0	0	0	0	0	A7MBN1|D3DUH8|J3QL11	Frame_Shift_Del	DEL	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.766	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PTPRM	5797	hgsc.bcm.edu	37	18	7567846	7567847	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr18:7567846_7567847delTT	ENST00000332175.8	+	1	1067_1068	c.30_31delTT	c.(28-33)actttgfs	p.L11fs	PTPRM_ENST00000400060.4_Frame_Shift_Del_p.L11fs|PTPRM_ENST00000580170.1_Frame_Shift_Del_p.L11fs	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	11					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GCCTGGCGACTTTGGCCGGACT	0.767																																					p.10_11del		.											.	PTPRM-228	0			c.30_31del						.																																			SO:0001589	frameshift_variant	5797	exon1			.	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.30_31delTT	18.37:g.7567846_7567847delTT	ENSP00000331418:p.Leu11fs	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	129	21	NM_001105244	0	0	0	0	0	A7MBN1|D3DUH8|J3QL11	Frame_Shift_Del	DEL	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.767	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
ANTXR1	84168	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	69472576	69472579	+	Frame_Shift_Del	DEL	GCAC	GCAC	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	GCAC	GCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:69472576_69472579delGCAC	ENST00000303714.4	+	18	1976_1979	c.1654_1657delGCAC	c.(1654-1659)gcacctfs	p.AP552fs		NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	552	Pro-rich.				actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						tcccaacagggcacctcctccctc	0.647									Familial Infantile Hemangioma																												p.552_553del		.											.	ANTXR1-94	0			c.1654_1657del						.																																			SO:0001589	frameshift_variant	84168	exon18	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	.	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1654_1657delGCAC	2.37:g.69472576_69472579delGCAC	ENSP00000301945:p.Ala552fs	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	106	22	NM_032208	0	0	0	0	0	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Frame_Shift_Del	DEL	ENST00000303714.4	37	CCDS1892.1																																																																																			.		0.647	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
CYP2D6	1565	broad.mit.edu	37	22	42523507	42523516	+	Frame_Shift_Del	DEL	AGGGGGACGA	AGGGGGACGA	-	rs149686350|rs61745683	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	AGGGGGACGA	AGGGGGACGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr22:42523507_42523516delAGGGGGACGA	ENST00000360608.5	-	7	1220_1229	c.1106_1115delTCGTCCCCCT	c.(1105-1116)atcgtccccctgfs	p.IVPL369fs	NDUFA6-AS1_ENST00000610250.1_RNA|NDUFA6-AS1_ENST00000536447.2_RNA|NDUFA6-AS1_ENST00000416037.2_RNA|NDUFA6-AS1_ENST00000417327.1_RNA|NDUFA6-AS1_ENST00000439129.1_RNA|CYP2D6_ENST00000389970.3_Frame_Shift_Del_p.IVPL369fs|NDUFA6-AS1_ENST00000451451.1_RNA|CYP2D6_ENST00000359033.4_Frame_Shift_Del_p.IVPL318fs|NDUFA6-AS1_ENST00000600968.1_RNA|NDUFA6-AS1_ENST00000434834.1_RNA|NDUFA6-AS1_ENST00000595777.1_RNA	NM_000106.5	NP_000097	P10635	CP2D6_HUMAN	cytochrome P450, family 2, subfamily D, polypeptide 6	369			I -> T (in allele CYP2D6*26).		alkaloid catabolic process (GO:0009822)|alkaloid metabolic process (GO:0009820)|coumarin metabolic process (GO:0009804)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|isoquinoline alkaloid metabolic process (GO:0033076)|monoterpenoid metabolic process (GO:0016098)|negative regulation of binding (GO:0051100)|negative regulation of cellular organofluorine metabolic process (GO:0090350)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)	p.I318I(1)|p.I369I(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(4)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21					Abiraterone(DB05812)|Acebutolol(DB01193)|Acetaminophen(DB00316)|Ajmaline(DB01426)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alprenolol(DB00866)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amoxapine(DB00543)|Amphetamine(DB00182)|Amprenavir(DB00701)|Amsacrine(DB00276)|Antipyrine(DB01435)|Aprindine(DB01429)|Arformoterol(DB01274)|Aripiprazole(DB01238)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzatropine(DB00245)|Benzyl alcohol(DB06770)|Bepridil(DB01244)|Betaxolol(DB00195)|Bicalutamide(DB01128)|Biperiden(DB00810)|Bisoprolol(DB00612)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Caffeine(DB00201)|Captopril(DB01197)|Carbinoxamine(DB00748)|Carteolol(DB00521)|Carvedilol(DB01136)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Cisapride(DB00604)|Citalopram(DB00215)|Clemastine(DB00283)|Clevidipine(DB04920)|Clomipramine(DB01242)|Clonidine(DB00575)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Darifenacin(DB00496)|Debrisoquin(DB04840)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dihydrocodeine(DB01551)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronedarone(DB04855)|Duloxetine(DB00476)|Efavirenz(DB00625)|Eletriptan(DB00216)|Encainide(DB01228)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erlotinib(DB00530)|Escitalopram(DB01175)|Ethylmorphine(DB01466)|Etoricoxib(DB01628)|Felodipine(DB01023)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fingolimod(DB08868)|Flecainide(DB01195)|Flunarizine(DB04841)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Galantamine(DB00674)|Gefitinib(DB00317)|Glutethimide(DB01437)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Histamine Phosphate(DB00667)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Hydroxychloroquine(DB01611)|Hydroxyurea(DB01005)|Hydroxyzine(DB00557)|Idarubicin(DB01177)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Isoniazid(DB00951)|Itraconazole(DB01167)|Ketoconazole(DB01026)|L-DOPA(DB01235)|Labetalol(DB00598)|Lansoprazole(DB00448)|Lercanidipine(DB00528)|Levomilnacipran(DB08918)|Lidocaine(DB00281)|Lisuride(DB00589)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Lovastatin(DB00227)|Lumefantrine(DB06708)|Maprotiline(DB00934)|Mefloquine(DB00358)|Mepyramine(DB06691)|Mequitazine(DB01071)|Mesoridazine(DB00933)|Methadone(DB00333)|Methamphetamine(DB01577)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Methylnaltrexone(DB06800)|Methylphenidate(DB00422)|Methyprylon(DB01107)|Metoclopramide(DB01233)|Metoprolol(DB00264)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midodrine(DB00211)|Mifepristone(DB00834)|Minaprine(DB00805)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Morphine(DB00295)|Nateglinide(DB00731)|Nebivolol(DB04861)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niacin(DB00627)|Nicardipine(DB00622)|Nicergoline(DB00699)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitrofural(DB00336)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxamniquine(DB01096)|Oxprenolol(DB01580)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paliperidone(DB01267)|Palonosetron(DB00377)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Pergolide(DB01186)|Perhexiline(DB01074)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenformin(DB00914)|Phentermine(DB00191)|Pimozide(DB01100)|Pindolol(DB00960)|Pioglitazone(DB01132)|Piperazine(DB00592)|Pipotiazine(DB01621)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Primaquine(DB01087)|Procainamide(DB01035)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Pyrimethamine(DB00205)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Remoxipride(DB00409)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivastigmine(DB00989)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tapentadol(DB06204)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Terbinafine(DB00857)|Tetrabenazine(DB04844)|Theophylline(DB00277)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Timolol(DB00373)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tolterodine(DB01036)|Trabectedin(DB05109)|Tramadol(DB00193)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Trospium(DB00209)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vinorelbine(DB00361)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GGTCACACCCAGGGGGACGATGTCCCCAAA	0.624																																					p.369_372del													.	CYP2D6-136	2	Substitution - coding silent(2)	urinary_tract(2)	c.1106_1115del						.																																			SO:0001589	frameshift_variant	1565	exon7			ACACCCAGGGGGA	M20403	CCDS33657.1, CCDS46721.1	22q13.1	2014-09-17	2003-01-14		ENSG00000100197	ENSG00000100197		"""Cytochrome P450s"""	2625	protein-coding gene	gene with protein product		124030	"""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolizing), polypeptide 6"", ""cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 2"", ""cytochrome P450, subfamily II (debrisoquine, sparteine, etc., -metabolising), polypeptide 7 pseudogene 2"", ""cytochrome P450, family 2, subfamily D, polypeptide 8 pseudogene 2"", ""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolising), polypeptide 8 pseudogene 2"""	CYP2DL1, CYP2D7P2, CYP2D7BP, CYP2D8P2, CYP2D7AP		8449513	Standard	NM_000106		Approved	CPD6, P450-DB1, CYP2D, P450C2D	uc003bce.3	P10635	OTTHUMG00000150918	ENST00000360608.5:c.1106_1115delTCGTCCCCCT	22.37:g.42523507_42523516delAGGGGGACGA	ENSP00000353820:p.Ile369fs	Somatic	201	0		WXS	Illumina HiSeq	Phase_I	142	13	NM_000106	0	0	0	0	0	Q16752|Q2XND6|Q2XND7|Q2XNE0|Q6B012|Q6NXU8	Frame_Shift_Del	DEL	ENST00000360608.5	37	CCDS46721.1																																																																																			.		0.624	CYP2D6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320525.1		
PCDHGA4	56111	hgsc.bcm.edu	37	5	140735215	140735218	+	Frame_Shift_Del	DEL	GCAA	GCAA	-	rs11575949	byFrequency	TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	GCAA	GCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:140735215_140735218delGCAA	ENST00000571252.1	+	1	448_451	c.448_451delGCAA	c.(448-453)gcaagafs	p.AR150fs	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	150	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.		A -> T (in dbSNP:rs11575949).		homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAATCCTGGGGCAAGATTTCCTCT	0.446																																					p.150_151del		.											.	.	0			c.448_451del						.																																			SO:0001589	frameshift_variant	56111	exon1			.	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.448_451delGCAA	5.37:g.140735215_140735218delGCAA	ENSP00000458570:p.Ala150fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	81	19	NM_018917	0	0	0	0	0	Q9Y5D3	Frame_Shift_Del	DEL	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.446	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
HECA	51696	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	139495590	139495590	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr6:139495590delA	ENST00000367658.2	+	3	1666	c.1381delA	c.(1381-1383)aagfs	p.K461fs	RP1-225E12.2_ENST00000586266.1_RNA|RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000590219.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000591102.1_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000585447.1_RNA|RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	461					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		CATCTGCATCAAGTGTAAGTC	0.547																																					p.K461fs		.											.	HECA-90	0			c.1381delA						.						234.0	198.0	210.0					6																	139495590		2203	4300	6503	SO:0001589	frameshift_variant	51696	exon3			.	AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.1381delA	6.37:g.139495590delA	ENSP00000356630:p.Lys461fs	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	180	59	NM_016217	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000367658.2	37	CCDS5194.1																																																																																			.		0.547	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042456.1	NM_016217	
COL5A1	1289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	137593045	137593045	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr9:137593045delA	ENST00000371817.3	+	4	934	c.520delA	c.(520-522)aagfs	p.K175fs	COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	175	Laminin G-like.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CAGCGTCCACAAGAAAAATGT	0.478																																					p.K174fs		.											.	COL5A1-524	0			c.520delA						.						132.0	100.0	111.0					9																	137593045		2203	4298	6501	SO:0001589	frameshift_variant	1289	exon4			.	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.520delA	9.37:g.137593045delA	ENSP00000360882:p.Lys175fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	78	28	NM_000093	0	0	0	0	0	Q15094|Q5SUX4	Frame_Shift_Del	DEL	ENST00000371817.3	37	CCDS6982.1																																																																																			.		0.478	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
GTF3C2	2976	broad.mit.edu;bcgsc.ca	37	2	27565919	27565920	+	Frame_Shift_Ins	INS	-	-	TGGCCTTT			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:27565919_27565920insTGGCCTTT	ENST00000359541.2	-	3	771_772	c.342_343insAAAGGCCA	c.(340-345)ccccaafs	p.Q115fs	AC109828.1_ENST00000590383.1_RNA|AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000589853.1_RNA|GTF3C2_ENST00000264720.3_Frame_Shift_Ins_p.Q115fs			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	115					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTAGGCTGTTGGGGCCTTTTGG	0.535																																					p.P115fs													.	GTF3C2-92	0			c.343_344insAAAGGCCA						.																																			SO:0001589	frameshift_variant	2976	exon3			GCTGTTGGGGCCT	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.342_343insAAAGGCCA	2.37:g.27565919_27565920insTGGCCTTT	ENSP00000352536:p.Gln115fs	Somatic	315	0		WXS	Illumina HiSeq	Phase_I	219	28	NM_001035521	0	0	0	0	0	D6W557|Q16632|Q9BWI7	Frame_Shift_Ins	INS	ENST00000359541.2	37	CCDS1749.1																																																																																			.		0.535	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
XRCC5	7520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	216981563	216981564	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr2:216981563_216981564insC	ENST00000392133.3	+	5	778_779	c.317_318insC	c.(316-321)gacttcfs	p.F107fs	XRCC5_ENST00000392132.2_Frame_Shift_Ins_p.F107fs			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	107					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		CAACAGGCTGACTGTATCCTTT	0.421								Non-homologous end-joining																													p.D106fs		.											.	XRCC5-970	0			c.317_318insC						.																																			SO:0001589	frameshift_variant	7520	exon3			.	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.318dupC	2.37:g.216981564_216981564dupC	ENSP00000375978:p.Phe107fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	75	24	NM_021141	0	0	0	0	0	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Frame_Shift_Ins	INS	ENST00000392133.3	37	CCDS2402.1																																																																																			.		0.421	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
TOP3B	8940	hgsc.bcm.edu;broad.mit.edu	37	22	22319734	22319735	+	In_Frame_Ins	INS	-	-	TTG			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr22:22319734_22319735insTTG	ENST00000398793.2	-	9	1299_1300	c.865_866insCAA	c.(865-867)agc>aCAAgc	p.288_289insT	TOP3B_ENST00000357179.5_In_Frame_Ins_p.288_289insT|TOP3B_ENST00000413067.2_In_Frame_Ins_p.17_18insT	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	288					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTCTTTCCTGCTTGTGGCCTCC	0.535																																					p.S289delinsTS		.											.	TOP3B-538	0			c.866_867insCAA						.																																			SO:0001652	inframe_insertion	8940	exon9			.	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.863_865dupCAA	22.37:g.22319735_22319737dupTTG	ENSP00000381773:p.Thr288_Thr288dup	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	55	14	NM_003935	0	0	0	0	0	A0M8Q3|Q9BUP5	In_Frame_Ins	INS	ENST00000398793.2	37	CCDS13797.1																																																																																			.		0.535	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935	
PCDHGA4	56111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140735217	140735218	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr5:140735217_140735218insG	ENST00000571252.1	+	1	450_451	c.450_451insG	c.(451-453)agafs	p.R151fs	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	151	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCTGGGGCAAGATTTCCTCT	0.45																																					p.A150fs		.											.	.	0			c.450_451insG						.																																			SO:0001589	frameshift_variant	56111	exon1			.	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		Exception_encountered	5.37:g.140735217_140735218insG	ENSP00000458570:p.Arg151fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	77	22	NM_018917	0	0	0	0	0	Q9Y5D3	Frame_Shift_Ins	INS	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.450	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
PRKRIP1	79706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	102040095	102040096	+	Splice_Site	DNP	GG	GG	AA			TCGA-B9-4113-01A-01D-1252-08	TCGA-B9-4113-11A-01D-1252-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	527ea66a-fb9e-4308-b49d-48226ac05304	881301ff-ec26-46fd-834f-93d9b3ec8da0	g.chr7:102040095_102040096GG>AA	ENST00000496391.1	+	7	1616	c.306_306GG>AA	c.(304-306)aaGG>aaAAg	p.K102K	PRKRIP1_ENST00000462601.1_Splice_Site_p.K45K|PRKRIP1_ENST00000397912.3_Splice_Site_p.K102K|PRKRIP1_ENST00000482465.1_3'UTR|PRKRIP1_ENST00000354783.4_Splice_Site_p.K64K			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	102	Required for RNA-binding. {ECO:0000250}.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|lung(4)|ovary(1)	6						TGGCTGAGAAGGTCAGTGAGCC	0.554																																					.		.											.	PRKRIP1	0			c.306+1G>A						.																																			SO:0001630	splice_region_variant	79706	exon3			GAGAAGGTCAGTG	AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	Exception_encountered	7.37:g.102040095_102040096delinsAA		Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	360.0	147.0		0	0	0	0	0	B4DGM2|Q8NDM6|Q96CF8	Splice_Site	DNP	ENST00000496391.1	37	CCDS34714.1																																																																																			.		0.554	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349489.1	NM_024653	Silent
