#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTPRF	5792	hgsc.bcm.edu	37	1	44084813	44084813	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr1:44084813T>C	ENST00000359947.4	+	27	4926	c.4586T>C	c.(4585-4587)tTc>tCc	p.F1529S	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.F1520S|PTPRF_ENST00000422171.2_Missense_Mutation_p.F888S|PTPRF_ENST00000372413.3_Missense_Mutation_p.F1520S|PTPRF_ENST00000372414.3_Missense_Mutation_p.F1529S	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1529	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATCCTGGCCTTCCTACGACGG	0.632																																					p.F1529S		.											.	PTPRF-232	0			c.T4586C						.						57.0	51.0	53.0					1																	44084813		2203	4300	6503	SO:0001583	missense	5792	exon27			TGGCCTTCCTACG	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4586T>C	1.37:g.44084813T>C	ENSP00000353030:p.Phe1529Ser	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_002840	0	0	36	36	0	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.04|17.04	3.286754|3.286754	0.59867|0.59867	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000429895	T;T;T;T;T;T|.	0.39406|.	1.08;1.08;1.08;1.08;1.08;1.08|.	5.42|5.42	4.3|4.3	0.51218|0.51218	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);|.	0.000000|.	0.35936|.	N|.	0.002893|.	D|D	0.89238|0.89238	0.6658|0.6658	H|H	0.99752|0.99752	4.75|4.75	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.996;1.0|.	D;D;D;P;D|.	0.97110|.	1.0;1.0;1.0;0.771;1.0|.	D|D	0.91544|0.91544	0.5252|0.5252	10|5	0.87932|.	D|.	0|.	.|.	11.2154|11.2154	0.48823|0.48823	0.0:0.0719:0.0:0.9281|0.0:0.0719:0.0:0.9281	.|.	1174;888;1106;1520;1529|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	S|P	1529;1520;1529;1520;888;601|1175	ENSP00000353030:F1529S;ENSP00000398822:F1520S;ENSP00000361491:F1529S;ENSP00000361490:F1520S;ENSP00000387885:F888S;ENSP00000361484:F601S|.	ENSP00000353030:F1529S|.	F|S	+|+	2|1	0|0	PTPRF|PTPRF	43857400|43857400	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.520000|0.520000	0.34377|0.34377	7.991000|7.991000	0.88244|0.88244	1.013000|1.013000	0.39391|0.39391	0.459000|0.459000	0.35465|0.35465	TTC|TCC	.		0.632	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
OR2G2	81470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247751788	247751788	+	Silent	SNP	T	T	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr1:247751788T>C	ENST00000320065.1	+	1	127	c.127T>C	c.(127-129)Ttg>Ctg	p.L43L	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ACTAACTATTTTGGGGAATAC	0.408																																					p.L43L		.											.	OR2G2-68	0			c.T127C						.						227.0	217.0	220.0					1																	247751788		2203	4300	6503	SO:0001819	synonymous_variant	81470	exon1			ACTATTTTGGGGA	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.127T>C	1.37:g.247751788T>C		Somatic	178	0		WXS	Illumina HiSeq	Phase_I	319	87	NM_001001915	0	0	0	0	0	Q5JQT2|Q6IEZ0	Silent	SNP	ENST00000320065.1	37	CCDS31092.1																																																																																			.		0.408	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
AKAP3	10566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	4736579	4736579	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr12:4736579G>C	ENST00000545990.2	-	5	2013	c.1489C>G	c.(1489-1491)Cct>Gct	p.P497A	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.P497A	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	497					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						ATATCTTCAGGGTACTCAAAG	0.463																																					p.P497A		.											.	AKAP3-292	0			c.C1489G						.						67.0	64.0	65.0					12																	4736579		2203	4300	6503	SO:0001583	missense	10566	exon4			CTTCAGGGTACTC	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1489C>G	12.37:g.4736579G>C	ENSP00000440994:p.Pro497Ala	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	47	10	NM_006422	0	0	0	0	0	O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	ENST00000545990.2	37	CCDS8531.1	.	.	.	.	.	.	.	.	.	.	G	0.811	-0.752022	0.03041	.	.	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.11821	2.74;2.74	4.5	-1.34	0.09143	A-kinase anchor 110kDa, C-terminal (1);	0.887861	0.09758	N	0.759675	T	0.13457	0.0326	M	0.68317	2.08	0.09310	N	1	B	0.29481	0.245	B	0.32090	0.14	T	0.40194	-0.9576	10	0.72032	D	0.01	0.0048	1.207	0.01896	0.1864:0.1329:0.362:0.3187	.	497	O75969	AKAP3_HUMAN	A	497	ENSP00000228850:P497A;ENSP00000440994:P497A	ENSP00000228850:P497A	P	-	1	0	AKAP3	4606840	0.215000	0.23574	0.000000	0.03702	0.001000	0.01503	1.832000	0.39151	-0.187000	0.10516	-0.136000	0.14681	CCT	.		0.463	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
ARID2	196528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	46244916	46244916	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr12:46244916A>T	ENST00000334344.6	+	15	3182	c.3010A>T	c.(3010-3012)Agt>Tgt	p.S1004C	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Missense_Mutation_p.S614C|ARID2_ENST00000422737.1_Missense_Mutation_p.S855C|ARID2_ENST00000457135.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1004	Gln-rich.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCCTACTGTCAGTCAAATGTT	0.502			"""N, S, F"""		hepatocellular carcinoma																																p.S1004C		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2-100	0			c.A3010T						.						212.0	175.0	188.0					12																	46244916		2203	4300	6503	SO:0001583	missense	196528	exon15			ACTGTCAGTCAAA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3010A>T	12.37:g.46244916A>T	ENSP00000335044:p.Ser1004Cys	Somatic	91	1		WXS	Illumina HiSeq	Phase_I	148	26	NM_152641	0	0	3	4	1	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.710443	0.48517	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.49720	0.77	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.58075	0.2097	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.81914	0.995;0.995;0.99	T	0.62105	-0.6924	10	0.72032	D	0.01	-11.3288	15.7664	0.78128	1.0:0.0:0.0:0.0	.	1004;614;1004	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	C	1004;121;121;855;614	ENSP00000335044:S1004C	ENSP00000335044:S1004C	S	+	1	0	ARID2	44531183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.623000	0.67757	2.137000	0.66172	0.379000	0.24179	AGT	.		0.502	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
AQP2	359	broad.mit.edu	37	12	50344816	50344816	+	Missense_Mutation	SNP	A	A	C	rs104894331		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr12:50344816A>C	ENST00000199280.3	+	1	288	c.203A>C	c.(202-204)aAc>aCc	p.N68T	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	68			N -> S (in ANDI). {ECO:0000269|PubMed:9048343}.		actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.N68T(2)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						GCCCACATCAACCCTGCCGTG	0.662																																					p.N68T													.	AQP2-92	2	Substitution - Missense(2)	cervix(1)|lung(1)	c.A203C	GRCh37	CM970098	AQP2	M	rs104894331	.						41.0	41.0	41.0					12																	50344816		2203	4300	6503	SO:0001583	missense	359	exon1			ACATCAACCCTGC		CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.203A>C	12.37:g.50344816A>C	ENSP00000199280:p.Asn68Thr	Somatic	52	6		WXS	Illumina HiSeq	Phase_I	81	27	NM_000486	0	0	0	0	0	Q9UD68	Missense_Mutation	SNP	ENST00000199280.3	37	CCDS8792.1	.	.	.	.	.	.	.	.	.	.	A	17.54	3.414384	0.62511	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	D;T	0.98792	-5.14;-0.93	4.62	4.62	0.57501	Major intrinsic protein, conserved site (1);Aquaporin-like (2);	0.000000	0.64402	D	0.000013	D	0.99569	0.9845	H	0.99911	4.935	0.58432	D	0.999993	D	0.89917	1.0	D	0.71870	0.975	D	0.97411	1.0002	10	0.87932	D	0	-19.7917	12.3053	0.54898	1.0:0.0:0.0:0.0	.	68	P41181	AQP2_HUMAN	T	68	ENSP00000199280:N68T;ENSP00000450022:N68T	ENSP00000199280:N68T	N	+	2	0	AQP2	48631083	1.000000	0.71417	0.995000	0.50966	0.381000	0.30169	7.516000	0.81772	1.859000	0.53934	0.533000	0.62120	AAC	A|0.998;C|0.002		0.662	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405540.1	NM_000486	
COL4A1	1282	ucsc.edu	37	13	110827563	110827563	+	Splice_Site	SNP	A	A	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr13:110827563A>C	ENST00000375820.4	-	37	3320		c.e37+1			NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1						axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			AGCGCTGGTTACCTTTTCACC	0.547																																					.													.	COL4A1-654	0			c.3198+2T>G						.						147.0	113.0	125.0					13																	110827563		2203	4300	6503	SO:0001630	splice_region_variant	1282	exon38			CTGGTTACCTTTT	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3198+1T>G	13.37:g.110827563A>C		Somatic	73	0		WXS	Illumina HiSeq		75	2	NM_001845	0	0	0	0	0	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Splice_Site	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.103563	0.37145	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7145	0.77658	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL4A1	109625564	1.000000	0.71417	0.996000	0.52242	0.171000	0.22731	7.681000	0.84073	2.168000	0.68352	0.528000	0.53228	.	.		0.547	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		Intron
HERC2	8924	broad.mit.edu	37	15	28370205	28370205	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr15:28370205T>G	ENST00000261609.7	-	84	13045	c.12937A>C	c.(12937-12939)Acc>Ccc	p.T4313P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGGCGAGGGTATGTGCTGAG	0.622																																					p.T4313P													.	HERC2-234	0			c.A12937C						.						136.0	125.0	129.0					15																	28370205		2203	4300	6503	SO:0001583	missense	8924	exon84			CGAGGGTATGTGC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12937A>C	15.37:g.28370205T>G	ENSP00000261609:p.Thr4313Pro	Somatic	131	22		WXS	Illumina HiSeq	Phase_I	186	26	NM_004667	0	0	24	24	0		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869602	0.91587	.	.	ENSG00000128731	ENST00000261609	D	0.88664	-2.41	5.19	5.19	0.71726	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.96349	0.8809	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97752	1.0215	10	0.87932	D	0	.	15.0549	0.71908	0.0:0.0:0.0:1.0	.	4313	O95714	HERC2_HUMAN	P	4313	ENSP00000261609:T4313P	ENSP00000261609:T4313P	T	-	1	0	HERC2	26043800	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	8.030000	0.88816	1.951000	0.56629	0.533000	0.62120	ACC	.		0.622	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
RYR3	6263	broad.mit.edu	37	15	33954438	33954438	+	Silent	SNP	C	C	T	rs372058994		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr15:33954438C>T	ENST00000389232.4	+	35	4777	c.4707C>T	c.(4705-4707)tgC>tgT	p.C1569C	RYR3_ENST00000415757.3_Silent_p.C1569C	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1569	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCGCGGTGTGCGCCCTGGGAA	0.612																																					p.C1569C													.	RYR3-520	0			c.C4707T						.	C		1,4157		0,1,2078	55.0	54.0	55.0		4707	-9.4	0.6	15		55	1,8441		0,1,4220	no	coding-synonymous	RYR3	NM_001036.3		0,2,6298	TT,TC,CC		0.0118,0.0241,0.0159		1569/4871	33954438	2,12598	2079	4221	6300	SO:0001819	synonymous_variant	6263	exon35			GGTGTGCGCCCTG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4707C>T	15.37:g.33954438C>T		Somatic	16	0		WXS	Illumina HiSeq	Phase_I	23	3	NM_001243996	0	0	0	0	0	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																			.		0.612	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
HERPUD1	9709	broad.mit.edu	37	16	56974154	56974154	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr16:56974154A>G	ENST00000439977.2	+	6	1099	c.902A>G	c.(901-903)tAc>tGc	p.Y301C	HERPUD1_ENST00000344114.4_Intron|HERPUD1_ENST00000379792.2_Missense_Mutation_p.Y276C|HERPUD1_ENST00000570273.1_Intron|RP11-325K4.2_ENST00000570210.1_RNA|RP11-325K4.3_ENST00000565861.1_RNA|HERPUD1_ENST00000300302.5_Missense_Mutation_p.Y300C	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	301					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						GTTGTTATGTACCTGTAAGCA	0.398			T	ERG	prostate																																p.Y301C				Dom	yes		16	16q12.2-q13	9709	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""		E	.	HERPUD1-90	0			c.A902G						.						122.0	117.0	119.0					16																	56974154		2198	4300	6498	SO:0001583	missense	9709	exon6			TTATGTACCTGTA	AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.902A>G	16.37:g.56974154A>G	ENSP00000409555:p.Tyr301Cys	Somatic	131	1		WXS	Illumina HiSeq	Phase_I	197	5	NM_014685	0	0	0	0	0	E9PGD1|O60644|Q6IAN8|Q96D92	Missense_Mutation	SNP	ENST00000439977.2	37	CCDS10771.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.254051	0.80135	.	.	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302	T	0.21543	2.0	5.74	5.74	0.90152	.	0.053782	0.85682	N	0.000000	T	0.49830	0.1580	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.54931	-0.8219	10	0.87932	D	0	-10.6095	15.2162	0.73267	1.0:0.0:0.0:0.0	.	276;300;301	E9PGD1;Q15011-2;Q15011	.;.;HERP1_HUMAN	C	300;276;301	ENSP00000369118:Y276C	ENSP00000300302:Y301C	Y	+	2	0	HERPUD1	55531655	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.050000	0.93843	2.186000	0.69663	0.533000	0.62120	TAC	.		0.398	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257056.5		
FLII	2314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18149935	18149935	+	Silent	SNP	G	G	A			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr17:18149935G>A	ENST00000327031.4	-	23	3249	c.3024C>T	c.(3022-3024)ttC>ttT	p.F1008F	FLII_ENST00000579294.1_Silent_p.F997F|FLII_ENST00000379450.4_Silent_p.F922F|FLII_ENST00000578558.1_Intron|FLII_ENST00000545457.2_Silent_p.F953F	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	1008					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AGAGGCTCTCGAACTTCTTTT	0.627																																					p.F1008F		.											.	FLII-91	0			c.C3024T						.						60.0	53.0	56.0					17																	18149935		2203	4300	6503	SO:0001819	synonymous_variant	2314	exon23			GCTCTCGAACTTC	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.3024C>T	17.37:g.18149935G>A		Somatic	19	0		WXS	Illumina HiSeq	Phase_I	52	13	NM_002018	0	0	139	215	76	B4DIL0|F5H407|J3QLG3	Silent	SNP	ENST00000327031.4	37	CCDS11192.1																																																																																			.		0.627	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
FDXR	2232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	72860612	72860612	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr17:72860612G>C	ENST00000293195.5	-	8	870	c.792C>G	c.(790-792)gaC>gaG	p.D264E	FDXR_ENST00000581969.1_5'Flank|FDXR_ENST00000544854.1_Missense_Mutation_p.D212E|FDXR_ENST00000583917.1_Intron|FDXR_ENST00000413947.2_Missense_Mutation_p.D295E|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000581530.1_Missense_Mutation_p.D270E|FDXR_ENST00000582944.1_Missense_Mutation_p.D256E|FDXR_ENST00000420580.2_Missense_Mutation_p.D224E|FDXR_ENST00000442102.2_Missense_Mutation_p.D307E|FDXR_ENST00000455107.2_Missense_Mutation_p.D220E	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	264					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CCTTGATCTTGTCCTGGAGAC	0.612											OREG0024720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D307E		.											.	FDXR-226	0			c.C921G						.						42.0	47.0	45.0					17																	72860612		2203	4300	6503	SO:0001583	missense	2232	exon8			GATCTTGTCCTGG	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.792C>G	17.37:g.72860612G>C	ENSP00000293195:p.Asp264Glu	Somatic	50	0	1140	WXS	Illumina HiSeq	Phase_I	88	7	NM_001258012	0	0	0	0	0	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.556819	0.00910	.	.	ENSG00000161513	ENST00000420580;ENST00000544854;ENST00000293195;ENST00000455107;ENST00000442102;ENST00000413947	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	4.65	2.43	0.29744	.	0.279368	0.40554	N	0.001071	T	0.04724	0.0128	N	0.04162	-0.26	0.33484	D	0.587776	B;B;B;B;B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B	0.09377	0.004;0.003;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.31613	-0.9937	10	0.05351	T	0.99	-16.3668	2.2561	0.04055	0.1249:0.3442:0.3522:0.1788	.	224;307;295;262;212;264;256;264;270	B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;ADRO_HUMAN;.	E	224;212;270;220;307;295	ENSP00000414172:D224E;ENSP00000445432:D212E;ENSP00000390875:D220E;ENSP00000416515:D307E;ENSP00000408595:D295E	ENSP00000293195:D270E	D	-	3	2	FDXR	70372207	0.964000	0.33143	1.000000	0.80357	0.295000	0.27426	0.151000	0.16283	0.910000	0.36722	0.561000	0.74099	GAC	.		0.612	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
HNRNPM	4670	ucsc.edu	37	19	8527467	8527467	+	Splice_Site	SNP	T	T	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr19:8527467T>G	ENST00000325495.4	+	3	377		c.e3+2		HNRNPM_ENST00000348943.3_Splice_Site	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCAAGGGTAAGTGTCTGA	0.428																																					.													.	HNRNPM-68	0			c.336+2T>G						.						241.0	220.0	227.0					19																	8527467		2203	4300	6503	SO:0001630	splice_region_variant	4670	exon3			CAAGGGTAAGTGT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.336+2T>G	19.37:g.8527467T>G		Somatic	137	1		WXS	Illumina HiSeq		122	1	NM_031203	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Splice_Site	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580056	0.65992	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0018	0.71479	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPM	8433467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.225000	0.72522	0.459000	0.35465	.	.		0.428	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		Intron
NANOS3	342977	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	13988494	13988494	+	Silent	SNP	A	A	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr19:13988494A>G	ENST00000397555.2	+	2	375	c.375A>G	c.(373-375)cgA>cgG	p.R125R	NANOS3_ENST00000339133.5_Silent_p.R144R|NANOS3_ENST00000591727.1_Intron|MIR181C_ENST00000384881.1_RNA|MIR181D_ENST00000384853.1_RNA	NM_001098622.2	NP_001092092.1	P60323	NANO3_HUMAN	nanos homolog 3 (Drosophila)	125					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	7			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			ACACCACCCGAAACTCGGCAG	0.662																																					p.R144R		.											.	NANOS3-69	0			c.A432G						.						13.0	17.0	16.0					19																	13988494		2065	4127	6192	SO:0001819	synonymous_variant	342977	exon1			CACCCGAAACTCG	BM702754	CCDS42511.1	19p13.13	2003-12-01				ENSG00000187556			22048	protein-coding gene	gene with protein product		608229					Standard	NM_001098622		Approved	NANOS1L, NOS3	uc002mxj.4	P60323		ENST00000397555.2:c.375A>G	19.37:g.13988494A>G		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	36	8	NM_001098622	0	0	0	0	0	Q495E5	Silent	SNP	ENST00000397555.2	37																																																																																				.		0.662	NANOS3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_292819	
NLRP7	199713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55452315	55452315	+	Silent	SNP	C	C	T			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr19:55452315C>T	ENST00000590030.1	-	2	376	c.336G>A	c.(334-336)tcG>tcA	p.S112S	NLRP7_ENST00000588756.1_Silent_p.S112S|NLRP7_ENST00000592784.1_Silent_p.S112S|NLRP7_ENST00000340844.2_Silent_p.S112S|NLRP7_ENST00000448121.2_Silent_p.S112S|NLRP7_ENST00000446217.1_Silent_p.S140S|NLRP7_ENST00000328092.5_Silent_p.S112S			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	112							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TTGCTAACTCCGAGTCTTCTT	0.433																																					p.S112S		.											.	NLRP7-291	0			c.G336A						.						239.0	189.0	206.0					19																	55452315		2203	4300	6503	SO:0001819	synonymous_variant	199713	exon3			TAACTCCGAGTCT	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.336G>A	19.37:g.55452315C>T		Somatic	215	0		WXS	Illumina HiSeq	Phase_I	255	60	NM_001127255	0	0	0	0	0	E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	37	CCDS33109.1																																																																																			.		0.433	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
CCT4	10575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	62115531	62115531	+	Missense_Mutation	SNP	T	T	C	rs199542002		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr2:62115531T>C	ENST00000394440.3	-	1	408	c.112A>G	c.(112-114)Att>Gtt	p.I38V	CCT4_ENST00000544185.1_5'UTR|CCT4_ENST00000538252.1_5'UTR|CCT4_ENST00000544079.1_Missense_Mutation_p.I38V|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	38					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			GCGGCGGAAATGTTGCTGAAG	0.677																																					p.I38V		.											.	CCT4-92	0			c.A112G						.	T	VAL/ILE	0,4404		0,0,2202	47.0	43.0	45.0		112	3.3	0.8	2		45	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCT4	NM_006430.2	29	0,1,6501	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	38/540	62115531	1,13003	2202	4300	6502	SO:0001583	missense	10575	exon1			CGGAAATGTTGCT		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.112A>G	2.37:g.62115531T>C	ENSP00000377958:p.Ile38Val	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	50	23	NM_001256721	0	0	21	86	65	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.513788	0.64522	0.0	1.16E-4	ENSG00000115484	ENST00000394440;ENST00000544079	T;T	0.12984	2.63;2.63	4.44	3.27	0.37495	.	0.053328	0.64402	D	0.000001	T	0.14570	0.0352	L	0.36672	1.1	0.80722	D	1	P;P	0.48834	0.916;0.847	P;B	0.47134	0.539;0.399	T	0.01520	-1.1334	10	0.87932	D	0	-12.7568	9.5232	0.39149	0.1581:0.0:0.0:0.8419	.	38;38	F5H5W3;P50991	.;TCPD_HUMAN	V	38	ENSP00000377958:I38V;ENSP00000443061:I38V	ENSP00000377958:I38V	I	-	1	0	CCT4	61969035	1.000000	0.71417	0.823000	0.32752	0.746000	0.42486	5.484000	0.66844	0.722000	0.32252	0.529000	0.55759	ATT	T|0.998;C|0.002		0.677	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		
ZSWIM2	151112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	187693177	187693177	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr2:187693177T>A	ENST00000295131.2	-	9	1475	c.1436A>T	c.(1435-1437)aAt>aTt	p.N479I		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	479					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TTTTTTTGAATTTGAATTATC	0.299																																					p.N479I		.											.	ZSWIM2-93	0			c.A1436T						.						36.0	42.0	40.0					2																	187693177		2202	4298	6500	SO:0001583	missense	151112	exon9			TTTGAATTTGAAT	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1436A>T	2.37:g.187693177T>A	ENSP00000295131:p.Asn479Ile	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	43	7	NM_182521	0	0	0	0	0	B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	37	CCDS33348.1	.	.	.	.	.	.	.	.	.	.	T	6.741	0.505511	0.12822	.	.	ENSG00000163012	ENST00000295131	T	0.28895	1.59	5.6	1.83	0.25207	.	1.004620	0.08011	N	0.990290	T	0.21186	0.0510	L	0.32530	0.975	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.36890	-0.9729	10	0.87932	D	0	0.0079	1.3043	0.02085	0.1451:0.1617:0.1507:0.5425	.	479	Q8NEG5	ZSWM2_HUMAN	I	479	ENSP00000295131:N479I	ENSP00000295131:N479I	N	-	2	0	ZSWIM2	187401422	0.045000	0.20229	0.035000	0.18076	0.220000	0.24768	0.733000	0.26087	0.070000	0.16634	-0.376000	0.06991	AAT	.		0.299	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521	
TMC2	117532	broad.mit.edu;bcgsc.ca	37	20	2621849	2621849	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr20:2621849A>G	ENST00000358864.1	+	20	2588	c.2573A>G	c.(2572-2574)aAt>aGt	p.N858S		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	858					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GGGACCTCCAATTCTGCCAGC	0.582																																					p.N858S													.	TMC2-93	0			c.A2573G						.						86.0	88.0	87.0					20																	2621849		2203	4300	6503	SO:0001583	missense	117532	exon20			CCTCCAATTCTGC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2573A>G	20.37:g.2621849A>G	ENSP00000351732:p.Asn858Ser	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	199	6	NM_080751	0	0	0	0	0	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	A	0.040	-1.286909	0.01387	.	.	ENSG00000149488	ENST00000358864	T	0.62498	0.02	4.89	0.764	0.18465	.	1.617550	0.03411	N	0.204850	T	0.24431	0.0592	N	0.00436	-1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46176	-0.9210	10	0.02654	T	1	4.0E-4	6.2652	0.20922	0.4255:0.0:0.5745:0.0	.	858	Q8TDI7	TMC2_HUMAN	S	858	ENSP00000351732:N858S	ENSP00000351732:N858S	N	+	2	0	TMC2	2569849	0.005000	0.15991	0.005000	0.12908	0.028000	0.11728	0.914000	0.28624	0.313000	0.23062	-0.462000	0.05337	AAT	.		0.582	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
CHD6	84181	broad.mit.edu	37	20	40033696	40033696	+	Missense_Mutation	SNP	G	G	A	rs375040457		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr20:40033696G>A	ENST00000373233.3	-	37	7862	c.7685C>T	c.(7684-7686)aCg>aTg	p.T2562M	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2562					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				AGTCACTGCCGTACCACTTTT	0.527																																					p.T2562M													.	CHD6-238	0			c.C7685T						.	G	MET/THR	0,4406		0,0,2203	131.0	129.0	129.0		7685	3.7	0.0	20		129	1,8599	1.2+/-3.3	0,1,4299	no	missense	CHD6	NM_032221.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	2562/2716	40033696	1,13005	2203	4300	6503	SO:0001583	missense	84181	exon37			ACTGCCGTACCAC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7685C>T	20.37:g.40033696G>A	ENSP00000362330:p.Thr2562Met	Somatic	186	2		WXS	Illumina HiSeq	Phase_I	237	5	NM_032221	0	0	15	15	0	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	G	8.202	0.798281	0.16397	0.0	1.16E-4	ENSG00000124177	ENST00000373233	D	0.86497	-2.13	5.65	3.73	0.42828	.	0.604983	0.15766	N	0.245699	T	0.79311	0.4424	L	0.48642	1.525	0.46203	D	0.998922	P	0.39131	0.661	B	0.29663	0.105	T	0.77130	-0.2701	10	0.66056	D	0.02	0.0011	7.825	0.29309	0.1395:0.1329:0.7276:0.0	.	2562	Q8TD26	CHD6_HUMAN	M	2562	ENSP00000362330:T2562M	ENSP00000362330:T2562M	T	-	2	0	CHD6	39467110	0.004000	0.15560	0.001000	0.08648	0.252000	0.25951	1.505000	0.35736	0.953000	0.37825	0.655000	0.94253	ACG	.		0.527	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
HELZ2	85441	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	62198513	62198513	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr20:62198513C>T	ENST00000467148.1	-	6	2267	c.2198G>A	c.(2197-2199)cGg>cAg	p.R733Q	HELZ2_ENST00000427522.2_Missense_Mutation_p.R164Q|HELZ2_ENST00000479540.1_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	733	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCGGCTCTGCCGCGCCACCTC	0.662																																					p.R733Q		.											.	.	0			c.G2198A						.						42.0	45.0	44.0					20																	62198513		2201	4296	6497	SO:0001583	missense	85441	exon7			CTCTGCCGCGCCA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.2198G>A	20.37:g.62198513C>T	ENSP00000417401:p.Arg733Gln	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	156	9	NM_001037335	0	0	3	3	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	C	0.028	-1.354760	0.01256	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.92199	-2.99;-2.99	5.06	-10.1	0.00402	.	1.876900	0.02583	N	0.099118	T	0.75027	0.3794	N	0.04880	-0.145	0.09310	N	1	B;B	0.16603	0.018;0.014	B;B	0.06405	0.002;0.001	T	0.70296	-0.4911	10	0.05959	T	0.93	-12.0678	6.0815	0.19944	0.1162:0.2139:0.0711:0.5987	.	733;164	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	Q	164;733	ENSP00000393257:R164Q;ENSP00000417401:R733Q	ENSP00000393257:R164Q	R	-	2	0	RP4-697K14.7	61668957	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.789000	0.04609	-1.726000	0.01370	-1.028000	0.02416	CGG	.		0.662	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
INPP5J	27124	hgsc.bcm.edu;broad.mit.edu	37	22	31529986	31529986	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr22:31529986C>T	ENST00000331075.5	+	13	2651	c.2602C>T	c.(2602-2604)Ctc>Ttc	p.L868F	INPP5J_ENST00000404453.1_Missense_Mutation_p.L233F|INPP5J_ENST00000405300.1_Missense_Mutation_p.L501F|INPP5J_ENST00000402238.1_Missense_Mutation_p.L207F|INPP5J_ENST00000404390.3_Missense_Mutation_p.L500F|INPP5J_ENST00000412277.2_Missense_Mutation_p.L801F|INPP5J_ENST00000401755.1_Missense_Mutation_p.L233F|INPP5J_ENST00000400294.2_Missense_Mutation_p.L501F	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	868	Ser-rich.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						CACACTGGAGCTCCTTGCACC	0.657																																					p.L500F		.											.	INPP5J-205	0			c.C1498T						.						21.0	26.0	24.0					22																	31529986		2173	4270	6443	SO:0001583	missense	27124	exon13			CTGGAGCTCCTTG	U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.2602C>T	22.37:g.31529986C>T	ENSP00000333262:p.Leu868Phe	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	35	7	NM_001002837	0	0	3	6	3	B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	ENST00000331075.5	37		.	.	.	.	.	.	.	.	.	.	C	21.8	4.204521	0.79127	.	.	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000400294;ENST00000405300;ENST00000404390;ENST00000402238;ENST00000404453;ENST00000401755	D;D;D;D;D;D;D;D	0.99319	-5.26;-5.24;-5.3;-5.3;-5.29;-5.74;-4.51;-4.51	5.54	5.54	0.83059	.	0.142348	0.32134	N	0.006526	D	0.98776	0.9588	L	0.29908	0.895	0.45129	D	0.998142	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.74674	0.984;0.963;0.963;0.962	D	0.99486	1.0949	10	0.49607	T	0.09	.	15.7279	0.77777	0.0:0.8631:0.1369:0.0	.	501;207;868;500	Q15735-2;B5MCL8;Q15735;Q15735-3	.;.;PI5PA_HUMAN;.	F	868;801;501;501;500;207;233;233	ENSP00000333262:L868F;ENSP00000392924:L801F;ENSP00000383150:L501F;ENSP00000384596:L501F;ENSP00000384534:L500F;ENSP00000385264:L207F;ENSP00000385343:L233F;ENSP00000384540:L233F	ENSP00000333262:L868F	L	+	1	0	INPP5J	29859986	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.528000	0.60580	2.610000	0.88304	0.655000	0.94253	CTC	.		0.657	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000321784.1	NM_001002837	
PRRT3	285368	hgsc.bcm.edu	37	3	9989480	9989480	+	Silent	SNP	G	G	C	rs543324498		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr3:9989480G>C	ENST00000412055.1	-	4	1506	c.1377C>G	c.(1375-1377)cgC>cgG	p.R459R	PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	459	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						GGGGGCCCCAGCGTAGCGGGG	0.721													g|||	1	0.000199681	0.0	0.0	5008	,	,		11573	0.0		0.001	False		,,,				2504	0.0				p.R459R		.											.	PRRT3-90	0			c.C1377G						.						4.0	6.0	5.0					3																	9989480		1778	3849	5627	SO:0001819	synonymous_variant	285368	exon4			GCCCCAGCGTAGC	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1377C>G	3.37:g.9989480G>C		Somatic	5	1		WXS	Illumina HiSeq	Phase_I	8	8	NM_207351	0	0	1	2	1	Q49AD0|Q6UXY6|Q8NBC9	Silent	SNP	ENST00000412055.1	37	CCDS43049.1																																																																																			.		0.721	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
CHST2	9435	hgsc.bcm.edu	37	3	142839977	142839977	+	Missense_Mutation	SNP	G	G	A	rs185111962	byFrequency	TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr3:142839977G>A	ENST00000309575.3	+	2	1703	c.319G>A	c.(319-321)Ggg>Agg	p.G107R		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	107					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						ggggcgcccagggccgcctcc	0.761													G|||	32	0.00638978	0.0008	0.0115	5008	,	,		9166	0.0		0.0179	False		,,,				2504	0.0051				p.G107R		.											.	CHST2-93	0			c.G319A						.	G	ARG/GLY	6,3188		0,6,1591	2.0	2.0	2.0		319	2.4	0.8	3		2	29,6187		0,29,3079	no	missense	CHST2	NM_004267.4	125	0,35,4670	AA,AG,GG		0.4665,0.1879,0.3719	benign	107/531	142839977	35,9375	1597	3108	4705	SO:0001583	missense	9435	exon2			CGCCCAGGGCCGC	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.319G>A	3.37:g.142839977G>A	ENSP00000307911:p.Gly107Arg	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	6	5	NM_004267	0	0	0	1	1	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	22	0.010073260073260074	6	0.012195121951219513	4	0.011049723756906077	0	0.0	12	0.0158311345646438	G	4.642	0.119345	0.08881	0.001879	0.004665	ENSG00000175040	ENST00000309575	D	0.97041	-4.22	3.3	2.42	0.29668	.	.	.	.	.	D	0.85225	0.5648	N	0.14661	0.345	0.27986	N	0.935857	B	0.06786	0.001	B	0.08055	0.003	T	0.82478	-0.0437	9	0.51188	T	0.08	-12.4417	4.825	0.13412	0.1239:0.2213:0.6548:0.0	.	107	Q9Y4C5	CHST2_HUMAN	R	107	ENSP00000307911:G107R	ENSP00000307911:G107R	G	+	1	0	CHST2	144322667	0.000000	0.05858	0.845000	0.33349	0.137000	0.21094	-0.018000	0.12568	0.947000	0.37659	0.407000	0.27541	GGG	G|0.990;A|0.010		0.761	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
SULT1E1	6783	broad.mit.edu	37	4	70713465	70713465	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr4:70713465T>C	ENST00000226444.3	-	6	654	c.542A>G	c.(541-543)aAg>aGg	p.K181R		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	181					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	ACTCTTTCCCTTTTCCCACCA	0.373																																					p.K181R													.	SULT1E1-91	0			c.A542G						.						101.0	101.0	101.0					4																	70713465		2203	4299	6502	SO:0001583	missense	6783	exon6			TTTCCCTTTTCCC	BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.542A>G	4.37:g.70713465T>C	ENSP00000226444:p.Lys181Arg	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	126	3	NM_005420	0	0	0	0	0	Q8N6X5	Missense_Mutation	SNP	ENST00000226444.3	37	CCDS3531.1	.	.	.	.	.	.	.	.	.	.	T	6.523	0.464767	0.12402	.	.	ENSG00000109193	ENST00000226444	D	0.81996	-1.56	4.21	1.61	0.23674	Sulfotransferase domain (1);	0.213134	0.41194	D	0.000932	T	0.67655	0.2916	L	0.35341	1.055	0.34216	D	0.674848	B	0.09022	0.002	B	0.16289	0.015	T	0.56866	-0.7908	10	0.21014	T	0.42	.	3.4375	0.07452	0.4064:0.0991:0.0:0.4945	.	181	P49888	ST1E1_HUMAN	R	181	ENSP00000226444:K181R	ENSP00000226444:K181R	K	-	2	0	SULT1E1	70748054	1.000000	0.71417	0.824000	0.32777	0.522000	0.34438	2.559000	0.45888	0.341000	0.23771	0.528000	0.53228	AAG	.		0.373	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251559.1	NM_005420	
RCHY1	25898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76439476	76439476	+	Silent	SNP	T	T	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr4:76439476T>C	ENST00000324439.5	-	1	419	c.21A>G	c.(19-21)gaA>gaG	p.E7E	THAP6_ENST00000507885.1_5'Flank|THAP6_ENST00000514480.1_5'Flank|THAP6_ENST00000380837.3_5'Flank|THAP6_ENST00000507556.1_5'Flank|THAP6_ENST00000311638.3_5'Flank|RCHY1_ENST00000512706.1_5'UTR|RCHY1_ENST00000451788.1_Silent_p.E7E|THAP6_ENST00000508105.1_5'Flank|RCHY1_ENST00000514021.1_Intron|THAP6_ENST00000502620.1_5'Flank|RCHY1_ENST00000513257.1_Silent_p.E7E|THAP6_ENST00000504190.1_5'Flank|RCHY1_ENST00000380840.2_Silent_p.E7E|THAP6_ENST00000507557.1_5'Flank	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	7					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TGGCGCCATCTTCCCGGGCCG	0.602																																					p.E7E		.											.	RCHY1-228	0			c.A21G						.						78.0	69.0	72.0					4																	76439476		2203	4300	6503	SO:0001819	synonymous_variant	25898	exon1			GCCATCTTCCCGG	AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.21A>G	4.37:g.76439476T>C		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	74	12	NM_001008925	0	0	1	1	0	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Silent	SNP	ENST00000324439.5	37	CCDS3567.1																																																																																			.		0.602	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252411.2	NM_015436	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	90052799	90052799	+	Missense_Mutation	SNP	G	G	A	rs200576500	byFrequency	TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr5:90052799G>A	ENST00000405460.2	+	57	11857	c.11761G>A	c.(11761-11763)Gct>Act	p.A3921T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3921	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTTAAAGGGCGCTGGGGAAGT	0.388													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16046	0.0		0.0	False		,,,				2504	0.0				p.A3921T		.											.	GPR98-103	0			c.G11761A						.	G	THR/ALA	5,3673		0,5,1834	77.0	75.0	76.0		11761	2.3	0.1	5		76	0,8158		0,0,4079	yes	missense	GPR98	NM_032119.3	58	0,5,5913	AA,AG,GG		0.0,0.1359,0.0422	benign	3921/6307	90052799	5,11831	1839	4079	5918	SO:0001583	missense	84059	exon57			AAGGGCGCTGGGG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11761G>A	5.37:g.90052799G>A	ENSP00000384582:p.Ala3921Thr	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	109	26	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	0.526	-0.860029	0.02610	0.001359	0.0	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.27256	1.68	5.3	2.27	0.28462	Na-Ca exchanger/integrin-beta4 (1);	0.732108	0.13525	N	0.381387	T	0.11879	0.0289	N	0.14661	0.345	0.22050	N	0.999396	B;B	0.23058	0.079;0.013	B;B	0.10450	0.005;0.002	T	0.25012	-1.0144	10	0.25751	T	0.34	.	4.1082	0.10047	0.2731:0.3558:0.3711:0.0	.	3921;3921	E7ETI5;Q8WXG9	.;GPR98_HUMAN	T	3921	ENSP00000384582:A3921T	ENSP00000296619:A3921T	A	+	1	0	GPR98	90088555	0.001000	0.12720	0.090000	0.20809	0.015000	0.08874	-0.111000	0.10807	0.694000	0.31654	0.467000	0.42956	GCT	.		0.388	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
KDM3B	51780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137766032	137766032	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr5:137766032A>G	ENST00000314358.5	+	22	5188	c.4988A>G	c.(4987-4989)tAt>tGt	p.Y1663C	KDM3B_ENST00000394866.1_Missense_Mutation_p.Y1319C|KDM3B_ENST00000542866.1_Missense_Mutation_p.Y695C	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1663	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						AAGCGACTCTATGAGGAGTAT	0.542																																					p.Y1663C		.											.	KDM3B-542	0			c.A4988G						.						146.0	136.0	140.0					5																	137766032		2203	4300	6503	SO:0001583	missense	51780	exon22			GACTCTATGAGGA	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4988A>G	5.37:g.137766032A>G	ENSP00000326563:p.Tyr1663Cys	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	191	27	NM_016604	0	0	13	21	8	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.178274	0.78564	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.70631	-0.5;-0.5;-0.5	5.71	4.51	0.55191	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.056809	0.64402	D	0.000001	T	0.72550	0.3474	L	0.41824	1.3	0.58432	D	0.999997	P;P	0.46457	0.878;0.786	P;P	0.54544	0.575;0.755	T	0.72181	-0.4368	10	0.51188	T	0.08	-12.6174	11.8878	0.52613	0.8691:0.0:0.0:0.1309	.	1319;1663	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	C	1663;1453;1319;695	ENSP00000326563:Y1663C;ENSP00000378335:Y1319C;ENSP00000439462:Y695C	ENSP00000326563:Y1663C	Y	+	2	0	KDM3B	137793931	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.941000	0.63540	0.939000	0.37446	0.533000	0.62120	TAT	.		0.542	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
C6orf211	79624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	151789725	151789725	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr6:151789725T>G	ENST00000367294.3	+	5	1065	c.806T>G	c.(805-807)tTg>tGg	p.L269W	C6orf211_ENST00000545879.1_Missense_Mutation_p.L150W	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	269										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		GCCGACTTCTTGTTGTCCTCT	0.328																																					p.L269W		.											.	C6orf211-90	0			c.T806G						.						132.0	138.0	136.0					6																	151789725		2203	4300	6503	SO:0001583	missense	79624	exon5			ACTTCTTGTTGTC	AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.806T>G	6.37:g.151789725T>G	ENSP00000356263:p.Leu269Trp	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	141	12	NM_024573	0	0	32	45	13	Q96FC6|Q9UFY5	Missense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.593869	0.86953	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	T;T	0.23552	1.9;1.9	6.02	6.02	0.97574	Domain of unknown function DUF89 (2);	0.141422	0.45126	D	0.000394	T	0.59959	0.2232	H	0.95884	3.735	0.58432	D	0.999993	D	0.89917	1.0	D	0.85130	0.997	T	0.74682	-0.3583	10	0.87932	D	0	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	269	Q9H993	CF211_HUMAN	W	269;150	ENSP00000356263:L269W;ENSP00000444121:L150W	ENSP00000356263:L269W	L	+	2	0	C6orf211	151831418	1.000000	0.71417	0.087000	0.20705	0.990000	0.78478	7.963000	0.87922	2.299000	0.77371	0.528000	0.53228	TTG	.		0.328	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573	
CDKN2A	1029	broad.mit.edu	37	9	21974720	21974720	+	Missense_Mutation	SNP	G	G	C	rs398123152|rs200382984		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr9:21974720G>C	ENST00000304494.5	-	1	377	c.107C>G	c.(106-108)gCg>gGg	p.A36G	CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000446177.1_Missense_Mutation_p.A36G|CDKN2A_ENST00000498124.1_Missense_Mutation_p.A36G|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579122.1_Missense_Mutation_p.A36G|CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000498628.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	36					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.L32_L37del(5)|p.G35fs*13(1)|p.0(1)|p.V28_V51del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GTTGGGCAGCGCCCCCGCCTC	0.726		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.A36G													.	CDKN2A-23992	1346	Whole gene deletion(1316)|Unknown(23)|Deletion - In frame(6)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(278)|skin(170)|central_nervous_system(163)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(57)|oesophagus(54)|pleura(52)|upper_aerodigestive_tract(48)|ovary(34)|kidney(31)|breast(30)|pancreas(29)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.C107G						.						30.0	40.0	36.0					9																	21974720		2185	4267	6452	SO:0001583	missense	1029	exon1			GGCAGCGCCCCCG	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.107C>G	9.37:g.21974720G>C	ENSP00000307101:p.Ala36Gly	Somatic	93	16		WXS	Illumina HiSeq	Phase_I	131	41	NM_058197	1	0	4	5	0	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	37	CCDS6510.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013279	0.93346	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	T;T	0.80653	-1.4;-1.4	4.89	-0.489	0.12052	Ankyrin repeat-containing domain (3);	.	.	.	.	D	0.88706	0.6509	M	0.89095	3.005	0.44439	D	0.997367	P;D	0.89917	0.937;1.0	P;D	0.73380	0.722;0.98	D	0.86801	0.1992	9	0.87932	D	0	.	9.1815	0.37146	0.4104:0.0:0.5896:0.0	.	36;36	P42771;G3XAG3	CD2A1_HUMAN;.	G	36	ENSP00000307101:A36G;ENSP00000394932:A36G	ENSP00000307101:A36G	A	-	2	0	CDKN2A	21964720	0.005000	0.15991	0.007000	0.13788	0.698000	0.40448	0.412000	0.21131	-0.185000	0.10550	0.655000	0.94253	GCG	.		0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
CTSL3P	392360	broad.mit.edu;bcgsc.ca	37	9	90401711	90401711	+	RNA	SNP	A	A	C			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr9:90401711A>C	ENST00000354530.2	+	0	569					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)										GAGGCTCTGCAGATGCTAAGT	0.478																																					.													.	.	0			.						.						219.0	183.0	195.0					9																	90401711		2203	4300	6503			392360	.			CTCTGCAGATGCT	AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90401711A>C		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	119	6	.	0	0	0	0	0		RNA	SNP	ENST00000354530.2	37																																																																																				.		0.478	CTSL3P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356542.1	NR_027917	
ALAS2	212	hgsc.bcm.edu	37	X	55046923	55046923	+	Missense_Mutation	SNP	C	C	T	rs185504937		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chrX:55046923C>T	ENST00000330807.5	-	6	790	c.653G>A	c.(652-654)cGt>cAt	p.R218H	ALAS2_ENST00000498636.1_5'Flank|ALAS2_ENST00000396198.3_Missense_Mutation_p.R205H|ALAS2_ENST00000335854.4_Missense_Mutation_p.R181H	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	218			R -> H (in XLSA; significantly increased thermosensitivity; dbSNP:rs185504937). {ECO:0000269|PubMed:21309041}.		cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	AGCACCATGACGCTGCAGGGT	0.542													c|||	2	0.000529801	0.0	0.0014	3775	,	,		16485	0.0		0.001	False		,,,				2504	0.0				p.R218H		.											.	ALAS2-131	0			c.G653A						.		HIS/ARG,HIS/ARG,HIS/ARG	0,3825		0,0,0,1632,561	24.0	19.0	21.0		653,542,614	-0.3	1.0	X		21	4,6706		0,3,1,2423,1857	yes	missense,missense,missense	ALAS2	NM_000032.4,NM_001037967.3,NM_001037968.3	29,29,29	0,3,1,4055,2418	TT,TC,T,CC,C		0.0596,0.0,0.038	possibly-damaging,possibly-damaging,possibly-damaging	218/588,181/551,205/575	55046923	4,10531	2193	4284	6477	SO:0001583	missense	212	exon6			CCATGACGCTGCA		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.653G>A	X.37:g.55046923C>T	ENSP00000332369:p.Arg218His	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	10	10	NM_000032	0	0	0	0	0	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	2|2	0.0012055455093429777|0.0012055455093429777	0|0	0.0|0.0	1|1	0.0027624309392265192|0.0027624309392265192	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	c|c	17.63|17.63	3.438420|3.438420	0.62955|0.62955	0.0|0.0	5.96E-4|5.96E-4	ENSG00000158578|ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854|ENST00000455688	D;D;D|.	0.95447|.	-3.71;-3.71;-3.71|.	5.01|5.01	-0.267|-0.267	0.12938|0.12938	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.517064|.	0.22034|.	N|.	0.065549|.	T|T	0.43853|0.43853	0.1266|0.1266	L|L	0.58925|0.58925	1.835|1.835	0.32536|0.32536	N|N	0.534315|0.534315	P;P;P|.	0.42993|.	0.52;0.797;0.653|.	B;P;P|.	0.47645|.	0.425;0.553;0.553|.	T|T	0.51260|0.51260	-0.8728|-0.8728	10|5	0.49607|.	T|.	0.09|.	-0.0054|-0.0054	3.4364|3.4364	0.07448|0.07448	0.3175:0.2067:0.0:0.4758|0.3175:0.2067:0.0:0.4758	.|.	181;205;218|.	A8K6C4;Q5JZF5;P22557|.	.;.;HEM0_HUMAN|.	H|I	218;205;181|170	ENSP00000332369:R218H;ENSP00000379501:R205H;ENSP00000337131:R181H|.	ENSP00000332369:R218H|.	R|V	-|-	2|1	0|0	ALAS2|ALAS2	55063648|55063648	0.915000|0.915000	0.31059|0.31059	0.992000|0.992000	0.48379|0.48379	0.923000|0.923000	0.55619|0.55619	0.333000|0.333000	0.19768|0.19768	-0.009000|-0.009000	0.14296|0.14296	0.519000|0.519000	0.50382|0.50382	CGT|GTC	C|0.999;T|0.001		0.542	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	
SCAF11	9169	broad.mit.edu	37	12	46320707	46320708	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr12:46320707_46320708delTC	ENST00000369367.3	-	11	3009_3010	c.2776_2777delGA	c.(2776-2778)gaafs	p.E926fs	SCAF11_ENST00000549162.1_Frame_Shift_Del_p.E734fs|SCAF11_ENST00000419565.2_Frame_Shift_Del_p.E926fs|SCAF11_ENST00000465950.1_Frame_Shift_Del_p.E611fs|SCAF11_ENST00000550629.1_5'Flank	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	926	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GGTTCTCCTTTCTCTCTCTCTC	0.446																																					p.926_926del													.	SCAF11-93	0			c.2776_2777del						.																																			SO:0001589	frameshift_variant	9169	exon11			CTCCTTTCTCTCT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2776_2777delGA	12.37:g.46320717_46320718delTC	ENSP00000358374:p.Glu926fs	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	264	8	NM_004719	0	0	0	0	0	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Del	DEL	ENST00000369367.3	37	CCDS8748.2																																																																																			.		0.446	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
RXFP2	122042	broad.mit.edu	37	13	32376429	32376429	+	Frame_Shift_Del	DEL	A	A	-	rs200447228		TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr13:32376429delA	ENST00000298386.2	+	18	2223	c.2152delA	c.(2152-2154)aaafs	p.K720fs	RXFP2_ENST00000380314.1_Frame_Shift_Del_p.K696fs	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	720					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TTTCAAAATTAAAAAAAAAAG	0.348																																					p.K718fs													.	RXFP2-90	0			c.2152delA						.						100.0	110.0	107.0					13																	32376429		2203	4300	6503	SO:0001589	frameshift_variant	122042	exon18			AAAATTAAAAAAA	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.2152delA	13.37:g.32376429delA	ENSP00000298386:p.Lys720fs	Somatic	160	0		WXS	Illumina HiSeq	Phase_I	171	5	NM_130806	0	0	0	0	0	B1ALE9|Q3KU23	Frame_Shift_Del	DEL	ENST00000298386.2	37	CCDS9342.1																																																																																			.		0.348	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
RNMT	8731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	13731629	13731630	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr18:13731629_13731630insT	ENST00000383314.2	+	3	353_354	c.113_114insT	c.(112-117)gcttctfs	p.S39fs	RNMT_ENST00000592764.1_Frame_Shift_Ins_p.S39fs|RNMT_ENST00000535051.1_Intron|RNMT_ENST00000589866.1_Frame_Shift_Ins_p.S39fs|RNMT_ENST00000262173.3_Frame_Shift_Ins_p.S39fs|RNMT_ENST00000543302.2_Frame_Shift_Ins_p.S39fs			O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase	39					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA (guanine-N7)-methylation (GO:0036265)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|receptor complex (GO:0043235)	mRNA (guanine-N7-)-methyltransferase activity (GO:0004482)|RNA binding (GO:0003723)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|skin(2)	18						AACACAACAGCTTCTGGGACTG	0.371																																					p.A38fs	GBM(29;474 594 19092 36647 41529)	.											.	RNMT-90	0			c.113_114insT						.																																			SO:0001589	frameshift_variant	8731	exon3			.	AF067791	CCDS11867.1	18p11.21	2008-05-14			ENSG00000101654	ENSG00000101654	2.1.1.56		10075	protein-coding gene	gene with protein product		603514				9828141, 9705270	Standard	NM_003799		Approved	RG7MT1	uc002ksl.1	O43148	OTTHUMG00000131718	ENST00000383314.2:c.115dupT	18.37:g.13731631_13731631dupT	ENSP00000372804:p.Ser39fs	Somatic	222	0		WXS	Illumina HiSeq	Phase_I	140	31	NM_003799	0	0	0	0	0	B0YJ90|D3DUJ5|O94996|Q9UIJ9	Frame_Shift_Ins	INS	ENST00000383314.2	37	CCDS11867.1																																																																																			.		0.371	RNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254636.1	NM_003799	
COL28A1	340267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	7412962	7412963	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-BQ-5887-01A-11D-1961-08	TCGA-BQ-5887-11A-01D-1961-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1bd98e6b-f43c-424d-9d69-f2653ae70618	84765358-2446-4447-ab14-94b835dc736b	g.chr7:7412962_7412963CC>AT	ENST00000399429.3	-	32	2714_2715	c.2574_2575GG>AT	c.(2572-2577)aaGGat>aaATat	p.D859Y		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	859	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TTGAAGTCATCCTTGCTGGAGA	0.515																																					p.D859Y		.											.	COL28A1	0			c.G2574A						.																																			SO:0001583	missense	340267	exon32			GTCATCCTTGCTG	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.2574_2575delinsAT	7.37:g.7412962_7412963delinsAT	ENSP00000382356:p.Asp859Tyr	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	25.0		0	0	0	0	0	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	DNP	ENST00000399429.3	37	CCDS43553.1																																																																																			.		0.515	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
