#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACTRT2	140625	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	2938841	2938841	+	Silent	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr1:2938841C>A	ENST00000378404.2	+	1	796	c.591C>A	c.(589-591)ctC>ctA	p.L197L		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	197						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		TGCAGCTGCTCCTGGCCAGCG	0.627																																					p.L197L													.	ACTRT2-90	0			c.C591A						.						38.0	39.0	39.0					1																	2938841		2203	4299	6502	SO:0001819	synonymous_variant	140625	exon1			GCTGCTCCTGGCC	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.591C>A	1.37:g.2938841C>A		Somatic	243	1		WXS	Illumina HiSeq	Phase_I	189	71	NM_080431	0	0	0	0	0	B1AN52|Q8NHS6|Q8TDG1	Silent	SNP	ENST00000378404.2	37	CCDS45.1																																																																																			.		0.627	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1	NM_080431	
TMOD4	29765	broad.mit.edu	37	1	151146999	151146999	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr1:151146999T>A	ENST00000416280.2	-	3	247	c.148A>T	c.(148-150)Aga>Tga	p.R50*	VPS72_ENST00000496809.1_5'Flank|TMOD4_ENST00000601585.1_5'Flank			Q9NZQ9	TMOD4_HUMAN	tropomodulin 4 (muscle)	0					muscle contraction (GO:0006936)	striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCACGTTGTCTTAGTCCAGCT	0.537																																					p.R50X													.	TMOD4-91	0			c.A148T						.						163.0	157.0	159.0					1																	151146999		2203	4300	6503	SO:0001587	stop_gained	29765	exon3			GTTGTCTTAGTCC	AF177173	CCDS988.1	1q12	2008-05-23			ENSG00000163157	ENSG00000163157			11874	protein-coding gene	gene with protein product	"""actin-capping protein"""	605834				10662549, 10497209	Standard	NM_013353		Approved	Sk-Tmod	uc001exc.4	Q9NZQ9	OTTHUMG00000012350	ENST00000416280.2:c.148A>T	1.37:g.151146999T>A	ENSP00000414180:p.Arg50*	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	39	3	NM_013353	0	0	0	0	0	B7Z6N9|Q5JR83|Q8WVL3|Q9UKH2	Nonsense_Mutation	SNP	ENST00000416280.2	37		.	.	.	.	.	.	.	.	.	.	.	29.1	4.976337	0.92982	.	.	ENSG00000163157	ENST00000295314;ENST00000416280;ENST00000441701	.	.	.	5.62	3.09	0.35607	.	0.117111	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6159	10.3631	0.44006	0.0:0.0:0.4458:0.5542	.	.	.	.	X	50	.	ENSP00000295314:R50X	R	-	1	2	TMOD4	149413623	1.000000	0.71417	0.988000	0.46212	0.952000	0.60782	3.215000	0.51169	0.915000	0.36847	0.459000	0.35465	AGA	.		0.537	TMOD4-201	KNOWN	basic	protein_coding	protein_coding			
PBX1	5087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	164761953	164761953	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr1:164761953C>T	ENST00000420696.2	+	3	676	c.488C>T	c.(487-489)aCg>aTg	p.T163M	PBX1_ENST00000367897.1_Missense_Mutation_p.T163M|PBX1_ENST00000540236.1_Missense_Mutation_p.T163M|PBX1_ENST00000540246.1_Missense_Mutation_p.T58M|PBX1_ENST00000560641.1_Missense_Mutation_p.T58M|PBX1_ENST00000401534.1_Missense_Mutation_p.T163M|PBX1_ENST00000559240.1_Missense_Mutation_p.T163M	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	163					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						ATCTACCATACGGAGCTGGAG	0.577			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.T163M		.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1-659	0			c.C488T						.						27.0	31.0	30.0					1																	164761953		2202	4300	6502	SO:0001583	missense	5087	exon3			ACCATACGGAGCT	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.488C>T	1.37:g.164761953C>T	ENSP00000405890:p.Thr163Met	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	60	30	NM_001204963	0	0	0	0	0	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709033	0.89018	.	.	ENSG00000185630	ENST00000340699;ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5	5.23	5.23	0.72850	PBX (1);	0.000000	0.85682	D	0.000000	T	0.43144	0.1234	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.65815	0.995;0.994;0.993;0.994;0.994	P;P;P;D;P	0.64877	0.738;0.806;0.852;0.93;0.82	T	0.39643	-0.9604	10	0.72032	D	0.01	-9.5716	18.3959	0.90497	0.0:1.0:0.0:0.0	.	58;163;163;163;163	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	M	163;163;163;163;163;58	ENSP00000341455:T163M;ENSP00000405890:T163M;ENSP00000356872:T163M;ENSP00000439943:T163M;ENSP00000384856:T163M;ENSP00000440869:T58M	ENSP00000341455:T163M	T	+	2	0	PBX1	163028577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.376000	0.79658	2.405000	0.81733	0.563000	0.77884	ACG	.		0.577	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
SUSD4	55061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223438095	223438095	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr1:223438095G>A	ENST00000343846.3	-	4	1234	c.601C>T	c.(601-603)Ccg>Tcg	p.P201S	SUSD4_ENST00000494793.2_Missense_Mutation_p.P201S|SUSD4_ENST00000344029.6_Missense_Mutation_p.P201S|SUSD4_ENST00000484758.2_Missense_Mutation_p.P130S|SUSD4_ENST00000478605.1_Intron|SUSD4_ENST00000454695.2_Missense_Mutation_p.P41S|SUSD4_ENST00000366878.4_Missense_Mutation_p.P201S			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	201	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GTCCCCACCGGGAAGGAGGTC	0.498																																					p.P201S		.											.	SUSD4-68	0			c.C601T						.						85.0	91.0	89.0					1																	223438095		2203	4300	6503	SO:0001583	missense	55061	exon5			CCACCGGGAAGGA	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.601C>T	1.37:g.223438095G>A	ENSP00000344219:p.Pro201Ser	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	88	18	NM_017982	0	0	0	0	0	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	ENST00000343846.3	37	CCDS41471.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775431	0.49786	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695;ENST00000344029	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.32	4.38	0.52667	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.47093	D	0.000255	T	0.58764	0.2145	N	0.20685	0.6	0.80722	D	1	B;D;P	0.71674	0.426;0.998;0.626	B;D;B	0.80764	0.329;0.994;0.432	T	0.56890	-0.7904	10	0.05721	T	0.95	-16.3711	10.3108	0.43708	0.0756:0.1375:0.7869:0.0	.	130;201;201	B7Z369;Q5VX71-3;Q5VX71	.;.;SUSD4_HUMAN	S	201;201;130;41;201	ENSP00000344219:P201S;ENSP00000355843:P201S;ENSP00000399288:P41S;ENSP00000339926:P201S	ENSP00000344219:P201S	P	-	1	0	SUSD4	221504718	1.000000	0.71417	0.997000	0.53966	0.827000	0.46813	4.506000	0.60428	1.415000	0.47037	0.491000	0.48974	CCG	.		0.498	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
SORCS1	114815	ucsc.edu;bcgsc.ca	37	10	108371705	108371705	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr10:108371705C>A	ENST00000263054.6	-	22	3004	c.2997G>T	c.(2995-2997)agG>agT	p.R999S	SORCS1_ENST00000478809.2_5'UTR|SORCS1_ENST00000369698.1_Missense_Mutation_p.R534S|SORCS1_ENST00000344440.6_Missense_Mutation_p.R999S	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	999					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GACCGATGTCCCTCCTCCACT	0.493																																					p.R999S													.	SORCS1-153	0			c.G2997T						.						114.0	102.0	106.0					10																	108371705		2203	4300	6503	SO:0001583	missense	114815	exon22			GATGTCCCTCCTC	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2997G>T	10.37:g.108371705C>A	ENSP00000263054:p.Arg999Ser	Somatic	166	3		WXS	Illumina HiSeq		151	34	NM_001206572	0	0	0	0	0	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.19|16.19	3.052900|3.052900	0.55218|0.55218	.|.	.|.	ENSG00000108018|ENSG00000108018	ENST00000452214|ENST00000369698;ENST00000263054;ENST00000344440	.|T;T;T	.|0.21543	.|2.0;2.55;2.56	5.41|5.41	-1.66|-1.66	0.08265|0.08265	.|.	.|0.116409	.|0.56097	.|D	.|0.000026	T|T	0.12774|0.12774	0.0310|0.0310	L|L	0.40543|0.40543	1.245|1.245	0.43088|0.43088	D|D	0.994752|0.994752	.|B;B;B;B;B	.|0.30146	.|0.176;0.27;0.27;0.176;0.27	.|B;B;B;B;B	.|0.35114	.|0.096;0.196;0.196;0.096;0.196	T|T	0.11084|0.11084	-1.0602|-1.0602	5|9	.|.	.|.	.|.	-25.7275|-25.7275	1.9546|1.9546	0.03373|0.03373	0.1101:0.3946:0.2156:0.2796|0.1101:0.3946:0.2156:0.2796	.|.	.|999;999;999;999;999	.|A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.|.;.;.;SORC1_HUMAN;.	V|S	14|534;999;999	.|ENSP00000358712:R534S;ENSP00000263054:R999S;ENSP00000345964:R999S	.|.	G|R	-|-	2|3	0|2	SORCS1|SORCS1	108361695|108361695	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.999000|0.999000	0.98932|0.98932	0.766000|0.766000	0.26560|0.26560	0.024000|0.024000	0.15214|0.15214	0.655000|0.655000	0.94253|0.94253	GGG|AGG	.		0.493	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
CCDC186	55088	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115917414	115917414	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr10:115917414G>A	ENST00000369287.3	-	3	924	c.658C>T	c.(658-660)Cag>Tag	p.Q220*		NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		220										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AAGAGCTCCTGATGCTTCTTA	0.274																																					p.Q220X													.	C10orf118-92	0			c.C658T						.						74.0	74.0	74.0					10																	115917414		2202	4298	6500	SO:0001587	stop_gained	55088	exon3			GCTCCTGATGCTT																												ENST00000369287.3:c.658C>T	10.37:g.115917414G>A	ENSP00000358293:p.Gln220*	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	24	8	NM_018017	0	0	0	0	0	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Nonsense_Mutation	SNP	ENST00000369287.3	37	CCDS7587.1	.	.	.	.	.	.	.	.	.	.	G	39	7.580594	0.98371	.	.	ENSG00000165813	ENST00000369287;ENST00000430353	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	16.5904	0.84763	0.0:0.0:1.0:0.0	.	.	.	.	X	220;326	.	ENSP00000358293:Q220X	Q	-	1	0	C10orf118	115907404	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.469000	0.90395	2.578000	0.87016	0.650000	0.86243	CAG	.		0.274	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		
CFAP46	54777	bcgsc.ca	37	10	134722730	134722730	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr10:134722730T>C	ENST00000368586.5	-	21	2768	c.2668A>G	c.(2668-2670)Agc>Ggc	p.S890G	TTC40_ENST00000368582.2_Missense_Mutation_p.S890G	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GTCACCGAGCTGACATCCTCA	0.582																																					p.S890G													.	.	0			c.A2668G						.																																			SO:0001583	missense	54777	exon21			CCGAGCTGACATC																												ENST00000368586.5:c.2668A>G	10.37:g.134722730T>C	ENSP00000357575:p.Ser890Gly	Somatic	50	0		WXS	Illumina HiSeq	Phase_1	31	4	NM_001200049	0	0	0	0	0		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	T	10.65	1.409946	0.25465	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.47869	2.82;0.83	5.13	1.6	0.23607	.	.	.	.	.	T	0.29061	0.0722	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.18713	-1.0328	8	0.20519	T	0.43	.	8.6876	0.34247	0.0:0.227:0.0:0.773	.	890	Q5SR76	CJ093_HUMAN	G	890	ENSP00000357575:S890G;ENSP00000357571:S890G	ENSP00000357571:S890G	S	-	1	0	C10orf93	134572720	0.008000	0.16893	0.159000	0.22649	0.034000	0.12701	1.353000	0.34045	0.805000	0.34159	-0.385000	0.06624	AGC	.		0.582	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
EPS8L2	64787	broad.mit.edu	37	11	726471	726471	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:726471G>T	ENST00000533256.1	+	20	2296	c.1921G>T	c.(1921-1923)Gcc>Tcc	p.A641S	EPS8L2_ENST00000530636.1_Missense_Mutation_p.A641S|EPS8L2_ENST00000318562.8_Missense_Mutation_p.A641S|EPS8L2_ENST00000526198.1_Missense_Mutation_p.A657S|AP006621.9_ENST00000527021.2_RNA			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	641					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGCCAAGGCCTTCAGCCC	0.756																																					p.A641S													.	EPS8L2-91	0			c.G1921T						.																																			SO:0001583	missense	64787	exon19			GCCAAGGCCTTCA	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1921G>T	11.37:g.726471G>T	ENSP00000435585:p.Ala641Ser	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	75	7	NM_022772	0	0	0	0	0	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212487	0.39102	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	3.3	1.09	0.20402	.	0.208508	0.29383	U	0.012303	T	0.11153	0.0272	L	0.27053	0.805	0.26101	N	0.980812	B;B	0.14438	0.01;0.01	B;B	0.10450	0.005;0.003	T	0.23297	-1.0192	10	0.45353	T	0.12	-19.1124	9.8968	0.41322	0.0:0.0:0.5629:0.4371	.	657;641	B7ZKL3;Q9H6S3	.;ES8L2_HUMAN	S	641;641;641;657	ENSP00000320828:A641S;ENSP00000435585:A641S;ENSP00000436035:A641S;ENSP00000436230:A657S	ENSP00000320828:A641S	A	+	1	0	EPS8L2	716471	1.000000	0.71417	0.995000	0.50966	0.558000	0.35554	2.264000	0.43302	0.706000	0.31912	0.298000	0.19748	GCC	.		0.756	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
GLYATL2	219970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	58601915	58601915	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:58601915T>C	ENST00000287275.1	-	6	1262	c.872A>G	c.(871-873)aAg>aGg	p.K291R	GLYATL2_ENST00000533636.1_5'Flank|GLYATL2_ENST00000532258.1_Missense_Mutation_p.K291R	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	291						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	ACAATATTTCTTGGGGGTGCA	0.363																																					p.K291R		.											.	GLYATL2-92	0			c.A872G						.						53.0	49.0	50.0					11																	58601915		1831	4083	5914	SO:0001583	missense	219970	exon6			TATTTCTTGGGGG	AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.872A>G	11.37:g.58601915T>C	ENSP00000287275:p.Lys291Arg	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	37	11	NM_145016	0	0	0	0	0	A5LGC7|Q86WC3|Q96AT2	Missense_Mutation	SNP	ENST00000287275.1	37	CCDS41649.1	.	.	.	.	.	.	.	.	.	.	T	7.457	0.643799	0.14451	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	T;T	0.14640	2.49;2.49	2.81	-1.38	0.09027	.	0.816947	0.10184	U	0.705518	T	0.08133	0.0203	L	0.34521	1.04	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.39921	-0.9590	10	0.25106	T	0.35	.	3.0975	0.06314	0.0:0.2741:0.2254:0.5005	.	291	Q8WU03	GLYL2_HUMAN	R	291	ENSP00000287275:K291R;ENSP00000434277:K291R	ENSP00000287275:K291R	K	-	2	0	GLYATL2	58358491	0.008000	0.16893	0.022000	0.16811	0.453000	0.32348	0.974000	0.29436	-0.398000	0.07679	-1.222000	0.01597	AAG	.		0.363	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394599.1	NM_145016	
PCF11	51585	broad.mit.edu	37	11	82879804	82879804	+	Silent	SNP	A	A	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:82879804A>T	ENST00000298281.4	+	8	2879	c.2427A>T	c.(2425-2427)ccA>ccT	p.P809P		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	809	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TTGAGGGGCCACAAGGTCAGC	0.562																																					p.P809P													.	PCF11-23	0			c.A2427T						.						55.0	56.0	56.0					11																	82879804		1914	4115	6029	SO:0001819	synonymous_variant	51585	exon8			GGGGCCACAAGGT	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.2427A>T	11.37:g.82879804A>T		Somatic	183	1		WXS	Illumina HiSeq	Phase_I	174	5	NM_015885	0	0	1	1	0	A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	37	CCDS44689.1																																																																																			.		0.562	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
MAML2	84441	broad.mit.edu;bcgsc.ca	37	11	95825356	95825356	+	Silent	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:95825356T>C	ENST00000524717.1	-	2	3123	c.1839A>G	c.(1837-1839)caA>caG	p.Q613Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	613					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgttgctgctgct	0.542			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q613Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.A1839G						.						50.0	53.0	52.0					11																	95825356		2075	4054	6129	SO:0001819	synonymous_variant	84441	exon2			TTGCTGTTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1839A>G	11.37:g.95825356T>C		Somatic	123	1		WXS	Illumina HiSeq	Phase_I	110	9	NM_032427	0	0	10	47	37	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.542	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MAML2	84441	hgsc.bcm.edu;bcgsc.ca	37	11	95825395	95825395	+	Silent	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:95825395C>T	ENST00000524717.1	-	2	3084	c.1800G>A	c.(1798-1800)caG>caA	p.Q600Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	600					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgct	0.537			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q600Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.G1800A						.						21.0	29.0	26.0					11																	95825395		1989	3928	5917	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1800G>A	11.37:g.95825395C>T		Somatic	159	0		WXS	Illumina HiSeq	Phase_I	137	16	NM_032427	2	1	1345	1412	64	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.537	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
SLC38A4	55089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	47170779	47170779	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:47170779C>T	ENST00000447411.1	-	12	1288	c.1082G>A	c.(1081-1083)cGg>cAg	p.R361Q	SLC38A4_ENST00000266579.4_Missense_Mutation_p.R361Q	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	361					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					CATTTTTCTCCGGGACCGACT	0.358																																					p.R361Q		.											.	SLC38A4-93	0			c.G1082A						.						87.0	88.0	88.0					12																	47170779		2203	4299	6502	SO:0001583	missense	55089	exon12			TTTCTCCGGGACC	AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.1082G>A	12.37:g.47170779C>T	ENSP00000389843:p.Arg361Gln	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	64	16	NM_001143824	0	0	0	0	0	A8K553	Missense_Mutation	SNP	ENST00000447411.1	37	CCDS8750.1	.	.	.	.	.	.	.	.	.	.	C	10.89	1.479698	0.26511	.	.	ENSG00000139209	ENST00000447411;ENST00000266579	T;T	0.02158	4.42;4.42	5.96	3.18	0.36537	.	0.116259	0.64402	N	0.000017	T	0.03871	0.0109	L	0.49640	1.575	0.45607	D	0.998544	B	0.24258	0.1	B	0.33890	0.172	T	0.41288	-0.9517	10	0.17369	T	0.5	-4.6085	15.3035	0.73972	0.0:0.872:0.0:0.128	.	361	Q969I6	S38A4_HUMAN	Q	361	ENSP00000389843:R361Q;ENSP00000266579:R361Q	ENSP00000266579:R361Q	R	-	2	0	SLC38A4	45457046	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	1.399000	0.34566	0.425000	0.26087	-0.940000	0.02684	CGG	.		0.358	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404574.1		
XPOT	11260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	64808728	64808728	+	Silent	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:64808728C>A	ENST00000332707.5	+	3	631	c.102C>A	c.(100-102)gcC>gcA	p.A34A		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	34	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		CCCCAGATGCCTGGCAGGTGT	0.388																																					p.A34A		.											.	XPOT-652	0			c.C102A						.						91.0	97.0	95.0					12																	64808728		2203	4300	6503	SO:0001819	synonymous_variant	11260	exon3			AGATGCCTGGCAG	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.102C>A	12.37:g.64808728C>A		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	37	5	NM_007235	0	0	6	8	2	A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	ENST00000332707.5	37	CCDS31852.1																																																																																			.		0.388	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
USP44	84101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	95907438	95907438	+	IGR	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:95907438A>G	ENST00000258499.3	-	0	4022				METAP2_ENST00000546753.1_Missense_Mutation_p.T376A|METAP2_ENST00000323666.5_Missense_Mutation_p.T399A|METAP2_ENST00000261220.9_Missense_Mutation_p.T376A|METAP2_ENST00000551840.1_Missense_Mutation_p.T398A|METAP2_ENST00000550777.1_Missense_Mutation_p.T363A	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44						mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						GCTTCCAAGAACAAAACACTT	0.418																																					p.T399A		.											.	METAP2-90	0			c.A1195G						.						84.0	82.0	83.0					12																	95907438		2203	4300	6503	SO:0001628	intergenic_variant	10988	exon11			CCAAGAACAAAAC	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7			12.37:g.95907438A>G		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	88	21	NM_006838	0	0	1	1	0	B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	37	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	A	2.554	-0.303387	0.05495	.	.	ENSG00000111142	ENST00000323666;ENST00000546753;ENST00000261220;ENST00000550777;ENST00000551840	.	.	.	5.83	2.17	0.27698	Winged helix-turn-helix transcription repressor DNA-binding (1);Peptidase M24, structural domain (2);	0.135470	0.64402	N	0.000002	T	0.03220	0.0094	N	0.00003	-3.5	0.39326	D	0.96532	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0	T	0.40194	-0.9576	9	0.02654	T	1	-9.0542	6.8846	0.24193	0.3929:0.0:0.6071:0.0	.	376;363;376;398;399	B4DUX5;F8VRR3;G3XA91;F8VQZ7;P50579	.;.;.;.;AMPM2_HUMAN	A	399;376;376;363;398	.	ENSP00000261220:T376A	T	+	1	0	METAP2	94431569	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.393000	0.59665	0.466000	0.27193	0.533000	0.62120	ACA	.		0.418	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
PABPC3	5042	ucsc.edu	37	13	25672007	25672007	+	Silent	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr13:25672007A>G	ENST00000281589.3	+	1	1708	c.1671A>G	c.(1669-1671)ttA>ttG	p.L557L		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	557	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGCAAATGTTAGGTGAACGGC	0.433																																					p.L557L													.	PABPC3-72	0			c.A1671G						.						118.0	107.0	110.0					13																	25672007		2203	4300	6503	SO:0001819	synonymous_variant	5042	exon1			AATGTTAGGTGAA	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1671A>G	13.37:g.25672007A>G		Somatic	154	1		WXS	Illumina HiSeq		182	1	NM_030979	0	0	0	1	1	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																			.		0.433	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
FRY	10129	broad.mit.edu	37	13	32841388	32841388	+	Silent	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr13:32841388C>A	ENST00000380250.3	+	55	8524	c.8028C>A	c.(8026-8028)gcC>gcA	p.A2676A	FRY_ENST00000542859.1_Silent_p.A46A	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2676						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AGCCCGCAGCCTGTGACGATG	0.552																																					p.A2676A													.	FRY-142	0			c.C8028A						.						99.0	107.0	104.0					13																	32841388		2065	4205	6270	SO:0001819	synonymous_variant	10129	exon55			CGCAGCCTGTGAC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.8028C>A	13.37:g.32841388C>A		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	72	3	NM_023037	0	0	3	4	1	Q9Y3N6	Silent	SNP	ENST00000380250.3	37	CCDS41875.1																																																																																			.		0.552	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
RALGAPA1	253959	ucsc.edu;bcgsc.ca	37	14	36103887	36103887	+	Missense_Mutation	SNP	G	G	A	rs554131227	byFrequency	TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr14:36103887G>A	ENST00000389698.3	-	32	4760	c.4370C>T	c.(4369-4371)gCa>gTa	p.A1457V	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.A1470V|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.A1457V|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.A1504V	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1457	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATCTACAGATGCCAAATCAGA	0.438													G|||	10	0.00199681	0.0076	0.0	5008	,	,		15122	0.0		0.0	False		,,,				2504	0.0				p.A1457V													.	RALGAPA1-138	0			c.C4370T						.						53.0	51.0	52.0					14																	36103887		2203	4297	6500	SO:0001583	missense	253959	exon32			ACAGATGCCAAAT	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.4370C>T	14.37:g.36103887G>A	ENSP00000374348:p.Ala1457Val	Somatic	136	3		WXS	Illumina HiSeq		111	21	NM_194301	0	0	3	3	0	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097606	0.56075	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	5.38	5.38	0.77491	.	0.293400	0.37577	N	0.002036	T	0.34077	0.0885	L	0.53249	1.67	0.33807	D	0.627326	P;B;B;B	0.38827	0.649;0.382;0.452;0.215	B;B;B;B	0.36567	0.228;0.146;0.228;0.101	T	0.50303	-0.8844	10	0.52906	T	0.07	-16.2934	19.5007	0.95093	0.0:0.0:1.0:0.0	.	1504;1470;1457;1457	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	V	1457;1457;1457;1504;95;1470;1504	ENSP00000374348:A1457V;ENSP00000302647:A1457V;ENSP00000258840:A1504V;ENSP00000451133:A95V;ENSP00000371803:A1470V;ENSP00000451877:A1504V	ENSP00000258840:A1504V	A	-	2	0	RALGAPA1	35173638	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.259000	0.58828	2.673000	0.90976	0.650000	0.86243	GCA	.		0.438	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
SPTBN5	51332	ucsc.edu	37	15	42147764	42147764	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr15:42147764G>A	ENST00000320955.6	-	54	9428	c.9201C>T	c.(9199-9201)agC>agT	p.S3067S		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3067					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GGTTCTTCCTGCTCTCCAGGA	0.632																																					p.S3032S													.	SPTBN5-91	0			c.C9096T						.						20.0	23.0	22.0					15																	42147764		2032	4171	6203	SO:0001819	synonymous_variant	51332	exon54			CTTCCTGCTCTCC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.9201C>T	15.37:g.42147764G>A		Somatic	48	0		WXS	Illumina HiSeq		41	4	NM_016642	0	0	0	0	0		Silent	SNP	ENST00000320955.6	37																																																																																				.		0.632	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
DAPK2	23604	broad.mit.edu;bcgsc.ca	37	15	64217047	64217047	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr15:64217047T>C	ENST00000457488.1	-	9	856	c.826A>G	c.(826-828)Atc>Gtc	p.I276V	DAPK2_ENST00000261891.3_Missense_Mutation_p.I276V|DAPK2_ENST00000558069.1_Missense_Mutation_p.I276V	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	276	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		GCCTCTTGGATTGTGAGCCGT	0.532																																					p.I276V													.	DAPK2-333	0			c.A826G						.						136.0	106.0	116.0					15																	64217047		2203	4300	6503	SO:0001583	missense	23604	exon9			CTTGGATTGTGAG	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.826A>G	15.37:g.64217047T>C	ENSP00000408277:p.Ile276Val	Somatic	246	0		WXS	Illumina HiSeq	Phase_I	151	6	NM_014326	0	0	0	0	0	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	37	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.967289	0.34754	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.39229	1.09;1.09	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.30823	0.0777	N	0.20766	0.605	0.80722	D	1	B	0.18166	0.026	B	0.30179	0.112	T	0.11060	-1.0603	10	0.13470	T	0.59	.	14.7185	0.69289	0.0:0.0:0.0:1.0	.	276	Q9UIK4	DAPK2_HUMAN	V	276	ENSP00000261891:I276V;ENSP00000408277:I276V	ENSP00000261891:I276V	I	-	1	0	DAPK2	62004100	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	5.074000	0.64401	2.198000	0.70561	0.533000	0.62120	ATC	.		0.532	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369367	65369367	+	Silent	SNP	C	C	T	rs550537101	byFrequency	TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr15:65369367C>T	ENST00000432196.2	+	1	214	c.214C>T	c.(214-216)Ctg>Ttg	p.L72L	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	72	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CCGGCCGGCGCTGGCGGCGGA	0.736													C|||	10	0.00199681	0.0068	0.0014	5008	,	,		9554	0.0		0.0	False		,,,				2504	0.0				p.L72L		.											.	.	0			c.C214T						.						2.0	2.0	2.0					15																	65369367		1202	2816	4018	SO:0001819	synonymous_variant	390594	exon1			CCGGCGCTGGCGG		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.214C>T	15.37:g.65369367C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	7	5	NM_001101362	0	0	0	0	0		Silent	SNP	ENST00000432196.2	37	CCDS45281.1																																																																																			.		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
FBXO22	26263	broad.mit.edu	37	15	76225142	76225142	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr15:76225142C>A	ENST00000308275.3	+	7	1016	c.911C>A	c.(910-912)gCt>gAt	p.A304D	FBXO22_ENST00000540507.1_Missense_Mutation_p.A200D	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	304					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						ACTGCTGAGGCTGCGATGCAG	0.537																																					p.A304D													.	FBXO22-658	0			c.C911A						.						133.0	121.0	125.0					15																	76225142		2197	4294	6491	SO:0001583	missense	26263	exon7			CTGAGGCTGCGAT	AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.911C>A	15.37:g.76225142C>A	ENSP00000307833:p.Ala304Asp	Somatic	142	2		WXS	Illumina HiSeq	Phase_I	115	7	NM_147188	0	0	15	15	0	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	37	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592872	0.86953	.	.	ENSG00000167196	ENST00000308275;ENST00000540507	.	.	.	5.52	5.52	0.82312	FIST C domain (1);	0.000000	0.85682	D	0.000000	T	0.78635	0.4314	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.79401	-0.1819	9	0.66056	D	0.02	-26.0739	18.7902	0.91971	0.0:1.0:0.0:0.0	.	304	Q8NEZ5	FBX22_HUMAN	D	304;200	.	ENSP00000307833:A304D	A	+	2	0	FBXO22	74012197	0.999000	0.42202	0.966000	0.40874	0.542000	0.35054	4.175000	0.58263	2.752000	0.94435	0.655000	0.94253	GCT	.		0.537	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188	
CDR2	1039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	22358803	22358803	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:22358803A>G	ENST00000268383.2	-	5	1155	c.848T>C	c.(847-849)tTc>tCc	p.F283S		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	283						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		GGGCTCTTTGAAAGGAACATA	0.532																																					p.F283S		.											.	CDR2-91	0			c.T848C						.						38.0	39.0	39.0					16																	22358803		2197	4300	6497	SO:0001583	missense	1039	exon5			TCTTTGAAAGGAA	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.848T>C	16.37:g.22358803A>G	ENSP00000268383:p.Phe283Ser	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	64	15	NM_001802	0	0	18	45	27	A8K8A8|Q13977	Missense_Mutation	SNP	ENST00000268383.2	37	CCDS32404.1	.	.	.	.	.	.	.	.	.	.	A	3.865	-0.029069	0.07589	.	.	ENSG00000140743	ENST00000268383	T	0.41065	1.01	5.79	4.68	0.58851	.	0.159588	0.56097	D	0.000023	T	0.29093	0.0723	L	0.27053	0.805	0.38438	D	0.946635	B	0.23185	0.081	B	0.20577	0.03	T	0.09100	-1.0690	10	0.15952	T	0.53	-9.0507	13.0653	0.59030	0.8657:0.1343:0.0:0.0	.	283	Q01850	CDR2_HUMAN	S	283	ENSP00000268383:F283S	ENSP00000268383:F283S	F	-	2	0	CDR2	22266304	0.890000	0.30428	0.599000	0.28851	0.617000	0.37484	3.322000	0.52007	0.991000	0.38814	0.533000	0.62120	TTC	.		0.532	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430081.1		
ZNF629	23361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30794425	30794425	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:30794425G>A	ENST00000262525.4	-	3	1431	c.1224C>T	c.(1222-1224)ggC>ggT	p.G408G	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			TGAAGCTCTTGCCGCACTCTG	0.652																																					p.G408G		.											.	.	0			c.C1224T						.						47.0	51.0	49.0					16																	30794425		2197	4300	6497	SO:0001819	synonymous_variant	23361	exon3			GCTCTTGCCGCAC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1224C>T	16.37:g.30794425G>A		Somatic	184	0		WXS	Illumina HiSeq	Phase_I	179	51	NM_001080417	0	0	2	4	2	Q15938	Silent	SNP	ENST00000262525.4	37	CCDS45463.1																																																																																			.		0.652	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
ZNF646	9726	broad.mit.edu	37	16	31087650	31087650	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:31087650A>G	ENST00000394979.2	+	1	428	c.5A>G	c.(4-6)gAg>gGg	p.E2G	ZNF668_ENST00000300849.4_5'Flank|ZNF668_ENST00000564456.1_5'Flank|ZNF668_ENST00000538906.1_5'Flank|ZNF646_ENST00000300850.5_Missense_Mutation_p.E2G|ZNF668_ENST00000394983.2_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						TGCCCCATGGAGGACACACCC	0.622																																					p.E2G													.	ZNF646-153	0			c.A5G						.						60.0	58.0	59.0					16																	31087650		2197	4300	6497	SO:0001583	missense	9726	exon2			CCATGGAGGACAC	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.5A>G	16.37:g.31087650A>G	ENSP00000378429:p.Glu2Gly	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	107	3	NM_014699	0	0	0	0	0	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	A	21.5	4.163319	0.78226	.	.	ENSG00000167395	ENST00000428260;ENST00000300850;ENST00000394979	T;T;T	0.12039	3.06;2.72;2.74	5.69	5.69	0.88448	.	.	.	.	.	T	0.15089	0.0364	N	0.24115	0.695	0.34472	D	0.702912	P	0.51537	0.946	P	0.49301	0.606	T	0.14868	-1.0457	9	0.59425	D	0.04	-19.4918	12.342	0.55099	1.0:0.0:0.0:0.0	.	2	O15015-2	.	G	2	ENSP00000391271:E2G;ENSP00000300850:E2G;ENSP00000378429:E2G	ENSP00000300850:E2G	E	+	2	0	ZNF646	30995151	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	1.981000	0.40628	2.167000	0.68274	0.460000	0.39030	GAG	.		0.622	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
MMP15	4324	broad.mit.edu	37	16	58074478	58074478	+	Silent	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:58074478C>A	ENST00000219271.3	+	5	1571	c.786C>A	c.(784-786)ggC>ggA	p.G262G		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	262					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	ATGAGCTGGGCCACGCGCTGG	0.602																																					p.G262G													.	MMP15-713	0			c.C786A						.						77.0	64.0	68.0					16																	58074478		2198	4300	6498	SO:0001819	synonymous_variant	4324	exon5			GCTGGGCCACGCG	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.786C>A	16.37:g.58074478C>A		Somatic	112	1		WXS	Illumina HiSeq	Phase_I	111	5	NM_002428	0	0	11	11	0	A0A2U6|Q14111	Silent	SNP	ENST00000219271.3	37	CCDS10792.1																																																																																			.		0.602	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
NFAT5	10725	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	69727578	69727578	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:69727578C>T	ENST00000354436.2	+	12	4114	c.3796C>T	c.(3796-3798)Cag>Tag	p.Q1266*	NFAT5_ENST00000393742.2_Nonsense_Mutation_p.Q1190*|NFAT5_ENST00000432919.1_Nonsense_Mutation_p.Q1284*|NFAT5_ENST00000349945.1_Nonsense_Mutation_p.Q1190*|NFAT5_ENST00000566899.1_Nonsense_Mutation_p.Q1190*|NFAT5_ENST00000567239.1_Nonsense_Mutation_p.Q1283*	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1266	Poly-Gln.				cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						gcaacaacaacagAGCATTTT	0.468																																					p.Q1284X													.	NFAT5-90	0			c.C3850T						.						59.0	53.0	55.0					16																	69727578		2198	4300	6498	SO:0001587	stop_gained	10725	exon13			CAACAACAGAGCA	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.3796C>T	16.37:g.69727578C>T	ENSP00000346420:p.Gln1266*	Somatic	115	1		WXS	Illumina HiSeq	Phase_I	87	23	NM_138713	0	0	5	5	0	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Nonsense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	C	37	6.228520	0.97394	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	.	.	.	5.06	5.06	0.68205	.	2.340300	0.01863	N	0.036730	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-1.0247	14.2685	0.66138	0.0:1.0:0.0:0.0	.	.	.	.	X	1284;1283;1190;1266;1190	.	ENSP00000338806:Q1190X	Q	+	1	0	NFAT5	68285079	1.000000	0.71417	0.944000	0.38274	0.119000	0.20118	4.177000	0.58276	2.507000	0.84556	0.555000	0.69702	CAG	.		0.468	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
OSGIN1	29948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	83994295	83994295	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:83994295G>A	ENST00000343939.2	+	5	958	c.575G>A	c.(574-576)tGg>tAg	p.W192*	OSGIN1_ENST00000393306.1_Nonsense_Mutation_p.W109*|OSGIN1_ENST00000361711.3_Nonsense_Mutation_p.W109*|OSGIN1_ENST00000565123.1_Nonsense_Mutation_p.W109*			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	192					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						GTCCTCACCTGGAAGCACCGG	0.652																																					p.W109X		.											.	OSGIN1-68	0			c.G326A						.						61.0	60.0	60.0					16																	83994295		2200	4300	6500	SO:0001587	stop_gained	29948	exon4			TCACCTGGAAGCA	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.575G>A	16.37:g.83994295G>A	ENSP00000343376:p.Trp192*	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	185	62	NM_182981	0	0	4	5	1	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Nonsense_Mutation	SNP	ENST00000343939.2	37		.	.	.	.	.	.	.	.	.	.	G	38	7.081125	0.98051	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1195	16.9387	0.86210	0.0:0.0:1.0:0.0	.	.	.	.	X	192;109;109	.	ENSP00000343376:W192X	W	+	2	0	OSGIN1	82551796	1.000000	0.71417	0.998000	0.56505	0.495000	0.33615	5.463000	0.66712	2.228000	0.72767	0.491000	0.48974	TGG	.		0.652	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
MTHFSD	64779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	86565821	86565821	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr16:86565821G>A	ENST00000360900.6	-	8	973	c.948C>T	c.(946-948)gaC>gaT	p.D316D	MTHFSD_ENST00000543303.2_Silent_p.D315D|MTHFSD_ENST00000322911.6_Silent_p.D315D|MTHFSD_ENST00000381214.5_Silent_p.D316D|MTHFSD_ENST00000546093.1_Silent_p.D153D	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	316	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						TCACACGGGCGTCCCCGGGGA	0.682																																					p.D316D		.											.	MTHFSD-90	0			c.C948T						.						11.0	14.0	13.0					16																	86565821		1876	4097	5973	SO:0001819	synonymous_variant	64779	exon8			ACGGGCGTCCCCG	AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.948C>T	16.37:g.86565821G>A		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	143	25	NM_001159377	0	0	0	0	0	A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Silent	SNP	ENST00000360900.6	37	CCDS54047.1																																																																																			.		0.682	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432182.1	NM_022764	
MYH10	4628	ucsc.edu;bcgsc.ca	37	17	8424548	8424548	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr17:8424548G>A	ENST00000269243.4	-	16	2058	c.1920C>T	c.(1918-1920)ggC>ggT	p.G640G	MYH10_ENST00000379980.4_Silent_p.G656G|MYH10_ENST00000360416.3_Silent_p.G671G|MYH10_ENST00000396239.1_Silent_p.G661G	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	640	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TATATGCGGAGCCAAAAGCTG	0.473																																					p.G671G													.	MYH10-92	0			c.C2013T						.						174.0	165.0	168.0					17																	8424548		2203	4300	6503	SO:0001819	synonymous_variant	4628	exon18			TGCGGAGCCAAAA	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.1920C>T	17.37:g.8424548G>A		Somatic	222	2		WXS	Illumina HiSeq		185	42	NM_001256012	0	0	3	5	2	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	37	CCDS11144.1																																																																																			.		0.473	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
GIT1	28964	bcgsc.ca	37	17	27902918	27902918	+	Splice_Site	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr17:27902918T>C	ENST00000225394.3	-	16	1914		c.e16-2		GIT1_ENST00000394869.3_Splice_Site|RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000579937.1_Splice_Site|GIT1_ENST00000581348.1_Intron	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1						regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		TTTCCGGATCTGAAACCCAGG	0.622																																					.	Colon(81;41 1719 20078 35068)												.	GIT1-251	0			c.1666-2A>G						.						85.0	91.0	89.0					17																	27902918		2200	4294	6494	SO:0001630	splice_region_variant	28964	exon17			CGGATCTGAAACC	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1666-2A>G	17.37:g.27902918T>C		Somatic	128	0		WXS	Illumina HiSeq	Phase_1	126	5	NM_014030	0	0	0	0	0	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Splice_Site	SNP	ENST00000225394.3	37	CCDS11250.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.150346	0.57151	.	.	ENSG00000108262	ENST00000225394;ENST00000394869	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.811	0.69994	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GIT1	24927044	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	5.079000	0.64431	2.157000	0.67596	0.379000	0.24179	.	.		0.622	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	NM_014030	Intron
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305800	39305800	+	Missense_Mutation	SNP	T	T	A	rs141998775		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr17:39305800T>A	ENST00000343246.4	-	1	254	c.220A>T	c.(220-222)Agc>Tgc	p.S74C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	74	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacag	0.657																																					p.S74C		.											.	KRTAP4-5-90	0			c.A220T						.						12.0	18.0	16.0					17																	39305800		2056	4148	6204	SO:0001583	missense	85289	exon1			AGCAGCTGGATTC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.220A>T	17.37:g.39305800T>A	ENSP00000340546:p.Ser74Cys	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	84	21	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.946118	0.34377	.	.	ENSG00000198271	ENST00000343246	T	0.00633	6.08	3.65	2.55	0.30701	.	.	.	.	.	T	0.01287	0.0042	N	0.25957	0.775	0.22412	N	0.999125	D	0.76494	0.999	D	0.63703	0.917	T	0.57015	-0.7883	9	0.59425	D	0.04	.	7.2679	0.26239	0.0:0.1123:0.0:0.8877	.	74	Q9BYR2	KRA45_HUMAN	C	74	ENSP00000340546:S74C	ENSP00000340546:S74C	S	-	1	0	KRTAP4-5	36559326	0.004000	0.15560	0.084000	0.20598	0.021000	0.10359	-0.223000	0.09177	0.555000	0.29079	0.358000	0.22013	AGC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
ACLY	47	ucsc.edu	37	17	40028342	40028342	+	Silent	SNP	A	A	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr17:40028342A>T	ENST00000352035.2	-	24	2866	c.2736T>A	c.(2734-2736)atT>atA	p.I912I	ACLY_ENST00000537919.1_Silent_p.I641I|ACLY_ENST00000588779.1_5'Flank|ACLY_ENST00000353196.1_Silent_p.I902I|ACLY_ENST00000393896.2_Silent_p.I902I|ACLY_ENST00000590151.1_Silent_p.I912I	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	912					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CTCGCGCACAAATGATGGTGT	0.562																																					p.I912I	Colon(64;807 1396 15971 30971)												.	ACLY-228	0			c.T2736A						.						82.0	69.0	74.0					17																	40028342		2203	4300	6503	SO:0001819	synonymous_variant	47	exon24			CGCACAAATGATG	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.2736T>A	17.37:g.40028342A>T		Somatic	173	0		WXS	Illumina HiSeq		143	6	NM_001096	0	0	40	45	5	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	ENST00000352035.2	37	CCDS11412.1																																																																																			.		0.562	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
ACSF2	80221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48541577	48541577	+	Splice_Site	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr17:48541577A>G	ENST00000300441.4	+	10	1242		c.e10-1		ACSF2_ENST00000502667.1_Splice_Site|ACSF2_ENST00000427954.2_Splice_Site|ACSF2_ENST00000504392.1_Splice_Site|ACSF2_ENST00000541920.1_Splice_Site	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2						fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TCTCTGATTCAGGTGTCATTG	0.547																																					.		.											.	ACSF2-68	0			c.1139-2A>G						.						130.0	117.0	121.0					17																	48541577		2203	4300	6503	SO:0001630	splice_region_variant	80221	exon10			TGATTCAGGTGTC	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1139-1A>G	17.37:g.48541577A>G		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	129	44	NM_025149	0	0	0	1	1	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Splice_Site	SNP	ENST00000300441.4	37	CCDS11567.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.562393	0.65538	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.256	0.66053	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSF2	45896576	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.372000	0.79612	2.016000	0.59253	0.533000	0.62120	.	.		0.547	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367423.3	NM_025149	Intron
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11134286	11134286	+	Silent	SNP	C	C	G	rs371276213		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:11134286C>G	ENST00000429416.3	+	21	3233	c.2952C>G	c.(2950-2952)gtC>gtG	p.V984V	SMARCA4_ENST00000358026.2_Silent_p.V984V|SMARCA4_ENST00000444061.3_Silent_p.V984V|SMARCA4_ENST00000589677.1_Silent_p.V984V|SMARCA4_ENST00000413806.3_Silent_p.V984V|SMARCA4_ENST00000344626.4_Silent_p.V984V|SMARCA4_ENST00000590574.1_Silent_p.V984V|SMARCA4_ENST00000541122.2_Silent_p.V984V|SMARCA4_ENST00000450717.3_Silent_p.V984V	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	984					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				AGAAGGAAGTCGAGGCCCAGT	0.597			"""F, N, Mis"""		NSCLC																																p.V984V		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.C2952G						.						46.0	42.0	44.0					19																	11134286		2202	4300	6502	SO:0001819	synonymous_variant	6597	exon20			GGAAGTCGAGGCC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2952C>G	19.37:g.11134286C>G		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	142	26	NM_003072	0	0	24	33	9	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Silent	SNP	ENST00000429416.3	37	CCDS12253.1																																																																																			.		0.597	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
NCCRP1	342897	hgsc.bcm.edu	37	19	39687743	39687743	+	Silent	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:39687743C>T	ENST00000339852.4	+	1	143	c.121C>T	c.(121-123)Ctg>Ttg	p.L41L		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	41	Pro-rich.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						gccgccaccactgccctcgcc	0.776																																					p.L41L	Melanoma(107;1207 1556 14956 29427 52130)	.											.	NCCRP1-91	0			c.C121T						.						2.0	3.0	3.0					19																	39687743		1158	2257	3415	SO:0001819	synonymous_variant	342897	exon1			CCACCACTGCCCT	AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.121C>T	19.37:g.39687743C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	9	5	NM_001001414	0	0	0	0	0	Q6NVV5	Silent	SNP	ENST00000339852.4	37	CCDS12529.1																																																																																			.		0.776	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463829.1	NM_001001414	
DHX34	9704	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47856826	47856826	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:47856826T>C	ENST00000328771.4	+	2	888	c.539T>C	c.(538-540)gTg>gCg	p.V180A		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	180	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GAGCACCAGGTGGTGGTAGTG	0.662																																					p.V180A													.	DHX34-231	0			c.T539C						.						34.0	38.0	36.0					19																	47856826		2203	4299	6502	SO:0001583	missense	9704	exon2			ACCAGGTGGTGGT	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.539T>C	19.37:g.47856826T>C	ENSP00000331907:p.Val180Ala	Somatic	63	1		WXS	Illumina HiSeq	Phase_I	56	19	NM_014681	0	0	2	2	0	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493784	0.84962	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.14266	2.52	5.26	5.26	0.73747	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.47852	D	0.000215	T	0.42063	0.1186	M	0.84846	2.72	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.996	T	0.47368	-0.9123	10	0.87932	D	0	-25.0325	14.1501	0.65378	0.0:0.0:0.0:1.0	.	180;180	Q14147;B4E3G3	DHX34_HUMAN;.	A	180	ENSP00000331907:V180A	ENSP00000257252:V180A	V	+	2	0	DHX34	52548666	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.672000	0.83956	1.992000	0.58205	0.454000	0.30748	GTG	.		0.662	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
LILRB1	10859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55143956	55143956	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:55143956A>G	ENST00000396331.1	+	7	1060	c.703A>G	c.(703-705)Atc>Gtc	p.I235V	LILRB1_ENST00000448689.1_Missense_Mutation_p.I235V|LILRB1_ENST00000396332.4_Missense_Mutation_p.I235V|LILRB1_ENST00000434867.2_Missense_Mutation_p.I235V|LILRB1_ENST00000396327.3_Missense_Mutation_p.I235V|LILRB1_ENST00000418536.2_Missense_Mutation_p.I235V|LILRB1_ENST00000396317.1_Missense_Mutation_p.I235V|LILRB1_ENST00000427581.2_Missense_Mutation_p.I271V|LILRB1_ENST00000324602.7_Missense_Mutation_p.I235V|LILRB1_ENST00000396315.1_Missense_Mutation_p.I235V|LILRB1_ENST00000396321.2_Missense_Mutation_p.I235V	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	235	Ig-like C2-type 3.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GCCAGGTCCTATCGTGGCCCC	0.537										HNSCC(37;0.09)																											p.I235V		.											.	LILRB1-137	0			c.A703G						.						98.0	102.0	101.0					19																	55143956		2203	4300	6503	SO:0001583	missense	10859	exon6			GGTCCTATCGTGG	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.703A>G	19.37:g.55143956A>G	ENSP00000379622:p.Ile235Val	Somatic	333	0		WXS	Illumina HiSeq	Phase_I	264	83	NM_001081637	0	0	9	9	0	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.218786	0.00286	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.10477	2.87;2.87;2.87;2.87;2.87;2.87;2.87;2.87;2.87;2.87;2.87	1.49	-1.31	0.09230	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.873016	0.09637	N	0.775542	T	0.01592	0.0051	N	0.00219	-1.825	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.11329	0.001;0.001;0.006;0.001;0.002	T	0.39014	-0.9634	10	0.02654	T	1	.	2.0446	0.03557	0.3776:0.0:0.3682:0.2542	.	235;235;235;235;235	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	V	235;235;235;235;235;235;235;235;271;235;235	ENSP00000379614:I235V;ENSP00000391514:I235V;ENSP00000409968:I235V;ENSP00000379622:I235V;ENSP00000379618:I235V;ENSP00000315997:I235V;ENSP00000405243:I235V;ENSP00000379623:I235V;ENSP00000395004:I271V;ENSP00000379610:I235V;ENSP00000379608:I235V	ENSP00000315997:I235V	I	+	1	0	LILRB1	59835768	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.930000	0.03972	-0.750000	0.04740	-1.160000	0.01791	ATC	.		0.537	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
CAD	790	broad.mit.edu	37	2	27462296	27462296	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr2:27462296G>A	ENST00000403525.1	+	32	5306	c.5162G>A	c.(5161-5163)cGc>cAc	p.R1721H	CAD_ENST00000264705.4_Missense_Mutation_p.R1784H			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCACCGTCCGCCGTGTGGTC	0.577																																					p.R1784H													.	CAD-295	0			c.G5351A						.						84.0	72.0	76.0					2																	27462296		2203	4300	6503	SO:0001583	missense	790	exon33			CCGTCCGCCGTGT	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.5162G>A	2.37:g.27462296G>A	ENSP00000384510:p.Arg1721His	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	151	5	NM_004341	0	0	21	24	3	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	G	3.326	-0.137714	0.06711	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.98455	-4.94;-4.88	4.88	4.88	0.63580	Metal-dependent hydrolase, composite domain (1);	0.105066	0.64402	D	0.000004	D	0.96334	0.8804	N	0.26162	0.8	0.48901	D	0.99972	B;D	0.65815	0.005;0.995	B;P	0.53146	0.006;0.719	D	0.94637	0.7827	10	0.02654	T	1	-15.6878	16.9731	0.86305	0.0:0.0:1.0:0.0	.	1721;1784	F8VPD4;P27708	.;PYR1_HUMAN	H	1784;1721	ENSP00000264705:R1784H;ENSP00000384510:R1721H	ENSP00000264705:R1784H	R	+	2	0	CAD	27315800	1.000000	0.71417	0.999000	0.59377	0.438000	0.31896	5.691000	0.68249	2.407000	0.81776	0.561000	0.74099	CGC	.		0.577	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
GIGYF2	26058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233651899	233651899	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr2:233651899G>C	ENST00000409547.1	+	11	883	c.572G>C	c.(571-573)gGg>gCg	p.G191A	GIGYF2_ENST00000409196.3_Missense_Mutation_p.G191A|GIGYF2_ENST00000452341.2_Missense_Mutation_p.G22A|GIGYF2_ENST00000373563.4_Missense_Mutation_p.G191A|GIGYF2_ENST00000373566.3_Missense_Mutation_p.G213A|GIGYF2_ENST00000409451.3_Missense_Mutation_p.G213A|GIGYF2_ENST00000409480.1_Missense_Mutation_p.G213A	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	191	Arg-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		ACATCAGTAGGGAGAAAGCAT	0.403																																					p.G213A		.											.	GIGYF2-28	0			c.G638C						.						104.0	106.0	106.0					2																	233651899		2203	4300	6503	SO:0001583	missense	26058	exon11			CAGTAGGGAGAAA	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.572G>C	2.37:g.233651899G>C	ENSP00000386537:p.Gly191Ala	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	92	16	NM_001103147	0	0	0	3	3	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.498686	0.64298	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000445650;ENST00000452341;ENST00000421778	T;T;T;T;T;T;T;T;T;T	0.78364	-0.69;-0.69;-0.69;-0.69;-1.02;-0.7;-0.69;-0.82;-1.17;-0.89	5.63	5.63	0.86233	.	0.192608	0.46442	D	0.000288	D	0.86247	0.5887	L	0.57536	1.79	0.36437	D	0.865276	D;D;P;D	0.76494	0.999;0.982;0.953;0.989	D;P;B;P	0.75484	0.986;0.898;0.371;0.874	D	0.84937	0.0863	10	0.29301	T	0.29	-24.5013	20.0345	0.97552	0.0:0.0:1.0:0.0	.	22;213;191;191	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	A	213;140;191;213;191;191;140;191;213;191;22;22;18	ENSP00000362667:G213A;ENSP00000362664:G191A;ENSP00000386765:G213A;ENSP00000386537:G191A;ENSP00000404195:G140A;ENSP00000387070:G191A;ENSP00000387170:G213A;ENSP00000410297:G191A;ENSP00000392218:G22A;ENSP00000411505:G22A	ENSP00000362664:G191A	G	+	2	0	GIGYF2	233360143	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.552000	0.67281	2.797000	0.96272	0.655000	0.94253	GGG	.		0.403	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																					p.L117L													.	CST1-91	1	Substitution - coding silent(1)	lung(1)	c.G351A						.						93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469	exon3			AGAGCACAACTGT	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T		Somatic	157	1		WXS	Illumina HiSeq	Phase_I	138	5	NM_001898	0	0	0	0	0	Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																			.		0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
HNF4A	3172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	42984469	42984469	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr20:42984469G>T	ENST00000316673.4	+	1	130	c.25G>T	c.(25-27)Ggg>Tgg	p.G9W	HNF4A_ENST00000609795.1_Missense_Mutation_p.G9W|RP5-881L22.5_ENST00000438702.1_RNA|HNF4A_ENST00000457232.1_Missense_Mutation_p.G9W			P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	157					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G9W(1)		endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CGCGCCCCTCGGGGCTCCAGT	0.682																																					p.G9W	Colon(79;2 1269 8820 14841 52347)	.											.	HNF4A-227	1	Substitution - Missense(1)	lung(1)	c.G25T						.						24.0	28.0	26.0					20																	42984469		2037	4184	6221	SO:0001583	missense	3172	exon1			CCCCTCGGGGCTC	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316673.4:c.25G>T	20.37:g.42984469G>T	ENSP00000315180:p.Gly9Trp	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	75	16	NM_001030003	0	0	0	0	0	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316673.4	37	CCDS42876.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213853	0.39102	.	.	ENSG00000101076	ENST00000316673;ENST00000457232	D;D	0.92595	-3.07;-3.06	4.98	3.04	0.35103	.	.	.	.	.	D	0.91099	0.7198	N	0.24115	0.695	0.80722	D	1	D;D;P	0.71674	0.998;0.998;0.948	D;D;P	0.70227	0.93;0.968;0.759	D	0.89491	0.3757	9	0.72032	D	0.01	.	7.9382	0.29941	0.1907:0.0:0.8093:0.0	.	9;9;9	F1D8T0;P41235-6;P41235-7	.;.;.	W	9	ENSP00000315180:G9W;ENSP00000396216:G9W	ENSP00000315180:G9W	G	+	1	0	HNF4A	42417883	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.571000	0.45990	0.635000	0.30488	-0.136000	0.14681	GGG	.		0.682	HNF4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079362.2		
GGT5	2687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24628898	24628898	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr22:24628898G>C	ENST00000327365.4	-	4	905	c.489C>G	c.(487-489)ttC>ttG	p.F163L	GGT5_ENST00000398292.3_Missense_Mutation_p.F163L|GGT5_ENST00000263112.7_Missense_Mutation_p.F131L|GGT5_ENST00000418439.2_Missense_Mutation_p.P88A	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	163					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						TGGTGGGCTGGAACAGCTGCG	0.701																																					p.F163L		.											.	GGT5-71	0			c.C489G						.						23.0	25.0	24.0					22																	24628898		2184	4285	6469	SO:0001583	missense	2687	exon4			GGGCTGGAACAGC	M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.489C>G	22.37:g.24628898G>C	ENSP00000330080:p.Phe163Leu	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	193	36	NM_001099781	0	0	1	1	0	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	37	CCDS13825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.533985|4.533985	0.85812|0.85812	.|.	.|.	ENSG00000099998|ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292|ENST00000418439	T;T;T|T	0.03717|0.66638	3.83;3.83;3.83|-0.22	4.32|4.32	3.3|3.3	0.37823|0.37823	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58264|0.58264	0.2110|0.2110	M|M	0.64997|0.64997	1.995|1.995	0.25198|0.25198	N|N	0.990074|0.990074	D;D;B;D|B	0.69078|0.25667	0.967;0.997;0.095;0.997|0.131	P;D;B;D|B	0.67900|0.25140	0.775;0.954;0.129;0.954|0.058	T|T	0.45469|0.45469	-0.9259|-0.9259	10|9	0.72032|0.17369	D|T	0.01|0.5	-37.4629|-37.4629	6.7667|6.7667	0.23571|0.23571	0.2119:0.0:0.7881:0.0|0.2119:0.0:0.7881:0.0	.|.	131;163;163;163|88	P36269-2;Q53XM9;Q6GMP0;P36269|E7EUG3	.;.;.;GGT5_HUMAN|.	L|A	163;131;78;163|88	ENSP00000330080:F163L;ENSP00000263112:F131L;ENSP00000381340:F163L|ENSP00000392146:P88A	ENSP00000263112:F131L|ENSP00000392146:P88A	F|P	-|-	3|1	2|0	GGT5|GGT5	22958898|22958898	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.180000|1.180000	0.32005|0.32005	1.170000|1.170000	0.42753|0.42753	0.585000|0.585000	0.79938|0.79938	TTC|CCA	.		0.701	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
TTC28	23331	broad.mit.edu	37	22	28504235	28504235	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr22:28504235G>T	ENST00000397906.2	-	7	1739	c.1598C>A	c.(1597-1599)gCg>gAg	p.A533E		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	533					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GTATTTGACCGCCTGGTCGTA	0.592																																					p.A533E													.	.	0			c.C1598A						.						60.0	62.0	61.0					22																	28504235		692	1591	2283	SO:0001583	missense	23331	exon7			TTGACCGCCTGGT	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.1598C>A	22.37:g.28504235G>T	ENSP00000381003:p.Ala533Glu	Somatic	97	2		WXS	Illumina HiSeq	Phase_I	88	9	NM_001145418	0	0	2	2	0	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486076	0.84854	.	.	ENSG00000100154	ENST00000397906	D	0.99304	-5.72	5.91	5.91	0.95273	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.99691	0.9883	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97637	1.0146	10	0.72032	D	0.01	-17.0032	19.2867	0.94077	0.0:0.0:1.0:0.0	.	533	Q96AY4	TTC28_HUMAN	E	533	ENSP00000381003:A533E	ENSP00000381003:A533E	A	-	2	0	TTC28	26834235	1.000000	0.71417	0.968000	0.41197	0.986000	0.74619	9.238000	0.95380	2.793000	0.96121	0.655000	0.94253	GCG	.		0.592	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
CSNK1E	1454	broad.mit.edu	37	22	38699223	38699223	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr22:38699223G>A	ENST00000396832.1	-	3	367	c.107C>T	c.(106-108)gCc>gTc	p.A36V	CSNK1E_ENST00000413574.2_Missense_Mutation_p.A36V|CSNK1E_ENST00000400206.2_Missense_Mutation_p.A36V|CSNK1E_ENST00000405675.3_Missense_Mutation_p.A36V|CSNK1E_ENST00000359867.3_Missense_Mutation_p.A36V|CSNK1E_ENST00000403904.1_Missense_Mutation_p.A36V	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	36	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					CAGCTTGATGGCGACTTCCTC	0.632																																					p.A36V	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)												.	CSNK1E-1193	0			c.C107T						.						67.0	38.0	48.0					22																	38699223		2202	4300	6502	SO:0001583	missense	1454	exon3			TTGATGGCGACTT		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.107C>T	22.37:g.38699223G>A	ENSP00000380044:p.Ala36Val	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	57	4	NM_001894	0	0	18	18	0		Missense_Mutation	SNP	ENST00000396832.1	37	CCDS13970.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501307	0.64298	.	.	ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675;ENST00000430335	T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.64	4.63	0.57726	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050330	0.85682	D	0.000000	D	0.88157	0.6361	M	0.90145	3.09	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.83275	0.8;0.988;0.996	D	0.90538	0.4500	10	0.87932	D	0	.	14.2141	0.65781	0.0723:0.0:0.9277:0.0	.	36;36;36	B0QY35;B0QY34;P49674	.;.;KC1E_HUMAN	V	36	ENSP00000352929:A36V;ENSP00000380044:A36V;ENSP00000383067:A36V;ENSP00000384074:A36V;ENSP00000407235:A36V;ENSP00000384426:A36V;ENSP00000412335:A36V	ENSP00000352929:A36V	A	-	2	0	CSNK1E	37029169	1.000000	0.71417	0.960000	0.40013	0.000000	0.00434	9.869000	0.99810	1.399000	0.46721	-0.136000	0.14681	GCC	.		0.632	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
NUP210	23225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	13438880	13438880	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr3:13438880T>C	ENST00000254508.5	-	3	495	c.413A>G	c.(412-414)aAg>aGg	p.K138R		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	138					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GGCCTGGATCTTCAGCTCCAG	0.602																																					p.K138R		.											.	NUP210-256	0			c.A413G						.						67.0	63.0	64.0					3																	13438880		2203	4300	6503	SO:0001583	missense	23225	exon3			TGGATCTTCAGCT	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.413A>G	3.37:g.13438880T>C	ENSP00000254508:p.Lys138Arg	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	85	25	NM_024923	0	0	1	4	3	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	T	5.986	0.365927	0.11352	.	.	ENSG00000132182	ENST00000254508	T	0.04758	3.56	3.96	2.77	0.32553	.	0.049223	0.85682	D	0.000000	T	0.03608	0.0103	L	0.33137	0.985	0.43203	D	0.995057	B	0.31817	0.341	B	0.31245	0.126	T	0.39099	-0.9630	10	0.07325	T	0.83	-12.7074	9.9009	0.41346	0.0:0.0:0.172:0.8279	.	138	Q8TEM1	PO210_HUMAN	R	138	ENSP00000254508:K138R	ENSP00000254508:K138R	K	-	2	0	NUP210	13413880	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	2.196000	0.42686	0.680000	0.31366	0.454000	0.30748	AAG	.		0.602	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
NME6	10201	broad.mit.edu	37	3	48336157	48336157	+	Silent	SNP	T	T	C	rs148416956		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr3:48336157T>C	ENST00000452211.1	-	7	768	c.531A>G	c.(529-531)gtA>gtG	p.V177V	NME6_ENST00000451657.1_Nonstop_Mutation_p.*164W|NME6_ENST00000421967.1_Silent_p.V185V|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000415644.1_Silent_p.V110V|NME6_ENST00000447314.1_Silent_p.V132V|NME6_ENST00000444069.1_5'UTR|NME6_ENST00000442597.1_Silent_p.V177V|NME6_ENST00000435684.1_Nonstop_Mutation_p.*164W|NME6_ENST00000415053.1_Silent_p.V177V|NME6_ENST00000450160.1_Nonstop_Mutation_p.*164W|NME6_ENST00000426689.2_Silent_p.V177V|NME6_ENST00000426723.1_Silent_p.V110V			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	177					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		CTGTTCCAGCTACATAGTGGA	0.537																																					p.V185V													.	NME6-115	0			c.A555G						.						106.0	96.0	99.0					3																	48336157		2203	4300	6503	SO:0001819	synonymous_variant	10201	exon6			TCCAGCTACATAG	AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.531A>G	3.37:g.48336157T>C		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	124	3	NM_005793	0	0	12	12	0	B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Silent	SNP	ENST00000452211.1	37		.	.	.	.	.	.	.	.	.	.	T	10.38	1.333284	0.24167	.	.	ENSG00000172113	ENST00000450160;ENST00000451657;ENST00000435684	.	.	.	4.24	-2.59	0.06209	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.1032	1.421	0.02312	0.1641:0.3655:0.1684:0.3019	.	.	.	.	W	164	.	.	X	-	2	0	NME6	48311161	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	-0.893000	0.04127	-0.303000	0.08856	0.459000	0.35465	TAG	T|1.000;A|0.000		0.537	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000346107.1	NM_005793	
RBM5	10181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50147868	50147868	+	Silent	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr3:50147868T>C	ENST00000347869.3	+	16	1510	c.1335T>C	c.(1333-1335)ccT>ccC	p.P445P	RBM5_ENST00000441812.2_Intron	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	445	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCGCTTCCCCTACTGGTGTAG	0.458																																					p.P445P		.											.	RBM5-278	0			c.T1335C						.						54.0	58.0	56.0					3																	50147868		2203	4300	6503	SO:0001819	synonymous_variant	10181	exon16			TTCCCCTACTGGT	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1335T>C	3.37:g.50147868T>C		Somatic	180	0		WXS	Illumina HiSeq	Phase_I	149	36	NM_005778	0	0	14	32	18	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Silent	SNP	ENST00000347869.3	37	CCDS2810.1																																																																																			.		0.458	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
GOLIM4	27333	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	167747034	167747034	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr3:167747034T>C	ENST00000470487.1	-	11	2179	c.1490A>G	c.(1489-1491)cAg>cGg	p.Q497R	GOLIM4_ENST00000309027.4_Missense_Mutation_p.Q469R	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	497	Gln-rich.|Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TTGGATTCCCTGGTCCTCTGC	0.383																																					p.Q497R		.											.	GOLIM4-291	0			c.A1490G						.						133.0	116.0	122.0					3																	167747034		2203	4300	6503	SO:0001583	missense	27333	exon11			ATTCCCTGGTCCT	U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.1490A>G	3.37:g.167747034T>C	ENSP00000417354:p.Gln497Arg	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	90	6	NM_014498	0	0	9	9	0		Missense_Mutation	SNP	ENST00000470487.1	37	CCDS3204.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.305022	0.60305	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	4.97	4.97	0.65823	.	0.242984	0.44097	D	0.000487	T	0.69575	0.3126	M	0.74881	2.28	0.43029	D	0.994599	D;D	0.64830	0.994;0.989	D;P	0.67103	0.949;0.814	T	0.68405	-0.5417	9	0.09590	T	0.72	-18.1647	11.9183	0.52778	0.0:0.0:0.1451:0.8549	.	469;497	F8W785;O00461	.;GOLI4_HUMAN	R	497;469	.	ENSP00000309893:Q469R	Q	-	2	0	GOLIM4	169229728	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	4.279000	0.58953	1.884000	0.54569	0.449000	0.29647	CAG	.		0.383	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351278.2		
HTT	3064	broad.mit.edu	37	4	3123099	3123099	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:3123099A>C	ENST00000355072.5	+	9	1358	c.1213A>C	c.(1213-1215)Acc>Ccc	p.T405P		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	405					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TGGGCAGCTCACCGCTGCTAA	0.547																																					p.T405P													.	HTT-281	0			c.A1213C						.						63.0	65.0	65.0					4																	3123099		1951	4145	6096	SO:0001583	missense	3064	exon9			CAGCTCACCGCTG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.1213A>C	4.37:g.3123099A>C	ENSP00000347184:p.Thr405Pro	Somatic	138	1		WXS	Illumina HiSeq	Phase_I	142	5	NM_002111	0	0	3	3	0	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.188909	0.38707	.	.	ENSG00000197386	ENST00000355072	T	0.05258	3.47	4.52	-9.03	0.00737	Armadillo-type fold (1);	0.764838	0.12277	N	0.483307	T	0.02533	0.0077	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33523	-0.9865	10	0.33141	T	0.24	.	0.7871	0.01051	0.2351:0.186:0.3049:0.2739	.	405	P42858	HD_HUMAN	P	405	ENSP00000347184:T405P	ENSP00000347184:T405P	T	+	1	0	HTT	3092897	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.501000	0.06398	-2.465000	0.00533	0.533000	0.62120	ACC	.		0.547	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
EVC	2121	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	5754739	5754739	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:5754739G>A	ENST00000264956.6	+	9	1459	c.1275G>A	c.(1273-1275)caG>caA	p.Q425Q	EVC_ENST00000382674.2_Silent_p.Q425Q|EVC_ENST00000509451.1_Silent_p.Q425Q	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	425					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				TCACGCAGCAGCACAAGGCCT	0.692																																					p.Q425Q													.	EVC-92	0			c.G1275A						.						20.0	20.0	20.0					4																	5754739		2203	4297	6500	SO:0001819	synonymous_variant	2121	exon9			GCAGCAGCACAAG	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1275G>A	4.37:g.5754739G>A		Somatic	157	2		WXS	Illumina HiSeq	Phase_I	134	43	NM_153717	0	0	10	32	22		Silent	SNP	ENST00000264956.6	37	CCDS3383.1																																																																																			.		0.692	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
KIAA0232	9778	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	6860177	6860177	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:6860177G>A	ENST00000307659.5	+	6	917	c.462G>A	c.(460-462)gaG>gaA	p.E154E	KIAA0232_ENST00000425103.1_Silent_p.E154E	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	154							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AAAAGTTAGAGGGGTCTCCCT	0.328																																					p.E154E													.	KIAA0232-92	0			c.G462A						.						41.0	39.0	40.0					4																	6860177		1811	4075	5886	SO:0001819	synonymous_variant	9778	exon6			GTTAGAGGGGTCT	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.462G>A	4.37:g.6860177G>A		Somatic	398	2		WXS	Illumina HiSeq	Phase_I	292	86	NM_014743	0	0	1	2	1	A7E2D2	Silent	SNP	ENST00000307659.5	37	CCDS43209.1																																																																																			.		0.328	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
APBB2	323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	40818110	40818110	+	Nonstop_Mutation	SNP	T	T	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:40818110T>A	ENST00000295974.8	-	18	2905	c.2276A>T	c.(2275-2277)tAg>tTg	p.*759L	APBB2_ENST00000504305.1_Nonstop_Mutation_p.*211L|RP11-632F7.3_ENST00000513127.1_RNA|APBB2_ENST00000506352.1_Nonstop_Mutation_p.*738L|APBB2_ENST00000508593.1_Nonstop_Mutation_p.*760L|APBB2_ENST00000513140.1_Nonstop_Mutation_p.*737L|APBB2_ENST00000543538.1_Nonstop_Mutation_p.*211L|APBB2_ENST00000502841.1_Nonstop_Mutation_p.*211L	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	0					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						CATGTGCAGCTATGGCATTTC	0.458																																					p.X760L	Ovarian(3;20 75 16686 49997)	.											.	APBB2-92	0			c.A2279T						.						255.0	249.0	251.0					4																	40818110		1979	4157	6136	SO:0001578	stop_lost	323	exon18			TGCAGCTATGGCA	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.2276A>T	4.37:g.40818110T>A		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	99	22	NM_004307	0	0	4	6	2	B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	ENST00000295974.8	37	CCDS54761.1	.	.	.	.	.	.	.	.	.	.	T	14.70	2.614383	0.46631	.	.	ENSG00000163697	ENST00000295974;ENST00000316212;ENST00000543538;ENST00000513140;ENST00000508593;ENST00000502841;ENST00000506352;ENST00000504305	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3812	0.74658	0.0:0.0:0.0:1.0	.	.	.	.	L	759;758;211;737;760;211;738;211	.	.	X	-	2	0	APBB2	40512867	1.000000	0.71417	0.936000	0.37596	0.073000	0.16967	8.000000	0.88501	2.040000	0.60383	0.477000	0.44152	TAG	.		0.458	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075	
FRYL	285527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48536646	48536646	+	Silent	SNP	A	A	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:48536646A>G	ENST00000503238.1	-	46	6620	c.6621T>C	c.(6619-6621)agT>agC	p.S2207S	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Silent_p.S2207S|FRYL_ENST00000537810.1_Silent_p.S2207S|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	2207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GACTCAATAGACTATAAATAA	0.333																																					p.S2207S		.											.	FRYL-69	0			c.T6621C						.						76.0	72.0	73.0					4																	48536646		1829	4086	5915	SO:0001819	synonymous_variant	285527	exon49			CAATAGACTATAA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.6621T>C	4.37:g.48536646A>G		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	67	10	NM_015030	0	0	4	4	0	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	A	0.350	-0.945182	0.02304	.	.	ENSG00000075539	ENST00000514617	T	0.12879	2.64	5.57	-1.09	0.09904	.	0.000000	0.85682	D	0.000000	T	0.18882	0.0453	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02844	-1.1103	7	0.35671	T	0.21	.	10.974	0.47454	0.529:0.0:0.471:0.0	.	.	.	.	P	1077	ENSP00000425344:S1077P	ENSP00000425344:S1077P	S	-	1	0	FRYL	48231403	1.000000	0.71417	0.766000	0.31476	0.006000	0.05464	1.028000	0.30128	0.032000	0.15435	-0.256000	0.11100	TCT	.		0.333	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
SMARCAD1	56916	broad.mit.edu	37	4	95204298	95204298	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:95204298C>G	ENST00000354268.4	+	22	2826	c.2753C>G	c.(2752-2754)aCc>aGc	p.T918S	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.T920S|SMARCAD1_ENST00000509418.1_Missense_Mutation_p.T488S			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	918	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		GAGTTTAATACCGATATGGAT	0.289																																					p.T920S													.	SMARCAD1-229	0			c.C2759G						.						83.0	82.0	82.0					4																	95204298		2203	4300	6503	SO:0001583	missense	56916	exon22			TTAATACCGATAT	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2753C>G	4.37:g.95204298C>G	ENSP00000346217:p.Thr918Ser	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	101	3	NM_001128429	0	0	5	5	0	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	C	7.713	0.695510	0.15106	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	5.33	5.33	0.75918	Helicase, C-terminal (3);	0.000000	0.51477	D	0.000097	T	0.53142	0.1778	N	0.02802	-0.49	0.58432	D	0.999992	B;B	0.14012	0.009;0.007	B;B	0.16722	0.016;0.009	T	0.51560	-0.8690	10	0.14656	T	0.56	-9.5026	19.0231	0.92922	0.0:1.0:0.0:0.0	.	918;920	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	S	920;920;918;488	ENSP00000351947:T920S;ENSP00000415576:T920S;ENSP00000346217:T918S;ENSP00000423286:T488S	ENSP00000346217:T918S	T	+	2	0	SMARCAD1	95423321	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.835000	0.55805	2.493000	0.84123	0.591000	0.81541	ACC	.		0.289	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
BBS7	55212	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	122774226	122774226	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr4:122774226T>A	ENST00000264499.4	-	8	917	c.734A>T	c.(733-735)gAc>gTc	p.D245V	BBS7_ENST00000506636.1_Missense_Mutation_p.D245V	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	245					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GTCAAAGCTGTCAATACACAA	0.333									Bardet-Biedl syndrome																												p.D245V													.	BBS7-91	0			c.A734T						.						115.0	100.0	105.0					4																	122774226		2203	4300	6503	SO:0001583	missense	55212	exon8	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AAGCTGTCAATAC	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.734A>T	4.37:g.122774226T>A	ENSP00000264499:p.Asp245Val	Somatic	215	1		WXS	Illumina HiSeq	Phase_I	193	58	NM_018190	0	0	3	5	2	Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	37	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.169776	0.78452	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	D;D	0.91843	-2.92;-2.92	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.89962	0.6867	L	0.52126	1.63	0.80722	D	1	B	0.32350	0.366	B	0.37091	0.241	D	0.87512	0.2440	10	0.22109	T	0.4	-16.8022	15.156	0.72743	0.0:0.0:0.0:1.0	.	245	Q8IWZ6	BBS7_HUMAN	V	245	ENSP00000264499:D245V;ENSP00000423626:D245V	ENSP00000264499:D245V	D	-	2	0	BBS7	122993676	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.777000	0.85628	1.990000	0.58119	0.477000	0.44152	GAC	.		0.333	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1		
PDLIM4	8572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131602211	131602211	+	Silent	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr5:131602211C>T	ENST00000253754.3	+	3	364	c.300C>T	c.(298-300)caC>caT	p.H100H	PDLIM4_ENST00000379018.3_Silent_p.H100H|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	100							zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTCAGGCACACAGGATCCACA	0.592																																					p.H100H		.											.	PDLIM4-91	0			c.C300T						.						93.0	69.0	77.0					5																	131602211		2203	4300	6503	SO:0001819	synonymous_variant	8572	exon3			GGCACACAGGATC	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.300C>T	5.37:g.131602211C>T		Somatic	251	0		WXS	Illumina HiSeq	Phase_I	235	70	NM_003687	0	0	1	1	0	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Silent	SNP	ENST00000253754.3	37	CCDS4152.1																																																																																			.		0.592	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2	NM_003687	
SLC22A4	6583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131647952	131647952	+	Silent	SNP	A	A	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr5:131647952A>C	ENST00000200652.3	+	2	666	c.492A>C	c.(490-492)tcA>tcC	p.S164S	SLC22A4_ENST00000491257.1_3'UTR|AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	164					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GGCAGCTGTCAGACAGGTAAG	0.572																																					p.S164S		.											.	SLC22A4-90	0			c.A492C						.						132.0	107.0	116.0					5																	131647952		2203	4300	6503	SO:0001819	synonymous_variant	6583	exon2			GCTGTCAGACAGG	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.492A>C	5.37:g.131647952A>C		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	56	18	NM_003059	0	0	0	0	0	O14546	Silent	SNP	ENST00000200652.3	37	CCDS4153.1																																																																																			.		0.572	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059	
DCANP1	140947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	134785315	134785315	+	5'Flank	SNP	G	G	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr5:134785315G>C	ENST00000503143.2	-	0	0				CTB-138E5.1_ENST00000510230.1_RNA|TIFAB_ENST00000537858.1_Silent_p.V105V	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN								nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGAGAAGGAGACCCTGTTGA	0.577																																					p.V105V		.											.	TIFAB-22	0			c.C315G						.						101.0	104.0	103.0					5																	134785315		2082	4221	6303	SO:0001631	upstream_gene_variant	497189	exon2			GAAGGAGACCCTG																													5.37:g.134785315G>C	Exception_encountered	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	133	24	NM_001099221	0	0	0	0	0		Silent	SNP	ENST00000503143.2	37	CCDS4186.1																																																																																			.		0.577	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372531.1		
PCDHGA1	56114	broad.mit.edu	37	5	140710540	140710540	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr5:140710540G>T	ENST00000517417.1	+	1	289	c.289G>T	c.(289-291)Gct>Tct	p.A97S	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.A97S	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A97S(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTCTGCGCTCAGAGCAT	0.473																																					p.A97S													.	PCDHGA1-137	2	Substitution - Missense(2)	kidney(2)	c.G289T						.						110.0	123.0	118.0					5																	140710540		2203	4300	6503	SO:0001583	missense	56114	exon1			CTCTGCGCTCAGA	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.289G>T	5.37:g.140710540G>T	ENSP00000431083:p.Ala97Ser	Somatic	126	1		WXS	Illumina HiSeq	Phase_I	113	9	NM_018912	0	0	4	4	0	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320750	0.60634	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.27402	1.67;1.67	4.37	3.49	0.39957	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.138694	0.32328	N	0.006242	T	0.37404	0.1002	M	0.79011	2.435	0.23813	N	0.99677	P;P	0.42010	0.726;0.768	B;B	0.43658	0.3;0.426	T	0.35375	-0.9791	10	0.59425	D	0.04	.	9.5567	0.39343	0.0857:0.1484:0.7659:0.0	.	97;97	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	S	97	ENSP00000431083:A97S;ENSP00000367345:A97S	ENSP00000367345:A97S	A	+	1	0	PCDHGA1	140690724	0.066000	0.20996	1.000000	0.80357	0.686000	0.39977	2.217000	0.42880	2.432000	0.82394	0.655000	0.94253	GCT	.		0.473	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
GABRA6	2559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	161116041	161116041	+	Silent	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr5:161116041T>C	ENST00000274545.5	+	4	745	c.312T>C	c.(310-312)aaT>aaC	p.N104N	RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Silent_p.N94N			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	104					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGAGTCTGAATAATTTGATGG	0.403										TCGA Ovarian(5;0.080)																											p.N104N		.											.	GABRA6-163	0			c.T312C						.						76.0	77.0	77.0					5																	161116041		2203	4299	6502	SO:0001819	synonymous_variant	2559	exon4			TCTGAATAATTTG		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.312T>C	5.37:g.161116041T>C		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	85	17	NM_000811	0	0	0	0	0	A8K096|Q4VAV2	Silent	SNP	ENST00000274545.5	37	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	T	8.919	0.960604	0.18583	.	.	ENSG00000145863	ENST00000520000	.	.	.	5.65	2.01	0.26516	.	.	.	.	.	T	0.54581	0.1867	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45571	-0.9252	4	.	.	.	.	6.8819	0.24179	0.0:0.4395:0.0:0.5605	.	.	.	.	T	44	.	.	I	+	2	0	GABRA6	161048619	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.646000	0.46630	0.507000	0.28148	-0.274000	0.10170	ATA	.		0.403	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
DTNBP1	84062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	15523339	15523339	+	Missense_Mutation	SNP	C	C	G	rs374085686		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr6:15523339C>G	ENST00000344537.5	-	10	1095	c.923G>C	c.(922-924)cGg>cCg	p.R308P	DTNBP1_ENST00000462989.2_Missense_Mutation_p.R152P|DTNBP1_ENST00000355917.3_Missense_Mutation_p.R309P	NM_032122.4	NP_115498.2	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1	308	Dysbindin.				actin cytoskeleton reorganization (GO:0031532)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|neuron projection morphogenesis (GO:0048812)|platelet dense granule organization (GO:0060155)|positive regulation of gene expression (GO:0010628)|positive regulation of neurotransmitter secretion (GO:0001956)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of dopamine secretion (GO:0014059)	axon (GO:0030424)|BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|growth cone (GO:0030426)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)|synaptic vesicle membrane (GO:0030672)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	14	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			ACTGATGTCCCGGGTGGCCGA	0.567									Hermansky-Pudlak syndrome																												p.R308P		.											.	DTNBP1-90	0			c.G923C						.						137.0	142.0	141.0					6																	15523339		2203	4300	6503	SO:0001583	missense	84062	exon10	Familial Cancer Database	HPS, HPS1-8	ATGTCCCGGGTGG	AF394226	CCDS4534.1, CCDS4535.1, CCDS75404.1, CCDS75405.1	6p22.3	2013-09-27			ENSG00000047579	ENSG00000047579		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17328	protein-coding gene	gene with protein product	"""dysbindin-1"", ""biogenesis of lysosomal organelles complex-1, subunit 8"""	607145				11316798	Standard	NM_032122		Approved	Dysbindin, My031, HPS7, DBND, BLOC1S8	uc003nbm.3	Q96EV8	OTTHUMG00000014295	ENST00000344537.5:c.923G>C	6.37:g.15523339C>G	ENSP00000341680:p.Arg308Pro	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	197	32	NM_032122	0	0	13	29	16	A8K3V3|Q5THY3|Q5THY4|Q96NV2|Q9H0U2|Q9H3J5	Missense_Mutation	SNP	ENST00000344537.5	37	CCDS4534.1	.	.	.	.	.	.	.	.	.	.	T	11.68	1.710179	0.30322	.	.	ENSG00000047579	ENST00000344537;ENST00000462989;ENST00000355917;ENST00000397306;ENST00000509674	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.62	-7.93	0.01156	.	1.163890	0.06365	N	0.712440	T	0.01558	0.0050	N	0.01297	-0.9	0.19300	N	0.999978	B	0.02656	0.0	B	0.08055	0.003	T	0.27331	-1.0077	10	0.08179	T	0.78	-9.2314	4.2873	0.10862	0.0902:0.1668:0.4361:0.307	.	308	Q96EV8	DTBP1_HUMAN	P	308;152;309;227;125	ENSP00000341680:R308P;ENSP00000427239:R152P;ENSP00000348183:R309P;ENSP00000421797:R125P	ENSP00000341680:R308P	R	-	2	0	DTNBP1	15631318	0.501000	0.26099	0.000000	0.03702	0.022000	0.10575	0.142000	0.16096	-2.293000	0.00664	-0.254000	0.11334	CGG	.		0.567	DTNBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000039933.2	NM_032122	
ACOT13	55856	broad.mit.edu;bcgsc.ca	37	6	24701750	24701750	+	Silent	SNP	A	A	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr6:24701750A>T	ENST00000230048.4	+	3	523	c.330A>T	c.(328-330)ggA>ggT	p.G110G	ACOT13_ENST00000537591.1_Silent_p.G87G|RP1-30M3.5_ENST00000607014.1_RNA|ACOT13_ENST00000476436.1_3'UTR	NM_018473.3	NP_060943.1	Q9NPJ3	ACO13_HUMAN	acyl-CoA thioesterase 13	110					metabolic process (GO:0008152)|protein homotetramerization (GO:0051289)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA hydrolase activity (GO:0047617)			large_intestine(1)	1						TGAAGCAAGGAAAAACACTTG	0.378																																					p.G110G													.	ACOT13-90	0			c.A330T						.						155.0	153.0	154.0					6																	24701750		2203	4300	6503	SO:0001819	synonymous_variant	55856	exon3			GCAAGGAAAAACA	AF220186	CCDS4558.1, CCDS54972.1	6p22.1	2009-11-20	2009-05-05	2009-05-05	ENSG00000112304	ENSG00000112304		"""Acyl CoA thioesterases"""	20999	protein-coding gene	gene with protein product		615652	"""thioesterase superfamily member 2"""	THEM2		16934754, 19405909	Standard	NM_018473		Approved	HT012	uc003nek.3	Q9NPJ3	OTTHUMG00000014359	ENST00000230048.4:c.330A>T	6.37:g.24701750A>T		Somatic	228	0		WXS	Illumina HiSeq	Phase_I	213	8	NM_018473	0	0	48	48	0	F5H2L4|O95549	Silent	SNP	ENST00000230048.4	37	CCDS4558.1																																																																																			.		0.378	ACOT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040010.2	NM_018473	
HIST1H3J	8356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27858516	27858516	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr6:27858516T>G	ENST00000359303.2	-	1	54	c.55A>C	c.(55-57)Aag>Cag	p.K19Q	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003535.2	NP_003526.1	P68431	H31_HUMAN	histone cluster 1, H3j	19					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	8						GCCAGCTGCTTCCGCGGTGCC	0.617																																					p.K19Q		.											.	HIST1H3J-69	0			c.A55C						.						29.0	33.0	31.0					6																	27858516		2203	4299	6502	SO:0001583	missense	8356	exon1			GCTGCTTCCGCGG	Z83737	CCDS4638.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197153	ENSG00000197153		"""Histones / Replication-dependent"""	4774	protein-coding gene	gene with protein product		602817	"""H3 histone family, member J"", ""histone 1, H3j"""	H3FJ		9439656, 12408966	Standard	NM_003535		Approved	H3/j	uc003nka.3	P68431	OTTHUMG00000016185	ENST00000359303.2:c.55A>C	6.37:g.27858516T>G	ENSP00000352252:p.Lys19Gln	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	89	25	NM_003535	0	0	0	0	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000359303.2	37	CCDS4638.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.572970	0.45798	.	.	ENSG00000197153	ENST00000359303	T	0.48522	0.81	4.06	4.06	0.47325	.	.	.	.	.	T	0.52224	0.1721	.	.	.	0.42070	D	0.991202	.	.	.	.	.	.	T	0.59316	-0.7477	6	0.87932	D	0	.	12.8321	0.57752	0.0:0.0:0.0:1.0	.	.	.	.	Q	19	ENSP00000352252:K19Q	ENSP00000352252:K19Q	K	-	1	0	HIST1H3J	27966495	1.000000	0.71417	0.997000	0.53966	0.747000	0.42532	7.496000	0.81526	2.071000	0.62044	0.533000	0.62120	AAG	.		0.617	HIST1H3J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043453.2	NM_003535	
DNAH8	1769	broad.mit.edu	37	6	38875811	38875811	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr6:38875811G>A	ENST00000359357.3	+	62	9031	c.8777G>A	c.(8776-8778)cGc>cAc	p.R2926H	DNAH8_ENST00000441566.1_Missense_Mutation_p.R2890H|DNAH8_ENST00000449981.2_Missense_Mutation_p.R3143H			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2926	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAGCTACCTCGCCATCCTCCT	0.383																																					p.R3143H													.	DNAH8-615	0			c.G9428A						.						121.0	116.0	118.0					6																	38875811		2203	4300	6503	SO:0001583	missense	1769	exon64			TACCTCGCCATCC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.8777G>A	6.37:g.38875811G>A	ENSP00000352312:p.Arg2926His	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	80	4	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	21.8	4.202583	0.79127	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.26223	1.77;1.77;1.75	5.74	4.88	0.63580	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.85682	D	0.000000	T	0.45796	0.1360	M	0.84773	2.715	0.58432	D	0.999998	D	0.89917	1.0	D	0.79784	0.993	T	0.54323	-0.8311	10	0.51188	T	0.08	.	14.9621	0.71164	0.0685:0.0:0.9315:0.0	.	2926	Q96JB1	DYH8_HUMAN	H	3131;3131;2926;2890	ENSP00000333363:R3131H;ENSP00000352312:R2926H;ENSP00000402294:R2890H	ENSP00000333363:R3131H	R	+	2	0	DNAH8	38983789	1.000000	0.71417	0.967000	0.41034	0.733000	0.41908	7.863000	0.87023	1.431000	0.47355	0.650000	0.86243	CGC	.		0.383	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
ENPP1	5167	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	132171207	132171207	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr6:132171207A>C	ENST00000360971.2	+	3	411	c.391A>C	c.(391-393)Aac>Cac	p.N131H		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	131	SMB 1. {ECO:0000255|PROSITE- ProRule:PRU00350}.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TGAGCTTGGAAACTGCTGTTT	0.423																																					p.N131H	Colon(104;336 1535 5856 11019 33782)												.	ENPP1-95	0			c.A391C						.						157.0	145.0	149.0					6																	132171207		2203	4300	6503	SO:0001583	missense	5167	exon3			CTTGGAAACTGCT	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.391A>C	6.37:g.132171207A>C	ENSP00000354238:p.Asn131His	Somatic	203	1		WXS	Illumina HiSeq	Phase_I	158	48	NM_006208	0	0	0	0	0	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	37	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	A	21.9	4.210856	0.79240	.	.	ENSG00000197594	ENST00000360971	T	0.46451	0.87	5.53	5.53	0.82687	Somatomedin B domain (4);Somatomedin B, chordata (1);	0.063724	0.64402	D	0.000008	T	0.61198	0.2328	M	0.82823	2.61	0.49130	D	0.999752	D	0.89917	1.0	D	0.83275	0.996	T	0.68428	-0.5411	10	0.87932	D	0	-26.8529	14.9356	0.70951	1.0:0.0:0.0:0.0	.	131	P22413	ENPP1_HUMAN	H	131	ENSP00000354238:N131H	ENSP00000354238:N131H	N	+	1	0	ENPP1	132212900	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	6.000000	0.70678	2.227000	0.72691	0.528000	0.53228	AAC	.		0.423	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2		
MICALL2	79778	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	1477990	1477990	+	Splice_Site	SNP	C	C	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr7:1477990C>G	ENST00000297508.7	-	11	2298		c.e11-1		MICALL2_ENST00000471899.1_Splice_Site|MICALL2_ENST00000405088.4_Splice_Site	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2						actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		AAGGGTCTCCCTGGAGAAGGA	0.672																																					.													.	MICALL2-90	0			c.2123-1G>C						.						32.0	21.0	24.0					7																	1477990		2186	4293	6479	SO:0001630	splice_region_variant	79778	exon12			GTCTCCCTGGAGA	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.2123-1G>C	7.37:g.1477990C>G		Somatic	192	2		WXS	Illumina HiSeq	Phase_I	160	36	NM_182924	0	0	1	4	3	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Splice_Site	SNP	ENST00000297508.7	37	CCDS5324.1	.	.	.	.	.	.	.	.	.	.	C	5.718	0.316910	0.10845	.	.	ENSG00000164877	ENST00000405088;ENST00000297508	.	.	.	3.43	2.49	0.30216	.	.	.	.	.	.	.	.	.	.	.	0.28847	N	0.896255	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9901	0.36019	0.2221:0.7778:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MICALL2	1444516	0.309000	0.24518	0.059000	0.19551	0.370000	0.29829	1.806000	0.38892	0.728000	0.32382	0.455000	0.32223	.	.		0.672	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	Intron
CBLL1	79872	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107398636	107398636	+	Silent	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr7:107398636C>T	ENST00000440859.3	+	6	956	c.489C>T	c.(487-489)ctC>ctT	p.L163L	CBLL1_ENST00000222597.2_Silent_p.L162L|CBLL1_ENST00000415884.2_3'UTR	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	163	HYB domain. {ECO:0000250}.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						GAGGTTCTCTCTTCATGTGTA	0.398																																					p.L163L													.	CBLL1-229	0			c.C489T						.						112.0	99.0	104.0					7																	107398636		2203	4300	6503	SO:0001819	synonymous_variant	79872	exon6			TTCTCTCTTCATG	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.489C>T	7.37:g.107398636C>T		Somatic	143	1		WXS	Illumina HiSeq	Phase_I	152	33	NM_024814	0	0	5	9	4	B7ZM03|Q8TAJ4|Q9H5S6	Silent	SNP	ENST00000440859.3	37	CCDS5747.1																																																																																			.		0.398	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
DNAJB9	4189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	108212287	108212287	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr7:108212287G>A	ENST00000249356.3	+	2	663	c.117G>A	c.(115-117)gaG>gaA	p.E39E	THAP5_ENST00000438865.1_5'Flank|THAP5_ENST00000493722.1_5'Flank|THAP5_ENST00000415914.3_5'Flank|DNAJB9_ENST00000465725.1_3'UTR|THAP5_ENST00000313516.5_5'Flank	NM_012328.2	NP_036460.1	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	39	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	misfolded protein binding (GO:0051787)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13						CGGCATCAGAGCGCCAAATCA	0.403																																					p.E39E		.											.	DNAJB9-226	0			c.G117A						.						107.0	116.0	113.0					7																	108212287		2203	4300	6503	SO:0001819	synonymous_variant	4189	exon2			ATCAGAGCGCCAA	AB026908	CCDS5752.1	7q31	2011-09-02			ENSG00000128590	ENSG00000128590		"""Heat shock proteins / DNAJ (HSP40)"""	6968	protein-coding gene	gene with protein product		602634		MDG1		9533036, 11147971	Standard	NM_012328		Approved		uc003vfn.3	Q9UBS3	OTTHUMG00000154866	ENST00000249356.3:c.117G>A	7.37:g.108212287G>A		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	137	43	NM_012328	0	0	14	29	15		Silent	SNP	ENST00000249356.3	37	CCDS5752.1																																																																																			.		0.403	DNAJB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337414.1		
DLGAP2	9228	broad.mit.edu	37	8	1497770	1497770	+	Missense_Mutation	SNP	G	G	A	rs370050230		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr8:1497770G>A	ENST00000421627.2	+	2	1045	c.911G>A	c.(910-912)cGc>cAc	p.R304H		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	383					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GAGGCCTACCGCAAGAGCTCG	0.672																																					p.R304H													.	DLGAP2-22	0			c.G911A						.						9.0	10.0	10.0					8																	1497770		2127	4234	6361	SO:0001583	missense	9228	exon2			CCTACCGCAAGAG	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.911G>A	8.37:g.1497770G>A	ENSP00000400258:p.Arg304His	Somatic	151	2		WXS	Illumina HiSeq	Phase_I	151	5	NM_004745	0	0	0	0	0	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.213135|5.213135	0.95069|0.95069	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.14022	.|2.54	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.39358|0.39358	0.1075|0.1075	M|M	0.70275|0.70275	2.135|2.135	0.53005|0.53005	D|D	0.999967|0.999967	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.994	T|T	0.11036|0.11036	-1.0604|-1.0604	5|10	.|0.51188	.|T	.|0.08	-16.7352|-16.7352	18.9482|18.9482	0.92630|0.92630	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|383;383	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	T|H	321|349;304	.|ENSP00000400258:R304H	.|ENSP00000348366:R349H	A|R	+|+	1|2	0|0	DLGAP2|DLGAP2	1485177|1485177	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.085000|7.085000	0.76875|0.76875	2.463000|2.463000	0.83235|0.83235	0.655000|0.655000	0.94253|0.94253	GCA|CGC	.		0.672	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
NEFM	4741	broad.mit.edu	37	8	24771576	24771576	+	Silent	SNP	C	C	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr8:24771576C>T	ENST00000221166.5	+	1	1052	c.270C>T	c.(268-270)ccC>ccT	p.P90P	NEFM_ENST00000437366.2_Silent_p.P90P|NEFM_ENST00000518131.1_Silent_p.P90P|GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000521540.1_3'UTR|RP11-624C23.1_ENST00000519689.1_RNA|NEFM_ENST00000433454.2_5'Flank			P07197	NFM_HUMAN	neurofilament, medium polypeptide	90	Head.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GCTCCGGACCCGGCGGCGACT	0.657																																					p.P90P													.	NEFM-577	0			c.C270T						.						16.0	19.0	18.0					8																	24771576		2179	4255	6434	SO:0001819	synonymous_variant	4741	exon1			CGGACCCGGCGGC	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.270C>T	8.37:g.24771576C>T		Somatic	118	1		WXS	Illumina HiSeq	Phase_I	144	4	NM_005382	0	0	0	0	0	B4DGN2|E9PBF7|Q4QRK6	Silent	SNP	ENST00000221166.5	37	CCDS6046.1																																																																																			.		0.657	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382	
FAM83H	286077	hgsc.bcm.edu	37	8	144809730	144809730	+	Missense_Mutation	SNP	G	G	C	rs367877690	byFrequency	TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr8:144809730G>C	ENST00000388913.3	-	5	2026	c.1901C>G	c.(1900-1902)gCa>gGa	p.A634G		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	634					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGGGAAGGCTGCTGGGACGCG	0.751													G|||	5	0.000998403	0.0038	0.0	5008	,	,		9374	0.0		0.0	False		,,,				2504	0.0				p.A634G		.											.	FAM83H-92	0			c.C1901G						.	G	GLY/ALA	5,3093		0,5,1544	6.0	8.0	7.0		1901	0.6	0.0	8		7	0,7130		0,0,3565	no	missense	FAM83H	NM_198488.3	60	0,5,5109	CC,CG,GG		0.0,0.1614,0.0489	benign	634/1180	144809730	5,10223	1549	3565	5114	SO:0001583	missense	286077	exon5			AAGGCTGCTGGGA	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1901C>G	8.37:g.144809730G>C	ENSP00000373565:p.Ala634Gly	Somatic	3	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_198488	0	0	0	3	3	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	g	0.018	-1.474564	0.01044	0.001614	0.0	ENSG00000180921	ENST00000388913	T	0.14516	2.5	3.85	0.608	0.17569	.	16.316900	0.01476	U	0.016496	T	0.08980	0.0222	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27054	-1.0085	10	0.20519	T	0.43	.	5.3436	0.15996	0.2787:0.3057:0.4156:0.0	.	634	Q6ZRV2	FA83H_HUMAN	G	634	ENSP00000373565:A634G	ENSP00000373565:A634G	A	-	2	0	FAM83H	144881718	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	0.100000	0.15231	0.258000	0.21686	0.561000	0.74099	GCA	.		0.751	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
PLEC	5339	hgsc.bcm.edu	37	8	145001217	145001217	+	Silent	SNP	C	C	T	rs374669316		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr8:145001217C>T	ENST00000322810.4	-	29	4453	c.4284G>A	c.(4282-4284)gcG>gcA	p.A1428A	PLEC_ENST00000527096.1_Silent_p.A1314A|PLEC_ENST00000354958.2_Silent_p.A1269A|PLEC_ENST00000398774.2_Silent_p.A1259A|PLEC_ENST00000357649.2_Silent_p.A1295A|PLEC_ENST00000345136.3_Silent_p.A1291A|PLEC_ENST00000354589.3_Silent_p.A1291A|PLEC_ENST00000356346.3_Silent_p.A1277A|PLEC_ENST00000436759.2_Silent_p.A1318A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1428	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTCAAGCTGCGCCTTGTACG	0.637																																					p.A1428A		.											.	PLEC-141	0			c.G4284A						.	C	,,,,,,,	1,4183		0,1,2091	58.0	63.0	62.0		3954,3831,3807,4284,3777,3873,3885,3873	-9.9	0.3	8		62	0,8434		0,0,4217	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	0,1,6308	TT,TC,CC		0.0,0.0239,0.0079	,,,,,,,	1318/4575,1277/4534,1269/4526,1428/4685,1259/4516,1291/4548,1295/4552,1291/4548	145001217	1,12617	2092	4217	6309	SO:0001819	synonymous_variant	5339	exon29			AAGCTGCGCCTTG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4284G>A	8.37:g.145001217C>T		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	69	4	NM_201380	0	0	20	20	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.637	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
CDKN2A	1029	hgsc.bcm.edu	37	9	21971184	21971184	+	Silent	SNP	T	T	G	rs201208890	byFrequency	TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr9:21971184T>G	ENST00000304494.5	-	2	444	c.174A>C	c.(172-174)cgA>cgC	p.R58R	CDKN2A_ENST00000578845.2_Silent_p.R7R|CDKN2A_ENST00000361570.3_Missense_Mutation_p.S114R|CDKN2A_ENST00000494262.1_Silent_p.R7R|CDKN2A_ENST00000446177.1_Silent_p.R58R|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000497750.1_Silent_p.R7R|CDKN2A_ENST00000530628.2_Missense_Mutation_p.S73R|CDKN2A_ENST00000498628.2_Silent_p.R7R|CDKN2A_ENST00000498124.1_Silent_p.R58R|CDKN2A_ENST00000579122.1_Silent_p.R58R|CDKN2A_ENST00000479692.2_Silent_p.R7R|CDKN2A_ENST00000579755.1_Missense_Mutation_p.S73R	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	58			R -> Q (in dbSNP:rs36204273).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(45)|p.M53_R58del(3)|p.R58fs*59(2)|p.V59fs*82(2)|p.0(1)|p.V28_V51del(1)|p.V59fs*63(1)|p.V59fs*61(1)|p.V59fs*60(1)|p.G55fs*86(1)|p.A57fs*85(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCTCCGCCACTCGGGCGCTGC	0.682		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			G|||	15	0.00299521	0.0113	0.0	5008	,	,		11788	0.0		0.0	False		,,,				2504	0.0				p.S73R		.											.	CDKN2A-23992	1374	Whole gene deletion(1316)|Unknown(45)|Deletion - Frameshift(7)|Deletion - In frame(4)|Insertion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(285)|skin(176)|central_nervous_system(167)|lung(145)|urinary_tract(92)|bone(74)|soft_tissue(57)|upper_aerodigestive_tract(55)|oesophagus(52)|pleura(51)|ovary(37)|kidney(32)|breast(32)|pancreas(30)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.A217C						.	G	,,,ARG/SER	25,4025		0,25,2000	7.0	9.0	8.0		174,174,,217	-4.5	0.0	9		8	0,8162		0,0,4081	no	coding-synonymous,coding-synonymous,utr-3,missense	CDKN2A	NM_000077.4,NM_001195132.1,NM_058197.4,NM_058195.3	,,,110	0,25,6081	GG,GT,TT		0.0,0.6173,0.2047	,,,benign	58/157,58/168,,73/133	21971184	25,12187	2025	4081	6106	SO:0001819	synonymous_variant	1029	exon2			CGCCACTCGGGCG	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.174A>C	9.37:g.21971184T>G		Somatic	4	2		WXS	Illumina HiSeq	Phase_I	34	18	NM_058195	0	0	0	0	0	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	37	CCDS6510.1	.	.	.	.	.	.	.	.	.	.	G	6.483	0.457206	0.12342	0.006173	0.0	ENSG00000147889	ENST00000361570;ENST00000530628	T;T	0.76186	-1.0;-0.95	5.79	-4.48	0.03515	.	0.576553	0.14595	N	0.309984	T	0.41789	0.1174	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22941	-1.0202	8	.	.	.	-3.0019	5.0452	0.14480	0.1174:0.1641:0.1404:0.5781	.	114	Q8N726	CD2A2_HUMAN	R	114;73	ENSP00000355153:S114R;ENSP00000432664:S73R	.	S	-	1	0	CDKN2A	21961184	0.000000	0.05858	0.001000	0.08648	0.194000	0.23727	-2.443000	0.01013	-1.206000	0.02641	-2.190000	0.00312	AGT	.		0.682	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
PIP5K1B	8395	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	71509346	71509346	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr9:71509346T>C	ENST00000265382.3	+	8	868	c.563T>C	c.(562-564)aTg>aCg	p.M188T	PIP5K1B_ENST00000541509.1_Missense_Mutation_p.M188T	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	188	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		ATTGTGGTGATGAACAACGTT	0.403																																					p.M188T													.	PIP5K1B-240	0			c.T563C						.						98.0	88.0	91.0					9																	71509346		2203	4300	6503	SO:0001583	missense	8395	exon8			TGGTGATGAACAA	U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.563T>C	9.37:g.71509346T>C	ENSP00000265382:p.Met188Thr	Somatic	227	2		WXS	Illumina HiSeq	Phase_I	216	53	NM_003558	0	0	1	4	3	A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Missense_Mutation	SNP	ENST00000265382.3	37	CCDS6624.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370255	0.82573	.	.	ENSG00000107242	ENST00000541509;ENST00000377290;ENST00000265382;ENST00000419747	T;T	0.43294	0.95;0.95	5.82	5.82	0.92795	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	M	0.89904	3.07	0.80722	D	1	D	0.64830	0.994	D	0.65323	0.934	T	0.77316	-0.2633	10	0.87932	D	0	-12.8359	16.1966	0.82029	0.0:0.0:0.0:1.0	.	188	O14986	PI51B_HUMAN	T	188;188;188;135	ENSP00000438082:M188T;ENSP00000265382:M188T	ENSP00000265382:M188T	M	+	2	0	PIP5K1B	70699166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.895000	0.87343	2.232000	0.73038	0.528000	0.53228	ATG	.		0.403	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052561.2	NM_003558	
TLR4	7099	broad.mit.edu	37	9	120475890	120475890	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr9:120475890T>C	ENST00000355622.6	+	3	1585	c.1484T>C	c.(1483-1485)cTg>cCg	p.L495P	TLR4_ENST00000394487.4_Missense_Mutation_p.L455P|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	495					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L495P(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TTCACAGAGCTGAGAAACTTG	0.448																																					p.L495P													.	TLR4-577	1	Substitution - Missense(1)	endometrium(1)	c.T1484C						.						79.0	77.0	78.0					9																	120475890		2203	4300	6503	SO:0001583	missense	7099	exon3			CAGAGCTGAGAAA	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1484T>C	9.37:g.120475890T>C	ENSP00000363089:p.Leu495Pro	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	71	3	NM_138554	0	0	2	2	0	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.049512	0.36181	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.72167	-0.63;-0.63	5.72	4.59	0.56863	.	0.885833	0.09654	N	0.773349	D	0.88789	0.6532	H	0.96547	3.84	0.43608	D	0.995976	D	0.89917	1.0	D	0.91635	0.999	D	0.84225	0.0463	10	0.42905	T	0.14	.	10.9103	0.47106	0.0:0.0745:0.0:0.9255	.	495	O00206	TLR4_HUMAN	P	455;495	ENSP00000377997:L455P;ENSP00000363089:L495P	ENSP00000363089:L495P	L	+	2	0	TLR4	119515711	0.598000	0.26882	0.021000	0.16686	0.009000	0.06853	4.192000	0.58378	1.012000	0.39366	0.528000	0.53228	CTG	.		0.448	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
SH3KBP1	30011	hgsc.bcm.edu;bcgsc.ca	37	X	19560045	19560045	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:19560045C>A	ENST00000397821.3	-	16	2180	c.1890G>T	c.(1888-1890)caG>caT	p.Q630H	SH3KBP1_ENST00000541422.1_Missense_Mutation_p.Q369H|SH3KBP1_ENST00000379698.4_Missense_Mutation_p.Q593H|SH3KBP1_ENST00000379716.1_Missense_Mutation_p.Q392H	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	630					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						GCACTCACTTCTGCTGGTCCT	0.627																																					p.Q630H		.											.	SH3KBP1-130	0			c.G1890T						.						106.0	96.0	100.0					X																	19560045		2203	4300	6503	SO:0001583	missense	30011	exon16			TCACTTCTGCTGG	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1890G>T	X.37:g.19560045C>A	ENSP00000380921:p.Gln630His	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	81	40	NM_031892	0	0	0	0	0	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	ENST00000397821.3	37	CCDS14193.1	.	.	.	.	.	.	.	.	.	.	C	3.308	-0.141521	0.06669	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000379716;ENST00000379698;ENST00000541422;ENST00000379726	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.39	4.41	0.53225	.	0.000000	0.64402	D	0.000010	T	0.30541	0.0768	N	0.12887	0.27	0.37413	D	0.9133	D;B;D	0.89917	1.0;0.156;0.997	D;B;D	0.85130	0.997;0.031;0.99	T	0.44050	-0.9353	10	0.02654	T	1	-14.024	6.2238	0.20695	0.0:0.7735:0.0:0.2265	.	392;630;593	Q5JPT4;Q96B97;Q5JPT5	.;SH3K1_HUMAN;.	H	615;630;392;593;369;610	ENSP00000380921:Q630H;ENSP00000369039:Q392H;ENSP00000369020:Q593H;ENSP00000442499:Q369H;ENSP00000369049:Q610H	ENSP00000369020:Q593H	Q	-	3	2	SH3KBP1	19469966	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.388000	0.34442	2.265000	0.75225	0.529000	0.55759	CAG	.		0.627	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
TAF1	6872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70618524	70618524	+	Silent	SNP	G	G	A			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:70618524G>A	ENST00000373790.4	+	24	3771	c.3720G>A	c.(3718-3720)aaG>aaA	p.K1240K	TAF1_ENST00000449580.1_Silent_p.K1240K|TAF1_ENST00000423759.1_Silent_p.K1261K|TAF1_ENST00000276072.3_Silent_p.K1261K	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1240					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ACCAGGAAAAGGAGAAGCTTA	0.458																																					p.K1261K		.											.	TAF1-900	0			c.G3783A						.						93.0	79.0	84.0					X																	70618524		2203	4300	6503	SO:0001819	synonymous_variant	6872	exon24			GGAAAAGGAGAAG		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3720G>A	X.37:g.70618524G>A		Somatic	157	0		WXS	Illumina HiSeq	Phase_I	129	74	NM_004606	0	0	2	3	1	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Silent	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	.	9.733	1.162842	0.21538	.	.	ENSG00000147133	ENST00000483985	.	.	.	5.54	3.77	0.43336	.	.	.	.	.	T	0.59074	0.2167	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53129	-0.8482	4	.	.	.	.	9.3163	0.37937	0.2564:0.0:0.7436:0.0	.	.	.	.	K	151	.	.	R	+	2	0	TAF1	70535249	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.737000	0.26144	0.520000	0.28426	0.468000	0.43344	AGG	.		0.458	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
ARMCX5	64860	broad.mit.edu;bcgsc.ca	37	X	101857944	101857944	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:101857944G>T	ENST00000604957.1	+	1	3497	c.875G>T	c.(874-876)gGg>gTg	p.G292V	RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000372742.1_Missense_Mutation_p.G292V|ARMCX5_ENST00000541409.1_Missense_Mutation_p.G292V|ARMCX5_ENST00000246174.2_Missense_Mutation_p.G292V|ARMCX5_ENST00000536530.1_Missense_Mutation_p.G292V|ARMCX5_ENST00000537008.1_Missense_Mutation_p.G292V|RP4-769N13.6_ENST00000476910.2_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	292										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						GAAAAGTATGGGCCTAATCCG	0.443																																					p.G292V													.	ARMCX5-131	0			c.G875T						.						69.0	64.0	66.0					X																	101857944		2203	4299	6502	SO:0001583	missense	64860	exon3			AGTATGGGCCTAA		CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.875G>T	X.37:g.101857944G>T	ENSP00000474720:p.Gly292Val	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	72	5	NM_022838	0	0	0	0	0	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	ENST00000604957.1	37	CCDS14500.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951432	0.53186	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	3.67	3.67	0.42095	.	0.166576	0.29034	N	0.013357	T	0.31009	0.0783	L	0.29908	0.895	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.04268	-1.0964	10	0.72032	D	0.01	-4.0369	10.0142	0.42006	0.0:0.0:1.0:0.0	.	292	Q6P1M9	ARMX5_HUMAN	V	292	ENSP00000246174:G292V;ENSP00000439001:G292V;ENSP00000446385:G292V;ENSP00000445851:G292V;ENSP00000361827:G292V	ENSP00000246174:G292V	G	+	2	0	ARMCX5	101744600	0.992000	0.36948	1.000000	0.80357	0.921000	0.55340	0.919000	0.28692	2.114000	0.64651	0.600000	0.82982	GGG	.		0.443	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838	
H2BFM	286436	broad.mit.edu	37	X	103294936	103294936	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:103294936G>T	ENST00000355016.3	+	1	421	c.393G>T	c.(391-393)aaG>aaT	p.K131N	H2BFM_ENST00000243297.5_Missense_Mutation_p.K234N	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	131						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						AGATGGGCAAGCTCGCCGAGG	0.632																																					p.K131N													.	H2BFM-109	0			c.G393T						.						6.0	7.0	7.0					X																	103294936		687	1564	2251	SO:0001583	missense	286436	exon1			GGGCAAGCTCGCC	AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.393G>T	X.37:g.103294936G>T	ENSP00000347119:p.Lys131Asn	Somatic	67	2		WXS	Illumina HiSeq	Phase_I	76	4	NM_001164416	0	0	0	0	0	A6NP82	Missense_Mutation	SNP	ENST00000355016.3	37	CCDS55468.1	.	.	.	.	.	.	.	.	.	.	.	15.77	2.932112	0.52866	.	.	ENSG00000101812	ENST00000243297;ENST00000355016;ENST00000417637	T;T;T	0.46819	0.86;0.86;0.86	2.66	1.77	0.24775	Histone-fold (2);	0.136209	0.24037	U	0.042133	T	0.38026	0.1025	N	0.19112	0.55	0.33773	D	0.623293	D	0.59357	0.985	P	0.51324	0.666	T	0.52208	-0.8606	10	0.87932	D	0	.	7.0558	0.25099	0.1505:0.0:0.8495:0.0	.	234	P0C1H6	H2BFM_HUMAN	N	234;131;29	ENSP00000243297:K234N;ENSP00000347119:K131N;ENSP00000402466:K29N	ENSP00000243297:K234N	K	+	3	2	H2BFM	103181592	1.000000	0.71417	0.013000	0.15412	0.004000	0.04260	1.478000	0.35442	0.384000	0.24942	0.519000	0.50382	AAG	.		0.632	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057758.2	XM_210048	
GLUD2	2747	ucsc.edu	37	X	120183026	120183026	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:120183026T>G	ENST00000328078.1	+	1	1565	c.1488T>G	c.(1486-1488)agT>agG	p.S496R		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	496					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						TCCAAGACAGTATATCGGGTG	0.453																																					p.S496R													.	GLUD2-131	0			c.T1488G						.						163.0	129.0	141.0					X																	120183026		2203	4300	6503	SO:0001583	missense	2747	exon1			AGACAGTATATCG	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1488T>G	X.37:g.120183026T>G	ENSP00000327589:p.Ser496Arg	Somatic	89	0		WXS	Illumina HiSeq		107	1	NM_012084	0	0	2	152	150	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.467675	0.00011	.	.	ENSG00000182890	ENST00000328078	D	0.95918	-3.85	1.99	-3.98	0.04082	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.045906	0.85682	N	0.000000	T	0.72961	0.3526	N	0.00453	-1.485	0.19300	N	0.999976	B	0.02656	0.0	B	0.01281	0.0	T	0.76277	-0.3018	10	0.02654	T	1	.	4.3409	0.11110	0.6313:0.0:0.1881:0.1806	.	496	P49448	DHE4_HUMAN	R	496	ENSP00000327589:S496R	ENSP00000327589:S496R	S	+	3	2	GLUD2	120010707	1.000000	0.71417	0.043000	0.18650	0.080000	0.17528	0.344000	0.19962	-1.074000	0.03132	-1.405000	0.01134	AGT	.		0.453	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
MAML2	84441	broad.mit.edu	37	11	95825392	95825392	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:95825392delC	ENST00000524717.1	-	2	3087	c.1803delG	c.(1801-1803)cagfs	p.Q621fs		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	621				Missing (in Ref. 1; AAK93831/AAK93833, 3; BAB47448, 5; AAI52450 and 6; AAP12462). {ECO:0000305}.	gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgct	0.537			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q601fs				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.1803delG						.						21.0	29.0	26.0					11																	95825392		1960	3863	5823	SO:0001589	frameshift_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1803delG	11.37:g.95825392delC	ENSP00000434552:p.Gln621fs	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	135	7	NM_032427	0	0	0	0	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Frame_Shift_Del	DEL	ENST00000524717.1	37	CCDS44714.1																																																																																			-|0.034;TGC|0.966		0.537	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MAML2	84441	broad.mit.edu	37	11	95825394	95825395	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr11:95825394_95825395delGC	ENST00000524717.1	-	2	3084_3085	c.1800_1801delGC	c.(1798-1803)cagcagfs	p.QQ600fs		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	600					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				tgctgctgctgctgctgctgct	0.54			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.600_601del				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.1800_1801del						.																																			SO:0001589	frameshift_variant	84441	exon2			GCTGCTGCTGCTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1800_1801delGC	11.37:g.95825394_95825395delGC	ENSP00000434552:p.Gln600fs	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	135	7	NM_032427	0	0	0	0	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Frame_Shift_Del	DEL	ENST00000524717.1	37	CCDS44714.1																																																																																			-|0.034;TGC|0.966		0.540	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
METTL7A	25840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	51319010	51319030	+	In_Frame_Del	DEL	GGAGTTTGCGGGCCCCTCCGG	GGAGTTTGCGGGCCCCTCCGG	-	rs142438796		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	GGAGTTTGCGGGCCCCTCCGG	GGAGTTTGCGGGCCCCTCCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:51319010_51319030delGGAGTTTGCGGGCCCCTCCGG	ENST00000548553.1	+	2	1170_1190	c.189_209delGGAGTTTGCGGGCCCCTCCGG	c.(187-210)caggagtttgcgggcccctccggg>cag	p.EFAGPSG64del	METTL7A_ENST00000332160.4_In_Frame_Del_p.EFAGPSG64del			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	64						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)	p.A66V(1)		endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						GTAACCTGCAGGAGTTTGCGGGCCCCTCCGGGAAACTCTCC	0.543																																					p.63_70del		.											.	METTL7A-90	1	Substitution - Missense(1)	lung(1)	c.189_209del						.																																			SO:0001651	inframe_deletion	25840	exon1			.		CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.189_209delGGAGTTTGCGGGCCCCTCCGG	12.37:g.51319010_51319030delGGAGTTTGCGGGCCCCTCCGG	ENSP00000448785:p.Glu64_Gly70del	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	80	12	NM_014033	0	0	0	0	0	Q9H7R3|Q9UHZ7|Q9Y422	In_Frame_Del	DEL	ENST00000548553.1	37	CCDS8804.1																																																																																			.		0.543	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	NM_014033	
RFC5	5985	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	118462664	118462664	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:118462664delA	ENST00000454402.2	+	6	548	c.430delA	c.(430-432)aaafs	p.K144fs	RFC5_ENST00000229043.3_Frame_Shift_Del_p.K59fs|RFC5_ENST00000392542.2_Frame_Shift_Del_p.K123fs	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	144					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTAATTGAGAAATTCACAGA	0.428																																					p.K144fs		.											.	RFC5-227	0			c.430delA						.						75.0	81.0	79.0					12																	118462664		2203	4300	6503	SO:0001589	frameshift_variant	5985	exon6			.		CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.430delA	12.37:g.118462664delA	ENSP00000408295:p.Lys144fs	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	53	15	NM_007370	0	0	0	0	0	A8MZ62|B3KSX8	Frame_Shift_Del	DEL	ENST00000454402.2	37	CCDS9185.1																																																																																			.		0.428	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344196.2	NM_007370	
LRRC16B	90668	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24528535	24528547	+	Frame_Shift_Del	DEL	CATCAATGCCCTG	CATCAATGCCCTG	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	CATCAATGCCCTG	CATCAATGCCCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr14:24528535_24528547delCATCAATGCCCTG	ENST00000342740.5	+	21	1837_1849	c.1683_1695delCATCAATGCCCTG	c.(1681-1695)ctcatcaatgccctgfs	p.LINAL561fs	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	561						cytoplasm (GO:0005737)		p.N563D(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CCAGCATCCTCATCAATGCCCTGGGCAGCAACA	0.62																																					p.561_565del		.											.	LRRC16B-139	1	Substitution - Missense(1)	large_intestine(1)	c.1683_1695del						.																																			SO:0001589	frameshift_variant	90668	exon21			.	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.1683_1695delCATCAATGCCCTG	14.37:g.24528535_24528547delCATCAATGCCCTG	ENSP00000340467:p.Leu561fs	Somatic	288	0		WXS	Illumina HiSeq	Phase_I	154	40	NM_138360	0	0	0	0	0	Q8TEF7|Q96HS9	Frame_Shift_Del	DEL	ENST00000342740.5	37	CCDS32054.1																																																																																			.		0.620	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
ZNF225	7768	broad.mit.edu	37	19	44636876	44636878	+	In_Frame_Del	DEL	AAA	AAA	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	AAA	AAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:44636876_44636878delAAA	ENST00000262894.6	+	5	2389_2391	c.2109_2111delAAA	c.(2107-2112)ttaaat>ttt	p.703_704LN>F	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_In_Frame_Del_p.703_704LN>F	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	703					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				CAttatttttaaatgacacataa	0.355																																					p.703_704del													.	.	0			c.2109_2111del						.																																			SO:0001651	inframe_deletion	7768	exon5			ATTTTTAAATGAC	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.2109_2111delAAA	19.37:g.44636876_44636878delAAA	ENSP00000262894:p.Leu703_Asn704delinsPhe	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	101	8	NM_013362	0	0	0	0	0	A8K8S2|Q53F12|Q9NS46|Q9UID8	In_Frame_Del	DEL	ENST00000262894.6	37	CCDS46100.1																																																																																			.		0.355	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
ZNF225	7768	hgsc.bcm.edu	37	19	44636876	44636889	+	Stop_Codon_Del	DEL	AAATGACACATAAC	AAATGACACATAAC	-	rs143348426	byFrequency	TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	AAATGACACATAAC	AAATGACACATAAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:44636876_44636889delAAATGACACATAAC	ENST00000262894.6	+	0	2389_2402				ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Stop_Codon_Del	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				CAttatttttaaatgacacataactgttgtactc	0.355																																					p.703_707del		.											.	.	0			c.2109_2364del						.																																			SO:0001567	stop_retained_variant	7768	exon5			.	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		Exception_encountered	19.37:g.44636876_44636889delAAATGACACATAAC	ENSP00000262894:p.*707Pheext*8	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	91	16	NM_013362	0	0	0	0	0	A8K8S2|Q53F12|Q9NS46|Q9UID8	Frame_Shift_Del	DEL	ENST00000262894.6	37	CCDS46100.1																																																																																			.		0.355	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
ZNF225	7768	broad.mit.edu;bcgsc.ca	37	19	44636880	44636885	+	In_Frame_Del	DEL	GACACA	GACACA	-	rs143348426	byFrequency	TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	GACACA	GACACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr19:44636880_44636885delGACACA	ENST00000262894.6	+	5	2393_2398	c.2113_2118delGACACA	c.(2113-2118)gacacadel	p.DT705del	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_In_Frame_Del_p.DT705del	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	705					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				atttttaaatgacacataactgttgt	0.359																																					p.705_706del													.	.	0			c.2113_2118del						.																																			SO:0001651	inframe_deletion	7768	exon5			TTAAATGACACAT	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.2113_2118delGACACA	19.37:g.44636880_44636885delGACACA	ENSP00000262894:p.Asp705_Thr706del	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	88	8	NM_013362	0	0	0	0	0	A8K8S2|Q53F12|Q9NS46|Q9UID8	In_Frame_Del	DEL	ENST00000262894.6	37	CCDS46100.1																																																																																			.		0.359	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
NEUROD1	4760	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	182543048	182543051	+	Frame_Shift_Del	DEL	GGTG	GGTG	-	rs565522208		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	GGTG	GGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr2:182543048_182543051delGGTG	ENST00000295108.3	-	2	994_997	c.537_540delCACC	c.(535-540)cccaccfs	p.PT179fs	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	179					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CCAGGTTGGTGGTGGGTTGGGATA	0.598																																					p.179_180del		.											.	NEUROD1-91	0			c.537_540del						.																																			SO:0001589	frameshift_variant	4760	exon2			.	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.537_540delCACC	2.37:g.182543048_182543051delGGTG	ENSP00000295108:p.Pro179fs	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	80	22	NM_002500	0	0	0	0	0	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Frame_Shift_Del	DEL	ENST00000295108.3	37	CCDS2283.1																																																																																			.		0.598	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
HIST1H2AL	8332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	27833355	27833357	+	In_Frame_Del	DEL	AAG	AAG	-	rs376667817		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr6:27833355_27833357delAAG	ENST00000357320.2	+	1	322_324	c.223_225delAAG	c.(223-225)aagdel	p.K76del		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	76						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						CCGCGACAACAAGAAGACCCGCA	0.665																																					p.75_75del		.											.	HIST1H2AL-68	0			c.223_225del						.																																			SO:0001651	inframe_deletion	8332	exon1			.	X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.223_225delAAG	6.37:g.27833358_27833360delAAG	ENSP00000349873:p.Lys76del	Somatic	216	0		WXS	Illumina HiSeq	Phase_I	217	47	NM_003511	0	0	0	0	0	P02261|Q2M1R2|Q76PA6	In_Frame_Del	DEL	ENST00000357320.2	37	CCDS4634.1																																																																																			.		0.665	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040160.1	NM_003511	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	151859497	151859497	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr7:151859497delT	ENST00000262189.6	-	43	11383	c.11165delA	c.(11164-11166)aagfs	p.K3722fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.K3722fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3722					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGTCTCAGCCTTTTCCAGTTT	0.468																																					p.K3722fs		.											.	MLL3-1398	0			c.11165delA						.						178.0	182.0	181.0					7																	151859497		2203	4300	6503	SO:0001589	frameshift_variant	58508	exon43			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11165delA	7.37:g.151859497delT	ENSP00000262189:p.Lys3722fs	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	80	23	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.468	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
TCEANC	170082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	13680806	13680808	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:13680806_13680808delCCT	ENST00000380600.1	+	2	266_268	c.179_181delCCT	c.(178-183)ccctct>cct	p.S61del	TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000545566.1_In_Frame_Del_p.S61del|TCEANC_ENST00000544987.1_In_Frame_Del_p.S61del|TCEANC_ENST00000314720.4_In_Frame_Del_p.S91del			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	61	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						AAAAACTGCCCCTCTGTGGCTTT	0.443																																					p.90_91del		.											.	TCEANC-41	0			c.269_271del						.																																			SO:0001651	inframe_deletion	170082	exon4			.		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.179_181delCCT	X.37:g.13680806_13680808delCCT	ENSP00000369974:p.Ser61del	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	58	33	NM_152634	0	0	0	0	0	A6NI06|B2RDM3	In_Frame_Del	DEL	ENST00000380600.1	37																																																																																				.		0.443	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634	
TMCC3	57458	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	94975986	94975987	+	Frame_Shift_Ins	INS	-	-	A	rs530422400		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:94975986_94975987insA	ENST00000261226.4	-	2	537_538	c.406_407insT	c.(406-408)tatfs	p.Y136fs	TMCC3_ENST00000551457.1_Frame_Shift_Ins_p.Y105fs	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	136						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						CTTTCGATGATACTGCTCTAAC	0.475																																					p.Y136fs		.											.	TMCC3-92	0			c.407_408insT						.																																			SO:0001589	frameshift_variant	57458	exon2			.	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.407dupT	12.37:g.94975987_94975987dupA	ENSP00000261226:p.Tyr136fs	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	73	12	NM_020698	0	0	0	0	0	Q8IWB2	Frame_Shift_Ins	INS	ENST00000261226.4	37	CCDS31877.1																																																																																			.		0.475	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
NEFH	4744	hgsc.bcm.edu	37	22	29885571	29885572	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr22:29885571_29885572insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1975_1976	c.1942_1943insCCCCTGAGAAGGCCAAGT	c.(1942-1944)tcc>tCCCCTGAGAAGGCCAAGTcc	p.648_648S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	654	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GGAAGCAAAGTCCCCTGAGAAG	0.569																																					p.S648delinsSPEKAKS		.											.	NEFH-90	0			c.1942_1943insCCCCTGAGAAGGCCAAGT						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	22.37:g.29885571_29885572insCCCCTGAGAAGGCCAAGT	Exception_encountered	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	223	71	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
HRCT1	646962	broad.mit.edu	37	9	35906600	35906601	+	Frame_Shift_Ins	INS	-	-	A	rs565823201|rs112212538		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr9:35906600_35906601insA	ENST00000354323.2	+	1	412_413	c.316_317insA	c.(316-318)cccfs	p.P106fs	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	106	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						ccaccaccacccccaccgccac	0.673																																					p.P106fs													.	HRCT1-22	0			c.316_317insA						.																																			SO:0001589	frameshift_variant	646962	exon1			CACCACCCCCACC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	Exception_encountered	9.37:g.35906600_35906601insA	ENSP00000346283:p.Pro106fs	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_001039792	0	0	0	0	0	B7ZBJ1	Frame_Shift_Ins	INS	ENST00000354323.2	37	CCDS35012.1																																																																																			.		0.673	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
HRCT1	646962	broad.mit.edu	37	9	35906601	35906602	+	Frame_Shift_Ins	INS	-	-	CA	rs565823201|rs112212538		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr9:35906601_35906602insCA	ENST00000354323.2	+	1	413_414	c.317_318insCA	c.(316-321)ccccacfs	p.H107fs	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	107	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						caccaccacccccaccgccacc	0.678																																					p.P106fs													.	HRCT1-22	0			c.317_318insCA						.																																			SO:0001589	frameshift_variant	646962	exon1			ACCACCCCCACCG		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	Exception_encountered	9.37:g.35906601_35906602insCA	ENSP00000346283:p.His107fs	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_001039792	0	0	0	0	0	B7ZBJ1	Frame_Shift_Ins	INS	ENST00000354323.2	37	CCDS35012.1																																																																																			.		0.678	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
SH3KBP1	30011	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	19560042	19560043	+	Splice_Site	INS	-	-	T			TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chrX:19560042_19560043insT	ENST00000397821.3	-	16	2182_2183		c.e16+1		SH3KBP1_ENST00000541422.1_Splice_Site|SH3KBP1_ENST00000379698.4_Splice_Site|SH3KBP1_ENST00000379716.1_Splice_Site	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1						apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						CAGGCACTCACTTCTGCTGGTC	0.634																																					.		.											.	SH3KBP1-130	0			c.1178+1->A						.																																			SO:0001630	splice_region_variant	30011	exon12			.	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1892+1->A	X.37:g.19560044_19560044dupT		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	81	41	NM_001184960	0	0	0	0	0	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Splice_Site	INS	ENST00000397821.3	37	CCDS14193.1																																																																																			.		0.634	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	Intron
CD163L1	283316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7526000	7526001	+	Missense_Mutation	DNP	GC	GC	TT	rs368002565		TCGA-B9-A5W8-01A-11D-A28G-10	TCGA-B9-A5W8-10A-01D-A28G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	28255a70-00c1-45b8-ad54-33a2def9c843	7d548692-a558-4aaa-b70f-8b2861f275ff	g.chr12:7526000_7526001GC>TT	ENST00000313599.3	-	14	3702_3703	c.3645_3646GC>AA	c.(3643-3648)acGCat>acAAat	p.H1216N	CD163L1_ENST00000396630.1_Missense_Mutation_p.H1216N|CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.H1226N			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1216	SRCR 11. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ATGGAGATATGCGTTTTAGGAC	0.525																																					p.H1226N		.											.	CD163L1-100	0			c.G3645A						.																																			SO:0001583	missense	283316	exon14			GATATGCGTTTTA	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3645_3646delinsTT	12.37:g.7526000_7526001delinsTT	ENSP00000315945:p.His1216Asn	Somatic	332.0	0.0		WXS	Illumina HiSeq	Phase_I	280.0	46.0	NM_174941	0	0	0	0	0	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	DNP	ENST00000313599.3	37	CCDS8577.1																																																																																			.		0.525	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
