#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SRSF4	6429	hgsc.bcm.edu;broad.mit.edu	37	1	29475685	29475685	+	Missense_Mutation	SNP	C	C	T	rs368357249		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:29475685C>T	ENST00000373795.4	-	6	956	c.722G>A	c.(721-723)cGg>cAg	p.R241Q	RP11-242O24.3_ENST00000413004.1_lincRNA|SRSF4_ENST00000546138.1_Silent_p.P139P|SRSF4_ENST00000466448.1_5'UTR	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	241	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						TTTCTTgctccggctccgact	0.592																																					p.R241Q		.											.	SRSF4-226	0			c.G722A						.	C	GLN/ARG	2,4398		0,2,2198	50.0	60.0	57.0		722	5.8	1.0	1		57	0,8596		0,0,4298	no	missense	SRSF4	NM_005626.4	43	0,2,6496	TT,TC,CC		0.0,0.0455,0.0154	probably-damaging	241/495	29475685	2,12994	2200	4298	6498	SO:0001583	missense	6429	exon6			TTGCTCCGGCTCC	BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.722G>A	1.37:g.29475685C>T	ENSP00000362900:p.Arg241Gln	Somatic	200	1		WXS	Illumina HiSeq	Phase_I	162	15	NM_005626	0	0	50	61	11	Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	ENST00000373795.4	37	CCDS333.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131145	0.56828	4.55E-4	0.0	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.38401	1.14	5.77	5.77	0.91146	.	0.201011	0.34932	N	0.003572	T	0.35189	0.0923	L	0.52573	1.65	0.80722	D	1	D	0.61080	0.989	B	0.42087	0.375	T	0.19778	-1.0295	10	0.59425	D	0.04	.	13.8822	0.63688	0.1522:0.8478:0.0:0.0	.	241	Q08170	SRSF4_HUMAN	Q	241	ENSP00000362900:R241Q	ENSP00000362900:R241Q	R	-	2	0	SRSF4	29348272	0.993000	0.37304	0.999000	0.59377	0.988000	0.76386	3.219000	0.51200	2.723000	0.93209	0.655000	0.94253	CGG	.		0.592	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
GJB5	2709	broad.mit.edu	37	1	35223072	35223072	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:35223072C>A	ENST00000338513.1	+	2	314	c.141C>A	c.(139-141)gaC>gaA	p.D47E	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	47					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				GGAGTGATGACCACAAGGACT	0.592																																					p.D47E													.	GJB5-91	0			c.C141A						.						142.0	120.0	128.0					1																	35223072		2203	4300	6503	SO:0001583	missense	2709	exon2			TGATGACCACAAG	BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.141C>A	1.37:g.35223072C>A	ENSP00000340811:p.Asp47Glu	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_005268	0	0	1	1	0	Q9UPA3	Missense_Mutation	SNP	ENST00000338513.1	37	CCDS382.1	.	.	.	.	.	.	.	.	.	.	C	4.945	0.175507	0.09391	.	.	ENSG00000189280	ENST00000338513	D	0.98150	-4.75	5.89	4.03	0.46877	Connexin, N-terminal (2);	0.052219	0.85682	D	0.000000	D	0.88340	0.6410	N	0.01289	-0.905	0.36678	D	0.87886	B	0.14805	0.011	B	0.21360	0.034	D	0.83549	0.0100	10	0.02654	T	1	.	9.8486	0.41043	0.0:0.757:0.115:0.128	.	47	O95377	CXB5_HUMAN	E	47	ENSP00000340811:D47E	ENSP00000340811:D47E	D	+	3	2	GJB5	34995659	0.995000	0.38212	1.000000	0.80357	0.995000	0.86356	0.341000	0.19909	0.840000	0.34995	0.561000	0.74099	GAC	.		0.592	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011561.1	NM_005268	
ZNF691	51058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	43317094	43317094	+	Silent	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:43317094C>A	ENST00000372506.1	+	4	805	c.465C>A	c.(463-465)ctC>ctA	p.L155L	ZNF691_ENST00000372508.3_Silent_p.L155L|ZNF691_ENST00000372504.1_Silent_p.L177L|ZNF691_ENST00000372502.1_Silent_p.L177L|ZNF691_ENST00000397044.3_Silent_p.L186L|ZNF691_ENST00000372507.1_Silent_p.L155L	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	186						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCTCAGACCTCACCACGCACC	0.597																																					p.L186L		.											.	ZNF691-24	0			c.C558A						.						61.0	56.0	58.0					1																	43317094		2203	4300	6503	SO:0001819	synonymous_variant	51058	exon4			AGACCTCACCACG		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.465C>A	1.37:g.43317094C>A		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	78	17	NM_001242739	0	0	10	11	1	A8MXP6|B4DJR7|O95878|Q9NWE8	Silent	SNP	ENST00000372506.1	37	CCDS476.1																																																																																			.		0.597	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
FGGY	55277	hgsc.bcm.edu	37	1	60139806	60139806	+	Splice_Site	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:60139806G>C	ENST00000303721.7	+	14	1686		c.e14+1		FGGY_ENST00000371218.4_Splice_Site|FGGY_ENST00000371212.1_Splice_Site|FGGY_ENST00000371210.1_Splice_Site	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					TTCTGTACAGGTATGTGAAGA	0.557																																					.		.											.	FGGY-69	0			c.1584+1G>C						.						161.0	106.0	124.0					1																	60139806		2203	4300	6503	SO:0001630	splice_region_variant	55277	exon15			GTACAGGTATGTG		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1512+1G>C	1.37:g.60139806G>C		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_001113411	0	0	0	0	0	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Splice_Site	SNP	ENST00000303721.7	37	CCDS611.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146268	0.77888	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6873	0.95984	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FGGY	59912394	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.760000	0.91671	2.890000	0.99128	0.585000	0.79938	.	.		0.557	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	Intron
CACHD1	57685	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	65143946	65143946	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:65143946G>A	ENST00000371073.2	+	23	3197	c.3197G>A	c.(3196-3198)gGg>gAg	p.G1066E	CACHD1_ENST00000290039.5_Missense_Mutation_p.G1015E|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1066					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TGCTTCGGGGGGATTGTGGGA	0.473																																					p.G1015E		.											.	CACHD1-92	0			c.G3044A						.						94.0	95.0	95.0					1																	65143946		2203	4300	6503	SO:0001583	missense	57685	exon23			TCGGGGGGATTGT	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3197G>A	1.37:g.65143946G>A	ENSP00000360113:p.Gly1066Glu	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	84	6	NM_020925	0	0	6	7	1	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37		.	.	.	.	.	.	.	.	.	.	G	33	5.284715	0.95517	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.58210	0.35;0.4	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.66839	0.2830	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66056	-0.6018	10	0.87932	D	0	-25.7352	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1066	Q5VU97	CAHD1_HUMAN	E	1066;1015	ENSP00000360113:G1066E;ENSP00000290039:G1015E	ENSP00000290039:G1015E	G	+	2	0	CACHD1	64916534	1.000000	0.71417	0.941000	0.38009	0.996000	0.88848	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GGG	.		0.473	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925	
FMO1	2326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171247924	171247924	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:171247924A>T	ENST00000354841.4	+	4	672	c.541A>T	c.(541-543)Ata>Tta	p.I181L	FMO1_ENST00000402921.2_Missense_Mutation_p.I118L|FMO1_ENST00000367750.3_Missense_Mutation_p.I181L|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	181					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GCATCCAGATATATTTAAGGA	0.418																																					p.I181L		.											.	FMO1-515	0			c.A541T						.						74.0	77.0	76.0					1																	171247924		2203	4300	6503	SO:0001583	missense	2326	exon5			CCAGATATATTTA	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.541A>T	1.37:g.171247924A>T	ENSP00000346901:p.Ile181Leu	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	137	44	NM_002021	0	0	71	167	96	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.131021	0.37630	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000402921;ENST00000354841	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.66	1.85	0.25348	.	0.462268	0.24947	N	0.034331	T	0.13243	0.0321	N	0.20610	0.595	0.09310	N	0.999994	B;B;B	0.13145	0.007;0.001;0.002	B;B;B	0.16289	0.015;0.001;0.01	T	0.21621	-1.0240	10	0.31617	T	0.26	-0.8266	5.0708	0.14606	0.5496:0.1475:0.3029:0.0	.	118;181;181	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	L	181;181;118;181	ENSP00000356724:I181L;ENSP00000406982:I181L;ENSP00000385543:I118L;ENSP00000346901:I181L	ENSP00000346901:I181L	I	+	1	0	FMO1	169514548	0.000000	0.05858	0.998000	0.56505	0.998000	0.95712	0.351000	0.20096	0.401000	0.25424	0.460000	0.39030	ATA	.		0.418	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
SUCO	51430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	172558217	172558217	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:172558217T>G	ENST00000263688.3	+	18	2195	c.1976T>G	c.(1975-1977)cTt>cGt	p.L659R	SUCO_ENST00000367723.4_Missense_Mutation_p.L810R|SUCO_ENST00000608151.1_Missense_Mutation_p.L811R|SUCO_ENST00000610051.1_Intron	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	659					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											AAAGATTATCTTGTGTTAGCT	0.383																																					p.L659R		.											.	.	0			c.T1976G						.						79.0	81.0	81.0					1																	172558217		2203	4299	6502	SO:0001583	missense	51430	exon18			ATTATCTTGTGTT	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1976T>G	1.37:g.172558217T>G	ENSP00000263688:p.Leu659Arg	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	88	30	NM_014283	0	0	7	13	6	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	T	3.471	-0.108011	0.06924	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	4.95	2.51	0.30379	.	0.913904	0.09394	N	0.808213	T	0.11324	0.0276	L	0.43152	1.355	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.28170	-1.0052	9	0.18276	T	0.48	-0.0114	2.1827	0.03879	0.4718:0.1619:0.0:0.3663	.	659;811;659	B4DZJ3;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	R	811;659	.	ENSP00000263688:L659R	L	+	2	0	C1orf9	170824840	0.000000	0.05858	0.002000	0.10522	0.610000	0.37248	-0.219000	0.09228	0.693000	0.31634	0.460000	0.39030	CTT	.		0.383	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
SHCBP1L	81626	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	182921876	182921876	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:182921876C>T	ENST00000367547.3	-	1	629	c.393G>A	c.(391-393)ctG>ctA	p.L131L	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_5'Flank	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	203										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TACAGTCCTGCAGCACTTCGT	0.627																																					p.L131L													.	SHCBP1L-91	0			c.G393A						.						40.0	37.0	38.0					1																	182921876		2203	4300	6503	SO:0001819	synonymous_variant	81626	exon1			GTCCTGCAGCACT	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.393G>A	1.37:g.182921876C>T		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	30	7	NM_030933	0	0	0	0	0	Q4G195|Q9BZQ3|Q9H2B6	Silent	SNP	ENST00000367547.3	37	CCDS30955.1																																																																																			.		0.627	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
KIF21B	23046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	200973948	200973948	+	Silent	SNP	C	C	A	rs140945427		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:200973948C>A	ENST00000422435.2	-	6	1162	c.846G>T	c.(844-846)cgG>cgT	p.R282R	KIF21B_ENST00000332129.2_Silent_p.R282R|KIF21B_ENST00000461742.2_Silent_p.R282R|KIF21B_ENST00000360529.5_Silent_p.R282R	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	282	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TAGCCCCTGTCCGCTTCAGCC	0.597																																					p.R282R		.											.	KIF21B-96	0			c.G846T						.						52.0	49.0	50.0					1																	200973948		2203	4300	6503	SO:0001819	synonymous_variant	23046	exon6			CCCTGTCCGCTTC	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.846G>T	1.37:g.200973948C>A		Somatic	68	2		WXS	Illumina HiSeq	Phase_I	84	26	NM_017596	0	0	3	3	0	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	CCDS58056.1																																																																																			C|1.000;T|0.000		0.597	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
TMEM81	388730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205053045	205053045	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:205053045A>C	ENST00000367167.3	-	1	600	c.404T>G	c.(403-405)tTc>tGc	p.F135C		NM_203376.1	NP_976310.1	Q6P7N7	TMM81_HUMAN	transmembrane protein 81	135	Ig-like.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			AAAGGGTTTGAAGACCTCATC	0.468																																					p.F135C		.											.	TMEM81-68	0			c.T404G						.						87.0	92.0	90.0					1																	205053045		2203	4300	6503	SO:0001583	missense	388730	exon1			GGTTTGAAGACCT	BC061592	CCDS1450.1	1q32.1	2013-01-11			ENSG00000174529	ENSG00000174529		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32349	protein-coding gene	gene with protein product							Standard	NM_203376		Approved	UNQ2788, MGC75217, HC3107, KVLA2788	uc001hbt.3	Q6P7N7	OTTHUMG00000037103	ENST00000367167.3:c.404T>G	1.37:g.205053045A>C	ENSP00000356135:p.Phe135Cys	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	139	32	NM_203376	0	0	2	3	1	Q6UVZ4	Missense_Mutation	SNP	ENST00000367167.3	37	CCDS1450.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.853325	0.51270	.	.	ENSG00000174529	ENST00000367167	T	0.42900	0.96	5.93	5.93	0.95920	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64216	0.2578	M	0.72894	2.215	0.47245	D	0.999365	D	0.89917	1.0	D	0.91635	0.999	T	0.67562	-0.5639	10	0.87932	D	0	-6.5281	14.6242	0.68608	1.0:0.0:0.0:0.0	.	135	Q6P7N7	TMM81_HUMAN	C	135	ENSP00000356135:F135C	ENSP00000356135:F135C	F	-	2	0	TMEM81	203319668	1.000000	0.71417	0.999000	0.59377	0.171000	0.22731	5.953000	0.70290	2.281000	0.76405	0.533000	0.62120	TTC	.		0.468	TMEM81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090076.1	NM_203376	
C10orf90	118611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	128193076	128193076	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr10:128193076C>G	ENST00000284694.7	-	3	813	c.693G>C	c.(691-693)gaG>gaC	p.E231D	C10orf90_ENST00000544758.1_Missense_Mutation_p.E328D|C10orf90_ENST00000392694.1_Missense_Mutation_p.E184D|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000454341.1_Missense_Mutation_p.E231D|C10orf90_ENST00000356858.3_Missense_Mutation_p.E184D	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	231					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		AAAAACTGGTCTCTTTGTCGT	0.557											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E231D		.											.	C10orf90-92	0			c.G693C						.						73.0	78.0	76.0					10																	128193076		2203	4300	6503	SO:0001583	missense	118611	exon3			ACTGGTCTCTTTG	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.693G>C	10.37:g.128193076C>G	ENSP00000284694:p.Glu231Asp	Somatic	96	0	1563	WXS	Illumina HiSeq	Phase_I	98	24	NM_001004298	0	0	0	0	0	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.944946	0.34283	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.28255	1.91;1.9;1.94;1.92;1.62	5.27	3.38	0.38709	.	0.457153	0.20722	N	0.086884	T	0.28863	0.0716	L	0.58101	1.795	0.09310	N	1	B;B;B;B;B	0.13594	0.001;0.001;0.008;0.001;0.001	B;B;B;B;B	0.19148	0.003;0.01;0.024;0.01;0.007	T	0.25641	-1.0126	10	0.59425	D	0.04	-3.5758	8.1384	0.31069	0.3227:0.5212:0.1561:0.0	.	328;328;184;231;231	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	D	184;231;231;328;231;184;184	ENSP00000284694:E231D;ENSP00000398786:E231D;ENSP00000444369:E328D;ENSP00000405995:E231D;ENSP00000376459:E184D	ENSP00000284694:E231D	E	-	3	2	C10orf90	128183066	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	0.565000	0.23578	0.756000	0.33013	0.655000	0.94253	GAG	.		0.557	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
OR52B2	255725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6190974	6190974	+	Missense_Mutation	SNP	T	T	A	rs35364339		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:6190974T>A	ENST00000530810.1	-	1	664	c.583A>T	c.(583-585)Act>Tct	p.T195S	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGTTAACAGTGATGTCAGCA	0.478																																					p.T195S	NSCLC(5;186 261 1778 7098 14207)	.											.	.	0			c.A583T						.						51.0	51.0	51.0					11																	6190974		2072	4218	6290	SO:0001583	missense	255725	exon1			TAACAGTGATGTC	AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.583A>T	11.37:g.6190974T>A	ENSP00000432011:p.Thr195Ser	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	43	11	NM_001004052	0	0	0	0	0	Q8NGM7	Missense_Mutation	SNP	ENST00000530810.1	37	CCDS53598.1	.	.	.	.	.	.	.	.	.	.	T	9.208	1.030275	0.19512	.	.	ENSG00000255307	ENST00000530810	T	0.00042	8.84	5.32	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	N	0.03881	-0.34	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.64347	-0.6429	9	0.26408	T	0.33	.	7.1804	0.25770	0.146:0.0:0.1526:0.7014	.	195	Q96RD2	O52B2_HUMAN	S	195	ENSP00000432011:T195S	ENSP00000432011:T195S	T	-	1	0	OR52B2	6147550	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	0.367000	0.20382	1.007000	0.39238	0.450000	0.29827	ACT	.		0.478	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385977.1	NM_001004052	
NUP160	23279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47819410	47819410	+	Silent	SNP	A	A	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:47819410A>C	ENST00000378460.2	-	27	3256	c.3210T>G	c.(3208-3210)gcT>gcG	p.A1070A	NUP160_ENST00000530326.1_Silent_p.A956A|NUP160_ENST00000528071.1_Silent_p.A956A	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	1070					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CCACAGCTCTAGCACGTGACT	0.443																																					p.A1070A		.											.	NUP160-209	0			c.T3210G						.						152.0	129.0	137.0					11																	47819410		2201	4298	6499	SO:0001819	synonymous_variant	23279	exon27			AGCTCTAGCACGT	D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.3210T>G	11.37:g.47819410A>C		Somatic	114	1		WXS	Illumina HiSeq	Phase_I	144	34	NM_015231	0	0	20	31	11	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	ENST00000378460.2	37	CCDS31484.1																																																																																			.		0.443	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	
OR4C11	219429	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	55371448	55371448	+	Missense_Mutation	SNP	C	C	A	rs373760102		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:55371448C>A	ENST00000302231.4	-	1	426	c.402G>T	c.(400-402)atG>atT	p.M134I		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						CCTGCTGGCTCATGATGGTTG	0.463																																					p.M134I		.											.	OR4C11-69	0			c.G402T						.						88.0	72.0	78.0					11																	55371448		2177	4010	6187	SO:0001583	missense	219429	exon1			CTGGCTCATGATG	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.402G>T	11.37:g.55371448C>A	ENSP00000306651:p.Met134Ile	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	110	6	NM_001004700	0	0	0	0	0	B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319072	0.41096	.	.	ENSG00000172188	ENST00000302231	T	0.00551	6.65	4.34	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000014	T	0.02047	0.0064	M	0.82923	2.615	0.27993	N	0.935588	D	0.69078	0.997	D	0.75020	0.985	T	0.08027	-1.0742	10	0.72032	D	0.01	.	10.4812	0.44695	0.0:0.9023:0.0:0.0977	.	134	Q6IEV9	OR4CB_HUMAN	I	134	ENSP00000306651:M134I	ENSP00000306651:M134I	M	-	3	0	OR4C11	55128024	0.991000	0.36638	0.963000	0.40424	0.237000	0.25408	2.968000	0.49224	1.187000	0.43000	0.478000	0.44815	ATG	.		0.463	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
DDX47	51202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12974592	12974592	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr12:12974592T>C	ENST00000358007.3	+	4	396	c.374T>C	c.(373-375)gTg>gCg	p.V125A	DDX47_ENST00000352940.4_Missense_Mutation_p.V125A	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	125	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		TCTGTAGCTGTGATTGTAGGT	0.358																																					p.V125A		.											.	DDX47-226	0			c.T374C						.						137.0	139.0	139.0					12																	12974592		2203	4300	6503	SO:0001583	missense	51202	exon4			TAGCTGTGATTGT	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.374T>C	12.37:g.12974592T>C	ENSP00000350698:p.Val125Ala	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	102	35	NM_201224	0	0	0	0	0	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	37	CCDS8655.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.143646	0.77888	.	.	ENSG00000213782	ENST00000352940;ENST00000358007;ENST00000544400	T;T;T	0.15017	2.46;2.46;2.46	4.87	4.87	0.63330	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21550	0.0519	N	0.13299	0.325	0.80722	D	1	B;B;D	0.55385	0.398;0.186;0.971	B;B;P	0.59703	0.379;0.121;0.862	T	0.05517	-1.0880	10	0.46703	T	0.11	-19.7359	14.3028	0.66364	0.0:0.0:0.0:1.0	.	125;125;125	Q9H4E3;G5E955;Q9H0S4	.;.;DDX47_HUMAN	A	125;125;62	ENSP00000319578:V125A;ENSP00000350698:V125A;ENSP00000444000:V62A	ENSP00000319578:V125A	V	+	2	0	DDX47	12865859	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	4.293000	0.59037	2.051000	0.60960	0.454000	0.30748	GTG	.		0.358	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355	
ANP32D	23519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48866684	48866684	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr12:48866684C>T	ENST00000266594.1	+	1	237	c.237C>T	c.(235-237)ggC>ggT	p.G79G		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	79						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						CCTCAGTGGGCCTAGAAGTAT	0.378																																					p.G79G		.											.	ANP32D-227	0			c.C237T						.						91.0	91.0	91.0					12																	48866684		2203	4300	6503	SO:0001819	synonymous_variant	23519	exon1			AGTGGGCCTAGAA	U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.237C>T	12.37:g.48866684C>T		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	112	38	NM_012404	0	0	0	0	0	Q6NTC4	Silent	SNP	ENST00000266594.1	37	CCDS31788.1																																																																																			.		0.378	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
TDG	6996	broad.mit.edu	37	12	104380795	104380795	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr12:104380795C>T	ENST00000392872.3	+	10	1394	c.1160C>T	c.(1159-1161)tCa>tTa	p.S387L	TDG_ENST00000536395.1_3'UTR|TDG_ENST00000544861.1_Missense_Mutation_p.S244L|TDG_ENST00000266775.9_Missense_Mutation_p.S383L|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Missense_Mutation_p.S183L	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase	387					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		ATGACCCAGTCATTTACAGAC	0.413								Base excision repair (BER), DNA glycosylases																													p.S387L													.	TDG-661	0			c.C1160T						.						168.0	133.0	145.0					12																	104380795		2203	4300	6503	SO:0001583	missense	6996	exon10			CCCAGTCATTTAC	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.1160C>T	12.37:g.104380795C>T	ENSP00000376611:p.Ser387Leu	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	166	6	NM_003211	0	0	12	14	2	Q8IUZ6|Q8IZM3	Missense_Mutation	SNP	ENST00000392872.3	37	CCDS9095.1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723998	0.68959	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000542036	T;T;T;T	0.31769	1.78;1.78;1.86;1.48	5.95	5.06	0.68205	.	0.444493	0.26556	N	0.023704	T	0.33760	0.0874	L	0.56769	1.78	0.58432	D	0.999992	B;B;B	0.14438	0.01;0.002;0.002	B;B;B	0.11329	0.004;0.006;0.006	T	0.10683	-1.0619	10	0.59425	D	0.04	0.0634	15.4557	0.75311	0.0:0.9335:0.0:0.0665	.	183;387;387	B4DI29;B2R848;Q13569	.;.;TDG_HUMAN	L	387;383;244;183	ENSP00000376611:S387L;ENSP00000266775:S383L;ENSP00000445899:S244L;ENSP00000439054:S183L	ENSP00000266775:S383L	S	+	2	0	TDG	102904925	1.000000	0.71417	0.784000	0.31847	0.985000	0.73830	4.673000	0.61604	1.526000	0.49068	0.655000	0.94253	TCA	.		0.413	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2		
KLF12	11278	hgsc.bcm.edu	37	13	74420188	74420188	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr13:74420188A>G	ENST00000377669.2	-	3	472	c.446T>C	c.(445-447)gTg>gCg	p.V149A	KLF12_ENST00000472022.1_5'UTR|KLF12_ENST00000377666.4_Missense_Mutation_p.V149A	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	149					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		TGCAGAGGCCACAAGGGGCCC	0.473																																					p.V149A		.											.	KLF12-91	0			c.T446C						.						81.0	70.0	74.0					13																	74420188		2203	4300	6503	SO:0001583	missense	11278	exon4			GAGGCCACAAGGG	AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.446T>C	13.37:g.74420188A>G	ENSP00000366897:p.Val149Ala	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_007249	0	0	7	7	0	A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	ENST00000377669.2	37	CCDS9449.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.879334	0.72294	.	.	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.29142	1.58;1.58	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.47930	0.1472	L	0.53249	1.67	0.80722	D	1	P	0.49447	0.924	P	0.59424	0.857	T	0.29336	-1.0015	10	0.38643	T	0.18	.	15.7258	0.77756	1.0:0.0:0.0:0.0	.	149	Q9Y4X4	KLF12_HUMAN	A	149	ENSP00000366897:V149A;ENSP00000366894:V149A	ENSP00000344057:V149A	V	-	2	0	KLF12	73318189	1.000000	0.71417	0.997000	0.53966	0.849000	0.48306	7.161000	0.77505	2.311000	0.77944	0.533000	0.62120	GTG	.		0.473	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045271.2	NM_007249	
FBXO34	55030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	55818351	55818351	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:55818351C>G	ENST00000313833.4	+	2	1488	c.1243C>G	c.(1243-1245)Cct>Gct	p.P415A	FBXO34_ENST00000440021.1_Missense_Mutation_p.P415A	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	415										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CGTTGGGTTACCTTTTTCCTC	0.458																																					p.P415A		.											.	FBXO34-228	0			c.C1243G						.						149.0	132.0	138.0					14																	55818351		2203	4300	6503	SO:0001583	missense	55030	exon2			GGGTTACCTTTTT	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1243C>G	14.37:g.55818351C>G	ENSP00000313159:p.Pro415Ala	Somatic	238	0		WXS	Illumina HiSeq	Phase_I	210	57	NM_017943	0	0	12	18	6	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	ENST00000313833.4	37	CCDS32086.1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.215359	0.01542	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.16897	2.31;2.31	5.48	1.31	0.21738	.	0.732971	0.11730	U	0.535077	T	0.12305	0.0299	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.33599	-0.9862	10	0.40728	T	0.16	-21.5592	0.8915	0.01255	0.1775:0.4073:0.173:0.2422	.	415	Q9NWN3	FBX34_HUMAN	A	415	ENSP00000313159:P415A;ENSP00000394117:P415A	ENSP00000313159:P415A	P	+	1	0	FBXO34	54888104	.	.	0.001000	0.08648	0.123000	0.20343	.	.	0.409000	0.25649	-0.156000	0.13503	CCT	.		0.458	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
SRSF5	6430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	70238167	70238167	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:70238167A>G	ENST00000553521.1	+	9	2261	c.808A>G	c.(808-810)Agt>Ggt	p.S270G	SRSF5_ENST00000557154.1_Missense_Mutation_p.S270G|SRSF5_ENST00000394366.2_Missense_Mutation_p.S270G|SRSF5_ENST00000553635.1_Missense_Mutation_p.S267G|SRSF5_ENST00000556587.1_3'UTR			Q13243	SRSF5_HUMAN	serine/arginine-rich splicing factor 5	270					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of cell cycle (GO:0051726)|response to wounding (GO:0009611)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|liver(1)	2						ATCAGTTGACAGTGGCAATTA	0.428																																					p.S270G		.											.	SRSF5-226	0			c.A808G						.						98.0	106.0	104.0					14																	70238167		2203	4300	6503	SO:0001583	missense	6430	exon8			GTTGACAGTGGCA	AF020307	CCDS32109.1	14q24	2013-02-12	2010-06-22	2010-06-22	ENSG00000100650	ENSG00000100650		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10787	protein-coding gene	gene with protein product	"""SR splicing factor 5"""	600914	"""splicing factor, arginine/serine-rich 5"""	SFRS5		7686911, 20516191	Standard	XM_005267998		Approved	SRP40, HRS	uc001xlp.3	Q13243		ENST00000553521.1:c.808A>G	14.37:g.70238167A>G	ENSP00000452123:p.Ser270Gly	Somatic	212	1		WXS	Illumina HiSeq	Phase_I	226	35	NM_001039465	0	0	47	70	23	O14797|Q16662|Q49AD6|Q6FGE0	Missense_Mutation	SNP	ENST00000553521.1	37	CCDS32109.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027850	0.54790	.	.	ENSG00000100650	ENST00000553521;ENST00000394366;ENST00000557154;ENST00000553635	T;T;T;T	0.15256	3.19;3.19;3.19;2.44	5.65	5.65	0.86999	.	0.483083	0.26711	N	0.022894	T	0.19406	0.0466	N	0.14661	0.345	0.80722	D	1	P;P	0.46395	0.877;0.805	P;P	0.51866	0.682;0.483	T	0.04005	-1.0985	10	0.49607	T	0.09	.	15.882	0.79211	1.0:0.0:0.0:0.0	.	267;270	Q13243-3;Q13243	.;SRSF5_HUMAN	G	270;270;270;267	ENSP00000452123:S270G;ENSP00000377892:S270G;ENSP00000451088:S270G;ENSP00000451391:S267G	ENSP00000377892:S270G	S	+	1	0	SRSF5	69307920	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.860000	0.75473	2.155000	0.67459	0.533000	0.62120	AGT	.		0.428	SRSF5-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412456.1	NM_001039465	
DICER1	23405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	95562982	95562982	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:95562982C>A	ENST00000526495.1	-	25	4566	c.4275G>T	c.(4273-4275)gaG>gaT	p.E1425D	DICER1_ENST00000527414.1_Missense_Mutation_p.E1425D|DICER1_ENST00000393063.1_Missense_Mutation_p.E1425D|DICER1_ENST00000343455.3_Missense_Mutation_p.E1425D|DICER1_ENST00000541352.1_Missense_Mutation_p.E1425D|DICER1_ENST00000556045.1_Missense_Mutation_p.E323D			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1425					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ACATCAGGCTctcctcctcct	0.478			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.E1425D		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1-961	0			c.G4275T						.						60.0	56.0	57.0					14																	95562982		2203	4300	6503	SO:0001583	missense	23405	exon24	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	CAGGCTCTCCTCC	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.4275G>T	14.37:g.95562982C>A	ENSP00000437256:p.Glu1425Asp	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	61	24	NM_030621	0	0	10	13	3	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.70|11.70	1.715346|1.715346	0.30413|0.30413	.|.	.|.	ENSG00000100697|ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352|ENST00000532939	T;T;T;T;D;T|.	0.87103|.	0.36;0.36;0.36;0.36;-2.21;0.67|.	5.32|5.32	1.91|1.91	0.25777|0.25777	Ribonuclease III (3);|.	0.391869|0.391869	0.24366|0.24366	N|N	0.039146|0.039146	T|.	0.38746|.	0.1052|.	L|L	0.38175|0.38175	1.15|1.15	0.39976|0.39976	D|D	0.974854|0.974854	B;B;B|.	0.13594|.	0.008;0.001;0.0|.	B;B;B|.	0.14578|.	0.009;0.011;0.004|.	T|.	0.21075|.	-1.0256|.	10|.	0.30854|.	T|.	0.27|.	-10.9506|-10.9506	0.6205|0.6205	0.00777|0.00777	0.405:0.2239:0.2011:0.17|0.405:0.2239:0.2011:0.17	.|.	323;1425;1425|.	B3KRG4;E0AD28;Q9UPY3|.	.;.;DICER_HUMAN|.	D|X	1425;1425;1425;1425;323;1425|104	ENSP00000343745:E1425D;ENSP00000437256:E1425D;ENSP00000376783:E1425D;ENSP00000435681:E1425D;ENSP00000451041:E323D;ENSP00000444719:E1425D|.	ENSP00000343745:E1425D|.	E|E	-|-	3|1	2|0	DICER1|DICER1	94632735|94632735	0.946000|0.946000	0.32159|0.32159	0.825000|0.825000	0.32803|0.32803	0.882000|0.882000	0.50991|0.50991	0.405000|0.405000	0.21015|0.21015	0.561000|0.561000	0.29186|0.29186	0.561000|0.561000	0.74099|0.74099	GAG|GAG	.		0.478	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
SYNE3	161176	hgsc.bcm.edu	37	14	95916297	95916297	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:95916297A>G	ENST00000334258.5	-	7	1434	c.1420T>C	c.(1420-1422)Tcc>Ccc	p.S474P	SYNE3_ENST00000554873.1_Missense_Mutation_p.S231P|SYNE3_ENST00000553340.1_Missense_Mutation_p.S474P|SYNE3_ENST00000557275.1_Missense_Mutation_p.S474P	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	474					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GTGTGAAGGGAAGGCAGGTCC	0.652																																					p.S474P		.											.	.	0			c.T1420C						.						32.0	32.0	32.0					14																	95916297		2170	4249	6419	SO:0001583	missense	161176	exon7			GAAGGGAAGGCAG	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1420T>C	14.37:g.95916297A>G	ENSP00000334308:p.Ser474Pro	Somatic	6	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_152592	0	0	2	2	0	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.989367	0.53934	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.15487	3.42;2.42;3.42;2.85	5.17	2.57	0.30868	.	0.000000	0.41712	D	0.000834	T	0.28830	0.0715	M	0.68317	2.08	0.27326	N	0.956905	D;D;D	0.67145	0.996;0.996;0.993	P;P;P	0.60682	0.878;0.878;0.759	T	0.04915	-1.0918	10	0.34782	T	0.22	-19.7633	6.0538	0.19800	0.6679:0.1694:0.0:0.1627	.	474;474;474	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	P	474;231;474;474	ENSP00000334308:S474P;ENSP00000452154:S231P;ENSP00000450562:S474P;ENSP00000450774:S474P	ENSP00000334308:S474P	S	-	1	0	C14orf49	94986050	0.963000	0.33076	0.998000	0.56505	0.802000	0.45316	0.686000	0.25392	0.754000	0.32968	0.482000	0.46254	TCC	.		0.652	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
TELO2	9894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1552985	1552985	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:1552985G>T	ENST00000262319.6	+	15	2103	c.1824G>T	c.(1822-1824)caG>caT	p.Q608H	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	608					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GCCTCCGGCAGCGCATGGACA	0.622																																					p.Q608H		.											.	TELO2-90	0			c.G1824T						.						143.0	133.0	137.0					16																	1552985		2199	4300	6499	SO:0001583	missense	9894	exon15			CCGGCAGCGCATG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1824G>T	16.37:g.1552985G>T	ENSP00000262319:p.Gln608His	Somatic	155	0		WXS	Illumina HiSeq	Phase_I	166	19	NM_016111	0	0	16	25	9	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772621	0.69992	.	.	ENSG00000100726	ENST00000262319	T	0.26518	1.73	5.09	5.09	0.68999	Telomere length regulation protein, conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.49660	0.1570	M	0.76938	2.355	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.50734	-0.8793	10	0.54805	T	0.06	-37.6041	10.8668	0.46860	0.0882:0.0:0.9118:0.0	.	608	Q9Y4R8	TELO2_HUMAN	H	608	ENSP00000262319:Q608H	ENSP00000262319:Q608H	Q	+	3	2	TELO2	1492986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.437000	0.52863	2.391000	0.81399	0.462000	0.41574	CAG	.		0.622	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
CNOT1	23019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	58580300	58580300	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:58580300T>G	ENST00000317147.5	-	29	4263	c.3931A>C	c.(3931-3933)Aat>Cat	p.N1311H	CNOT1_ENST00000245138.4_Missense_Mutation_p.N162H|SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000441024.2_Missense_Mutation_p.N1311H|CNOT1_ENST00000569240.1_Missense_Mutation_p.N1306H	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1311	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TCATCTAAATTCTTCAGGCGA	0.413																																					p.N1311H		.											.	CNOT1-95	0			c.A3931C						.						142.0	128.0	133.0					16																	58580300		2198	4300	6498	SO:0001583	missense	23019	exon29			CTAAATTCTTCAG	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3931A>C	16.37:g.58580300T>G	ENSP00000320949:p.Asn1311His	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	159	43	NM_206999	0	0	28	48	20	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.719378	0.48728	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.49432	0.81;0.78	5.39	5.39	0.77823	.	0.219192	0.53938	D	0.000042	T	0.35335	0.0928	N	0.24115	0.695	0.45541	D	0.998496	B;B;B;B	0.31351	0.0;0.32;0.0;0.003	B;B;B;B	0.34138	0.003;0.176;0.001;0.004	T	0.26258	-1.0108	10	0.48119	T	0.1	.	10.6062	0.45396	0.0:0.0753:0.0:0.9247	.	162;1311;1311;1306	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	H	1311;162;1306;1311	ENSP00000320949:N1311H;ENSP00000413113:N1311H	ENSP00000245138:N162H	N	-	1	0	CNOT1	57137801	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.289000	0.72696	2.043000	0.60533	0.528000	0.53228	AAT	.		0.413	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
SF3B3	23450	broad.mit.edu	37	16	70563043	70563043	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:70563043G>A	ENST00000302516.5	+	3	549	c.338G>A	c.(337-339)cGt>cAt	p.R113H	SNORD111B_ENST00000408587.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	113					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				AGTGGATGCCGTCGCATCGTT	0.443																																					p.R113H													.	SF3B3-91	0			c.G338A						.						81.0	77.0	79.0					16																	70563043		2198	4300	6498	SO:0001583	missense	23450	exon3			GATGCCGTCGCAT	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.338G>A	16.37:g.70563043G>A	ENSP00000305790:p.Arg113His	Somatic	89	1		WXS	Illumina HiSeq	Phase_I	119	4	NM_012426	0	0	32	32	0	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	G	34	5.293119	0.95546	.	.	ENSG00000189091	ENST00000302516;ENST00000310750	T	0.50001	0.76	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.80253	0.4589	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86338	0.1703	10	0.87932	D	0	.	19.5928	0.95522	0.0:0.0:1.0:0.0	.	113	Q15393	SF3B3_HUMAN	H	113	ENSP00000305790:R113H	ENSP00000305790:R113H	R	+	2	0	SF3B3	69120544	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	9.847000	0.99503	2.624000	0.88883	0.561000	0.74099	CGT	.		0.443	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
MLKL	197259	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	74729257	74729257	+	Missense_Mutation	SNP	C	C	G	rs376500500		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:74729257C>G	ENST00000308807.7	-	2	862	c.399G>C	c.(397-399)tgG>tgC	p.W133C	MLKL_ENST00000306247.7_Missense_Mutation_p.W133C	NM_152649.2	NP_689862.1			mixed lineage kinase domain-like											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(6)|skin(1)|stomach(2)	19						CTTCCTGTGCCCAGGACGCTC	0.542																																					p.W133C													.	MLKL-561	0			c.G399C						.						171.0	134.0	147.0					16																	74729257		2198	4300	6498	SO:0001583	missense	197259	exon2			CTGTGCCCAGGAC	AK091708	CCDS32487.1, CCDS45528.1	16q22.3	2008-02-05				ENSG00000168404			26617	protein-coding gene	gene with protein product		615153				12477932	Standard	NM_152649		Approved	FLJ34389	uc002fdb.2	Q8NB16		ENST00000308807.7:c.399G>C	16.37:g.74729257C>G	ENSP00000308351:p.Trp133Cys	Somatic	184	0		WXS	Illumina HiSeq	Phase_I	194	35	NM_152649	0	0	6	7	1		Missense_Mutation	SNP	ENST00000308807.7	37	CCDS32487.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.442978	0.25987	.	.	ENSG00000168404	ENST00000308807;ENST00000306247	T;T	0.78595	-1.19;2.72	4.15	3.08	0.35506	.	0.298558	0.30959	N	0.008526	T	0.79076	0.4385	L	0.34521	1.04	0.48087	D	0.999588	D;B	0.89917	1.0;0.152	D;B	0.78314	0.991;0.087	T	0.77991	-0.2379	10	0.49607	T	0.09	-10.8226	9.0746	0.36513	0.0:0.7742:0.2258:0.0	.	133;133	Q8NB16-2;Q8NB16	.;MLKL_HUMAN	C	133	ENSP00000308351:W133C;ENSP00000303118:W133C	ENSP00000303118:W133C	W	-	3	0	MLKL	73286758	0.880000	0.30214	0.792000	0.32020	0.055000	0.15305	1.805000	0.38883	2.243000	0.73865	0.555000	0.69702	TGG	.		0.542	MLKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436403.3	NM_152649	
ZNF778	197320	broad.mit.edu	37	16	89288533	89288533	+	Missense_Mutation	SNP	A	A	T	rs547595021		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:89288533A>T	ENST00000433976.2	+	3	391	c.59A>T	c.(58-60)cAt>cTt	p.H20L	ZNF778_ENST00000306502.6_Intron	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	20					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		GTCTGCCTTCATGAAGAACAG	0.443																																					p.H20L													.	.	0			c.A59T						.						108.0	102.0	104.0					16																	89288533		1961	4168	6129	SO:0001583	missense	197320	exon3			GCCTTCATGAAGA	AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.59A>T	16.37:g.89288533A>T	ENSP00000405289:p.His20Leu	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	103	4	NM_182531	0	0	0	0	0	Q08AG0	Missense_Mutation	SNP	ENST00000433976.2	37	CCDS45550.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.338506	0.24253	.	.	ENSG00000170100	ENST00000433976	T	0.05649	3.41	1.17	-2.12	0.07165	.	.	.	.	.	T	0.01976	0.0062	N	0.08118	0	0.25678	N	0.985829	P	0.36647	0.563	B	0.26094	0.066	T	0.44847	-0.9301	9	0.09590	T	0.72	.	4.7794	0.13195	0.4168:0.5831:0.0:0.0	.	20	Q96MU6	ZN778_HUMAN	L	20	ENSP00000405289:H20L	ENSP00000405289:H20L	H	+	2	0	ZNF778	87816034	0.000000	0.05858	0.249000	0.24280	0.277000	0.26821	-0.446000	0.06837	-0.453000	0.07076	0.369000	0.22263	CAT	.		0.443	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430383.1	NM_182531	
SERPINF1	5176	broad.mit.edu	37	17	1673260	1673260	+	Silent	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:1673260C>A	ENST00000254722.4	+	3	362	c.199C>A	c.(199-201)Cgg>Agg	p.R67R	SERPINF1_ENST00000571870.1_3'UTR	NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	67					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						TGACCTGTACCGGGTGCGATC	0.632																																					p.R67R													.	SERPINF1-227	0			c.C199A						.						92.0	85.0	88.0					17																	1673260		2203	4300	6503	SO:0001819	synonymous_variant	5176	exon3			CTGTACCGGGTGC	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.199C>A	17.37:g.1673260C>A		Somatic	138	0		WXS	Illumina HiSeq	Phase_I	182	6	NM_002615	0	0	36	36	0	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Silent	SNP	ENST00000254722.4	37	CCDS11012.1																																																																																			.		0.632	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	
SLC13A5	284111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	6597517	6597517	+	Splice_Site	SNP	C	C	G	rs113208940		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:6597517C>G	ENST00000433363.2	-	8	1289		c.e8-1		SLC13A5_ENST00000381074.4_Splice_Site|SLC13A5_ENST00000573648.1_Splice_Site|SLC13A5_ENST00000293800.6_Splice_Site	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5						transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						GGAGACATACCTAGGTGGGGA	0.502																																					.		.											.	SLC13A5-90	0			c.1056-1G>C						.						74.0	62.0	66.0					17																	6597517		2203	4300	6503	SO:0001630	splice_region_variant	284111	exon9			ACATACCTAGGTG	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.1056-1G>C	17.37:g.6597517C>G		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	66	17	NM_001143838	0	0	0	0	0	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Splice_Site	SNP	ENST00000433363.2	37	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969840	0.34754	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5007	0.87731	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC13A5	6538241	1.000000	0.71417	0.947000	0.38551	0.090000	0.18270	6.842000	0.75379	2.815000	0.96918	0.561000	0.74099	.	G|1.000		0.502	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	Intron
GAS7	8522	broad.mit.edu;bcgsc.ca	37	17	9846496	9846496	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:9846496G>A	ENST00000432992.2	-	7	833	c.673C>T	c.(673-675)Cag>Tag	p.Q225*	GAS7_ENST00000542249.1_Nonsense_Mutation_p.Q161*|GAS7_ENST00000437099.2_Nonsense_Mutation_p.Q161*|GAS7_ENST00000585266.1_Nonsense_Mutation_p.Q165*|GAS7_ENST00000580865.1_Nonsense_Mutation_p.Q85*|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000323816.4_Nonsense_Mutation_p.Q165*|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000578655.1_5'Flank|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000579158.1_Nonsense_Mutation_p.Q161*	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	225	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						AGCTGTTTCTGGAGCAGTAGT	0.552			T	MLL	AML*																																p.Q225X				Dom	yes		17	17p	8522	growth arrest-specific 7		L	.	GAS7-1083	0			c.C673T						.						182.0	164.0	170.0					17																	9846496		2203	4300	6503	SO:0001587	stop_gained	8522	exon7			GTTTCTGGAGCAG	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.673C>T	17.37:g.9846496G>A	ENSP00000407552:p.Gln225*	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	334	16	NM_201433	0	0	4	4	0	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Nonsense_Mutation	SNP	ENST00000432992.2	37	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	G	38	6.925348	0.97940	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	.	.	.	5.36	5.36	0.76844	.	0.081859	0.51477	D	0.000091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.6746	18.2231	0.89907	0.0:0.0:1.0:0.0	.	.	.	.	X	225;165;164;85;165;39	.	.	Q	-	1	0	GAS7	9787221	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	8.955000	0.93058	2.676000	0.91093	0.655000	0.94253	CAG	.		0.552	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433	
MYO1D	4642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	30932193	30932193	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:30932193C>T	ENST00000318217.5	-	21	3080	c.2776G>A	c.(2776-2778)Gac>Aac	p.D926N	MYO1D_ENST00000394649.4_Missense_Mutation_p.D838N|MYO1D_ENST00000579584.1_Missense_Mutation_p.D926N	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	926	Myosin tail. {ECO:0000255}.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			ACAATGAGGTCTTTGTTGTCT	0.423																																					p.D926N		.											.	MYO1D-137	0			c.G2776A						.						131.0	112.0	119.0					17																	30932193		2203	4300	6503	SO:0001583	missense	4642	exon21			TGAGGTCTTTGTT	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.2776G>A	17.37:g.30932193C>T	ENSP00000324527:p.Asp926Asn	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	108	19	NM_015194	0	0	51	70	19	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	32	5.168518	0.94768	.	.	ENSG00000176658	ENST00000318217;ENST00000394649	T	0.61158	0.13	4.88	4.88	0.63580	Myosin tail 2 (1);	0.000000	0.41294	U	0.000917	T	0.77579	0.4151	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.99;0.994	T	0.81355	-0.0970	10	0.72032	D	0.01	.	15.8776	0.79178	0.0:1.0:0.0:0.0	.	837;926	Q7Z3N6;O94832	.;MYO1D_HUMAN	N	926;118	ENSP00000324527:D926N	ENSP00000324527:D926N	D	-	1	0	MYO1D	27956306	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.421000	0.82119	0.655000	0.94253	GAC	.		0.423	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
UBTF	7343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42289818	42289818	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:42289818G>C	ENST00000302904.4	-	8	1157	c.665C>G	c.(664-666)aCt>aGt	p.T222S	UBTF_ENST00000343638.5_Intron|UBTF_ENST00000436088.1_Missense_Mutation_p.T222S|UBTF_ENST00000393606.3_Intron|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000527034.1_Intron|UBTF_ENST00000526094.1_Intron|UBTF_ENST00000529383.1_Missense_Mutation_p.T222S|UBTF_ENST00000533177.1_Intron|UBTF_ENST00000537550.1_5'Flank			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	222					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTCCTTCGTAGTGGCCTGCAA	0.637																																					p.T222S		.											.	UBTF-90	0			c.C665G						.						78.0	73.0	75.0					17																	42289818		2203	4300	6503	SO:0001583	missense	7343	exon8			TTCGTAGTGGCCT	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.665C>G	17.37:g.42289818G>C	ENSP00000302640:p.Thr222Ser	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	179	44	NM_014233	0	0	0	0	0	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	37	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	g	2.112	-0.403562	0.04832	.	.	ENSG00000108312	ENST00000302904;ENST00000436088;ENST00000529383	D;D;D	0.97791	-4.54;-4.54;-4.54	4.9	3.89	0.44902	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.171589	0.50627	N	0.000119	D	0.89853	0.6835	N	0.03050	-0.425	0.33275	D	0.561518	B	0.12630	0.006	B	0.23716	0.048	D	0.84792	0.0779	10	0.02654	T	1	-4.647	10.1054	0.42530	0.0:0.1493:0.696:0.1547	.	222	P17480	UBF1_HUMAN	S	222	ENSP00000302640:T222S;ENSP00000390669:T222S;ENSP00000435708:T222S	ENSP00000302640:T222S	T	-	2	0	UBTF	39645344	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.273000	0.65564	1.135000	0.42183	0.442000	0.29010	ACT	.		0.637	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
MRPL10	124995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45901623	45901623	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:45901623G>A	ENST00000351111.2	-	5	739	c.734C>T	c.(733-735)tCt>tTt	p.S245F	MRPL10_ENST00000290208.7_Missense_Mutation_p.S255F|OSBPL7_ENST00000007414.3_5'Flank|OSBPL7_ENST00000392507.3_5'Flank|MRPL10_ENST00000414011.1_Missense_Mutation_p.S255F	NM_145255.3	NP_660298.2	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10	245					ribosome biogenesis (GO:0042254)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|large_intestine(1)|lung(3)|ovary(1)	8						CGACATGACAGAATCCTTCTC	0.577																																					p.S255F		.											.	MRPL10-91	0			c.C764T						.						119.0	104.0	109.0					17																	45901623		2203	4300	6503	SO:0001583	missense	124995	exon6			ATGACAGAATCCT	AB051618	CCDS11516.1, CCDS11517.1	17q21.3	2012-09-13			ENSG00000159111	ENSG00000159111		"""Mitochondrial ribosomal proteins / large subunits"""	14055	protein-coding gene	gene with protein product	"""39S ribosomal protein L10, mitochondrial"""	611825				11551941	Standard	NM_148887		Approved	RPML8, MRP-L8, L10MT, MRP-L10, MRPL8, MGC17973	uc002ily.3	Q7Z7H8	OTTHUMG00000156302	ENST00000351111.2:c.734C>T	17.37:g.45901623G>A	ENSP00000324100:p.Ser245Phe	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	179	87	NM_148887	0	0	44	104	60	A6NGJ4|Q96B80|Q96Q55	Missense_Mutation	SNP	ENST00000351111.2	37	CCDS11516.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809636	0.50421	.	.	ENSG00000159111	ENST00000351111;ENST00000290208;ENST00000414011	T;T;T	0.50813	0.73;1.76;1.76	4.76	2.49	0.30216	.	1.038680	0.07593	N	0.922261	T	0.57286	0.2043	L	0.59436	1.845	0.09310	N	1	P;D	0.56521	0.8;0.976	B;P	0.51016	0.347;0.656	T	0.53034	-0.8495	10	0.72032	D	0.01	-2.0384	13.9408	0.64054	0.0:0.3197:0.6803:0.0	.	245;255	Q7Z7H8;A6NGJ4	RM10_HUMAN;.	F	245;255;255	ENSP00000324100:S245F;ENSP00000290208:S255F;ENSP00000395870:S255F	ENSP00000290208:S255F	S	-	2	0	MRPL10	43256622	0.009000	0.17119	0.001000	0.08648	0.056000	0.15407	1.692000	0.37731	0.954000	0.37851	0.491000	0.48974	TCT	.		0.577	MRPL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343764.1	NM_145255	
GGA3	23163	broad.mit.edu	37	17	73237524	73237524	+	Silent	SNP	G	G	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:73237524G>T	ENST00000245541.6	-	10	1119	c.903C>A	c.(901-903)gtC>gtA	p.V301V	GGA3_ENST00000351904.7_Silent_p.V268V|GGA3_ENST00000537686.1_3'UTR|GGA3_ENST00000582486.1_Silent_p.V229V|GGA3_ENST00000538886.1_Silent_p.V179V|GGA3_ENST00000578348.1_Silent_p.V179V|GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000582717.1_Silent_p.V229V	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	301	Binds to ARF1 (in long isoform).|Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			CGCCATTGATGACCTGCCCTT	0.547																																					p.V301V													.	GGA3-154	0			c.C903A						.						160.0	142.0	148.0					17																	73237524		2203	4300	6503	SO:0001819	synonymous_variant	23163	exon10			ATTGATGACCTGC	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.903C>A	17.37:g.73237524G>T		Somatic	105	0		WXS	Illumina HiSeq	Phase_I	156	4	NM_138619	0	0	14	14	0	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Silent	SNP	ENST00000245541.6	37	CCDS11717.1																																																																																			.		0.547	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619	
SHC2	25759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	422226	422226	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:422226T>C	ENST00000264554.6	-	11	1539	c.1540A>G	c.(1540-1542)Acc>Gcc	p.T514A		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	514	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGGGTTGGTGACGCTGTCT	0.677																																					p.T514A		.											.	SHC2-392	0			c.A1540G						.						23.0	28.0	27.0					19																	422226		2196	4298	6494	SO:0001583	missense	25759	exon11			GGTTGGTGACGCT	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.1540A>G	19.37:g.422226T>C	ENSP00000264554:p.Thr514Ala	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	31	9	NM_012435	0	0	3	3	0	O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	ENST00000264554.6	37	CCDS45891.1	.	.	.	.	.	.	.	.	.	.	T	18.98	3.738320	0.69304	.	.	ENSG00000129946	ENST00000264554	T	0.65178	-0.14	4.76	4.76	0.60689	SH2 motif (5);	0.000000	0.85682	D	0.000000	T	0.67401	0.2889	M	0.65975	2.015	0.54753	D	0.999983	P	0.36495	0.556	P	0.44561	0.453	T	0.71563	-0.4555	10	0.62326	D	0.03	-60.9323	13.7837	0.63097	0.0:0.0:0.0:1.0	.	514	P98077	SHC2_HUMAN	A	514	ENSP00000264554:T514A	ENSP00000264554:T514A	T	-	1	0	SHC2	373226	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	7.409000	0.80053	2.084000	0.62774	0.533000	0.62120	ACC	.		0.677	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3		
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9046479	9046479	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:9046479C>G	ENST00000397910.4	-	5	35355	c.35152G>C	c.(35152-35154)Gta>Cta	p.V11718L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11720	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGCCATTACAGGTGTGGCA	0.502																																					p.V11718L		.											.	MUC16-566	0			c.G35152C						.						125.0	120.0	121.0					19																	9046479		1975	4155	6130	SO:0001583	missense	94025	exon5			CCATTACAGGTGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35152G>C	19.37:g.9046479C>G	ENSP00000381008:p.Val11718Leu	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	158	44	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	6.049	0.377322	0.11466	.	.	ENSG00000181143	ENST00000397910	T	0.01998	4.51	3.09	-1.82	0.07857	.	.	.	.	.	T	0.00845	0.0028	N	0.01352	-0.895	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.47032	-0.9148	8	0.87932	D	0	.	1.1809	0.01845	0.2598:0.1629:0.1061:0.4712	.	11718	B5ME49	.	L	11718	ENSP00000381008:V11718L	ENSP00000381008:V11718L	V	-	1	0	MUC16	8907479	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.203000	0.09438	-0.527000	0.06374	-0.373000	0.07131	GTA	.		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9085838	9085838	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:9085838C>A	ENST00000397910.4	-	1	6180	c.5977G>T	c.(5977-5979)Gaa>Taa	p.E1993*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1993	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAAACTTTTTCTGAAGAAACT	0.473																																					p.E1993X		.											.	MUC16-566	0			c.G5977T						.						139.0	135.0	136.0					19																	9085838		1983	4158	6141	SO:0001587	stop_gained	94025	exon1			CTTTTTCTGAAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5977G>T	19.37:g.9085838C>A	ENSP00000381008:p.Glu1993*	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	126	9	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	46	12.553061	0.99677	.	.	ENSG00000181143	ENST00000397910	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	1993	.	ENSP00000381008:E1993X	E	-	1	0	MUC16	8946838	0.001000	0.12720	0.291000	0.24904	0.292000	0.27327	0.223000	0.17719	0.308000	0.22923	0.313000	0.20887	GAA	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF44	51710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12384693	12384693	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:12384693G>C	ENST00000356109.5	-	5	639	c.521C>G	c.(520-522)aCt>aGt	p.T174S	ZNF44_ENST00000355684.5_Missense_Mutation_p.T126S	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		TTTGTGTCCAGTATCAACTCT	0.438																																					p.T174S		.											.	ZNF44-23	0			c.C521G						.						158.0	157.0	158.0					19																	12384693		2179	4293	6472	SO:0001583	missense	51710	exon5			TGTCCAGTATCAA	X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.521C>G	19.37:g.12384693G>C	ENSP00000348419:p.Thr174Ser	Somatic	145	1		WXS	Illumina HiSeq	Phase_I	171	48	NM_001164276	0	0	7	14	7	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	37	CCDS54223.1	.	.	.	.	.	.	.	.	.	.	G	4.481	0.089108	0.08583	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.07114	3.29;3.22;3.28	1.28	0.0261	0.14148	.	.	.	.	.	T	0.07324	0.0185	L	0.39692	1.235	.	.	.	B;B	0.24368	0.102;0.048	B;B	0.22753	0.018;0.041	T	0.15065	-1.0450	8	0.46703	T	0.11	.	8.1694	0.31245	0.0:0.2536:0.7464:0.0	.	174;126	P15621;F8W7T7	ZNF44_HUMAN;.	S	174;174;126;126	ENSP00000377008:T174S;ENSP00000348419:T174S;ENSP00000347910:T126S	ENSP00000347910:T126S	T	-	2	0	ZNF44	12245693	0.000000	0.05858	0.002000	0.10522	0.361000	0.29550	-0.136000	0.10405	0.070000	0.16634	0.313000	0.20887	ACT	.		0.438	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264	
ZNF208	7757	broad.mit.edu;bcgsc.ca	37	19	22157487	22157487	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:22157487A>T	ENST00000397126.4	-	4	497	c.349T>A	c.(349-351)Tat>Aat	p.Y117N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATTGGTATAACCAATTTTT	0.353																																					p.Y117N													.	ZNF208-7	0			c.T349A						.						90.0	90.0	90.0					19																	22157487		2038	4232	6270	SO:0001583	missense	7757	exon4			TGGTATAACCAAT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.349T>A	19.37:g.22157487A>T	ENSP00000380315:p.Tyr117Asn	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	182	7	NM_007153	0	0	0	0	0		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	A	7.551	0.662680	0.14645	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.06449	3.3	1.62	-1.2	0.09554	.	.	.	.	.	T	0.06826	0.0174	.	.	.	0.09310	N	1	D	0.54047	0.964	P	0.50136	0.632	T	0.27536	-1.0071	8	0.28530	T	0.3	.	2.3589	0.04302	0.491:0.3012:0.2078:0.0	.	117	O43345	ZN208_HUMAN	N	117	ENSP00000380315:Y117N	ENSP00000380315:Y117N	Y	-	1	0	ZNF208	21949327	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.308000	0.08156	-0.342000	0.08363	0.240000	0.17902	TAT	.		0.353	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
MAP4K1	11184	hgsc.bcm.edu	37	19	39096057	39096057	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:39096057T>C	ENST00000591517.1	-	19	1466	c.1438A>G	c.(1438-1440)Aag>Gag	p.K480E	MAP4K1_ENST00000423454.2_Missense_Mutation_p.K142E|MAP4K1_ENST00000589130.1_Missense_Mutation_p.K476E|MAP4K1_ENST00000589002.1_5'Flank|MAP4K1_ENST00000396857.2_Missense_Mutation_p.K480E|MAP4K1_ENST00000586296.1_Intron	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	480					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ACCTTTCTCTTCATCTTTTCC	0.587																																					p.K480E		.											.	MAP4K1-980	0			c.A1438G						.						21.0	21.0	21.0					19																	39096057		1807	4060	5867	SO:0001583	missense	11184	exon19			TTCTCTTCATCTT	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1438A>G	19.37:g.39096057T>C	ENSP00000465039:p.Lys480Glu	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	17	2	NM_007181	0	0	0	0	0		Missense_Mutation	SNP	ENST00000591517.1	37	CCDS59385.1	.	.	.	.	.	.	.	.	.	.	.	1.988	-0.432397	0.04669	.	.	ENSG00000104814	ENST00000396857;ENST00000221409;ENST00000423454	T;T	0.72394	-0.65;2.9	4.72	4.72	0.59763	.	1.847090	0.02398	N	0.080338	T	0.58163	0.2103	N	0.22421	0.69	0.22656	N	0.998888	P;B;B	0.38195	0.622;0.143;0.162	B;B;B	0.32762	0.152;0.075;0.055	T	0.53585	-0.8418	10	0.52906	T	0.07	.	6.9512	0.24546	0.0:0.1009:0.0:0.8991	.	142;480;480	B4E087;Q92918-2;Q92918	.;.;M4K1_HUMAN	E	480;480;142	ENSP00000380066:K480E;ENSP00000396383:K142E	ENSP00000221409:K480E	K	-	1	0	MAP4K1	43787897	0.899000	0.30636	0.992000	0.48379	0.788000	0.44548	0.992000	0.29667	1.989000	0.58080	0.334000	0.21626	AAG	.		0.587	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600	
ZNF544	27300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58774085	58774085	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:58774085G>A	ENST00000596652.1	+	6	2347	c.2113G>A	c.(2113-2115)Gtg>Atg	p.V705M	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000415203.2_Missense_Mutation_p.V677M|ZNF544_ENST00000600044.1_Missense_Mutation_p.V677M|CTD-3138B18.5_ENST00000597230.1_RNA|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000600220.1_Missense_Mutation_p.V677M|ZNF544_ENST00000599953.1_Missense_Mutation_p.V563M|ZNF544_ENST00000269829.4_Missense_Mutation_p.V705M			Q6NX49	ZN544_HUMAN	zinc finger protein 544	705					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TCAACTTGTAGTGCATCGGCG	0.488																																					p.V705M		.											.	ZNF544-91	0			c.G2113A						.						143.0	146.0	145.0					19																	58774085		2203	4300	6503	SO:0001583	missense	27300	exon7			CTTGTAGTGCATC	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.2113G>A	19.37:g.58774085G>A	ENSP00000469635:p.Val705Met	Somatic	282	0		WXS	Illumina HiSeq	Phase_I	327	85	NM_014480	0	0	17	17	0	A8K6J1|Q9UEX4	Missense_Mutation	SNP	ENST00000596652.1	37	CCDS12973.1	.	.	.	.	.	.	.	.	.	.	G	7.249	0.602782	0.13939	.	.	ENSG00000198131	ENST00000269829;ENST00000415203;ENST00000441758	T;T	0.36340	1.26;1.26	3.46	-0.182	0.13287	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24661	0.0598	L	0.49126	1.545	0.09310	N	1	B;B;P	0.39480	0.061;0.235;0.675	B;B;B	0.32677	0.018;0.019;0.15	T	0.12734	-1.0536	9	0.48119	T	0.1	.	4.3215	0.11020	0.411:0.1657:0.4233:0.0	.	677;677;705	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	M	705;677;257	ENSP00000269829:V705M;ENSP00000394341:V677M	ENSP00000269829:V705M	V	+	1	0	ZNF544	63465897	0.000000	0.05858	0.000000	0.03702	0.507000	0.33981	-0.746000	0.04829	-0.024000	0.13941	0.563000	0.77884	GTG	.		0.488	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480	
NT5C1B	93034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	18767651	18767651	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr2:18767651G>C	ENST00000359846.2	-	4	384	c.307C>G	c.(307-309)Caa>Gaa	p.Q103E	NT5C1B_ENST00000460052.1_5'UTR|NT5C1B_ENST00000600945.1_Missense_Mutation_p.Q103E|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.Q103E|NT5C1B_ENST00000304081.4_Missense_Mutation_p.Q43E|RNU6-1215P_ENST00000384441.1_RNA	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	103	Ser-rich.				nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GATGATTCTTGTGATCCCTGT	0.488																																					p.Q120E		.											.	NT5C1B-47	0			c.C358G						.						97.0	86.0	89.0					2																	18767651		2203	4300	6503	SO:0001583	missense	93034	exon4			ATTCTTGTGATCC	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.307C>G	2.37:g.18767651G>C	ENSP00000352904:p.Gln103Glu	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	104	11	NM_001199087	0	0	0	0	0	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655456	0.29425	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846;ENST00000416783	D	0.91124	-2.79	4.79	4.79	0.61399	.	0.287423	0.25604	N	0.029528	D	0.84723	0.5535	L	0.29908	0.895	0.26210	N	0.979313	B;B;B;P;B;B;B;B	0.35745	0.366;0.366;0.278;0.518;0.39;0.264;0.209;0.313	B;B;B;B;B;B;B;B	0.35931	0.156;0.156;0.079;0.156;0.068;0.164;0.106;0.214	T	0.77930	-0.2403	10	0.37606	T	0.19	-30.2005	13.6483	0.62294	0.0:0.0:1.0:0.0	.	86;120;43;86;43;43;103;103	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;5NT1B_HUMAN;.	E	103;43;43;103;120	ENSP00000412639:Q43E	ENSP00000305979:Q43E	Q	-	1	0	NT5C1B-RDH14;NT5C1B	18631132	0.991000	0.36638	0.985000	0.45067	0.092000	0.18411	2.396000	0.44468	2.941000	0.99782	0.655000	0.94253	CAA	.		0.488	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
CPO	130749	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	207827299	207827299	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr2:207827299C>T	ENST00000272852.3	+	7	784	c.738C>T	c.(736-738)taC>taT	p.Y246Y		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	246						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TCACACCTTACGGCTACACCA	0.448																																					p.Y246Y		.											.	CPO-154	0			c.C738T						.						170.0	160.0	164.0					2																	207827299		2203	4300	6503	SO:0001819	synonymous_variant	130749	exon7			ACCTTACGGCTAC		CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.738C>T	2.37:g.207827299C>T		Somatic	179	0		WXS	Illumina HiSeq	Phase_I	255	15	NM_173077	0	0	0	0	0	Q2M277|Q7RTW7	Silent	SNP	ENST00000272852.3	37	CCDS2372.1																																																																																			.		0.448	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202040.2	NM_173077	
JAG1	182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	10625851	10625851	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr20:10625851C>T	ENST00000254958.5	-	17	2682	c.2167G>A	c.(2167-2169)Gag>Aag	p.E723K	JAG1_ENST00000488480.1_RNA|JAG1_ENST00000423891.2_Missense_Mutation_p.E564K	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	723	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)	p.E723fs*6(1)		biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GCATCCCCCTCATCATAGCAG	0.547									Alagille Syndrome																												p.E723K		.											.	JAG1-1273	1	Insertion - Frameshift(1)	lung(1)	c.G2167A						.						122.0	99.0	107.0					20																	10625851		2203	4300	6503	SO:0001583	missense	182	exon17	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CCCCCTCATCATA	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2167G>A	20.37:g.10625851C>T	ENSP00000254958:p.Glu723Lys	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	142	43	NM_000214	0	0	36	41	5	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.224010	0.39300	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.85629	-2.01;-2.01	5.85	5.85	0.93711	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	N	0.12569	0.235	0.58432	D	0.999995	B	0.02656	0.0	B	0.06405	0.002	T	0.68777	-0.5319	10	0.10377	T	0.69	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	723	P78504	JAG1_HUMAN	K	723;564	ENSP00000254958:E723K;ENSP00000389519:E564K	ENSP00000254958:E723K	E	-	1	0	JAG1	10573851	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	4.891000	0.63185	2.767000	0.95098	0.655000	0.94253	GAG	.		0.547	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
SON	6651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34918555	34918555	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr21:34918555T>G	ENST00000356577.4	+	2	589	c.114T>G	c.(112-114)aaT>aaG	p.N38K	SON_ENST00000381679.4_Missense_Mutation_p.N38K|SON_ENST00000300278.4_Missense_Mutation_p.N38K|SON_ENST00000290239.6_Missense_Mutation_p.N38K|SON_ENST00000381692.2_Missense_Mutation_p.N38K	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	38					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GTGAAACAAATACACCCATTG	0.393																																					p.N38K		.											.	SON-97	0			c.T114G						.						75.0	76.0	76.0					21																	34918555		2203	4300	6503	SO:0001583	missense	6651	exon2			AACAAATACACCC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.114T>G	21.37:g.34918555T>G	ENSP00000348984:p.Asn38Lys	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	65	23	NM_032195	0	0	28	43	15	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678619	0.68042	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000381692;ENST00000300278;ENST00000381679	T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45	5.68	-2.68	0.06041	.	0.232218	0.30244	N	0.010080	T	0.15003	0.0362	L	0.27053	0.805	0.22639	N	0.998909	B;D;D;D	0.58970	0.003;0.984;0.967;0.967	B;P;P;P	0.50860	0.001;0.449;0.652;0.652	T	0.20571	-1.0271	10	0.66056	D	0.02	.	10.9891	0.47539	0.0:0.578:0.0:0.422	.	38;38;38;38	Q6ZRV7;P18583;P18583-3;P18583-6	.;SON_HUMAN;.;.	K	38	ENSP00000348984:N38K;ENSP00000290239:N38K;ENSP00000371111:N38K;ENSP00000300278:N38K;ENSP00000371095:N38K	ENSP00000290239:N38K	N	+	3	2	SON	33840425	0.995000	0.38212	0.896000	0.35187	0.659000	0.38960	0.152000	0.16302	-0.281000	0.09141	-0.359000	0.07587	AAT	.		0.393	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
SON	6651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34922861	34922861	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr21:34922861T>G	ENST00000356577.4	+	3	1799	c.1324T>G	c.(1324-1326)Tct>Gct	p.S442A	SON_ENST00000381679.4_Missense_Mutation_p.S442A|SON_ENST00000300278.4_Missense_Mutation_p.S442A|SON_ENST00000290239.6_Missense_Mutation_p.S442A|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	442					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCCAGGGCCCTCTGTGACACC	0.632																																					p.S442A		.											.	SON-97	0			c.T1324G						.						34.0	37.0	36.0					21																	34922861		2202	4299	6501	SO:0001583	missense	6651	exon3			GGGCCCTCTGTGA	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1324T>G	21.37:g.34922861T>G	ENSP00000348984:p.Ser442Ala	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	87	23	NM_032195	0	0	30	48	18	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937742	0.52972	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.14893	2.65;2.66;2.66;2.47	4.92	1.26	0.21427	.	0.404453	0.21839	N	0.068355	T	0.13713	0.0332	N	0.19112	0.55	0.24219	N	0.995448	P;P;P	0.47962	0.844;0.903;0.903	B;P;P	0.50270	0.432;0.636;0.636	T	0.09975	-1.0650	10	0.38643	T	0.18	.	6.7013	0.23227	0.0:0.3711:0.0:0.6289	.	442;442;442	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	A	442	ENSP00000348984:S442A;ENSP00000290239:S442A;ENSP00000300278:S442A;ENSP00000371095:S442A	ENSP00000290239:S442A	S	+	1	0	SON	33844731	.	.	1.000000	0.80357	0.966000	0.64601	.	.	0.427000	0.26145	0.402000	0.26972	TCT	.		0.632	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
UBE2L3	7332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21975858	21975858	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr22:21975858G>C	ENST00000342192.4	+	4	563	c.365G>C	c.(364-366)cGg>cCg	p.R122P	UBE2L3_ENST00000545681.1_Missense_Mutation_p.R90P|UBE2L3_ENST00000458578.2_Missense_Mutation_p.R180P	NM_003347.3	NP_003338.1	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3	122					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein K11-linked ubiquitination (GO:0070979)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)|ubiquitin-protein transferase activity (GO:0004842)		UBE2L3/KRAS(2)	large_intestine(4)	4	Colorectal(54;0.105)					CACCCGCTTCGGGCTGACCTA	0.478																																					p.R180P		.											.	UBE2L3-414	0			c.G539C						.						34.0	34.0	34.0					22																	21975858		2203	4300	6503	SO:0001583	missense	7332	exon4			CGCTTCGGGCTGA	AJ000519	CCDS13790.1, CCDS58795.1, CCDS58796.1	22q11.2	2007-02-05			ENSG00000185651	ENSG00000185651		"""Ubiquitin-conjugating enzymes E2"""	12488	protein-coding gene	gene with protein product		603721				8672131, 9693040	Standard	NM_001256356		Approved	UBCH7	uc031rxe.1	P68036	OTTHUMG00000150823	ENST00000342192.4:c.365G>C	22.37:g.21975858G>C	ENSP00000344259:p.Arg122Pro	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	62	20	NM_001256355	0	0	188	276	88	B2R4A7|B4DDG1|B4DSZ4|E7EWS7|P51966|P70653|Q9HAV1	Missense_Mutation	SNP	ENST00000342192.4	37	CCDS13790.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.485144	0.84854	.	.	ENSG00000185651	ENST00000458578;ENST00000342192;ENST00000545681	T;T;T	0.71934	-0.61;-0.61;1.16	5.66	5.66	0.87406	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.070661	0.53938	D	0.000050	D	0.87103	0.6094	M	0.90814	3.15	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.75484	0.986;0.977	D	0.89031	0.3442	10	0.66056	D	0.02	.	17.2403	0.87011	0.0:0.0:1.0:0.0	.	90;122	B4DDG1;P68036	.;UB2L3_HUMAN	P	180;122;90	ENSP00000400906:R180P;ENSP00000344259:R122P;ENSP00000445931:R90P	ENSP00000344259:R122P	R	+	2	0	UBE2L3	20305858	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.848000	0.99507	2.680000	0.91292	0.561000	0.74099	CGG	.		0.478	UBE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320219.1	NM_198157	
LIMK2	3985	broad.mit.edu	37	22	31667152	31667152	+	Missense_Mutation	SNP	C	C	T	rs530553008		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr22:31667152C>T	ENST00000331728.4	+	12	1462	c.1348C>T	c.(1348-1350)Cgg>Tgg	p.R450W	LIMK2_ENST00000340552.4_Missense_Mutation_p.R429W|LIMK2_ENST00000333611.4_Missense_Mutation_p.R429W|LIMK2_ENST00000444929.2_Missense_Mutation_p.R204W|LIMK2_ENST00000406516.1_Missense_Mutation_p.R372W	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						CATCATCCACCGGGATCTGAA	0.537																																					p.R450W													.	LIMK2-548	0			c.C1348T						.						186.0	142.0	157.0					22																	31667152		2203	4300	6503	SO:0001583	missense	3985	exon12			ATCCACCGGGATC	D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1348C>T	22.37:g.31667152C>T	ENSP00000332687:p.Arg450Trp	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	174	5	NM_005569	0	0	38	39	1	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	ENST00000331728.4	37	CCDS13891.1	.	.	.	.	.	.	.	.	.	.	.	19.32	3.805918	0.70682	.	.	ENSG00000182541	ENST00000406516;ENST00000444929;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	D;D;D;D;D	0.94138	-3.36;-2.43;-2.43;-2.43;-3.36	5.28	4.25	0.50352	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98068	0.9363	H	0.99261	4.49	0.54753	D	0.999987	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.999;0.998;0.971	D	0.98141	1.0436	10	0.87932	D	0	-17.07	11.9007	0.52682	0.4439:0.5561:0.0:0.0	.	482;429;204;450;372	F5GY29;Q7L3H5;E7EUC1;P53671;B5MC51	.;.;.;LIMK2_HUMAN;.	W	372;204;450;482;429;429	ENSP00000384602:R372W;ENSP00000409522:R204W;ENSP00000332687:R450W;ENSP00000330470:R429W;ENSP00000339916:R429W	ENSP00000332687:R450W	R	+	1	2	LIMK2	29997152	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	1.785000	0.38684	1.204000	0.43247	0.460000	0.39030	CGG	.		0.537	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
NUP50	10762	hgsc.bcm.edu	37	22	45574342	45574342	+	Silent	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr22:45574342A>G	ENST00000347635.4	+	5	1030	c.564A>G	c.(562-564)aaA>aaG	p.K188K	NUP50_ENST00000407019.2_Silent_p.K160K|NUP50_ENST00000396096.2_Silent_p.K160K|CTA-268H5.12_ENST00000610217.1_RNA|NUP50_ENST00000425733.2_5'UTR	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	188	5 X 2 AA repeats of F-G.|Binding to CDKN1B. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTATCTTTAAAGACTATGAGA	0.453																																					p.K188K		.											.	NUP50-68	0			c.A564G						.						42.0	42.0	42.0					22																	45574342		2202	4296	6498	SO:0001819	synonymous_variant	10762	exon5			CTTTAAAGACTAT	AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.564A>G	22.37:g.45574342A>G		Somatic	87	2		WXS	Illumina HiSeq	Phase_I	113	12	NM_007172	0	0	17	17	0	B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Silent	SNP	ENST00000347635.4	37	CCDS14062.1																																																																																			.		0.453	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
VHL	7428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	10191506	10191506	+	Missense_Mutation	SNP	C	C	G	rs5030820		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr3:10191506C>G	ENST00000256474.2	+	3	1339	c.499C>G	c.(499-501)Cgg>Ggg	p.R167G	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Missense_Mutation_p.R126G	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	167			R -> G (in VHLD; type I-II). {ECO:0000269|PubMed:9829911}.|R -> Q (in pheochromocytoma and VHLD; type II; common mutation; dbSNP:rs5030821). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.|R -> W (in pheochromocytoma and VHLD; type II; common mutation; dbSNP:rs5030820). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:8592333, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.R167W(8)|p.R167G(2)|p.R167fs*1(1)|p.V166fs*6(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCAGGTTGTCCGGAGCCTAGT	0.512		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																												p.R167G		.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	.	VHL-6694	12	Substitution - Missense(10)|Deletion - Frameshift(1)|Insertion - Frameshift(1)	kidney(8)|adrenal_gland(2)|large_intestine(1)|endometrium(1)	c.C499G	GRCh37	CM941383|CM941384|HX040002	VHL	M|X	rs5030820	.						92.0	84.0	87.0					3																	10191506		2203	4300	6503	SO:0001583	missense	7428	exon3	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	GTTGTCCGGAGCC	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.499C>G	3.37:g.10191506C>G	ENSP00000256474:p.Arg167Gly	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	58	24	NM_000551	0	0	5	11	6	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548531	0.65311	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99830	-7.01;-7.01	4.86	3.97	0.46021	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	M	0.68952	2.095	0.42468	D	0.992812	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97794	1.0240	10	0.54805	T	0.06	-6.8035	10.4067	0.44260	0.3559:0.6441:0.0:0.0	.	126;167	P40337-2;P40337	.;VHL_HUMAN	G	167;126;85	ENSP00000256474:R167G;ENSP00000344757:R126G	ENSP00000256474:R167G	R	+	1	2	VHL	10166506	0.999000	0.42202	0.908000	0.35775	0.831000	0.47069	2.914000	0.48797	1.375000	0.46248	0.655000	0.94253	CGG	C|1.000		0.512	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1	NM_000551	
PHF7	51533	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52443866	52443866	+	5'Flank	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr3:52443866C>T	ENST00000327906.3	+	0	0				BAP1_ENST00000296288.5_Missense_Mutation_p.S10N|PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Missense_Mutation_p.S10N	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.S10T(1)|p.E7_S10delELES(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		ACCTGGGTCGCTCTCCAGCTC	0.746																																					p.S10N		.											.	BAP1-1032	2	Substitution - Missense(1)|Deletion - In frame(1)	kidney(2)	c.G29A						.						24.0	30.0	28.0					3																	52443866		2203	4298	6501	SO:0001631	upstream_gene_variant	8314	exon1			GGGTCGCTCTCCA	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52443866C>T	Exception_encountered	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	48	24	NM_004656	0	0	0	0	0	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	37	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450733	0.96205	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.61627	0.09;0.09	4.93	4.93	0.64822	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (4);	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83154	-0.0102	10	0.66056	D	0.02	-4.1481	15.9287	0.79644	0.0:1.0:0.0:0.0	.	10	Q92560	BAP1_HUMAN	N	10	ENSP00000417132:S10N;ENSP00000296288:S10N	ENSP00000296288:S10N	S	-	2	0	BAP1	52418906	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.832000	0.62759	2.289000	0.77006	0.561000	0.74099	AGC	.		0.746	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
HAUS3	79441	hgsc.bcm.edu;bcgsc.ca	37	4	2242534	2242534	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:2242534A>C	ENST00000243706.4	-	2	369	c.140T>G	c.(139-141)gTg>gGg	p.V47G	POLN_ENST00000511885.2_Intron|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000506763.1_Missense_Mutation_p.V47G|HAUS3_ENST00000443786.2_Missense_Mutation_p.V47G	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	47					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTGTTCATTCACATTCCCACA	0.413																																					p.V47G		.											.	HAUS3-138	0			c.T140G						.						121.0	110.0	114.0					4																	2242534		2203	4300	6503	SO:0001583	missense	79441	exon2			TCATTCACATTCC	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.140T>G	4.37:g.2242534A>C	ENSP00000243706:p.Val47Gly	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	153	13	NM_024511	0	0	5	5	0	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	ENST00000243706.4	37	CCDS33941.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101593	0.76983	.	.	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	T;T	0.59638	0.25;0.25	4.68	4.68	0.58851	.	0.084524	0.49305	U	0.000154	T	0.70596	0.3242	M	0.78049	2.395	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.62089	0.898;0.898	T	0.74222	-0.3735	10	0.87932	D	0	-17.236	8.3587	0.32346	0.9107:0.0:0.0893:0.0	.	47;47	B4DF64;Q68CZ6	.;HAUS3_HUMAN	G	47	ENSP00000243706:V47G;ENSP00000392903:V47G	ENSP00000243706:V47G	V	-	2	0	HAUS3	2212332	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.993000	0.70616	1.850000	0.53721	0.459000	0.35465	GTG	.		0.413	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511	
APBB2	323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	41015603	41015603	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:41015603T>A	ENST00000295974.8	-	6	1461	c.832A>T	c.(832-834)Aca>Tca	p.T278S	APBB2_ENST00000506352.1_Missense_Mutation_p.T278S|APBB2_ENST00000508593.1_Missense_Mutation_p.T278S|APBB2_ENST00000513140.1_Missense_Mutation_p.T278S	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	278					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						GGGGTACCTGTTTCATCCGGG	0.507																																					p.T278S	Ovarian(3;20 75 16686 49997)	.											.	APBB2-92	0			c.A832T						.						123.0	121.0	122.0					4																	41015603		1967	4143	6110	SO:0001583	missense	323	exon6			TACCTGTTTCATC	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.832A>T	4.37:g.41015603T>A	ENSP00000295974:p.Thr278Ser	Somatic	299	2		WXS	Illumina HiSeq	Phase_I	327	89	NM_173075	0	0	0	0	0	B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	ENST00000295974.8	37	CCDS54761.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.609|9.609	1.130697|1.130697	0.21041|0.21041	.|.	.|.	ENSG00000163697|ENSG00000163697	ENST00000513611|ENST00000295974;ENST00000316212;ENST00000513140;ENST00000508593;ENST00000506352	.|T;T;T;T	.|0.16073	.|2.38;2.38;2.38;2.37	6.03|6.03	-1.64|-1.64	0.08318|0.08318	.|.	.|0.353536	.|0.31484	.|N	.|0.007572	T|T	0.09512|0.09512	0.0234|0.0234	L|L	0.31065|0.31065	0.9|0.9	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.26602	.|0.016;0.002;0.005;0.154	.|B;B;B;B	.|0.25759	.|0.022;0.005;0.007;0.063	T|T	0.30001|0.30001	-0.9993|-0.9993	5|10	.|0.09338	.|T	.|0.73	.|.	11.3558|11.3558	0.49615|0.49615	0.0:0.369:0.0:0.631|0.0:0.369:0.0:0.631	.|.	.|261;278;278;278	.|B4DJ88;E9PG87;Q92870-2;Q92870	.|.;.;.;APBB2_HUMAN	I|S	267|278;277;278;278;278	.|ENSP00000295974:T278S;ENSP00000426018:T278S;ENSP00000427211:T278S;ENSP00000421539:T278S	.|ENSP00000295974:T278S	N|T	-|-	2|1	0|0	APBB2|APBB2	40710360|40710360	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.071000|0.071000	0.16799|0.16799	1.642000|1.642000	0.37207|0.37207	-0.038000|-0.038000	0.13624|0.13624	0.455000|0.455000	0.32223|0.32223	AAC|ACA	.		0.507	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075	
TMPRSS11A	339967	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	68777129	68777129	+	Silent	SNP	C	C	T	rs376494815		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:68777129C>T	ENST00000334830.7	-	10	1943	c.1197G>A	c.(1195-1197)aaG>aaA	p.K399K	TMPRSS11A_ENST00000396188.2_Silent_p.K396K|TMPRSS11A_ENST00000508048.1_Silent_p.K395K|UBA6-AS1_ENST00000500538.2_RNA			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	399	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						CAGGCTTGTCCTTTTGACCAC	0.403																																					p.K399K	NSCLC(26;2 894 10941 14480 22546)	.											.	TMPRSS11A-69	0			c.G1197A						.	C	,	0,4406		0,0,2203	181.0	170.0	174.0		1188,1197	3.8	1.0	4		174	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TMPRSS11A	NM_001114387.1,NM_182606.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	396/419,399/422	68777129	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	339967	exon10			CTTGTCCTTTTGA	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.1197G>A	4.37:g.68777129C>T		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	176	9	NM_182606	0	0	0	0	0	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Silent	SNP	ENST00000334830.7	37	CCDS3519.1																																																																																			.		0.403	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
ALPK1	80216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	113333046	113333046	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:113333046G>A	ENST00000458497.1	+	5	619	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	ALPK1_ENST00000505912.1_3'UTR|ALPK1_ENST00000177648.9_Missense_Mutation_p.V114M|ALPK1_ENST00000504176.2_Missense_Mutation_p.V36M	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	114							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TGTGTTCTTGGTGGACCGGTT	0.622																																					p.V114M		.											.	ALPK1-337	0			c.G340A						.						54.0	51.0	52.0					4																	113333046		2203	4300	6503	SO:0001583	missense	80216	exon5			TTCTTGGTGGACC	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.340G>A	4.37:g.113333046G>A	ENSP00000398048:p.Val114Met	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	39	7	NM_001102406	0	0	2	6	4	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	G	5.078	0.200114	0.09652	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000309610;ENST00000504176	T;T;T	0.24151	1.87;1.87;1.87	5.34	-1.67	0.08238	.	0.652897	0.16722	N	0.202210	T	0.05364	0.0142	N	0.00538	-1.39	0.20873	N	0.999835	B;B;B;B	0.18610	0.029;0.023;0.006;0.009	B;B;B;B	0.12837	0.008;0.008;0.005;0.004	T	0.39231	-0.9624	10	0.18276	T	0.48	0.8551	6.1882	0.20510	0.448:0.3512:0.2008:0.0	.	36;89;89;114	F5H138;Q9H623;E7EX13;Q96QP1	.;.;.;ALPK1_HUMAN	M	114;114;89;36	ENSP00000398048:V114M;ENSP00000177648:V114M;ENSP00000426044:V36M	ENSP00000177648:V114M	V	+	1	0	ALPK1	113552495	1.000000	0.71417	0.016000	0.15963	0.097000	0.18754	2.098000	0.41757	-0.525000	0.06391	-0.502000	0.04539	GTG	.		0.622	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123128292	123128292	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:123128292G>C	ENST00000264501.4	+	16	1899	c.1526G>C	c.(1525-1527)aGt>aCt	p.S509T	KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000455637.1_Missense_Mutation_p.S509T|KIAA1109_ENST00000388738.3_Missense_Mutation_p.S509T			Q2LD37	K1109_HUMAN	KIAA1109	509					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCTAGTGACAGTCCTCCAGAC	0.313																																					p.S509T		.											.	KIAA1109-80	0			c.G1526C						.						117.0	112.0	114.0					4																	123128292		1798	4073	5871	SO:0001583	missense	84162	exon14			GTGACAGTCCTCC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1526G>C	4.37:g.123128292G>C	ENSP00000264501:p.Ser509Thr	Somatic	300	0		WXS	Illumina HiSeq	Phase_I	276	65	NM_015312	0	0	1	3	2	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.47|11.47	1.647458|1.647458	0.29246|0.29246	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000424425|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.23147	.|2.51;2.51;1.92	5.67|5.67	4.81|4.81	0.61882|0.61882	.|.	.|0.580238	.|0.15339	.|N	.|0.267600	T|T	0.38983|0.38983	0.1061|0.1061	L|L	0.33485|0.33485	1.01|1.01	0.42164|0.42164	D|D	0.991613|0.991613	.|D	.|0.58268	.|0.982	.|D	.|0.67548	.|0.952	T|T	0.08848|0.08848	-1.0702|-1.0702	5|10	.|0.45353	.|T	.|0.12	.|.	13.7177|13.7177	0.62708|0.62708	0.0749:0.0:0.9251:0.0|0.0749:0.0:0.9251:0.0	.|.	.|509	.|Q2LD37	.|K1109_HUMAN	H|T	341|509	.|ENSP00000264501:S509T;ENSP00000373390:S509T;ENSP00000389925:S509T	.|ENSP00000264501:S509T	Q|S	+|+	3|2	2|0	KIAA1109|KIAA1109	123347742|123347742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.198000|3.198000	0.51035|0.51035	1.349000|1.349000	0.45751|0.45751	0.655000|0.655000	0.94253|0.94253	CAG|AGT	.		0.313	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
NIM1K	167359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	43280172	43280172	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:43280172A>G	ENST00000512796.1	+	4	2151	c.652A>G	c.(652-654)Agc>Ggc	p.S218G	NIM1_ENST00000326035.2_Missense_Mutation_p.S218G			Q8IY84	NIM1_HUMAN		218	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)										TTTTGGATTCAGCACAGTAAG	0.433																																					p.S218G		.											.	.	0			c.A652G						.						93.0	87.0	89.0					5																	43280172		2203	4300	6503	SO:0001583	missense	0	exon4			GGATTCAGCACAG																												ENST00000512796.1:c.652A>G	5.37:g.43280172A>G	ENSP00000420849:p.Ser218Gly	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	120	40	NM_153361	0	0	1	2	1	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.726016	0.89298	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.30448	1.53;1.53	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56819	0.2011	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56062	-0.8041	10	0.33940	T	0.23	.	15.9442	0.79782	1.0:0.0:0.0:0.0	.	218	Q8IY84	NIM1_HUMAN	G	218	ENSP00000313572:S218G;ENSP00000420849:S218G	ENSP00000313572:S218G	S	+	1	0	AC114947.1	43315929	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.166000	0.68216	0.533000	0.62120	AGC	.		0.433	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
HTR1A	3350	broad.mit.edu	37	5	63257393	63257393	+	Silent	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:63257393G>A	ENST00000323865.3	-	1	387	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	52					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCATTGCCCAGCACCGCGCAG	0.592																																					p.L52L													.	HTR1A-94	0			c.C154T						.						78.0	79.0	78.0					5																	63257393		2203	4300	6503	SO:0001819	synonymous_variant	3350	exon1			TGCCCAGCACCGC	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.154C>T	5.37:g.63257393G>A		Somatic	85	1		WXS	Illumina HiSeq	Phase_I	82	3	NM_000524	0	0	0	0	0	Q6LAE7	Silent	SNP	ENST00000323865.3	37	CCDS34168.1																																																																																			.		0.592	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
BDP1	55814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	70800508	70800508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:70800508C>T	ENST00000358731.4	+	16	2565	c.2302C>T	c.(2302-2304)Cag>Tag	p.Q768*	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	768					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGTCATATTACAGCCTGAGAA	0.328																																					p.Q768X		.											.	BDP1-92	0			c.C2302T						.						94.0	86.0	88.0					5																	70800508		1839	4090	5929	SO:0001587	stop_gained	55814	exon16			ATATTACAGCCTG	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.2302C>T	5.37:g.70800508C>T	ENSP00000351575:p.Gln768*	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	143	42	NM_018429	0	0	2	3	1	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Nonsense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	C	38	7.211890	0.98139	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000451951;ENST00000444711	.	.	.	4.86	1.8	0.24995	.	0.592434	0.16073	N	0.230909	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.9453	0.29982	0.165:0.4911:0.3439:0.0	.	.	.	.	X	768;768;348;768	.	ENSP00000351575:Q768X	Q	+	1	0	BDP1	70836264	0.007000	0.16637	0.008000	0.14137	0.007000	0.05969	0.576000	0.23744	0.600000	0.29862	0.603000	0.83216	CAG	.		0.328	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
ECI2	10455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4128067	4128067	+	Splice_Site	SNP	T	T	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr6:4128067T>A	ENST00000380118.3	-	5	538		c.e5-2		ECI2_ENST00000465828.1_Splice_Site|C6orf201_ENST00000380175.4_Intron|ECI2_ENST00000413766.2_Splice_Site|ECI2_ENST00000361538.2_Splice_Site|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000380125.2_Splice_Site			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2						fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						ATGATACATCTGTGTAATGGG	0.398																																					.		.											.	ECI2-90	0			c.412-2A>T						.						116.0	118.0	117.0					6																	4128067		2203	4300	6503	SO:0001630	splice_region_variant	10455	exon6			TACATCTGTGTAA	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.502-2A>T	6.37:g.4128067T>A		Somatic	164	0		WXS	Illumina HiSeq	Phase_I	194	53	NM_006117	0	0	0	0	0	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Splice_Site	SNP	ENST00000380118.3	37	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	T	12.53	1.966691	0.34659	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000361538;ENST00000465828;ENST00000495548	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6923	0.69096	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ECI2	4073066	1.000000	0.71417	0.918000	0.36340	0.109000	0.19521	6.484000	0.73621	2.148000	0.66965	0.533000	0.62120	.	.		0.398	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	Intron
SCGN	10590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	25701539	25701539	+	Silent	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr6:25701539T>C	ENST00000377961.2	+	11	975	c.807T>C	c.(805-807)tgT>tgC	p.C269C	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	269	EF-hand 6. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						TGGCTTTGTGTCTTGGGCTGA	0.463																																					p.C269C		.											.	SCGN-93	0			c.T807C						.						146.0	132.0	137.0					6																	25701539		2203	4300	6503	SO:0001819	synonymous_variant	10590	exon11			TTTGTGTCTTGGG	BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.807T>C	6.37:g.25701539T>C		Somatic	145	1		WXS	Illumina HiSeq	Phase_I	197	57	NM_006998	0	0	4	14	10	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Silent	SNP	ENST00000377961.2	37	CCDS4561.1																																																																																			.		0.463	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1		
SKIV2L	6499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31937328	31937328	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr6:31937328G>A	ENST00000375394.2	+	28	3690	c.3577G>A	c.(3577-3579)Gag>Aag	p.E1193K	STK19_ENST00000375333.2_5'Flank|SKIV2L_ENST00000544581.1_Missense_Mutation_p.E1000K|STK19_ENST00000375331.2_5'Flank|DXO_ENST00000478221.1_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	1193					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						AGGGACCCCTGAGGGCCTGGT	0.662																																					p.E1193K		.											.	SKIV2L-290	0			c.G3577A						.						64.0	77.0	72.0					6																	31937328		1511	2709	4220	SO:0001583	missense	6499	exon28			ACCCCTGAGGGCC		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.3577G>A	6.37:g.31937328G>A	ENSP00000364543:p.Glu1193Lys	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	160	41	NM_006929	0	0	30	41	11	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946649	0.92593	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.39229	1.09;1.09	5.38	5.38	0.77491	DSH, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71221	0.3314	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80353	-0.1418	10	0.87932	D	0	-26.0112	17.9328	0.89004	0.0:0.0:1.0:0.0	.	1193	Q15477	SKIV2_HUMAN	K	1193;1035;1000	ENSP00000364543:E1193K;ENSP00000442645:E1000K	ENSP00000364543:E1193K	E	+	1	0	SKIV2L	32045307	1.000000	0.71417	0.476000	0.27291	0.947000	0.59692	8.247000	0.89830	2.507000	0.84556	0.655000	0.94253	GAG	.		0.662	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
NYAP1	222950	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	100087003	100087003	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr7:100087003C>T	ENST00000300179.2	+	4	1818	c.1659C>T	c.(1657-1659)gcC>gcT	p.A553A	NYAP1_ENST00000454988.1_Silent_p.A496A|NYAP1_ENST00000423930.1_Silent_p.A553A	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	553					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CCTACCCAGCCACAGCAGCTG	0.682																																					p.A553A		.											.	.	0			c.C1659T						.						16.0	19.0	18.0					7																	100087003		2157	4234	6391	SO:0001819	synonymous_variant	222950	exon4			CCCAGCCACAGCA	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.1659C>T	7.37:g.100087003C>T		Somatic	43	0		WXS	Illumina HiSeq	Phase_I	81	19	NM_173564	0	0	0	0	0	Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	37	CCDS5696.1																																																																																			.		0.682	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
LAMB1	3912	broad.mit.edu	37	7	107580801	107580801	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr7:107580801A>G	ENST00000222399.6	-	25	3624	c.3394T>C	c.(3394-3396)Tgt>Cgt	p.C1132R	CTB-13F3.1_ENST00000608515.1_RNA|LAMB1_ENST00000393561.1_Missense_Mutation_p.C1156R	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1132	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TCACAGTCACAGGCTAGAAGG	0.502																																					p.C1132R													.	LAMB1-97	0			c.T3394C						.						56.0	50.0	52.0					7																	107580801		2203	4300	6503	SO:0001583	missense	3912	exon25			AGTCACAGGCTAG	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3394T>C	7.37:g.107580801A>G	ENSP00000222399:p.Cys1132Arg	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	63	3	NM_002291	0	0	1	1	0	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.187734	0.78789	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	D;D	0.94330	-3.4;-3.4	5.3	5.3	0.74995	EGF-like, laminin (4);	.	.	.	.	D	0.98406	0.9470	H	0.99764	4.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99620	1.0983	9	0.87932	D	0	.	15.3999	0.74830	1.0:0.0:0.0:0.0	.	1132;1156	P07942;G3XAI2	LAMB1_HUMAN;.	R	1156;1132	ENSP00000377191:C1156R;ENSP00000222399:C1132R	ENSP00000222399:C1132R	C	-	1	0	LAMB1	107368037	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.761000	0.91691	2.225000	0.72522	0.460000	0.39030	TGT	.		0.502	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
CCAR2	57805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	22473664	22473664	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr8:22473664C>T	ENST00000308511.4	+	14	1997	c.1748C>T	c.(1747-1749)gCc>gTc	p.A583V	CCAR2_ENST00000389279.3_Missense_Mutation_p.A583V|CCAR2_ENST00000520861.1_Missense_Mutation_p.A258V|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	583					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										AAGGAAGAAGCCACCAAGGAG	0.552																																					p.A583V		.											.	KIAA1967-92	0			c.C1748T						.						94.0	92.0	93.0					8																	22473664		2203	4300	6503	SO:0001583	missense	57805	exon14			AAGAAGCCACCAA	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1748C>T	8.37:g.22473664C>T	ENSP00000310670:p.Ala583Val	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	133	39	NM_021174	0	0	32	61	29	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	37	CCDS34863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.012|2.012	-0.426830|-0.426830	0.04701|0.04701	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000520861|ENST00000520738	T;T;T|.	0.31769|.	1.48;1.48;1.48|.	3.18|3.18	0.0872|0.0872	0.14449|0.14449	.|.	0.654422|.	0.13268|.	N|.	0.400758|.	T|T	0.14313|0.14313	0.0346|0.0346	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.24404|0.24404	-1.0161|-1.0161	10|5	0.28530|.	T|.	0.3|.	-1.6537|-1.6537	3.0601|3.0601	0.06197|0.06197	0.1906:0.4477:0.0:0.3617|0.1906:0.4477:0.0:0.3617	.|.	258;583|.	G3V119;Q8N163|.	.;K1967_HUMAN|.	V|S	583;583;258|275	ENSP00000310670:A583V;ENSP00000373930:A583V;ENSP00000429773:A258V|.	ENSP00000310670:A583V|.	A|P	+|+	2|1	0|0	KIAA1967|KIAA1967	22529609|22529609	0.001000|0.001000	0.12720|0.12720	0.050000|0.050000	0.19076|0.19076	0.319000|0.319000	0.28217|0.28217	-0.315000|-0.315000	0.08081|0.08081	-0.013000|-0.013000	0.14199|0.14199	-0.323000|-0.323000	0.08544|0.08544	GCC|CCA	.		0.552	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
KCTD9	54793	broad.mit.edu	37	8	25293942	25293942	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr8:25293942C>T	ENST00000221200.4	-	7	779	c.559G>A	c.(559-561)Gca>Aca	p.A187T	KCTD9_ENST00000518067.1_5'Flank	NM_017634.3	NP_060104.2	Q7L273	KCTD9_HUMAN	potassium channel tetramerization domain containing 9	187					protein homooligomerization (GO:0051260)					breast(1)|endometrium(2)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	12		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		ACCTTTATTGCCACTTCTAGG	0.323																																					p.A187T													.	KCTD9-90	0			c.G559A						.						96.0	101.0	99.0					8																	25293942		2203	4300	6503	SO:0001583	missense	54793	exon7			TTATTGCCACTTC	BC021216	CCDS6048.1	8p21.1	2013-06-20	2013-06-20		ENSG00000104756	ENSG00000104756		"""BTB/POZ domain containing"""	22401	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 9"""			11483580	Standard	NM_017634		Approved	FLJ20038, BTBD27	uc003xeo.3	Q7L273	OTTHUMG00000099428	ENST00000221200.4:c.559G>A	8.37:g.25293942C>T	ENSP00000221200:p.Ala187Thr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	80	4	NM_017634	0	0	0	0	0	Q6NUM8|Q9NXV4	Missense_Mutation	SNP	ENST00000221200.4	37	CCDS6048.1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467383	0.43839	.	.	ENSG00000104756	ENST00000221200	T	0.44083	0.93	5.58	5.58	0.84498	BTB/POZ-like (1);BTB/POZ fold (2);	0.298399	0.30830	U	0.008781	T	0.26195	0.0639	N	0.08118	0	0.53005	D	0.999966	B	0.06786	0.001	B	0.06405	0.002	T	0.11084	-1.0602	10	0.13108	T	0.6	.	19.9348	0.97133	0.0:1.0:0.0:0.0	.	187	Q7L273	KCTD9_HUMAN	T	187	ENSP00000221200:A187T	ENSP00000221200:A187T	A	-	1	0	KCTD9	25349859	0.995000	0.38212	0.998000	0.56505	0.863000	0.49368	3.248000	0.51430	2.789000	0.95967	0.591000	0.81541	GCA	.		0.323	KCTD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216890.1	NM_017634	
TEX15	56154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	30704070	30704070	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr8:30704070T>C	ENST00000256246.2	-	1	2538	c.2464A>G	c.(2464-2466)Att>Gtt	p.I822V	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	822					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGGGAATAAATGTCAAATCCT	0.373																																					p.I822V		.											.	TEX15-97	0			c.A2464G						.						55.0	51.0	53.0					8																	30704070		2203	4298	6501	SO:0001583	missense	56154	exon1			AATAAATGTCAAA	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.2464A>G	8.37:g.30704070T>C	ENSP00000256246:p.Ile822Val	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	101	10	NM_031271	0	0	0	0	0		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.665157	0.00765	.	.	ENSG00000133863	ENST00000256246	T	0.09911	2.93	6.03	3.73	0.42828	.	0.872782	0.10069	N	0.719942	T	0.08846	0.0219	L	0.27053	0.805	0.09310	N	1	B	0.33171	0.4	B	0.33960	0.173	T	0.19224	-1.0312	10	0.87932	D	0	.	7.3269	0.26560	0.0:0.1436:0.0:0.8564	.	822	Q9BXT5	TEX15_HUMAN	V	822	ENSP00000256246:I822V	ENSP00000256246:I822V	I	-	1	0	TEX15	30823612	0.000000	0.05858	0.032000	0.17829	0.027000	0.11550	0.328000	0.19681	2.302000	0.77476	0.533000	0.62120	ATT	.		0.373	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
SPATA31A3	727830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	40705657	40705657	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:40705657C>T	ENST00000356699.5	+	4	3343	c.3314C>T	c.(3313-3315)cCc>cTc	p.P1105L	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1105					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCAATGTTTCCCCCTATTCAC	0.478																																					p.P1105L		.											.	.	0			c.C3314T						.						125.0	111.0	116.0					9																	40705657		1582	3157	4739	SO:0001583	missense	727830	exon4			TGTTTCCCCCTAT			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3314C>T	9.37:g.40705657C>T	ENSP00000349132:p.Pro1105Leu	Somatic	315	0		WXS	Illumina HiSeq	Phase_I	322	168	NM_001083124	0	0	0	0	0		Missense_Mutation	SNP	ENST00000356699.5	37	CCDS47969.1	.	.	.	.	.	.	.	.	.	.	C	5.075	0.199434	0.09652	.	.	ENSG00000147926	ENST00000356699	T	0.03860	3.78	2.79	-3.16	0.05217	.	1.572250	0.03917	N	0.282808	T	0.05960	0.0155	L	0.38175	1.15	0.09310	N	1	D	0.61697	0.99	P	0.52481	0.7	T	0.27872	-1.0061	10	0.19590	T	0.45	.	0.5688	0.00692	0.1756:0.2945:0.1729:0.357	.	1105	Q5VYP0	F75A3_HUMAN	L	1105	ENSP00000349132:P1105L	ENSP00000349132:P1105L	P	+	2	0	FAM75A3	40695657	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.642000	0.05427	-0.776000	0.04578	0.398000	0.26397	CCC	.		0.478	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124	
RORB	6096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	77286722	77286722	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:77286722G>A	ENST00000396204.2	+	9	1162	c.1162G>A	c.(1162-1164)Gaa>Aaa	p.E388K	RORB_ENST00000376896.3_Missense_Mutation_p.E377K			Q92753	RORB_HUMAN	RAR-related orphan receptor B	388	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.E377Q(2)|p.E377*(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	CTGGCTTATAGAACCAAGGAA	0.428																																					p.E377K		.											.	RORB-229	3	Substitution - Missense(2)|Substitution - Nonsense(1)	breast(2)|ovary(1)	c.G1129A						.						73.0	69.0	70.0					9																	77286722		2203	4300	6503	SO:0001583	missense	6096	exon9			CTTATAGAACCAA	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1162G>A	9.37:g.77286722G>A	ENSP00000379507:p.Glu388Lys	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	96	33	NM_006914	0	0	0	0	0	Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	37		.	.	.	.	.	.	.	.	.	.	G	22.2	4.255074	0.80135	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.96967	-4.19;-4.19	5.73	5.73	0.89815	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.95834	0.8644	L	0.56280	1.765	0.80722	D	1	B;B	0.27594	0.182;0.01	B;B	0.35813	0.211;0.04	D	0.93462	0.6811	10	0.52906	T	0.07	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	388;377	Q92753;Q58EY0	RORB_HUMAN;.	K	377;388	ENSP00000366093:E377K;ENSP00000379507:E388K	ENSP00000366093:E377K	E	+	1	0	RORB	76476542	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.807000	0.99171	2.861000	0.98227	0.655000	0.94253	GAA	.		0.428	RORB-201	KNOWN	basic	protein_coding	protein_coding			
CDK5RAP2	55755	broad.mit.edu	37	9	123313163	123313163	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:123313163C>A	ENST00000349780.4	-	4	392	c.213G>T	c.(211-213)aaG>aaT	p.K71N	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.K71N|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.K71N|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.K71N	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	71					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						AGTTTTCTTTCTTCAATTCAG	0.383																																					p.K71N													.	CDK5RAP2-229	0			c.G213T						.						90.0	93.0	92.0					9																	123313163		2203	4300	6503	SO:0001583	missense	55755	exon4			TTCTTTCTTCAAT	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.213G>T	9.37:g.123313163C>A	ENSP00000343818:p.Lys71Asn	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	138	5	NM_018249	0	0	12	12	0	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.776470	0.70107	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000345313	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	6.08	5.19	0.71726	Spindle associated (1);	0.000000	0.64402	D	0.000007	T	0.49270	0.1547	M	0.76574	2.34	0.47862	D	0.999531	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.997	T	0.52697	-0.8541	10	0.87932	D	0	.	10.6118	0.45425	0.0:0.8517:0.0:0.1483	.	71;71;71	Q96SN8-2;Q96SN8-4;Q96SN8	.;.;CK5P2_HUMAN	N	71	ENSP00000354065:K71N;ENSP00000352258:K71N;ENSP00000343818:K71N;ENSP00000353317:K71N	ENSP00000341695:K71N	K	-	3	2	CDK5RAP2	122352984	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.387000	0.34430	1.589000	0.49982	0.591000	0.81541	AAG	.		0.383	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
EXOSC2	23404	ucsc.edu	37	9	133569210	133569210	+	Missense_Mutation	SNP	G	G	C	rs202001690		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:133569210G>C	ENST00000372358.5	+	1	103	c.32G>C	c.(31-33)cGc>cCc	p.R11P	EXOSC2_ENST00000372351.3_Missense_Mutation_p.R11P|EXOSC2_ENST00000546165.1_Missense_Mutation_p.R11P|EXOSC2_ENST00000372352.3_Missense_Mutation_p.R11P			Q13868	EXOS2_HUMAN	exosome component 2	11					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		CCAGTGGCTCGCAAGCCTCTT	0.587																																					p.R11P	Pancreas(134;1683 1824 10118 27928 31640)												.	EXOSC2-91	0			c.G32C						.						33.0	33.0	33.0					9																	133569210		2201	4299	6500	SO:0001583	missense	23404	exon1			TGGCTCGCAAGCC	AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.32G>C	9.37:g.133569210G>C	ENSP00000361433:p.Arg11Pro	Somatic	51	3		WXS	Illumina HiSeq		58	7	NM_014285	0	0	10	14	4	A3KFL3|B4DKK6|Q9NUY4	Missense_Mutation	SNP	ENST00000372358.5	37	CCDS6935.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950566	0.73787	.	.	ENSG00000130713	ENST00000372358;ENST00000546165;ENST00000372352;ENST00000372351;ENST00000372350;ENST00000495699	.	.	.	6.06	6.06	0.98353	.	0.199231	0.43579	D	0.000553	T	0.57740	0.2074	L	0.55481	1.735	0.43476	D	0.995695	B;D	0.53312	0.051;0.959	B;P	0.45881	0.012;0.496	T	0.61282	-0.7094	9	0.62326	D	0.03	-21.9848	12.8575	0.57894	0.0736:0.0:0.9264:0.0	.	11;11	B4DKK6;Q13868	.;EXOS2_HUMAN	P	11	.	ENSP00000361425:R11P	R	+	2	0	EXOSC2	132559031	0.994000	0.37717	0.924000	0.36721	0.379000	0.30106	3.806000	0.55583	2.882000	0.98803	0.655000	0.94253	CGC	.		0.587	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054673.1	NM_014285	
UTP14A	10813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	129045744	129045744	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chrX:129045744C>T	ENST00000394422.3	+	6	412	c.384C>T	c.(382-384)atC>atT	p.I128I	UTP14A_ENST00000371042.3_5'Flank|UTP14A_ENST00000371051.5_Silent_p.I74I|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Intron	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	128					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TGCTTCAGATCCACAGAGAAG	0.473																																					p.I128I		.											.	UTP14A-132	0			c.C384T						.						139.0	133.0	135.0					X																	129045744		2203	4300	6503	SO:0001819	synonymous_variant	10813	exon6			TCAGATCCACAGA	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.384C>T	X.37:g.129045744C>T		Somatic	138	0		WXS	Illumina HiSeq	Phase_I	180	109	NM_006649	0	0	0	0	0	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	37	CCDS14615.1																																																																																			.		0.473	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
RCAN3	11123	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	24840967	24840967	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:24840967delT	ENST00000374395.4	+	2	418	c.105delT	c.(103-105)gatfs	p.D35fs	RCAN3_ENST00000436717.2_Frame_Shift_Del_p.D35fs|RCAN3_ENST00000412742.2_Frame_Shift_Del_p.D35fs|RCAN3_ENST00000538532.1_Frame_Shift_Del_p.D35fs|RCAN3_ENST00000374393.2_Frame_Shift_Del_p.D35fs	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	35					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		ATGAAGATGATTTGGATGAGA	0.433																																					p.D35fs		.											.	RCAN3-90	0			c.105delT						.						206.0	186.0	193.0					1																	24840967		2203	4300	6503	SO:0001589	frameshift_variant	11123	exon1			.		CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.105delT	1.37:g.24840967delT	ENSP00000363516:p.Asp35fs	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	101	21	NM_001251980	0	0	0	0	0	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Frame_Shift_Del	DEL	ENST00000374395.4	37	CCDS254.1																																																																																			.		0.433	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2		
MTCH2	23788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	47653227	47653227	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:47653227delG	ENST00000302503.3	-	6	563	c.406delC	c.(406-408)ctcfs	p.L136fs	MTCH2_ENST00000534074.1_5'Flank|MTCH2_ENST00000542981.1_Intron	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	136					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						TGTGTGATGAGGGTAGCAGCA	0.433																																					p.L136fs		.											.	MTCH2-90	0			c.406delC						.						170.0	137.0	148.0					11																	47653227		2201	4298	6499	SO:0001589	frameshift_variant	23788	exon6			.	AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.406delC	11.37:g.47653227delG	ENSP00000303222:p.Leu136fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	66	23	NM_014342	0	0	0	0	0	B2R7L8	Frame_Shift_Del	DEL	ENST00000302503.3	37	CCDS7943.1																																																																																			.		0.433	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391921.2	NM_014342	
CHD8	57680	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	21862522	21862522	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:21862522delT	ENST00000557364.1	-	31	5776	c.5513delA	c.(5512-5514)aagfs	p.K1838fs	CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Frame_Shift_Del_p.K1559fs|CHD8_ENST00000399982.2_Frame_Shift_Del_p.K1838fs|SNORD8_ENST00000363915.1_RNA|SNORD9_ENST00000362566.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1838					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTCATCTGTCTTTTTGTCTAG	0.498																																					p.K1838fs		.											.	CHD8-277	0			c.5513delA						.						76.0	78.0	77.0					14																	21862522		2011	4188	6199	SO:0001589	frameshift_variant	57680	exon30			.	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.5513delA	14.37:g.21862522delT	ENSP00000451601:p.Lys1838fs	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	83	24	NM_001170629	0	0	0	0	0	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Del	DEL	ENST00000557364.1	37	CCDS53885.1																																																																																			.		0.498	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
NFATC3	4775	broad.mit.edu	37	16	68200904	68200904	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:68200904delT	ENST00000346183.3	+	5	1784	c.1760delT	c.(1759-1761)atafs	p.I587fs	NFATC3_ENST00000575270.1_Frame_Shift_Del_p.I587fs|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000329524.4_Frame_Shift_Del_p.I587fs|NFATC3_ENST00000349223.5_Frame_Shift_Del_p.I587fs	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	587	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		ATAGCCTCTATACCCGTTGAG	0.383																																					p.I587fs													.	NFATC3-92	0			c.1760delT						.						223.0	215.0	218.0					16																	68200904		2198	4300	6498	SO:0001589	frameshift_variant	4775	exon5			CCTCTATACCCGT	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.1760delT	16.37:g.68200904delT	ENSP00000300659:p.Ile587fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	157	10	NM_173163	0	0	0	0	0	O75211|Q14516|Q99840|Q99841|Q99842	Frame_Shift_Del	DEL	ENST00000346183.3	37	CCDS10860.1																																																																																			.		0.383	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
ERBB2	2064	broad.mit.edu	37	17	37883164	37883164	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:37883164delT	ENST00000269571.5	+	25	3226	c.3067delT	c.(3067-3069)tatfs	p.Y1023fs	ERBB2_ENST00000541774.1_Frame_Shift_Del_p.Y1008fs|ERBB2_ENST00000445658.2_Frame_Shift_Del_p.Y747fs|ERBB2_ENST00000540147.1_Frame_Shift_Del_p.Y993fs|ERBB2_ENST00000584601.1_Frame_Shift_Del_p.Y993fs|ERBB2_ENST00000406381.2_Frame_Shift_Del_p.Y993fs|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000584450.1_Frame_Shift_Del_p.Y1023fs|MIEN1_ENST00000474210.1_5'Flank			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	1023					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TGCTGAGGAGTATCTGGTACC	0.627		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.Y1023fs				Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2-9959	0			c.3067delT						.						106.0	109.0	108.0					17																	37883164		2203	4300	6503	SO:0001589	frameshift_variant	2064	exon25			GAGGAGTATCTGG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.3067delT	17.37:g.37883164delT	ENSP00000269571:p.Tyr1023fs	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	333	7	NM_004448	0	0	0	0	0	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Frame_Shift_Del	DEL	ENST00000269571.5	37	CCDS32642.1																																																																																			.		0.627	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
LRRC8E	80131	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	7960603	7960603	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:7960603delG	ENST00000306708.6	+	2	216	c.115delG	c.(115-117)gggfs	p.G39fs		NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	39					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						GCTCATGATTGGGGTCTTTGG	0.627																																					p.G39fs		.											.	LRRC8E-92	0			c.115delG						.						120.0	90.0	100.0					19																	7960603		2203	4300	6503	SO:0001589	frameshift_variant	80131	exon3			.		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.115delG	19.37:g.7960603delG	ENSP00000306524:p.Gly39fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	68	17	NM_001268284	0	0	0	0	0	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Frame_Shift_Del	DEL	ENST00000306708.6	37	CCDS12189.1																																																																																			.		0.627	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
CALR	811	broad.mit.edu	37	19	13054650	13054658	+	In_Frame_Del	DEL	GAGGATGAG	GAGGATGAG	-	rs374121178|rs550353351	byFrequency	TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	GAGGATGAG	GAGGATGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:13054650_13054658delGAGGATGAG	ENST00000316448.5	+	9	1250_1258	c.1177_1185delGAGGATGAG	c.(1177-1185)gaggatgagdel	p.EDE396del	RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000592268.1_5'Flank|RAD23A_ENST00000586534.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000541222.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	396	Asp/Glu/Lys-rich.|C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	ggacaaagatgaggatgaggaggatgagg	0.569														16	0.00319489	0.0113	0.0014	5008	,	,		17189	0.0		0.0	False		,,,				2504	0.0				p.393_395del													.	CALR-91	0			c.1177_1185del						.			197,4061		72,53,2004						-3.0	0.8			229	266,7976		129,8,3984	no	coding	CALR	NM_004343.3		201,61,5988	A1A1,A1R,RR		3.2274,4.6266,3.704				463,12037				SO:0001651	inframe_deletion	811	exon9			AAAGATGAGGATG	M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1177_1185delGAGGATGAG	19.37:g.13054659_13054667delGAGGATGAG	ENSP00000320866:p.Glu396_Glu398del	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	5	3	NM_004343	0	0	0	0	0	Q6IAT4|Q9UDG2	In_Frame_Del	DEL	ENST00000316448.5	37	CCDS12288.1																																																																																			.		0.569	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
ZNF225	7768	broad.mit.edu	37	19	44636328	44636328	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:44636328delT	ENST00000262894.6	+	5	1841	c.1561delT	c.(1561-1563)tttfs	p.F521fs	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Frame_Shift_Del_p.F521fs	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				TGGGAAAAGATTTACTCAGAA	0.388																																					p.F521fs													.	.	0			c.1561delT						.						83.0	92.0	89.0					19																	44636328		2200	4296	6496	SO:0001589	frameshift_variant	7768	exon5			AAAAGATTTACTC	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1561delT	19.37:g.44636328delT	ENSP00000262894:p.Phe521fs	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	125	12	NM_013362	0	0	0	0	0	A8K8S2|Q53F12|Q9NS46|Q9UID8	Frame_Shift_Del	DEL	ENST00000262894.6	37	CCDS46100.1																																																																																			.		0.388	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
GPR155	151556	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	175346653	175346657	+	Frame_Shift_Del	DEL	GTTAA	GTTAA	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	GTTAA	GTTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr2:175346653_175346657delGTTAA	ENST00000392552.2	-	2	266_270	c.28_32delTTAAC	c.(28-33)ttaaccfs	p.LT10fs	GPR155_ENST00000392551.2_Frame_Shift_Del_p.LT10fs|GPR155_ENST00000295500.4_Frame_Shift_Del_p.LT10fs	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	10					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						GACTGCAATGGTTAAGTTCTCTGCA	0.4																																					p.10_11del		.											.	GPR155-91	0			c.28_32del						.																																			SO:0001589	frameshift_variant	151556	exon2			.	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.28_32delTTAAC	2.37:g.175346653_175346657delGTTAA	ENSP00000376335:p.Leu10fs	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	162	45	NM_001267051	0	0	0	0	0	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Frame_Shift_Del	DEL	ENST00000392552.2	37	CCDS2259.1																																																																																			.		0.400	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
HAUS3	79441	hgsc.bcm.edu	37	4	2242527	2242530	+	Frame_Shift_Del	DEL	TTCA	TTCA	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	TTCA	TTCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:2242527_2242530delTTCA	ENST00000243706.4	-	2	373_376	c.144_147delTGAA	c.(142-147)aatgaafs	p.NE48fs	POLN_ENST00000511885.2_Intron|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000506763.1_Frame_Shift_Del_p.NE48fs|HAUS3_ENST00000443786.2_Frame_Shift_Del_p.NE48fs	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	48					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						ACACGTTCTGTTCATTCACATTCC	0.407																																					p.48_49del		.											.	HAUS3-138	0			c.144_147del						.																																			SO:0001589	frameshift_variant	79441	exon2			.	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.144_147delTGAA	4.37:g.2242531_2242534delTTCA	ENSP00000243706:p.Asn48fs	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	148	39	NM_024511	0	0	0	0	0	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Frame_Shift_Del	DEL	ENST00000243706.4	37	CCDS33941.1																																																																																			.		0.407	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511	
SAR1B	51128	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	133956720	133956720	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:133956720delT	ENST00000402673.2	-	3	359	c.81delA	c.(79-81)aaafs	p.K27fs	SAR1B_ENST00000439578.1_Frame_Shift_Del_p.K27fs|SAR1B_ENST00000507419.1_Intron	NM_016103.3	NP_057187.1	Q9Y6B6	SAR1B_HUMAN	secretion associated, Ras related GTPase 1B	27					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|GTP catabolic process (GO:0006184)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			kidney(2)|lung(2)|urinary_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAAATACCAGTTTACCAGTTT	0.343																																					p.K27fs		.											.	SAR1B-227	0			c.81delA						.						179.0	162.0	168.0					5																	133956720		2202	4300	6502	SO:0001589	frameshift_variant	51128	exon4			.	AF092130	CCDS4177.1	5q31.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000152700	ENSG00000152700			10535	protein-coding gene	gene with protein product		607690	"""SAR1a gene homolog (S. cerevisiae) 2"", ""SAR1a gene homolog 2 (S. cerevisiae)"", ""SAR1 homolog B (S. cerevisiae)"""	SARA2			Standard	NM_001033503		Approved		uc003kzr.3	Q9Y6B6	OTTHUMG00000129114	ENST00000402673.2:c.81delA	5.37:g.133956720delT	ENSP00000385432:p.Lys27fs	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	170	41	NM_001033503	0	0	0	0	0	D3DQA4|Q567T4	Frame_Shift_Del	DEL	ENST00000402673.2	37	CCDS4177.1																																																																																			.		0.343	SAR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251158.2	NM_016103	
MAML1	9794	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	179192969	179192987	+	Frame_Shift_Del	DEL	GGGTCTGCAGGGCAGACCT	GGGTCTGCAGGGCAGACCT	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	GGGTCTGCAGGGCAGACCT	GGGTCTGCAGGGCAGACCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:179192969_179192987delGGGTCTGCAGGGCAGACCT	ENST00000292599.3	+	2	1221_1239	c.958_976delGGGTCTGCAGGGCAGACCT	c.(958-978)gggtctgcagggcagacctttfs	p.GSAGQTF320fs	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTGAGGGCCGGGTCTGCAGGGCAGACCTTTCTGGGGCC	0.571																																					p.320_326del		.											.	MAML1-848	0			c.958_976del						.																																			SO:0001589	frameshift_variant	9794	exon2			.	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.958_976delGGGTCTGCAGGGCAGACCT	5.37:g.179192969_179192987delGGGTCTGCAGGGCAGACCT	ENSP00000292599:p.Gly320fs	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	89	21	NM_014757	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000292599.3	37	CCDS34315.1																																																																																			.		0.571	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	113265327	113265327	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:113265327delG	ENST00000401783.2	-	6	1810	c.1474delC	c.(1474-1476)cggfs	p.R492fs	SVEP1_ENST00000302728.8_Frame_Shift_Del_p.R492fs|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Frame_Shift_Del_p.R469fs|SVEP1_ENST00000374461.1_Frame_Shift_Del_p.R469fs	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	492	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCCACACACCGGGGTTCTGGC	0.443																																					p.R492fs		.											.	SVEP1-75	0			c.1474delC						.						133.0	135.0	134.0					9																	113265327		1926	4129	6055	SO:0001589	frameshift_variant	79987	exon6			.	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1474delC	9.37:g.113265327delG	ENSP00000384917:p.Arg492fs	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	110	29	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Frame_Shift_Del	DEL	ENST00000401783.2	37	CCDS48004.1																																																																																			.		0.443	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ATXN3L	92552	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	13337247	13337248	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chrX:13337247_13337248delTG	ENST00000380622.2	-	1	1270_1271	c.806_807delCA	c.(805-807)acafs	p.T269fs	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	269					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TTACACATGATGTCTTTGGAAG	0.426																																					p.269_269del		.											.	ATXN3L-542	0			c.806_807del						.																																			SO:0001589	frameshift_variant	92552	exon1			.		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.806_807delCA	X.37:g.13337247_13337248delTG	ENSP00000369996:p.Thr269fs	Somatic	338	0		WXS	Illumina HiSeq	Phase_I	360	205	NM_001135995	0	0	0	0	0	B2RNY8	Frame_Shift_Del	DEL	ENST00000380622.2	37	CCDS48080.1																																																																																			.		0.426	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995	
TSIX	9383	broad.mit.edu	37	X	73047124	73047125	+	lincRNA	DEL	AC	AC	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chrX:73047124_73047125delAC	ENST00000604411.1	+	0	35085_35086				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		GCCACACATGACACACACACAC	0.47																																					.													.	.	0			.						.			21,2160		6,4,5,902,352						-3.8	0.0			146	63,3745		10,20,23,1404,917	no	intergenic				16,24,28,2306,1269	A1A1,A1R,A1,RR,R		1.6544,0.9629,1.4026				84,5905						9383	.			CACATGACACACA			Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73047134_73047135delAC		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	104	7	.	0	0	0	0	0		RNA	DEL	ENST00000604411.1	37																																																																																				.		0.470	TSIX-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000469120.1	NR_003255	
SERPINB10	5273	broad.mit.edu	37	18	61584738	61584739	+	Frame_Shift_Ins	INS	-	-	A	rs201620640		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr18:61584738_61584739insA	ENST00000238508.3	+	3	276_277	c.217_218insA	c.(217-219)gaafs	p.E73fs		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	73					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R76fs*7(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				CCCTGAAAGTGAAAAAAAAAGG	0.282																																					p.E73fs													.	SERPINB10-227	1	Deletion - Frameshift(1)	large_intestine(1)	c.217_218insA						.																																			SO:0001589	frameshift_variant	5273	exon2			GAAAGTGAAAAAA	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.226dupA	18.37:g.61584747_61584747dupA	ENSP00000238508:p.Glu73fs	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	42	7	NM_005024	0	0	0	0	0	Q4VAX4|Q4VAX7	Frame_Shift_Ins	INS	ENST00000238508.3	37	CCDS11990.1																																																																																			-|0.985;A|0.015		0.282	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
CEP250	11190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	34064377	34064378	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr20:34064377_34064378insT	ENST00000397527.1	+	16	2540_2541	c.1820_1821insT	c.(1819-1824)gctttgfs	p.L608fs	RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA|CEP250_ENST00000342580.4_Frame_Shift_Ins_p.L608fs|RP3-477O4.14_ENST00000444933.1_RNA	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	608	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			TTAAATGAGGCTTTGGCGTTAG	0.515																																					p.A607fs		.											.	CEP250-27	0			c.1820_1821insT						.																																			SO:0001589	frameshift_variant	11190	exon16			.	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.1823dupT	20.37:g.34064380_34064380dupT	ENSP00000380661:p.Leu608fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	74	23	NM_007186	0	0	0	0	0	E1P5Q3|O14812|O60588|Q9H450	Frame_Shift_Ins	INS	ENST00000397527.1	37	CCDS13255.1																																																																																			.		0.515	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
PRMT2	3275	hgsc.bcm.edu;broad.mit.edu	37	21	48056904	48056905	+	Splice_Site	INS	-	-	AA			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr21:48056904_48056905insAA	ENST00000397637.1	+	2	993		c.e2+2		PRMT2_ENST00000458387.2_Splice_Site|PRMT2_ENST00000451211.2_Splice_Site|PRMT2_ENST00000334494.4_Splice_Site|PRMT2_ENST00000397628.1_Splice_Site|PRMT2_ENST00000397638.2_Splice_Site|PRMT2_ENST00000291705.6_Splice_Site|PRMT2_ENST00000440086.1_Splice_Site|PRMT2_ENST00000355680.3_Splice_Site			P55345	ANM2_HUMAN	protein arginine methyltransferase 2						developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		GAATCGCAGGTAATTTCCGTTC	0.421																																					.		.											.	PRMT2-91	0			c.39+2->AA						.																																			SO:0001630	splice_region_variant	3275	exon2			.	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.39+2->AA	21.37:g.48056905_48056906dupAA		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	55	12	NM_001535	0	0	0	0	0	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Splice_Site	INS	ENST00000397637.1	37	CCDS13737.1																																																																																			.		0.421	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535	Intron
CADPS2	93664	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	122130209	122130210	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr7:122130209_122130210insA	ENST00000449022.2	-	11	1796_1797	c.1777_1778insT	c.(1777-1779)tatfs	p.Y593fs	CADPS2_ENST00000313070.7_Frame_Shift_Ins_p.Y593fs|CADPS2_ENST00000334010.7_Frame_Shift_Ins_p.Y593fs|CADPS2_ENST00000412584.2_Frame_Shift_Ins_p.Y593fs|CADPS2_ENST00000476131.1_5'Flank	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	593					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						AACTGGTTTATATGATTGACCT	0.376																																					p.Y593fs		.											.	CADPS2-94	0			c.1778_1779insT						.																																			SO:0001589	frameshift_variant	93664	exon11			.		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1778dupT	7.37:g.122130210_122130210dupA	ENSP00000398481:p.Tyr593fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	145	39	NM_001167940	0	0	0	0	0	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Frame_Shift_Ins	INS	ENST00000449022.2	37	CCDS55158.1																																																																																			.		0.376	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
