#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TRIT1	54802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40307511	40307511	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:40307511T>C	ENST00000316891.5	-	11	1323	c.1309A>G	c.(1309-1311)Ata>Gta	p.I437V	TRIT1_ENST00000537440.1_Missense_Mutation_p.I133V|TRIT1_ENST00000537223.1_Missense_Mutation_p.I133V|TRIT1_ENST00000441669.2_Missense_Mutation_p.I355V|TRIT1_ENST00000372818.1_Missense_Mutation_p.I411V|TRIT1_ENST00000545233.1_Missense_Mutation_p.I191V|TRIT1_ENST00000491865.1_5'UTR|TRIT1_ENST00000541099.1_Missense_Mutation_p.I55V	NM_017646.4	NP_060116.2	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1	437					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|tRNA dimethylallyltransferase activity (GO:0052381)			breast(1)|large_intestine(5)|liver(1)|lung(3)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(1)	15	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGACTTTCTATGGTGTTGACA	0.418																																					p.I437V		.											.	TRIT1-91	0			c.A1309G						.						266.0	252.0	257.0					1																	40307511		2203	4300	6503	SO:0001583	missense	54802	exon11			TTTCTATGGTGTT	AF074918	CCDS30681.1	1p34.2	2012-10-05			ENSG00000043514	ENSG00000043514	2.5.1.8		20286	protein-coding gene	gene with protein product						11111046, 15870694	Standard	NM_017646		Approved	FLJ20061, IPT	uc021olz.1	Q9H3H1	OTTHUMG00000009245	ENST00000316891.5:c.1309A>G	1.37:g.40307511T>C	ENSP00000321810:p.Ile437Val	Somatic	259	0		WXS	Illumina HiSeq	Phase_I	249	99	NM_017646	0	0	14	18	4	A1A4X7|Q3T7B5|Q5QPK5|Q5QPK6|Q6IAC9|Q96FJ3|Q96L45|Q9NXT7	Missense_Mutation	SNP	ENST00000316891.5	37	CCDS30681.1	.	.	.	.	.	.	.	.	.	.	T	0.782	-0.761836	0.02996	.	.	ENSG00000043514	ENST00000046894;ENST00000372825;ENST00000441669;ENST00000316891;ENST00000372818;ENST00000534869;ENST00000545233;ENST00000537440;ENST00000537223;ENST00000541099	T;T	0.41065	1.02;1.01	5.67	-5.07	0.02938	.	2.410530	0.01192	N	0.007346	T	0.21761	0.0524	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.06463	-1.0825	10	0.20519	T	0.43	0.246	1.1747	0.01832	0.3107:0.2806:0.0931:0.3157	.	437;411;355;133	Q9H3H1;Q9H3H1-4;Q9H3H1-5;Q3T7B5	MOD5_HUMAN;.;.;.	V	411;355;349;437;411;330;191;133;133;55	ENSP00000321810:I437V;ENSP00000361905:I411V	ENSP00000046894:I411V	I	-	1	0	TRIT1	40080098	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.878000	0.04192	-0.471000	0.06891	-0.242000	0.12053	ATA	.		0.418	TRIT1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025627.2	NM_017646	
MIER1	57708	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	67423741	67423741	+	Splice_Site	SNP	G	G	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:67423741G>C	ENST00000355356.3	+	4	329		c.e4-1		MIER1_ENST00000357692.2_Splice_Site|MIER1_ENST00000479067.1_Splice_Site|MIER1_ENST00000401042.3_Splice_Site|MIER1_ENST00000371014.1_Splice_Site|MIER1_ENST00000371016.1_Splice_Site|MIER1_ENST00000371018.3_Splice_Site|MIER1_ENST00000355977.6_Splice_Site|MIER1_ENST00000401041.1_Splice_Site	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator						positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						GATTTATTTAGGAAGGCGACA	0.373																																					.		.											.	MIER1-91	0			c.232-1G>C						.						87.0	80.0	82.0					1																	67423741		1874	4116	5990	SO:0001630	splice_region_variant	57708	exon6			TATTTAGGAAGGC		CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.181-1G>C	1.37:g.67423741G>C		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	53	15	NM_001146111	0	0	0	0	0	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Splice_Site	SNP	ENST00000355356.3	37	CCDS41348.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468581	0.63625	.	.	ENSG00000198160	ENST00000371017;ENST00000371018;ENST00000357692;ENST00000401041;ENST00000371016;ENST00000371014;ENST00000401042;ENST00000355356	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8992	0.96978	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MIER1	67196329	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	8.843000	0.92142	2.789000	0.95967	0.591000	0.81541	.	.		0.373	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025491.2	NM_020948	Intron
USP33	23032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	78163088	78163088	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:78163088C>A	ENST00000370793.1	-	25	3089	c.2743G>T	c.(2743-2745)Gtt>Ttt	p.V915F	USP33_ENST00000370794.3_Missense_Mutation_p.V884F|USP33_ENST00000357428.1_Missense_Mutation_p.V915F	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	915	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						CGCAGGATAACTTCAGGCCCT	0.373																																					p.V915F	Melanoma(152;72 1870 11110 26780 42647)	.											.	USP33-659	0			c.G2743T						.						107.0	112.0	110.0					1																	78163088		2203	4300	6503	SO:0001583	missense	23032	exon25			GGATAACTTCAGG	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.2743G>T	1.37:g.78163088C>A	ENSP00000359829:p.Val915Phe	Somatic	139	1		WXS	Illumina HiSeq	Phase_I	131	47	NM_015017	0	0	7	18	11	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	ENST00000370793.1	37	CCDS678.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417992	0.62622	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428	T;T;T	0.12672	2.67;2.66;2.66	5.25	5.25	0.73442	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (3);	0.123739	0.53938	D	0.000042	T	0.12092	0.0294	L	0.41415	1.275	0.51012	D	0.999908	P	0.49447	0.924	P	0.55455	0.776	T	0.00978	-1.1493	10	0.87932	D	0	.	7.1563	0.25639	0.0:0.7905:0.0:0.2095	.	915	Q8TEY7	UBP33_HUMAN	F	884;915;915	ENSP00000359830:V884F;ENSP00000359829:V915F;ENSP00000350009:V915F	ENSP00000350009:V915F	V	-	1	0	USP33	77935676	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	1.037000	0.30241	2.602000	0.87976	0.650000	0.86243	GTT	.		0.373	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017	
ZNHIT6	54680	broad.mit.edu	37	1	86123544	86123544	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:86123544T>G	ENST00000370574.3	-	9	1491	c.1358A>C	c.(1357-1359)aAa>aCa	p.K453T	ZNHIT6_ENST00000431532.2_Missense_Mutation_p.K414T			Q9NWK9	BCD1_HUMAN	zinc finger, HIT-type containing 6	453					box C/D snoRNP assembly (GO:0000492)|ribosome biogenesis (GO:0042254)	extracellular vesicular exosome (GO:0070062)|pre-snoRNP complex (GO:0070761)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|cervix(2)|large_intestine(10)|lung(1)|urinary_tract(1)	17						GTGAAGAACTTTCATGTCATT	0.328																																					p.K453T													.	ZNHIT6-153	0			c.A1358C						.						123.0	125.0	124.0					1																	86123544		2202	4289	6491	SO:0001583	missense	54680	exon9			AGAACTTTCATGT	AL442074	CCDS707.1, CCDS53338.1	1p22.3	2013-01-17	2010-09-15	2008-06-23	ENSG00000117174	ENSG00000117174		"""Zinc fingers, HIT-type"""	26089	protein-coding gene	gene with protein product	"""box C/D snoRNA essential 1 homolog (S. cerevisiae)"""		"""chromosome 1 open reading frame 181"", ""zinc finger, HIT type 6"""	C1orf181		12747765	Standard	NM_017953		Approved	FLJ20729, NY-BR-75, BCD1	uc001dlh.3	Q9NWK9	OTTHUMG00000010576	ENST00000370574.3:c.1358A>C	1.37:g.86123544T>G	ENSP00000359606:p.Lys453Thr	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	155	5	NM_017953	0	0	0	0	0	B2RBA1|B4DP13|D3DT20|Q9H278|Q9H3X3|Q9NWN0	Missense_Mutation	SNP	ENST00000370574.3	37	CCDS707.1	.	.	.	.	.	.	.	.	.	.	T	7.146	0.582748	0.13749	.	.	ENSG00000117174	ENST00000431532;ENST00000370574	T;T	0.45668	0.9;0.89	5.67	1.28	0.21552	.	0.875078	0.10215	N	0.701695	T	0.12390	0.0301	L	0.38175	1.15	0.09310	N	1	B;B	0.24092	0.097;0.097	B;B	0.16722	0.016;0.016	T	0.25950	-1.0117	10	0.39692	T	0.17	-1.7217	5.4691	0.16660	0.4588:0.0:0.128:0.4132	.	414;453	B4DP13;Q9NWK9	.;BCD1_HUMAN	T	414;453	ENSP00000414344:K414T;ENSP00000359606:K453T	ENSP00000359606:K453T	K	-	2	0	ZNHIT6	85896132	0.022000	0.18835	0.121000	0.21740	0.985000	0.73830	0.713000	0.25794	0.447000	0.26695	0.533000	0.62120	AAA	.		0.328	ZNHIT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029186.1	NM_017953	
ARHGAP29	9411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94668261	94668261	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:94668261C>A	ENST00000260526.6	-	11	1164	c.982G>T	c.(982-984)Gca>Tca	p.A328S	ARHGAP29_ENST00000370217.3_Missense_Mutation_p.A328S	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	328					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AATAATTTTGCCTTTTTGAGA	0.388																																					p.A328S		.											.	ARHGAP29-296	0			c.G982T						.						145.0	130.0	135.0					1																	94668261		2203	4300	6503	SO:0001583	missense	9411	exon11			ATTTTGCCTTTTT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.982G>T	1.37:g.94668261C>A	ENSP00000260526:p.Ala328Ser	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	77	26	NM_004815	0	0	0	3	3	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652915	0.88056	.	.	ENSG00000137962	ENST00000260526;ENST00000370217	T;T	0.47869	0.83;0.83	6.06	5.16	0.70880	.	0.000000	0.38381	N	0.001718	T	0.58278	0.2111	M	0.69358	2.11	0.58432	D	0.999999	P;D	0.89917	0.944;1.0	P;D	0.83275	0.646;0.996	T	0.60622	-0.7227	10	0.41790	T	0.15	-25.713	15.6619	0.77193	0.0:0.9344:0.0:0.0656	.	328;328	Q52LW3-2;Q52LW3	.;RHG29_HUMAN	S	328	ENSP00000260526:A328S;ENSP00000359237:A328S	ENSP00000260526:A328S	A	-	1	0	ARHGAP29	94440849	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.054000	0.76649	1.578000	0.49821	0.650000	0.86243	GCA	.		0.388	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
KCNC4	3749	ucsc.edu	37	1	110774883	110774883	+	Silent	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:110774883T>C	ENST00000369787.3	+	4	1887	c.1860T>C	c.(1858-1860)ccT>ccC	p.P620P	KCNC4_ENST00000413138.3_Intron|KCNC4_ENST00000438661.2_Intron|KCNC4_ENST00000412512.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	620					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		AGCATTCACCTGAGGCTGCAT	0.547																																					p.P620P													.	KCNC4-154	0			c.T1860C						.						99.0	73.0	82.0					1																	110774883		2203	4300	6503	SO:0001819	synonymous_variant	3749	exon4			TTCACCTGAGGCT	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1860T>C	1.37:g.110774883T>C		Somatic	41	0		WXS	Illumina HiSeq		33	4	NM_004978	0	0	0	0	0	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	37	CCDS821.1																																																																																			.		0.547	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
BCL9	607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	147086309	147086309	+	Silent	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:147086309A>C	ENST00000234739.3	+	6	1194	c.454A>C	c.(454-456)Agg>Cgg	p.R152R	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	152					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TACAGCCCCCAGGTCTTCTAC	0.498			T	"""IGH@, IGL@"""	B-ALL																																p.R152R		.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9-707	0			c.A454C						.						118.0	119.0	119.0					1																	147086309		2203	4300	6503	SO:0001819	synonymous_variant	607	exon6			GCCCCCAGGTCTT	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.454A>C	1.37:g.147086309A>C		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	76	30	NM_004326	0	0	2	2	0	Q5T489	Silent	SNP	ENST00000234739.3	37	CCDS30833.1																																																																																			.		0.498	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
BCL9	607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	147086367	147086367	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:147086367A>G	ENST00000234739.3	+	6	1252	c.512A>G	c.(511-513)aAg>aGg	p.K171R	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	171					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCTGCTCAGAAGACTCCAGCC	0.537			T	"""IGH@, IGL@"""	B-ALL																																p.K171R		.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9-707	0			c.A512G						.						106.0	100.0	102.0					1																	147086367		2203	4300	6503	SO:0001583	missense	607	exon6			CTCAGAAGACTCC	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.512A>G	1.37:g.147086367A>G	ENSP00000234739:p.Lys171Arg	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	63	34	NM_004326	0	0	0	1	1	Q5T489	Missense_Mutation	SNP	ENST00000234739.3	37	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.492914	0.84962	.	.	ENSG00000116128	ENST00000234739	T	0.63580	-0.05	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.64382	0.2593	L	0.41824	1.3	0.58432	D	0.999993	D;D	0.63880	0.993;0.993	D;D	0.72625	0.978;0.978	T	0.63598	-0.6601	10	0.36615	T	0.2	-20.3683	15.8615	0.79026	1.0:0.0:0.0:0.0	.	171;171	Q1JQ81;O00512	.;BCL9_HUMAN	R	171	ENSP00000234739:K171R	ENSP00000234739:K171R	K	+	2	0	BCL9	145552991	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.962000	0.76048	2.333000	0.79357	0.533000	0.62120	AAG	.		0.537	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
KPRP	448834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152733695	152733695	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:152733695G>A	ENST00000606109.1	+	1	1659	c.1631G>A	c.(1630-1632)gGc>gAc	p.G544D	KPRP_ENST00000368773.1_Missense_Mutation_p.G544D			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	544						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTGGTGCTGGCTGTGGGCCT	0.577																																					p.G544D		.											.	KPRP-95	0			c.G1631A						.						78.0	72.0	74.0					1																	152733695		2203	4300	6503	SO:0001583	missense	448834	exon2			GTGCTGGCTGTGG	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1631G>A	1.37:g.152733695G>A	ENSP00000475216:p.Gly544Asp	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	117	52	NM_001025231	0	0	0	0	0		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224172	0.58668	.	.	ENSG00000203786	ENST00000368773	T	0.12672	2.66	3.95	3.03	0.35002	.	0.773292	0.11405	N	0.567368	T	0.05181	0.0138	L	0.40543	1.245	0.09310	N	1	P	0.44044	0.825	B	0.41691	0.364	T	0.28170	-1.0052	10	0.51188	T	0.08	-1.4837	7.7874	0.29099	0.114:0.0:0.886:0.0	.	544	Q5T749	KPRP_HUMAN	D	544	ENSP00000357762:G544D	ENSP00000357762:G544D	G	+	2	0	KPRP	151000319	0.168000	0.22989	0.022000	0.16811	0.516000	0.34256	0.680000	0.25306	1.243000	0.43853	0.313000	0.20887	GGC	.		0.577	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
NID1	4811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	236195870	236195870	+	Silent	SNP	A	A	G	rs564280440		TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:236195870A>G	ENST00000264187.6	-	6	1450	c.1368T>C	c.(1366-1368)acT>acC	p.T456T	NID1_ENST00000366595.3_Silent_p.T456T	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	456	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	AGTGGAGGTCAGTGTTCTCAA	0.537													A|||	1	0.000199681	0.0	0.0014	5008	,	,		18327	0.0		0.0	False		,,,				2504	0.0				p.T456T		.											.	NID1-154	0			c.T1368C						.						89.0	80.0	83.0					1																	236195870		2203	4300	6503	SO:0001819	synonymous_variant	4811	exon6			GAGGTCAGTGTTC	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1368T>C	1.37:g.236195870A>G		Somatic	45	1		WXS	Illumina HiSeq	Phase_I	59	23	NM_002508	0	0	6	8	2	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	CCDS1608.1																																																																																			.		0.537	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247597496	247597496	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr1:247597496G>T	ENST00000336119.3	+	5	3165	c.2419G>T	c.(2419-2421)Gac>Tac	p.D807Y	NLRP3_ENST00000348069.2_Missense_Mutation_p.D750Y|NLRP3_ENST00000391827.2_Missense_Mutation_p.D750Y|NLRP3_ENST00000366497.2_Missense_Mutation_p.D807Y|NLRP3_ENST00000391828.3_Missense_Mutation_p.D807Y|NLRP3_ENST00000366496.2_Missense_Mutation_p.D807Y	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	807					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGACCTGAGTGACAACGCCCT	0.577																																					p.D807Y		.											.	NLRP3-674	0			c.G2419T						.						136.0	123.0	127.0					1																	247597496		2203	4300	6503	SO:0001583	missense	114548	exon5			CTGAGTGACAACG	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2419G>T	1.37:g.247597496G>T	ENSP00000337383:p.Asp807Tyr	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	121	38	NM_004895	0	0	0	0	0	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	g	1.230	-0.624429	0.03636	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;D;T;D	0.87729	0.56;0.63;0.56;-2.29;0.63;-2.29	3.44	1.55	0.23275	.	0.684628	0.12798	N	0.438274	T	0.69369	0.3103	N	0.13198	0.31	0.09310	N	0.999996	B;B;B;B;B	0.33826	0.427;0.004;0.279;0.013;0.015	B;B;B;B;B	0.34301	0.179;0.01;0.086;0.043;0.012	T	0.61153	-0.7120	10	0.02654	T	1	.	4.9238	0.13883	0.1408:0.2854:0.5737:0.0	.	787;750;750;807;807	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	Y	807;807;807;750;807;750	ENSP00000375704:D807Y;ENSP00000355453:D807Y;ENSP00000337383:D807Y;ENSP00000294752:D750Y;ENSP00000355452:D807Y;ENSP00000375703:D750Y	ENSP00000337383:D807Y	D	+	1	0	NLRP3	245664119	0.000000	0.05858	0.947000	0.38551	0.104000	0.19210	-1.135000	0.03225	0.475000	0.27415	0.472000	0.43445	GAC	.		0.577	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
DDX50	79009	broad.mit.edu;bcgsc.ca	37	10	70670998	70670998	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr10:70670998C>T	ENST00000373585.3	+	4	742	c.635C>T	c.(634-636)cCa>cTa	p.P212L	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	212	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						AGCCGCTCACCAAAGGTAATC	0.388																																					p.P212L													.	DDX50-91	0			c.C635T						.						57.0	63.0	61.0					10																	70670998		2203	4300	6503	SO:0001583	missense	79009	exon4			GCTCACCAAAGGT	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.635C>T	10.37:g.70670998C>T	ENSP00000362687:p.Pro212Leu	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	96	7	NM_024045	0	0	0	0	0	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.690120	0.68271	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.04603	3.59	5.31	5.31	0.75309	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.093786	0.85682	D	0.000000	T	0.23410	0.0566	M	0.76433	2.335	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.80764	0.994;0.992	T	0.00223	-1.1903	10	0.72032	D	0.01	-10.7506	19.4076	0.94655	0.0:1.0:0.0:0.0	.	212;212	Q9BQ39;B4DED6	DDX50_HUMAN;.	L	212	ENSP00000362687:P212L	ENSP00000362687:P212L	P	+	2	0	DDX50	70341004	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	7.030000	0.76484	2.645000	0.89757	0.556000	0.70494	CCA	.		0.388	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
ECD	11319	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	74906091	74906091	+	Missense_Mutation	SNP	C	C	G	rs147908494	byFrequency	TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr10:74906091C>G	ENST00000372979.4	-	9	1276	c.1070G>C	c.(1069-1071)cGg>cCg	p.R357P	ECD_ENST00000454759.2_Missense_Mutation_p.R314P|ECD_ENST00000430082.2_Missense_Mutation_p.R357P	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	357					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					TAGCCTTTCCCGGTACTGAGC	0.388																																					p.R357P		.											.	ECD-91	0			c.G1070C						.						70.0	60.0	64.0					10																	74906091		2203	4300	6503	SO:0001583	missense	11319	exon9			CTTTCCCGGTACT	BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.1070G>C	10.37:g.74906091C>G	ENSP00000362070:p.Arg357Pro	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	40	7	NM_001135752	0	0	5	7	2	C9JX46|E9PAW8	Missense_Mutation	SNP	ENST00000372979.4	37	CCDS7321.1	.	.	.	.	.	.	.	.	.	.	c	16.22	3.061911	0.55432	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759	T;T;T	0.18657	2.2;2.2;2.2	5.86	3.46	0.39613	.	0.479204	0.25307	N	0.031608	T	0.22704	0.0548	L	0.46157	1.445	0.25782	N	0.984718	P;P;P	0.48694	0.583;0.719;0.914	P;P;P	0.52793	0.511;0.518;0.709	T	0.11397	-1.0589	10	0.36615	T	0.2	-20.0372	1.3395	0.02151	0.2109:0.0988:0.1488:0.5415	.	314;357;357	E9PAW8;C9JX46;O95905	.;.;SGT1_HUMAN	P	357;357;314	ENSP00000362070:R357P;ENSP00000401566:R357P;ENSP00000395786:R314P	ENSP00000362070:R357P	R	-	2	0	ECD	74576097	0.515000	0.26210	1.000000	0.80357	0.871000	0.50021	0.390000	0.20768	1.054000	0.40438	-0.310000	0.09108	CGG	C|0.999;T|0.001		0.388	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048606.1	NM_007265	
ADK	132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	76468112	76468112	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr10:76468112T>C	ENST00000286621.2	+	11	1048	c.998T>C	c.(997-999)cTg>cCg	p.L333P	ADK_ENST00000539909.1_Missense_Mutation_p.L276P|ADK_ENST00000541550.1_Missense_Mutation_p.L298P|ADK_ENST00000372734.3_Missense_Mutation_p.L316P	NM_006721.3	NP_006712.2	P55263	ADK_HUMAN	adenosine kinase	333					adenosine metabolic process (GO:0046085)|AMP salvage (GO:0044209)|circadian regulation of gene expression (GO:0032922)|dATP biosynthetic process (GO:0006175)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of T cell proliferation (GO:0042102)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenosine kinase activity (GO:0004001)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	8	Prostate(51;0.0112)|Ovarian(15;0.148)				Abacavir(DB01048)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Adenosine(DB00640)|Ribavirin(DB00811)	GACAAGCCTCTGACTGAATGT	0.453																																					p.L333P		.											.	ADK-228	0			c.T998C						.						148.0	145.0	146.0					10																	76468112		2203	4300	6503	SO:0001583	missense	132	exon11			AGCCTCTGACTGA	U50196	CCDS7343.1, CCDS7344.1, CCDS55716.1, CCDS55717.1	10q22.2	2006-02-21			ENSG00000156110	ENSG00000156110	2.7.1.20		257	protein-coding gene	gene with protein product	"""adenosine 5'-phosphotransferase"""	102750				8577746	Standard	NM_001123		Approved	AK	uc001jwi.3	P55263	OTTHUMG00000018506	ENST00000286621.2:c.998T>C	10.37:g.76468112T>C	ENSP00000286621:p.Leu333Pro	Somatic	201	0		WXS	Illumina HiSeq	Phase_I	184	67	NM_006721	0	0	40	63	23	B7Z783|B7Z800|O00741|O00742|Q16710|Q5JQ10|Q5JQ11|Q9BTN2	Missense_Mutation	SNP	ENST00000286621.2	37	CCDS7343.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.992018	0.74703	.	.	ENSG00000156110	ENST00000539909;ENST00000286621;ENST00000372734;ENST00000541550	D;D;D;D	0.90620	-2.7;-1.54;-1.54;-1.54	5.48	5.48	0.80851	Carbohydrate/purine kinase (1);	0.220948	0.39210	N	0.001422	D	0.94656	0.8277	M	0.79011	2.435	0.80722	D	1	D;B;D;B	0.69078	0.997;0.226;0.997;0.042	D;B;D;B	0.66847	0.947;0.275;0.947;0.173	D	0.94816	0.7983	10	0.54805	T	0.06	-6.7191	14.538	0.67973	0.0:0.0:0.0:1.0	.	298;276;316;333	B7Z800;B7Z783;Q5JQ10;P55263	.;.;.;ADK_HUMAN	P	276;333;316;298	ENSP00000443965:L276P;ENSP00000286621:L333P;ENSP00000361819:L316P;ENSP00000438321:L298P	ENSP00000286621:L333P	L	+	2	0	ADK	76138118	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.195000	0.77798	2.078000	0.62432	0.533000	0.62120	CTG	.		0.453	ADK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048763.1	NM_001123, NM_006721	
NRAP	4892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115381720	115381720	+	Missense_Mutation	SNP	C	C	T	rs200031510	byFrequency	TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr10:115381720C>T	ENST00000359988.3	-	24	2921	c.2677G>A	c.(2677-2679)Gta>Ata	p.V893I	NRAP_ENST00000369360.3_Missense_Mutation_p.V866I|NRAP_ENST00000360478.3_Missense_Mutation_p.V858I|NRAP_ENST00000369358.4_Missense_Mutation_p.V901I	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TTGTAGCCTACGTCTGTGGCT	0.522													T|||	2	0.000399361	0.0	0.0014	5008	,	,		23471	0.0		0.0	False		,,,				2504	0.001				p.V893I		.											.	NRAP-522	0			c.G2677A						.	T	ILE/VAL,ILE/VAL	1,4405	826.1+/-416.6	0,1,2202	288.0	219.0	243.0		2677,2572	-0.2	0.9	10		243	0,8600		0,0,4300	no	missense,missense	NRAP	NM_198060.2,NM_006175.3	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	893/1731,858/1696	115381720	1,13005	2203	4300	6503	SO:0001583	missense	4892	exon24			AGCCTACGTCTGT		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2677G>A	10.37:g.115381720C>T	ENSP00000353078:p.Val893Ile	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	147	51	NM_001261463	0	0	0	0	0		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	T	6.299	0.423219	0.11928	2.27E-4	0.0	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.99	-0.164	0.13359	.	0.321128	0.38492	N	0.001669	T	0.12433	0.0302	N	0.05078	-0.115	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.31052	-0.9957	10	0.13853	T	0.58	.	10.9817	0.47499	0.0:0.3842:0.0:0.6158	.	893;858;893	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	I	901;866;893;858	ENSP00000358365:V901I;ENSP00000358367:V866I;ENSP00000353078:V893I;ENSP00000353666:V858I	ENSP00000353078:V893I	V	-	1	0	NRAP	115371710	0.260000	0.24053	0.933000	0.37362	0.951000	0.60555	0.212000	0.17497	-0.541000	0.06257	-0.254000	0.11334	GTA	C|1.000;T|0.000		0.522	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
NLRP6	171389	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	281108	281108	+	Silent	SNP	G	G	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:281108G>C	ENST00000312165.5	+	4	1374	c.1374G>C	c.(1372-1374)gcG>gcC	p.A458A	NLRP6_ENST00000534750.1_Silent_p.A458A	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	458	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GACGCAGGGCGCAGTTTGCCG	0.662																																					p.A458A		.											.	NLRP6-583	0			c.G1374C						.						58.0	65.0	63.0					11																	281108		2201	4300	6501	SO:0001819	synonymous_variant	171389	exon4			CAGGGCGCAGTTT	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.1374G>C	11.37:g.281108G>C		Somatic	169	1		WXS	Illumina HiSeq	Phase_I	188	68	NM_138329	0	0	3	8	5	A8K9F3|E9PJZ8	Silent	SNP	ENST00000312165.5	37	CCDS7693.1																																																																																			.		0.662	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
KCNQ1	3784	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	2466713	2466713	+	Splice_Site	SNP	G	G	A	rs199472683		TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:2466713G>A	ENST00000155840.5	+	1	493	c.385G>A	c.(385-387)Gtc>Atc	p.V129I		NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	129					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CCACTTCGCCGTGTGAGTATC	0.682																																					p.V129I		.											.	KCNQ1-515	0			c.G385A						.						10.0	11.0	11.0					11																	2466713		2130	4214	6344	SO:0001630	splice_region_variant	3784	exon1			TTCGCCGTGTGAG	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.386+1G>A	11.37:g.2466713G>A		Somatic	30	1		WXS	Illumina HiSeq	Phase_I	30	10	NM_000218	0	0	0	0	0	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	ENST00000155840.5	37	CCDS7736.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398120	0.83120	.	.	ENSG00000053918	ENST00000496887;ENST00000155840	D;D	0.97066	-4.23;-4.23	3.17	3.17	0.36434	.	0.185677	0.34025	N	0.004327	D	0.94735	0.8301	M	0.64080	1.96	0.80722	D	1	P	0.46512	0.879	B	0.38616	0.277	D	0.94080	0.7343	10	0.49607	T	0.09	-20.4654	11.9712	0.53065	0.0:0.0:1.0:0.0	.	129	P51787	KCNQ1_HUMAN	I	42;129	ENSP00000434560:V42I;ENSP00000155840:V129I	ENSP00000155840:V129I	V	+	1	0	KCNQ1	2423289	1.000000	0.71417	0.968000	0.41197	0.837000	0.47467	8.420000	0.90256	1.771000	0.52183	0.561000	0.74099	GTC	.		0.682	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	Missense_Mutation
OR1S1	219959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57982376	57982376	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:57982376G>A	ENST00000309433.6	+	1	160	c.160G>A	c.(160-162)Ggg>Agg	p.G54R		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				CACTGTGATTGGGAACGGGCT	0.448																																					p.G54R		.											.	OR1S1-113	0			c.G160A						.						323.0	297.0	306.0					11																	57982376		2201	4296	6497	SO:0001583	missense	219959	exon1			GTGATTGGGAACG	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.160G>A	11.37:g.57982376G>A	ENSP00000311688:p.Gly54Arg	Somatic	322	0		WXS	Illumina HiSeq	Phase_I	229	90	NM_001004458	0	0	0	0	0	Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	37	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.576223	0.45902	.	.	ENSG00000172774	ENST00000309433	T	0.15256	2.44	3.45	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000137	T	0.49558	0.1564	H	0.95328	3.655	0.09310	N	0.999999	D	0.89917	1.0	D	0.70935	0.971	T	0.50406	-0.8832	10	0.87932	D	0	.	10.0621	0.42282	0.1064:0.0:0.8936:0.0	.	54	Q8NH92	OR1S1_HUMAN	R	54	ENSP00000311688:G54R	ENSP00000311688:G54R	G	+	1	0	OR1S1	57738952	0.784000	0.28713	0.803000	0.32268	0.673000	0.39480	2.153000	0.42282	1.770000	0.52166	0.479000	0.44913	GGG	.		0.448	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458	
DPF2	5977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65113439	65113439	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:65113439T>C	ENST00000528416.1	+	8	947	c.814T>C	c.(814-816)Tac>Cac	p.Y272H	DPF2_ENST00000532264.1_3'UTR|DPF2_ENST00000252268.4_Missense_Mutation_p.Y286H|DPF2_ENST00000415073.2_Intron	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	272					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						GCCCAACAACTACTGTGACTT	0.537																																					p.Y272H		.											.	DPF2-91	0			c.T814C						.						123.0	125.0	124.0					11																	65113439		2201	4297	6498	SO:0001583	missense	5977	exon8			AACAACTACTGTG	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.814T>C	11.37:g.65113439T>C	ENSP00000436901:p.Tyr272His	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	220	95	NM_006268	0	0	4	10	6	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.025345	0.93518	.	.	ENSG00000133884	ENST00000528416;ENST00000252268	D;D	0.91011	-2.75;-2.77	5.92	5.92	0.95590	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.34338	N	0.004057	D	0.95739	0.8614	M	0.87900	2.915	0.54753	D	0.999988	D	0.63046	0.992	D	0.87578	0.998	D	0.96274	0.9201	10	0.87932	D	0	-23.8316	14.3154	0.66446	0.0:0.0:0.0:1.0	.	272	Q92785	REQU_HUMAN	H	272;286	ENSP00000436901:Y272H;ENSP00000252268:Y286H	ENSP00000252268:Y286H	Y	+	1	0	DPF2	64870015	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.946000	0.87746	2.270000	0.75569	0.459000	0.35465	TAC	.		0.537	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66488565	66488565	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:66488565C>G	ENST00000533211.1	-	3	478	c.147G>C	c.(145-147)aaG>aaC	p.K49N	SPTBN2_ENST00000529997.1_Missense_Mutation_p.K49N|SPTBN2_ENST00000309996.2_Missense_Mutation_p.K49N			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	49	Actin-binding.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTGCCAGAGCCTTAATGCGAG	0.572																																					p.K49N		.											.	SPTBN2-155	0			c.G147C						.						76.0	65.0	68.0					11																	66488565		2200	4295	6495	SO:0001583	missense	6712	exon2			CAGAGCCTTAATG	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.147G>C	11.37:g.66488565C>G	ENSP00000432568:p.Lys49Asn	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	74	37	NM_006946	0	0	0	0	0	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576172	0.65878	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262;ENST00000527010	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	4.58	3.67	0.42095	Calponin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.76133	0.3945	M	0.92169	3.28	0.52099	D	0.999946	D	0.67145	0.996	P	0.61477	0.889	T	0.79100	-0.1942	10	0.87932	D	0	.	8.4196	0.32692	0.0:0.8157:0.0:0.1843	.	49	O15020	SPTN2_HUMAN	N	49	ENSP00000432568:K49N;ENSP00000311489:K49N;ENSP00000433593:K49N;ENSP00000433631:K49N	ENSP00000311489:K49N	K	-	3	2	SPTBN2	66245141	0.999000	0.42202	1.000000	0.80357	0.959000	0.62525	0.667000	0.25112	1.062000	0.40625	0.561000	0.74099	AAG	.		0.572	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877707	82877707	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:82877707A>C	ENST00000298281.4	+	5	2220	c.1768A>C	c.(1768-1770)Agt>Cgt	p.S590R		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	590					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AAACTGGCAAAGTTCCAAGTC	0.373																																					p.S590R		.											.	PCF11-23	0			c.A1768C						.						69.0	70.0	70.0					11																	82877707		1801	3982	5783	SO:0001583	missense	51585	exon5			TGGCAAAGTTCCA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1768A>C	11.37:g.82877707A>C	ENSP00000298281:p.Ser590Arg	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	151	57	NM_015885	0	0	1	2	1	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199720	0.38905	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.46063	1.89;0.89;0.88	6.07	4.96	0.65561	.	0.165679	0.43747	D	0.000537	T	0.27063	0.0663	N	0.19112	0.55	0.28203	N	0.927278	P;B	0.50528	0.936;0.244	P;B	0.45099	0.469;0.143	T	0.13072	-1.0523	9	.	.	.	.	4.9308	0.13916	0.7534:0.0:0.2466:0.0	.	590;590	E9PQ01;O94913	.;PCF11_HUMAN	R	590	ENSP00000298281:S590R;ENSP00000434540:S590R;ENSP00000431567:S590R	.	S	+	1	0	PCF11	82555355	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.144000	0.64832	2.326000	0.78906	0.533000	0.62120	AGT	.		0.373	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
B4GALNT3	283358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	662534	662534	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr12:662534C>A	ENST00000266383.5	+	14	1458	c.1445C>A	c.(1444-1446)cCc>cAc	p.P482H		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	482					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CTGGCTCAGCCCCGGGAGGGC	0.627																																					p.P482H		.											.	B4GALNT3-92	0			c.C1445A						.						55.0	63.0	60.0					12																	662534		2203	4300	6503	SO:0001583	missense	283358	exon14			CTCAGCCCCGGGA	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.1445C>A	12.37:g.662534C>A	ENSP00000266383:p.Pro482His	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	132	40	NM_173593	0	0	0	0	0	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387397	0.42308	.	.	ENSG00000139044	ENST00000266383;ENST00000322843	T;T	0.32988	3.47;1.43	5.75	1.75	0.24633	.	0.694092	0.14730	N	0.301809	T	0.20861	0.0502	L	0.36672	1.1	0.09310	N	1	P;P	0.41265	0.744;0.61	B;B	0.39027	0.288;0.167	T	0.08249	-1.0731	10	0.39692	T	0.17	-7.1623	5.6204	0.17453	0.0:0.6186:0.1433:0.238	.	385;482	E9PHD9;Q6L9W6	.;B4GN3_HUMAN	H	482;385	ENSP00000266383:P482H;ENSP00000322953:P385H	ENSP00000266383:P482H	P	+	2	0	B4GALNT3	532795	0.000000	0.05858	0.001000	0.08648	0.072000	0.16883	-0.111000	0.10807	0.790000	0.33803	0.650000	0.86243	CCC	.		0.627	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
TMTC3	160418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	88548132	88548132	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr12:88548132A>G	ENST00000266712.6	+	4	696	c.476A>G	c.(475-477)tAt>tGt	p.Y159C		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	159					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						TTTTTGTCATATACCAGATCA	0.318																																					p.Y159C		.											.	TMTC3-91	0			c.A476G						.						82.0	80.0	81.0					12																	88548132		2203	4296	6499	SO:0001583	missense	160418	exon4			TGTCATATACCAG		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.476A>G	12.37:g.88548132A>G	ENSP00000266712:p.Tyr159Cys	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	82	30	NM_181783	0	0	0	0	0	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	ENST00000266712.6	37	CCDS9032.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221546	0.79464	.	.	ENSG00000139324	ENST00000266712;ENST00000551088	T	0.71698	-0.59	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.86682	0.5991	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89279	0.3610	9	.	.	.	-14.1188	15.2357	0.73430	1.0:0.0:0.0:0.0	.	159	Q6ZXV5-2	.	C	159;86	ENSP00000266712:Y159C	.	Y	+	2	0	TMTC3	87072263	1.000000	0.71417	0.995000	0.50966	0.908000	0.53690	6.888000	0.75622	1.998000	0.58463	0.455000	0.32223	TAT	.		0.318	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	NM_181783	
FOXO1	2308	bcgsc.ca	37	13	41134471	41134471	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr13:41134471G>A	ENST00000379561.5	-	2	1541	c.1157C>T	c.(1156-1158)tCa>tTa	p.S386L	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	386	Required for interaction with RUNX2. {ECO:0000250}.|Sufficient for interaction with NLK. {ECO:0000250}.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)		PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		AACAGTTAATGATGTTGGTGA	0.478																																					p.S386L													.	FOXO1-1295	0			c.C1157T						.						184.0	169.0	174.0					13																	41134471		2203	4300	6503	SO:0001583	missense	2308	exon2			GTTAATGATGTTG		CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.1157C>T	13.37:g.41134471G>A	ENSP00000368880:p.Ser386Leu	Somatic	192	0		WXS	Illumina HiSeq	Phase_1	118	7	NM_002015	0	0	1	1	0	O43523|Q5VYC7|Q6NSK6	Missense_Mutation	SNP	ENST00000379561.5	37	CCDS9371.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968769	0.53614	.	.	ENSG00000150907	ENST00000379561	D	0.94650	-3.48	5.84	5.84	0.93424	.	0.316112	0.34156	N	0.004220	D	0.94450	0.8214	M	0.64997	1.995	0.49130	D	0.999756	B;D	0.53151	0.096;0.958	B;P	0.47827	0.068;0.558	D	0.92586	0.6079	10	0.23302	T	0.38	0.0571	19.1261	0.93384	0.0:0.0:1.0:0.0	.	360;386	F8TAD1;Q12778	.;FOXO1_HUMAN	L	386	ENSP00000368880:S386L	ENSP00000368880:S386L	S	-	2	0	FOXO1	40032471	1.000000	0.71417	0.544000	0.28141	0.430000	0.31655	9.476000	0.97823	2.779000	0.95612	0.655000	0.94253	TCA	.		0.478	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3	NM_002015	
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31598378	31598378	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr14:31598378C>A	ENST00000399332.1	-	25	4687	c.4199G>T	c.(4198-4200)gGt>gTt	p.G1400V	HECTD1_ENST00000553700.1_Missense_Mutation_p.G1400V	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1400	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTTGGTCGAACCCAAGCTGAT	0.468																																					p.G1400V		.											.	HECTD1-570	0			c.G4199T						.						187.0	182.0	184.0					14																	31598378		2062	4202	6264	SO:0001583	missense	25831	exon25			GTCGAACCCAAGC	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4199G>T	14.37:g.31598378C>A	ENSP00000382269:p.Gly1400Val	Somatic	306	1		WXS	Illumina HiSeq	Phase_I	267	87	NM_015382	0	0	4	4	0	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672271	0.29693	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.44482	0.92;0.92;1.43	5.52	4.63	0.57726	.	0.136560	0.49305	U	0.000153	T	0.25419	0.0618	N	0.08118	0	0.58432	D	0.999998	B;B	0.24186	0.099;0.099	B;B	0.19946	0.027;0.025	T	0.03493	-1.1031	10	0.24483	T	0.36	-8.1627	16.9601	0.86270	0.0:0.8726:0.1274:0.0	.	1400;1400	D3DS86;Q9ULT8	.;HECD1_HUMAN	V	1400;1402;1400;827	ENSP00000450697:G1400V;ENSP00000382269:G1400V;ENSP00000451860:G827V	ENSP00000261312:G1402V	G	-	2	0	HECTD1	30668129	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.549000	0.67261	1.442000	0.47568	0.557000	0.71058	GGT	.		0.468	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
PCNX	22990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	71413816	71413816	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr14:71413816G>T	ENST00000304743.2	+	2	784	c.338G>T	c.(337-339)aGg>aTg	p.R113M	PCNX_ENST00000238570.5_Missense_Mutation_p.R113M|PCNX_ENST00000439984.3_Missense_Mutation_p.R113M	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	113						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TGTTCAACCAGGAGAAAAGAC	0.398																																					p.R113M		.											.	PCNX-91	0			c.G338T						.						108.0	94.0	99.0					14																	71413816		2203	4300	6503	SO:0001583	missense	22990	exon2			CAACCAGGAGAAA	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.338G>T	14.37:g.71413816G>T	ENSP00000304192:p.Arg113Met	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	24	9	NM_014982	0	0	0	0	0	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149085	0.57151	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.42513	0.97;0.97;0.97	5.87	5.87	0.94306	.	0.248009	0.40144	N	0.001174	T	0.54013	0.1832	L	0.48642	1.525	0.47737	D	0.999505	D;D;D	0.71674	0.99;0.99;0.998	P;P;P	0.61592	0.707;0.707;0.891	T	0.52124	-0.8617	10	0.56958	D	0.05	.	13.8269	0.63357	0.0783:0.0:0.9217:0.0	.	113;113;113	B2RTR6;Q96RV3;Q96RV3-2	.;PCX1_HUMAN;.	M	113	ENSP00000304192:R113M;ENSP00000238570:R113M;ENSP00000396617:R113M	ENSP00000238570:R113M	R	+	2	0	PCNX	70483569	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.762000	0.68809	2.779000	0.95612	0.655000	0.94253	AGG	.		0.398	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64005696	64005696	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr15:64005696G>C	ENST00000443617.2	-	23	4406	c.4319C>G	c.(4318-4320)gCt>gGt	p.A1440G	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1440					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GTTGCATGCAGCAGTGTACAC	0.537																																					p.A1440G		.											.	HERC1-666	0			c.C4319G						.						104.0	101.0	102.0					15																	64005696		2101	4230	6331	SO:0001583	missense	8925	exon23			CATGCAGCAGTGT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4319C>G	15.37:g.64005696G>C	ENSP00000390158:p.Ala1440Gly	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	96	33	NM_003922	0	0	0	0	0	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853473	0.51270	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	T	0.34859	1.34	5.53	5.53	0.82687	.	0.069961	0.56097	D	0.000037	T	0.22513	0.0543	N	0.08118	0	0.44417	D	0.997336	B;B	0.09022	0.002;0.0	B;B	0.11329	0.006;0.003	T	0.04678	-1.0934	10	0.49607	T	0.09	.	14.9975	0.71443	0.0:0.1421:0.8579:0.0	.	424;1440	B4DKS2;Q15751	.;HERC1_HUMAN	G	1440;424	ENSP00000390158:A1440G	ENSP00000389613:A424G	A	-	2	0	HERC1	61792749	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.377000	0.79668	2.599000	0.87857	0.655000	0.94253	GCT	.		0.537	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
CILP	8483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65496681	65496681	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr15:65496681A>T	ENST00000261883.4	-	6	1010	c.844T>A	c.(844-846)Ttt>Att	p.F282I		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	282					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ATGGGGGCAAACTTGACCTTT	0.527																																					p.F282I		.											.	CILP-97	0			c.T844A						.						119.0	105.0	110.0					15																	65496681		2201	4299	6500	SO:0001583	missense	8483	exon6			GGGCAAACTTGAC	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.844T>A	15.37:g.65496681A>T	ENSP00000261883:p.Phe282Ile	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	128	53	NM_003613	0	0	0	0	0	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	ENST00000261883.4	37	CCDS10203.1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.541043	0.65085	.	.	ENSG00000138615	ENST00000261883	T	0.38722	1.12	5.63	5.63	0.86233	Carboxypeptidase-like, regulatory domain (1);	0.095383	0.64402	D	0.000001	T	0.45337	0.1337	M	0.69358	2.11	0.36495	D	0.868693	B	0.29341	0.242	B	0.29942	0.109	T	0.56414	-0.7983	10	0.72032	D	0.01	-4.1505	15.024	0.71653	1.0:0.0:0.0:0.0	.	282	O75339	CILP1_HUMAN	I	282	ENSP00000261883:F282I	ENSP00000261883:F282I	F	-	1	0	CILP	63283734	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.410000	0.73294	2.148000	0.66965	0.460000	0.39030	TTT	.		0.527	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
SRL	6345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	4245669	4245669	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr16:4245669A>C	ENST00000399609.3	-	5	507	c.495T>G	c.(493-495)ttT>ttG	p.F165L	SRL_ENST00000537996.1_Missense_Mutation_p.F123L	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	624	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						AATTCTGGCCAAACTTCTCAA	0.527																																					p.F165L		.											.	SRL-73	0			c.T495G						.						92.0	93.0	93.0					16																	4245669		1908	4134	6042	SO:0001583	missense	6345	exon5			CTGGCCAAACTTC	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.495T>G	16.37:g.4245669A>C	ENSP00000382518:p.Phe165Leu	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	217	154	NM_001098814	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399609.3	37	CCDS42113.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436347	0.83885	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.96041	-3.89;-3.89	5.1	4.01	0.46588	.	0.000000	0.85682	U	0.000000	D	0.95475	0.8530	M	0.75264	2.295	0.80722	D	1	P	0.51147	0.942	P	0.49953	0.627	D	0.94708	0.7889	10	0.87932	D	0	-10.1449	9.749	0.40464	0.8549:0.0:0.1451:0.0	.	165	Q86TD4-2	.	L	165;623;123	ENSP00000382518:F165L;ENSP00000440350:F123L	ENSP00000333285:F623L	F	-	3	2	SRL	4185670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.492000	0.45311	1.065000	0.40693	0.533000	0.62120	TTT	.		0.527	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	XM_064152	
GSG2	83903	hgsc.bcm.edu	37	17	3629036	3629036	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:3629036C>G	ENST00000325418.4	+	1	1826	c.1807C>G	c.(1807-1809)Ctg>Gtg	p.L603V	ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	603	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										CTTCATTGTGCTGGAATTTGA	0.473																																					p.L603V		.											.	GSG2-297	0			c.C1807G						.						109.0	107.0	108.0					17																	3629036		2203	4300	6503	SO:0001583	missense	83903	exon1			ATTGTGCTGGAAT	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1807C>G	17.37:g.3629036C>G	ENSP00000325290:p.Leu603Val	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_031965	0	0	0	0	0	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448766	0.43531	.	.	ENSG00000177602	ENST00000325418	T	0.68181	-0.31	4.87	2.73	0.32206	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000076	T	0.74114	0.3674	L	0.55103	1.725	0.46167	D	0.9989	D	0.60575	0.988	D	0.69824	0.966	T	0.73748	-0.3885	10	0.87932	D	0	-7.7857	9.0105	0.36137	0.0:0.8109:0.0:0.1891	.	603	Q8TF76	HASP_HUMAN	V	603	ENSP00000325290:L603V	ENSP00000325290:L603V	L	+	1	2	GSG2	3575785	0.240000	0.23847	0.994000	0.49952	0.963000	0.63663	0.635000	0.24629	0.643000	0.30638	-0.345000	0.07892	CTG	.		0.473	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
NLK	51701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26490600	26490600	+	Silent	SNP	A	A	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:26490600A>G	ENST00000407008.3	+	5	1501	c.783A>G	c.(781-783)ttA>ttG	p.L261L		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for interaction with TAB2. {ECO:0000250}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CTGGCATTTTACATCGAGACA	0.318																																					p.L261L		.											.	NLK-1403	0			c.A783G						.						85.0	83.0	83.0					17																	26490600		2203	4300	6503	SO:0001819	synonymous_variant	51701	exon5			CATTTTACATCGA	AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.783A>G	17.37:g.26490600A>G		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	46	17	NM_016231	0	0	3	9	6	B2RCX1|Q2PNI9|Q6P2A3	Silent	SNP	ENST00000407008.3	37	CCDS11224.2																																																																																			.		0.318	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255607.3	NM_016231	
COX11	1353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	53045784	53045784	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:53045784T>G	ENST00000299335.3	-	1	362	c.224A>C	c.(223-225)aAg>aCg	p.K75T	STXBP4_ENST00000434978.2_5'Flank|STXBP4_ENST00000376352.2_5'Flank|STXBP4_ENST00000405898.1_5'Flank|STXBP4_ENST00000398391.2_5'Flank|STXBP4_ENST00000299341.4_5'Flank|COX11_ENST00000571584.1_Missense_Mutation_p.K75T	NM_004375.3	NP_004366.1	Q9Y6N1	COX11_HUMAN	cytochrome c oxidase assembly homolog 11 (yeast)	75					hydrogen ion transmembrane transport (GO:1902600)|negative regulation of glucokinase activity (GO:0033132)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|prostate(1)	9						GTTCGAGCTCTTAGGCCGCCG	0.677																																					p.K75T		.											.	COX11-91	0			c.A224C						.						36.0	39.0	38.0					17																	53045784		2193	4279	6472	SO:0001583	missense	1353	exon1			GAGCTCTTAGGCC	AF044321	CCDS11583.1, CCDS58579.1	17q22	2012-10-15	2012-10-15			ENSG00000166260		"""Mitochondrial respiratory chain complex assembly factors"""	2261	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit 11"", ""cytochrome c oxidase assembly protein COX11"""	603648	"""COX11 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX11 cytochrome c oxidase assembly homolog (yeast)"""			9878253	Standard	NM_004375		Approved	COX11P	uc010wng.1	Q9Y6N1		ENST00000299335.3:c.224A>C	17.37:g.53045784T>G	ENSP00000299335:p.Lys75Thr	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	149	75	NM_001162861	0	0	8	19	11	D3DTY5|I3L220|Q6FHB7|Q9BRX0|Q9UME8	Missense_Mutation	SNP	ENST00000299335.3	37	CCDS11583.1	.	.	.	.	.	.	.	.	.	.	T	8.726	0.915585	0.17907	.	.	ENSG00000166260	ENST00000299335	T	0.46451	0.87	5.02	2.75	0.32379	.	0.295867	0.40728	N	0.001025	T	0.34890	0.0913	M	0.61703	1.905	0.29814	N	0.831394	B;B	0.18863	0.031;0.007	B;B	0.14023	0.01;0.003	T	0.27468	-1.0073	10	0.22706	T	0.39	-11.5209	7.4832	0.27417	0.0:0.2509:0.0:0.7491	.	75;75	B4DI26;Q9Y6N1	.;COX11_HUMAN	T	75	ENSP00000299335:K75T	ENSP00000299335:K75T	K	-	2	0	COX11	50400783	0.913000	0.31002	0.971000	0.41717	0.013000	0.08279	1.102000	0.31050	0.364000	0.24374	-0.250000	0.11733	AAG	.		0.677	COX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439182.1	NM_004375	
DDX5	1655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62500170	62500170	+	Silent	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:62500170T>C	ENST00000225792.5	-	4	773	c.372A>G	c.(370-372)ggA>ggG	p.G124G	DDX5_ENST00000450599.2_Intron|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000580026.1_5'Flank|CEP95_ENST00000553412.1_5'Flank|CEP95_ENST00000581056.1_5'Flank|DDX5_ENST00000578804.1_Silent_p.G124G|CEP95_ENST00000556440.2_5'Flank	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	124					cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CAACTGGCCATCCCTGAGCTT	0.398			T	ETV4	prostate																																p.G124G	NSCLC(22;406 813 4871 19580 40307)	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5-228	0			c.A372G						.						143.0	136.0	138.0					17																	62500170		2203	4300	6503	SO:0001819	synonymous_variant	1655	exon4			TGGCCATCCCTGA	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.372A>G	17.37:g.62500170T>C		Somatic	173	1		WXS	Illumina HiSeq	Phase_I	172	103	NM_004396	0	0	40	96	56	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Silent	SNP	ENST00000225792.5	37	CCDS11659.1																																																																																			.		0.398	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
SLC9A3R1	9368	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	72745286	72745286	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:72745286A>T	ENST00000262613.5	+	1	496	c.301A>T	c.(301-303)Aag>Tag	p.K101*	MIR3615_ENST00000585285.1_RNA|MIR3615_ENST00000581999.1_RNA	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1	101					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						GCAGCTGCAGAAGCTCGGCGT	0.736																																					p.K101X		.											.	SLC9A3R1-90	0			c.A301T						.						3.0	5.0	4.0					17																	72745286		1866	3862	5728	SO:0001587	stop_gained	9368	exon1			CTGCAGAAGCTCG	AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863	ENST00000262613.5:c.301A>T	17.37:g.72745286A>T	ENSP00000262613:p.Lys101*	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	28	15	NM_004252	0	0	19	21	2	B3KY21|O43552|Q86WQ5	Nonsense_Mutation	SNP	ENST00000262613.5	37	CCDS11705.1	.	.	.	.	.	.	.	.	.	.	A	39	7.293378	0.98192	.	.	ENSG00000109062	ENST00000262613;ENST00000413388	.	.	.	4.34	4.34	0.51931	.	0.194752	0.44097	D	0.000484	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.2354	7.5228	0.27637	0.901:0.0:0.099:0.0	.	.	.	.	X	101;51	.	ENSP00000262613:K101X	K	+	1	0	SLC9A3R1	70256881	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.636000	0.54317	1.831000	0.53308	0.402000	0.26972	AAG	.		0.736	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443671.1		
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80038618	80038618	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:80038618C>T	ENST00000306749.2	-	39	6994	c.6776G>A	c.(6775-6777)aGc>aAc	p.S2259N	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2259	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGAGGCCAGGCTGTGGAACAC	0.687																																					p.S2259N	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.G6776A						.						45.0	45.0	45.0					17																	80038618		2191	4290	6481	SO:0001583	missense	2194	exon39			GCCAGGCTGTGGA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6776G>A	17.37:g.80038618C>T	ENSP00000304592:p.Ser2259Asn	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	32	7	NM_004104	0	0	39	53	14	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.242946	0.22796	.	.	ENSG00000169710	ENST00000306749	T	0.26067	1.76	4.47	2.3	0.28687	Thioesterase (1);	0.302769	0.35407	N	0.003229	T	0.10252	0.0251	N	0.08118	0	0.34398	D	0.694932	B	0.06786	0.001	B	0.06405	0.002	T	0.16541	-1.0399	10	0.19147	T	0.46	-34.0126	6.0153	0.19598	0.0:0.6205:0.1749:0.2047	.	2259	P49327	FAS_HUMAN	N	2259	ENSP00000304592:S2259N	ENSP00000304592:S2259N	S	-	2	0	FASN	77631907	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	0.914000	0.28624	1.091000	0.41335	0.591000	0.81541	AGC	.		0.687	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
METTL4	64863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2554953	2554953	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr18:2554953G>C	ENST00000574538.1	-	4	1319	c.544C>G	c.(544-546)Cag>Gag	p.Q182E	snoU109_ENST00000459316.1_RNA|METTL4_ENST00000319888.6_Missense_Mutation_p.Q182E	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	182					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						CCCTTGTCCTGTTTTTCAAAA	0.388																																					p.Q182E		.											.	METTL4-227	0			c.C544G						.						119.0	124.0	122.0					18																	2554953		2203	4300	6503	SO:0001583	missense	64863	exon4			TGTCCTGTTTTTC		CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.544C>G	18.37:g.2554953G>C	ENSP00000458290:p.Gln182Glu	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	104	61	NM_022840	0	0	0	0	0	B2RNA1|Q2TAA7|Q9H5U9	Missense_Mutation	SNP	ENST00000574538.1	37	CCDS11826.1	.	.	.	.	.	.	.	.	.	.	G	7.036	0.561490	0.13498	.	.	ENSG00000101574	ENST00000319888	T	0.21031	2.03	5.85	0.516	0.17019	.	1.312720	0.04780	N	0.429705	T	0.14743	0.0356	L	0.42245	1.32	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.26744	-1.0094	10	0.02654	T	1	0.1066	4.6714	0.12691	0.2571:0.2993:0.4436:0.0	.	182	Q8N3J2	METL4_HUMAN	E	182	ENSP00000320349:Q182E	ENSP00000320349:Q182E	Q	-	1	0	METTL4	2544953	0.000000	0.05858	0.000000	0.03702	0.916000	0.54674	0.407000	0.21049	0.055000	0.16094	0.655000	0.94253	CAG	.		0.388	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254326.3	NM_022840	
OSBPL1A	114876	broad.mit.edu;bcgsc.ca	37	18	21819191	21819191	+	Silent	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr18:21819191C>A	ENST00000319481.3	-	16	1643	c.1437G>T	c.(1435-1437)gcG>gcT	p.A479A	OSBPL1A_ENST00000357041.4_Silent_p.A97A|OSBPL1A_ENST00000399443.3_5'UTR	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	479					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TACCTGACAGCGCATCATAGA	0.522																																					p.A479A													.	OSBPL1A-94	0			c.G1437T						.						171.0	134.0	146.0					18																	21819191		2203	4300	6503	SO:0001819	synonymous_variant	114876	exon16			TGACAGCGCATCA	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1437G>T	18.37:g.21819191C>A		Somatic	88	1		WXS	Illumina HiSeq	Phase_I	68	5	NM_080597	0	0	0	0	0	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	37	CCDS11884.1																																																																																			.		0.522	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
PALM	5064	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	746543	746543	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:746543T>G	ENST00000338448.5	+	9	939	c.893T>G	c.(892-894)gTc>gGc	p.V298G	PALM_ENST00000264560.7_Missense_Mutation_p.V254G|PALM_ENST00000593172.1_3'UTR	NM_002579.2	NP_002570.2	O75781	PALM_HUMAN	paralemmin	298					cellular component movement (GO:0006928)|cellular response to electrical stimulus (GO:0071257)|cytoskeleton organization (GO:0007010)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of filopodium assembly (GO:0051491)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)|synapse maturation (GO:0060074)	apicolateral plasma membrane (GO:0016327)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasmic membrane-bounded vesicle (GO:0016023)|dendrite membrane (GO:0032590)|dendritic spine membrane (GO:0032591)|filopodium membrane (GO:0031527)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		GAGCCCCCGGTCACAATGATC	0.667																																					p.V298G		.											.	PALM-68	0			c.T893G						.						34.0	32.0	32.0					19																	746543		2203	4299	6502	SO:0001583	missense	5064	exon9			CCCCGGTCACAAT	Y16270	CCDS32857.1, CCDS32858.1	19p13.3	2008-07-17				ENSG00000099864			8594	protein-coding gene	gene with protein product		608134				9615234, 9813098	Standard	XM_005259565		Approved	KIAA0270	uc002lpm.1	O75781		ENST00000338448.5:c.893T>G	19.37:g.746543T>G	ENSP00000341911:p.Val298Gly	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	56	19	NM_002579	0	0	16	21	5	O43359|O95673|Q92559|Q9UPJ4|Q9UQS2|Q9UQS3	Missense_Mutation	SNP	ENST00000338448.5	37	CCDS32857.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.706659	0.68615	.	.	ENSG00000099864	ENST00000338448;ENST00000264560;ENST00000538247	T;T	0.28666	1.6;1.6	4.92	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.55049	0.1896	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.60627	-0.7226	10	0.87932	D	0	-41.4159	9.8074	0.40801	0.1538:0.0:0.0:0.8462	.	254;298	O75781-2;O75781	.;PALM_HUMAN	G	298;254;163	ENSP00000341911:V298G;ENSP00000264560:V254G	ENSP00000264560:V254G	V	+	2	0	PALM	697543	1.000000	0.71417	0.998000	0.56505	0.546000	0.35178	5.847000	0.69451	1.839000	0.53478	0.379000	0.24179	GTC	.		0.667	PALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457592.1	NM_002579	
CELF5	60680	broad.mit.edu	37	19	3293390	3293390	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:3293390G>T	ENST00000292672.2	+	12	1441	c.1404G>T	c.(1402-1404)atG>atT	p.M468I	CELF5_ENST00000541430.2_3'UTR	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	468	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						AGATCGGCATGAAGAGGCTCA	0.642																																					p.M468I													.	CELF5-92	0			c.G1404T						.						92.0	82.0	85.0					19																	3293390		2203	4300	6503	SO:0001583	missense	60680	exon12			CGGCATGAAGAGG	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.1404G>T	19.37:g.3293390G>T	ENSP00000292672:p.Met468Ile	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	94	6	NM_021938	0	0	1	1	0	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	37	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315867	0.81469	.	.	ENSG00000161082	ENST00000292672	T	0.05855	3.38	4.73	4.73	0.59995	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.09992	0.0245	N	0.04508	-0.205	0.80722	D	1	D	0.63046	0.992	D	0.67900	0.954	T	0.50021	-0.8876	10	0.72032	D	0.01	-29.5717	16.6332	0.85039	0.0:0.0:1.0:0.0	.	468	Q8N6W0	CELF5_HUMAN	I	468	ENSP00000292672:M468I	ENSP00000292672:M468I	M	+	3	0	CELF5	3244390	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.515000	0.73751	2.333000	0.79357	0.561000	0.74099	ATG	.		0.642	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
PIAS4	51588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4013072	4013072	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:4013072A>C	ENST00000262971.2	+	2	294	c.179A>C	c.(178-180)gAg>gCg	p.E60A		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	60					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGATCAAGGAGCTGTACGAG	0.632																																					p.E60A		.											.	PIAS4-659	0			c.A179C						.						58.0	57.0	57.0					19																	4013072		2203	4300	6503	SO:0001583	missense	51588	exon2			TCAAGGAGCTGTA	AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.179A>C	19.37:g.4013072A>C	ENSP00000262971:p.Glu60Ala	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	86	38	NM_015897	0	0	2	4	2	O75926|Q96G19|Q9UN16	Missense_Mutation	SNP	ENST00000262971.2	37	CCDS12118.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.769648	0.90020	.	.	ENSG00000105229	ENST00000262971	T	0.39592	1.07	5.14	5.14	0.70334	DNA-binding SAP (1);	0.053905	0.85682	D	0.000000	T	0.60444	0.2269	L	0.61036	1.89	0.53688	D	0.999975	D	0.69078	0.997	D	0.68765	0.96	T	0.64571	-0.6376	10	0.87932	D	0	-35.6334	14.1251	0.65215	1.0:0.0:0.0:0.0	.	60	Q8N2W9	PIAS4_HUMAN	A	60	ENSP00000262971:E60A	ENSP00000262971:E60A	E	+	2	0	PIAS4	3964072	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.283000	0.95860	1.938000	0.56188	0.459000	0.35465	GAG	.		0.632	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457496.1	NM_015897	
FBXW9	84261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12807385	12807385	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:12807385G>T	ENST00000380339.3	-	1	47	c.11C>A	c.(10-12)cCc>cAc	p.P4H	FBXW9_ENST00000393261.3_Missense_Mutation_p.P4H|FBXW9_ENST00000587955.1_Missense_Mutation_p.P4H|FBXW9_ENST00000544494.1_5'UTR			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	4					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						CCGCCCTAGGGGAAGCTCCAT	0.662																																					p.P4H		.											.	FBXW9-227	0			c.C11A						.						34.0	36.0	35.0					19																	12807385		1899	3937	5836	SO:0001583	missense	84261	exon1			CCTAGGGGAAGCT	BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.11C>A	19.37:g.12807385G>T	ENSP00000369696:p.Pro4His	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	99	31	NM_032301	0	0	7	14	7	B3KVP7|Q9BT89	Missense_Mutation	SNP	ENST00000380339.3	37		.	.	.	.	.	.	.	.	.	.	G	12.20	1.867154	0.32977	.	.	ENSG00000132004	ENST00000393261;ENST00000380339	T;T	0.47869	1.86;0.83	3.77	1.64	0.23874	.	0.182213	0.26646	N	0.023231	T	0.42810	0.1219	L	0.27053	0.805	0.22142	N	0.999336	D;D	0.61697	0.99;0.99	P;P	0.55824	0.785;0.785	T	0.20605	-1.0270	10	0.87932	D	0	-7.2791	6.1222	0.20159	0.2273:0.0:0.7727:0.0	.	4;4	Q5XUX1-2;Q5XUX1-3	.;.	H	4	ENSP00000376945:P4H;ENSP00000369696:P4H	ENSP00000369696:P4H	P	-	2	0	FBXW9	12668385	0.169000	0.23002	0.087000	0.20705	0.044000	0.14063	2.195000	0.42677	0.575000	0.29434	0.462000	0.41574	CCC	.		0.662	FBXW9-201	KNOWN	basic	protein_coding	protein_coding		NM_032301	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38976604	38976604	+	Missense_Mutation	SNP	C	C	T	rs398123472		TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:38976604C>T	ENST00000359596.3	+	34	5309	c.5309C>T	c.(5308-5310)tCg>tTg	p.S1770L	RYR1_ENST00000355481.4_Missense_Mutation_p.S1770L|RYR1_ENST00000360985.3_Missense_Mutation_p.S1770L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1770	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GTCACCACTTCGCTGAGGCCC	0.682																																					p.S1770L		.											.	RYR1-100	0			c.C5309T						.						41.0	40.0	40.0					19																	38976604		2203	4300	6503	SO:0001583	missense	6261	exon34			CCACTTCGCTGAG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5309C>T	19.37:g.38976604C>T	ENSP00000352608:p.Ser1770Leu	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	87	41	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376736	0.24857	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.73469	-0.75;-0.75;-0.75	3.62	3.62	0.41486	.	0.079974	0.50627	U	0.000120	T	0.68311	0.2987	M	0.62723	1.935	0.32730	N	0.509105	P;P	0.52170	0.945;0.951	B;B	0.40134	0.273;0.32	T	0.79472	-0.1789	10	0.72032	D	0.01	.	10.3775	0.44090	0.0:0.612:0.388:0.0	.	1770;1770	P21817-2;P21817	.;RYR1_HUMAN	L	1770	ENSP00000352608:S1770L;ENSP00000347667:S1770L;ENSP00000354254:S1770L	ENSP00000347667:S1770L	S	+	2	0	RYR1	43668444	0.864000	0.29904	1.000000	0.80357	0.159000	0.22180	1.096000	0.30976	1.850000	0.53721	0.585000	0.79938	TCG	.		0.682	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PSG3	5671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	43237192	43237192	+	Silent	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:43237192G>T	ENST00000327495.5	-	3	637	c.453C>A	c.(451-453)atC>atA	p.I151I	PSG3_ENST00000595140.1_Silent_p.I151I|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	151	Ig-like C2-type 1.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TGCTGCTGGAGATGGAGGGCT	0.522																																					p.I151I		.											.	PSG3-92	0			c.C453A						.						160.0	160.0	160.0					19																	43237192		2203	4300	6503	SO:0001819	synonymous_variant	5671	exon3			GCTGGAGATGGAG		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.453C>A	19.37:g.43237192G>T		Somatic	341	1		WXS	Illumina HiSeq	Phase_I	310	117	NM_021016	0	0	0	0	0	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Silent	SNP	ENST00000327495.5	37	CCDS12611.1																																																																																			.		0.522	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016	
PPP1R15A	23645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49377875	49377875	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr19:49377875G>A	ENST00000200453.5	+	2	1654	c.1385G>A	c.(1384-1386)gGa>gAa	p.G462E		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	462	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GCAGCCTTGGGAGAAGCTGAG	0.562																																					p.G462E		.											.	PPP1R15A-226	0			c.G1385A						.						74.0	74.0	74.0					19																	49377875		2203	4300	6503	SO:0001583	missense	23645	exon2			CCTTGGGAGAAGC	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1385G>A	19.37:g.49377875G>A	ENSP00000200453:p.Gly462Glu	Somatic	85	1		WXS	Illumina HiSeq	Phase_I	115	32	NM_014330	0	0	54	72	18	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	37	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	G	0.790	-0.759239	0.03019	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.04603	3.59	0.884	-1.77	0.07982	.	1.784130	0.03162	N	0.169529	T	0.02418	0.0074	N	0.11427	0.14	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38200	-0.9672	10	0.02654	T	1	-0.2961	5.0156	0.14335	0.6685:0.0:0.3315:0.0	.	462	O75807	PR15A_HUMAN	E	462;302;420	ENSP00000200453:G462E	ENSP00000200453:G462E	G	+	2	0	PPP1R15A	54069687	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-0.455000	0.06762	-1.201000	0.02659	-1.131000	0.01979	GGA	.		0.562	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32726845	32726845	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:32726845G>A	ENST00000421745.2	+	47	9231	c.9097G>A	c.(9097-9099)Ggg>Agg	p.G3033R		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3033					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CATATCAGTTGGGGATGGATT	0.363																																					p.G3033R	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.G9097A						.						126.0	121.0	123.0					2																	32726845		2203	4300	6503	SO:0001583	missense	57448	exon47			TCAGTTGGGGATG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.9097G>A	2.37:g.32726845G>A	ENSP00000393596:p.Gly3033Arg	Somatic	138	1		WXS	Illumina HiSeq	Phase_I	116	23	NM_016252	0	0	0	0	0	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	33	5.269920	0.95429	.	.	ENSG00000115760	ENST00000421745	T	0.75154	-0.91	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.83774	0.5327	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84031	0.0359	10	0.66056	D	0.02	.	20.0137	0.97470	0.0:0.0:1.0:0.0	.	3033	Q9NR09	BIRC6_HUMAN	R	3033	ENSP00000393596:G3033R	ENSP00000393596:G3033R	G	+	1	0	BIRC6	32580349	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.734000	0.93682	0.563000	0.77884	GGG	.		0.363	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37280725	37280725	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:37280725C>A	ENST00000233099.5	-	17	2520	c.2425G>T	c.(2425-2427)Gaa>Taa	p.E809*	HEATR5B_ENST00000354531.2_Nonsense_Mutation_p.E809*	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	809						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TTAACACATTCAGCAAAGTGA	0.328																																					p.E809X		.											.	HEATR5B-142	0			c.G2425T						.						51.0	52.0	52.0					2																	37280725		2203	4300	6503	SO:0001587	stop_gained	54497	exon17			CACATTCAGCAAA	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2425G>T	2.37:g.37280725C>A	ENSP00000233099:p.Glu809*	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	28	8	NM_019024	0	0	0	0	0	B5MDU8|Q7Z3B2|Q9NVL7	Nonsense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	42	9.667231	0.99233	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-27.7923	20.1736	0.98170	0.0:1.0:0.0:0.0	.	.	.	.	X	809	.	ENSP00000233099:E809X	E	-	1	0	HEATR5B	37134229	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.771000	0.85420	2.767000	0.95098	0.557000	0.71058	GAA	.		0.328	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109379713	109379713	+	Silent	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:109379713T>C	ENST00000283195.6	+	20	2844	c.2718T>C	c.(2716-2718)aaT>aaC	p.N906N		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	906					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						ATGGCATGAATAGGCTTCCAC	0.413																																					p.N906N		.											.	RANBP2-675	0			c.T2718C						.						76.0	72.0	73.0					2																	109379713		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon20			CATGAATAGGCTT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2718T>C	2.37:g.109379713T>C		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	93	29	NM_006267	0	0	0	0	0	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.413	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
UBXN4	23190	hgsc.bcm.edu	37	2	136505919	136505919	+	Silent	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:136505919T>C	ENST00000272638.9	+	2	476	c.165T>C	c.(163-165)gcT>gcC	p.A55A		NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	55					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						GTTTTGTTGCTATTAAAATCG	0.284																																					p.A55A		.											.	UBXN4-92	0			c.T165C						.						85.0	76.0	79.0					2																	136505919		1813	4081	5894	SO:0001819	synonymous_variant	23190	exon2			TGTTGCTATTAAA	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.165T>C	2.37:g.136505919T>C		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_014607	0	0	19	19	0	A8K9W4|Q4ZG56|Q8IYM5	Silent	SNP	ENST00000272638.9	37	CCDS42761.1																																																																																			.		0.284	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607	
ZNF804A	91752	ucsc.edu;bcgsc.ca	37	2	185802049	185802049	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:185802049G>T	ENST00000302277.6	+	4	2520	c.1926G>T	c.(1924-1926)caG>caT	p.Q642H		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	642							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CAGAAAAGCAGTATTTAGCTG	0.348																																					p.Q642H													.	ZNF804A-163	0			c.G1926T						.						94.0	104.0	101.0					2																	185802049		2203	4297	6500	SO:0001583	missense	91752	exon4			AAAGCAGTATTTA	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1926G>T	2.37:g.185802049G>T	ENSP00000303252:p.Gln642His	Somatic	195	4		WXS	Illumina HiSeq		136	53	NM_194250	0	0	0	0	0	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	9.524	1.109178	0.20714	.	.	ENSG00000170396	ENST00000302277	T	0.06218	3.33	5.65	-3.11	0.05299	.	1.188910	0.06060	N	0.658227	T	0.04182	0.0116	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.45381	-0.9265	10	0.40728	T	0.16	0.2582	0.8399	0.01148	0.3584:0.1165:0.2907:0.2344	.	642	Q7Z570	Z804A_HUMAN	H	642	ENSP00000303252:Q642H	ENSP00000303252:Q642H	Q	+	3	2	ZNF804A	185510294	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.555000	0.05999	-0.453000	0.07076	0.655000	0.94253	CAG	.		0.348	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
SLC40A1	30061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190428768	190428768	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:190428768G>A	ENST00000261024.2	-	7	1370	c.944C>T	c.(943-945)gCt>gTt	p.A315V		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	315					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			ATAAAGGAAAGCAAGACCCAT	0.532																																					p.A315V		.											.	SLC40A1-91	0			c.C944T						.						106.0	86.0	92.0					2																	190428768		2203	4300	6503	SO:0001583	missense	30061	exon7			AGGAAAGCAAGAC	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.944C>T	2.37:g.190428768G>A	ENSP00000261024:p.Ala315Val	Somatic	50	1		WXS	Illumina HiSeq	Phase_I	60	25	NM_014585	0	0	19	19	0	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	37	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	G	36	5.785758	0.96937	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.94723	-3.5	6.16	6.16	0.99307	Major facilitator superfamily domain, general substrate transporter (1);	0.089656	0.85682	D	0.000000	D	0.96818	0.8961	M	0.70903	2.155	0.80722	D	1	D	0.63046	0.992	D	0.65773	0.938	D	0.94766	0.7940	10	0.28530	T	0.3	-24.5676	20.8598	0.99761	0.0:0.0:1.0:0.0	.	315	Q9NP59	S40A1_HUMAN	V	315;50	ENSP00000261024:A315V	ENSP00000261024:A315V	A	-	2	0	SLC40A1	190137013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.850000	0.99511	2.937000	0.99478	0.650000	0.86243	GCT	.		0.532	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		
SLC40A1	30061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190428774	190428774	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr2:190428774C>G	ENST00000261024.2	-	7	1364	c.938G>C	c.(937-939)gGt>gCt	p.G313A		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	313					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			GAAAGCAAGACCCATGCCAGC	0.527																																					p.G313A		.											.	SLC40A1-91	0			c.G938C						.						109.0	88.0	95.0					2																	190428774		2203	4300	6503	SO:0001583	missense	30061	exon7			GCAAGACCCATGC	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.938G>C	2.37:g.190428774C>G	ENSP00000261024:p.Gly313Ala	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	68	28	NM_014585	0	0	25	25	0	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	37	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.246458	0.59103	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.92752	-3.1	6.16	3.02	0.34903	Major facilitator superfamily domain, general substrate transporter (1);	0.199649	0.53938	N	0.000049	T	0.82102	0.4964	N	0.16903	0.455	0.49915	D	0.999833	P	0.34826	0.471	B	0.35470	0.203	T	0.79320	-0.1852	10	0.02654	T	1	-15.2428	12.8928	0.58082	0.1134:0.5621:0.3246:0.0	.	313	Q9NP59	S40A1_HUMAN	A	313;48	ENSP00000261024:G313A	ENSP00000261024:G313A	G	-	2	0	SLC40A1	190137019	0.713000	0.27926	1.000000	0.80357	0.999000	0.98932	1.166000	0.31834	1.561000	0.49584	0.650000	0.86243	GGT	.		0.527	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		
PCBP3	54039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47333926	47333926	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr21:47333926T>G	ENST00000400314.1	+	10	1000	c.662T>G	c.(661-663)tTt>tGt	p.F221C	PCBP3_ENST00000400304.1_Missense_Mutation_p.F189C|PCBP3_ENST00000400310.1_Missense_Mutation_p.F221C|PCBP3_ENST00000449640.1_Missense_Mutation_p.F221C|PCBP3_ENST00000400308.1_Intron|PCBP3_ENST00000400309.1_Missense_Mutation_p.F221C			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	221					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CCTGTCATTTTTGCAGGTGGT	0.602																																					p.F221C		.											.	PCBP3-227	0			c.T662G						.						64.0	72.0	69.0					21																	47333926		1987	4167	6154	SO:0001583	missense	54039	exon8			TCATTTTTGCAGG	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.662T>G	21.37:g.47333926T>G	ENSP00000383168:p.Phe221Cys	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	100	39	NM_020528	0	0	0	0	0	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	ENST00000400314.1	37	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250671	0.80135	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000449640;ENST00000346743;ENST00000400304	T;T;T;T;T	0.47177	1.49;1.41;1.43;1.49;0.85	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.58206	0.2106	L	0.52364	1.645	0.80722	D	1	D;B;D;B	0.67145	0.986;0.039;0.996;0.004	P;B;P;B	0.58391	0.838;0.099;0.784;0.029	T	0.59445	-0.7453	10	0.48119	T	0.1	-3.3437	14.9659	0.71193	0.0:0.0:0.0:1.0	.	189;221;221;221	E9PFP8;P57721-4;P57721;P57721-5	.;.;PCBP3_HUMAN;.	C	221;221;221;221;221;189	ENSP00000383168:F221C;ENSP00000383165:F221C;ENSP00000383164:F221C;ENSP00000401198:F221C;ENSP00000383159:F189C	ENSP00000330225:F221C	F	+	2	0	PCBP3	46158354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.577000	0.82486	1.933000	0.56026	0.460000	0.39030	TTT	.		0.602	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
VPRBP	9730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	51456171	51456171	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr3:51456171G>T	ENST00000335891.5	-	8	2058	c.2049C>A	c.(2047-2049)aaC>aaA	p.N683K				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1132					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		AGTTGTGACAGTTATAGCTGG	0.502																																					p.N1079K		.											.	VPRBP-92	0			c.C3237A						.						135.0	138.0	137.0					3																	51456171		2033	4194	6227	SO:0001583	missense	9730	exon15			GTGACAGTTATAG	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2049C>A	3.37:g.51456171G>T	ENSP00000338857:p.Asn683Lys	Somatic	198	0		WXS	Illumina HiSeq	Phase_I	208	171	NM_014703	0	0	0	2	2	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	G	13.79	2.340869	0.41498	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.01240	5.12;5.12	5.99	4.03	0.46877	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.127622	0.64402	D	0.000001	T	0.01156	0.0038	L	0.31926	0.97	0.58432	D	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.45614	-0.9249	10	0.07175	T	0.84	-19.5801	6.0918	0.19999	0.2259:0.1364:0.6376:0.0	.	1132	Q9Y4B6	VPRBP_HUMAN	K	703;683	ENSP00000393183:N703K;ENSP00000338857:N683K	ENSP00000338857:N683K	N	-	3	2	VPRBP	51431211	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.575000	0.46025	1.377000	0.46286	0.655000	0.94253	AAC	.		0.502	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52584609	52584609	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr3:52584609A>T	ENST00000296302.7	-	29	4726	c.4725T>A	c.(4723-4725)taT>taA	p.Y1575*	RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.Y1488*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.Y1468*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.Y1520*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.Y1483*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.Y1468*|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.Y1538*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.Y1495*			Q86U86	PB1_HUMAN	polybromo 1	1575	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTGGGCCGGGATATGGAGGTG	0.572			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.Y1468X		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1-575	0			c.T4404A						.						81.0	84.0	83.0					3																	52584609		2203	4300	6503	SO:0001587	stop_gained	55193	exon29			GCCGGGATATGGA	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4725T>A	3.37:g.52584609A>T	ENSP00000296302:p.Tyr1575*	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	95	68	NM_018313	0	0	1	2	1	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	A	43	9.940619	0.99300	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767	.	.	.	5.93	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.079	8.842	0.35148	0.7955:0.0:0.2045:0.0	.	.	.	.	X	1488;1468;1575;1468;1520;1495;1538;1483	.	ENSP00000296302:Y1575X	Y	-	3	2	PBRM1	52559649	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.050000	0.30404	1.087000	0.41251	-0.250000	0.11733	TAT	.		0.572	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
COL8A1	1295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	99513269	99513269	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr3:99513269C>T	ENST00000261037.3	+	5	904	c.524C>T	c.(523-525)cCt>cTt	p.P175L	COL8A1_ENST00000273342.4_Missense_Mutation_p.P175L	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	175	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						ATGGGCATGCCTGGGGCAAAA	0.552																																					p.P175L		.											.	COL8A1-90	0			c.C524T						.						44.0	48.0	46.0					3																	99513269		2203	4300	6503	SO:0001583	missense	1295	exon5			GCATGCCTGGGGC	AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.524C>T	3.37:g.99513269C>T	ENSP00000261037:p.Pro175Leu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	52	44	NM_001850	0	0	3	3	0	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294831	0.40594	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.96685	-4.09;-4.09	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.97945	0.9324	M	0.88450	2.955	0.58432	D	0.999999	P;P	0.51449	0.945;0.945	P;P	0.57204	0.815;0.815	D	0.98294	1.0515	10	0.54805	T	0.06	.	16.849	0.85988	0.0:1.0:0.0:0.0	.	176;175	E7EPK9;P27658	.;CO8A1_HUMAN	L	175	ENSP00000261037:P175L;ENSP00000273342:P175L	ENSP00000261037:P175L	P	+	2	0	COL8A1	100995959	0.976000	0.34144	0.960000	0.40013	0.992000	0.81027	2.529000	0.45632	2.583000	0.87209	0.655000	0.94253	CCT	.		0.552	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850	
PDIA5	10954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122821610	122821610	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr3:122821610T>A	ENST00000316218.7	+	5	449	c.354T>A	c.(352-354)ttT>ttA	p.F118L		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	118					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		ATGGTGCATTTCATACTGAAT	0.393																																					p.F118L		.											.	PDIA5-91	0			c.T354A						.						138.0	121.0	127.0					3																	122821610		2203	4300	6503	SO:0001583	missense	10954	exon5			TGCATTTCATACT	AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.354T>A	3.37:g.122821610T>A	ENSP00000323313:p.Phe118Leu	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	27	24	NM_006810	0	0	0	0	0	D3DN95|Q9BV43	Missense_Mutation	SNP	ENST00000316218.7	37	CCDS3020.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.148995	0.78001	.	.	ENSG00000065485	ENST00000316218;ENST00000484644	T	0.20598	2.06	4.97	4.97	0.65823	Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.41903	0.1179	M	0.76574	2.34	0.53688	D	0.999974	D	0.76494	0.999	D	0.75484	0.986	T	0.30621	-0.9972	10	0.14656	T	0.56	.	12.261	0.54651	0.0:0.0:0.0:1.0	.	118	Q14554	PDIA5_HUMAN	L	118;22	ENSP00000323313:F118L	ENSP00000323313:F118L	F	+	3	2	PDIA5	124304300	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.656000	0.46716	2.080000	0.62538	0.460000	0.39030	TTT	.		0.393	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810	
CSN3	1448	hgsc.bcm.edu;broad.mit.edu	37	4	71114720	71114720	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr4:71114720T>A	ENST00000304954.3	+	4	179	c.93T>A	c.(91-93)caT>caA	p.H31Q		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	171					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						tGCAGTGCCATGAGAATGATG	0.294																																					p.H31Q		.											.	CSN3-93	0			c.T93A						.						71.0	71.0	71.0					4																	71114720		2203	4300	6503	SO:0001583	missense	1448	exon4			GTGCCATGAGAAT	U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.93T>A	4.37:g.71114720T>A	ENSP00000304822:p.His31Gln	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	65	7	NM_005212	0	0	0	0	0	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	CCDS3538.1	.	.	.	.	.	.	.	.	.	.	T	4.544	0.101098	0.08731	.	.	ENSG00000171209	ENST00000304954	T	0.21932	1.98	4.38	0.665	0.17896	.	2.181060	0.01313	N	0.010690	T	0.13157	0.0319	N	0.14661	0.345	0.09310	N	1	B	0.30686	0.29	B	0.31101	0.124	T	0.20240	-1.0281	10	0.20046	T	0.44	-5.3853	6.2755	0.20979	0.0:0.303:0.0:0.697	.	31	P07498	CASK_HUMAN	Q	31	ENSP00000304822:H31Q	ENSP00000304822:H31Q	H	+	3	2	CSN3	71149309	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.050000	0.14120	0.131000	0.18576	-0.379000	0.06801	CAT	.		0.294	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212	
AFM	173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	74364944	74364944	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr4:74364944T>C	ENST00000226355.3	+	11	1496	c.1403T>C	c.(1402-1404)tTt>tCt	p.F468S		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	468	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGTGAAGAGTTTGCCTGTGTT	0.403																																					p.F468S		.											.	AFM-92	0			c.T1403C						.						184.0	158.0	167.0					4																	74364944		2203	4300	6503	SO:0001583	missense	173	exon11			AAGAGTTTGCCTG	L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.1403T>C	4.37:g.74364944T>C	ENSP00000226355:p.Phe468Ser	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	49	18	NM_001133	0	0	0	0	0	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	ENST00000226355.3	37	CCDS3557.1	.	.	.	.	.	.	.	.	.	.	T	11.29	1.595211	0.28445	.	.	ENSG00000079557	ENST00000226355	T	0.57107	0.42	5.55	4.38	0.52667	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.351548	0.26931	N	0.021779	T	0.55401	0.1918	L	0.41356	1.27	0.29327	N	0.866933	D	0.69078	0.997	D	0.65773	0.938	T	0.49000	-0.8984	10	0.21014	T	0.42	.	7.4141	0.27034	0.0:0.0943:0.0:0.9057	.	468	P43652	AFAM_HUMAN	S	468	ENSP00000226355:F468S	ENSP00000226355:F468S	F	+	2	0	AFM	74583808	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	2.017000	0.40981	2.111000	0.64477	0.533000	0.62120	TTT	.		0.403	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2		
AFF1	4299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	88029422	88029422	+	Silent	SNP	A	A	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr4:88029422A>T	ENST00000307808.6	+	10	1887	c.1467A>T	c.(1465-1467)tcA>tcT	p.S489S	AFF1_ENST00000395146.4_Silent_p.S496S|AFF1_ENST00000544085.1_Silent_p.S127S	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	489	Poly-Ser.				positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AGAGCAGTTCAAGTGACAGCG	0.542																																					p.S496S		.											.	AFF1-289	0			c.A1488T						.						101.0	96.0	98.0					4																	88029422		2203	4300	6503	SO:0001819	synonymous_variant	4299	exon11			CAGTTCAAGTGAC	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1467A>T	4.37:g.88029422A>T		Somatic	68	1		WXS	Illumina HiSeq	Phase_I	73	8	NM_001166693	0	0	6	7	1	B4DTU1|E9PBM3	Silent	SNP	ENST00000307808.6	37	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.868153	0.32977	.	.	ENSG00000172493	ENST00000541943	.	.	.	5.91	-4.33	0.03677	.	.	.	.	.	T	0.60340	0.2261	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66618	-0.5878	5	0.66056	D	0.02	-6.0776	10.0883	0.42432	0.2811:0.5837:0.062:0.0732	.	.	.	.	L	149	.	ENSP00000446349:Q149L	Q	+	2	0	AFF1	88248446	0.000000	0.05858	0.948000	0.38648	0.997000	0.91878	-2.633000	0.00869	-0.424000	0.07382	0.533000	0.62120	CAA	.		0.542	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
LEF1	51176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	109084775	109084775	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr4:109084775A>C	ENST00000265165.1	-	3	1017	c.363T>G	c.(361-363)aaT>aaG	p.N121K	LEF1_ENST00000438313.2_Missense_Mutation_p.N121K|LEF1_ENST00000512172.1_Missense_Mutation_p.N53K|LEF1_ENST00000379951.2_Missense_Mutation_p.N121K|LEF1_ENST00000510624.1_Missense_Mutation_p.N53K	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	121	Pro-rich.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		ATGGGTCGTTATTCATATTTG	0.428																																					p.N121K		.											.	LEF1-721	0			c.T363G						.						196.0	173.0	181.0					4																	109084775		2203	4300	6503	SO:0001583	missense	51176	exon3			GTCGTTATTCATA		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.363T>G	4.37:g.109084775A>C	ENSP00000265165:p.Asn121Lys	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	103	40	NM_001130714	0	0	1	1	0	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	ENST00000265165.1	37	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	A	9.451	1.090605	0.20471	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313;ENST00000510624;ENST00000515500;ENST00000512172	D;D;D;D	0.99113	-5.42;-5.42;-5.42;-5.44	5.74	-3.28	0.05033	CTNNB1 binding, N-teminal (1);	0.187580	0.53938	D	0.000050	D	0.96728	0.8932	L	0.47716	1.5	0.32383	N	0.554276	P;P;P;P;B	0.42078	0.77;0.643;0.728;0.732;0.322	B;B;B;B;B	0.40901	0.184;0.132;0.156;0.343;0.216	D	0.94059	0.7325	10	0.28530	T	0.3	-19.1486	13.7994	0.63190	0.4778:0.0:0.5222:0.0	.	53;6;121;121;121	E9PDK3;B4DZY5;Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;.;.;LEF1_HUMAN	K	121;121;121;53;53;53	ENSP00000265165:N121K;ENSP00000369284:N121K;ENSP00000406176:N121K;ENSP00000422840:N53K	ENSP00000265165:N121K	N	-	3	2	LEF1	109304224	0.997000	0.39634	0.018000	0.16275	0.994000	0.84299	0.624000	0.24462	-0.783000	0.04534	0.460000	0.39030	AAT	.		0.428	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2		
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	155226303	155226303	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr4:155226303C>A	ENST00000357232.4	-	16	3975	c.3976G>T	c.(3976-3978)Gta>Tta	p.V1326L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1326	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GTTGTCACTACCTCTCCAGTG	0.338																																					p.V1326L		.											.	DCHS2-94	0			c.G3976T						.						43.0	43.0	43.0					4																	155226303		2203	4300	6503	SO:0001583	missense	54798	exon16			TCACTACCTCTCC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3976G>T	4.37:g.155226303C>A	ENSP00000349768:p.Val1326Leu	Somatic	58	2		WXS	Illumina HiSeq	Phase_I	43	17	NM_017639	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	8.031	0.761814	0.15914	.	.	ENSG00000197410	ENST00000357232	T	0.60171	0.21	6.03	4.32	0.51571	Cadherin (4);Cadherin-like (1);	0.306795	0.27424	N	0.019429	T	0.26195	0.0639	N	0.02985	-0.445	0.80722	D	1	B	0.29552	0.248	B	0.27380	0.079	T	0.06285	-1.0835	10	0.33940	T	0.23	.	2.2328	0.04001	0.1217:0.4475:0.226:0.2048	.	1326	Q6V1P9	PCD23_HUMAN	L	1326	ENSP00000349768:V1326L	ENSP00000349768:V1326L	V	-	1	0	DCHS2	155445753	0.023000	0.18921	0.984000	0.44739	0.510000	0.34073	0.027000	0.13621	0.879000	0.35944	0.655000	0.94253	GTA	.		0.338	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
TRIP13	9319	broad.mit.edu	37	5	916037	916037	+	Silent	SNP	C	C	T	rs147247158		TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr5:916037C>T	ENST00000166345.3	+	12	1508	c.1152C>T	c.(1150-1152)agC>agT	p.S384S	TRIP13_ENST00000510412.1_3'UTR	NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	384					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			AGGGCCTCAGCGGCCGGGTCC	0.537																																					p.S384S													.	TRIP13-90	0			c.C1152T						.	C		0,4406		0,0,2203	156.0	171.0	166.0		1152	-10.8	0.0	5	dbSNP_134	166	1,8599		0,1,4299	no	coding-synonymous	TRIP13	NM_004237.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		384/433	916037	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9319	exon12			CCTCAGCGGCCGG	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.1152C>T	5.37:g.916037C>T		Somatic	305	0		WXS	Illumina HiSeq	Phase_I	281	7	NM_004237	0	0	5	5	0	C9K0T3|D3DTC0|O15324	Silent	SNP	ENST00000166345.3	37	CCDS3858.1																																																																																			C|1.000;T|0.000		0.537	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237	
FAM105A	54491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	14609077	14609077	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr5:14609077T>C	ENST00000274217.3	+	7	968	c.848T>C	c.(847-849)tTc>tCc	p.F283S		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	283	OTU.									large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					CCTTTGAGCTTCATGATGAAT	0.433																																					p.F283S		.											.	FAM105A-91	0			c.T848C						.						149.0	153.0	152.0					5																	14609077		2203	4300	6503	SO:0001583	missense	54491	exon7			TGAGCTTCATGAT		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.848T>C	5.37:g.14609077T>C	ENSP00000274217:p.Phe283Ser	Somatic	217	0		WXS	Illumina HiSeq	Phase_I	222	83	NM_019018	0	0	5	11	6	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756651	0.69648	.	.	ENSG00000145569	ENST00000274217	T	0.16743	2.32	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000001	T	0.37625	0.1010	M	0.72894	2.215	0.41254	D	0.986734	D	0.76494	0.999	D	0.68943	0.961	T	0.23691	-1.0181	10	0.87932	D	0	-22.3388	10.4145	0.44314	0.1462:0.0:0.0:0.8538	.	283	Q9NUU6	F105A_HUMAN	S	283	ENSP00000274217:F283S	ENSP00000274217:F283S	F	+	2	0	FAM105A	14662077	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.702000	0.61817	1.819000	0.53055	0.477000	0.44152	TTC	.		0.433	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
NSD1	64324	bcgsc.ca	37	5	176637986	176637986	+	Silent	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr5:176637986C>T	ENST00000439151.2	+	5	2631	c.2586C>T	c.(2584-2586)tcC>tcT	p.S862S	NSD1_ENST00000354179.4_Silent_p.S593S|NSD1_ENST00000347982.4_Silent_p.S593S|NSD1_ENST00000361032.4_Silent_p.S759S	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	862					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATGTTTTATCCGAGTTGAAGG	0.403			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.S862S				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.C2586T						.						144.0	139.0	141.0					5																	176637986		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	TTTATCCGAGTTG	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2586C>T	5.37:g.176637986C>T		Somatic	115	0		WXS	Illumina HiSeq	Phase_1	136	6	NM_022455	0	0	1	1	0	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.403	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
TXNDC5	81567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	7889004	7889004	+	Silent	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr6:7889004A>C	ENST00000379757.4	-	7	934	c.897T>G	c.(895-897)acT>acG	p.T299T	TXNDC5_ENST00000473453.1_Silent_p.T191T|TXNDC5_ENST00000539054.1_Silent_p.T227T|BLOC1S5-TXNDC5_ENST00000439343.2_3'UTR	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	299					apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					CCGTCGCTCCAGTCTCTGTGC	0.642																																					p.T299T	Ovarian(119;1430 1625 3928 26125 34589)	.											.	TXNDC5-90	0			c.T897G						.						136.0	131.0	132.0					6																	7889004		2203	4300	6503	SO:0001819	synonymous_variant	81567	exon7			CGCTCCAGTCTCT	AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.897T>G	6.37:g.7889004A>C		Somatic	250	0		WXS	Illumina HiSeq	Phase_I	275	114	NM_030810	0	0	19	27	8	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Silent	SNP	ENST00000379757.4	37	CCDS4505.1																																																																																			.		0.642	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1	NM_030810	
HCRTR2	3062	broad.mit.edu	37	6	55039406	55039406	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr6:55039406G>T	ENST00000370862.3	+	1	357	c.21G>T	c.(19-21)gaG>gaT	p.E7D		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	7					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CCAAATTGGAGGACTCCCCCC	0.567																																					p.E7D													.	HCRTR2-525	0			c.G21T						.						96.0	92.0	93.0					6																	55039406		2203	4300	6503	SO:0001583	missense	3062	exon1			ATTGGAGGACTCC	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.21G>T	6.37:g.55039406G>T	ENSP00000359899:p.Glu7Asp	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	117	5	NM_001526	0	0	0	0	0	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	37	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883677	0.51908	.	.	ENSG00000137252	ENST00000370862	T	0.61627	0.09	4.99	4.99	0.66335	.	0.129886	0.53938	D	0.000050	T	0.25344	0.0616	N	0.16478	0.41	0.35600	D	0.80775	B	0.10296	0.003	B	0.06405	0.002	T	0.06463	-1.0825	10	0.30854	T	0.27	.	13.4409	0.61112	0.0:0.0:0.8433:0.1567	.	7	O43614	OX2R_HUMAN	D	7	ENSP00000359899:E7D	ENSP00000359899:E7D	E	+	3	2	HCRTR2	55147365	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.863000	0.48396	2.599000	0.87857	0.563000	0.77884	GAG	.		0.567	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
LIN28B	389421	broad.mit.edu	37	6	105405976	105405976	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr6:105405976G>A	ENST00000345080.4	+	2	216	c.13G>A	c.(13-15)Ggg>Agg	p.G5R		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	5					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				CTTCTCAGGCGGGGCTAGCAA	0.517																																					p.G5R													.	LIN28B-90	0			c.G13A						.						44.0	50.0	48.0					6																	105405976		2203	4300	6503	SO:0001583	missense	389421	exon2			TCAGGCGGGGCTA	AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.13G>A	6.37:g.105405976G>A	ENSP00000344401:p.Gly5Arg	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	116	4	NM_001004317	0	0	0	0	0	A1L165|B2RPN6|Q5TCM4	Missense_Mutation	SNP	ENST00000345080.4	37	CCDS34504.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486186	0.63962	.	.	ENSG00000187772	ENST00000345080	.	.	.	5.78	5.78	0.91487	.	0.050237	0.85682	D	0.000000	T	0.76248	0.3961	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75539	-0.3282	9	0.52906	T	0.07	-5.991	20.0044	0.97430	0.0:0.0:1.0:0.0	.	5	Q6ZN17	LN28B_HUMAN	R	5	.	ENSP00000344401:G5R	G	+	1	0	LIN28B	105512669	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.434000	0.97515	2.714000	0.92807	0.650000	0.86243	GGG	.		0.517	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041646.2	NM_001004317	
CARD11	84433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	2963967	2963967	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr7:2963967A>T	ENST00000396946.4	-	15	2243	c.1840T>A	c.(1840-1842)Tcc>Acc	p.S614T		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	614					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGGATGGAGGAGGGTCCGAAG	0.612			Mis		DLBCL																																p.S614T		.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11-870	0			c.T1840A						.						90.0	75.0	80.0					7																	2963967		2203	4300	6503	SO:0001583	missense	84433	exon15			TGGAGGAGGGTCC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1840T>A	7.37:g.2963967A>T	ENSP00000380150:p.Ser614Thr	Somatic	86	1		WXS	Illumina HiSeq	Phase_I	81	28	NM_032415	0	0	0	0	0	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	A	8.933	0.963857	0.18583	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.44083	0.93;0.93	5.15	2.24	0.28232	.	0.185348	0.47852	D	0.000202	T	0.24160	0.0585	N	0.14661	0.345	0.19945	N	0.999941	B	0.15719	0.014	B	0.18263	0.021	T	0.17561	-1.0365	10	0.52906	T	0.07	-14.7989	8.2592	0.31775	0.2504:0.0:0.7496:0.0	.	614	Q9BXL7	CAR11_HUMAN	T	614;85	ENSP00000380150:S614T;ENSP00000347695:S85T	ENSP00000347695:S85T	S	-	1	0	CARD11	2930493	1.000000	0.71417	0.427000	0.26684	0.393000	0.30537	2.109000	0.41863	0.203000	0.20529	-0.345000	0.07892	TCC	.		0.612	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
PNPLA8	50640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	108112970	108112970	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr7:108112970C>T	ENST00000422087.1	-	12	2630	c.2224G>A	c.(2224-2226)Gaa>Aaa	p.E742K	PNPLA8_ENST00000257694.8_Missense_Mutation_p.E742K|PNPLA8_ENST00000426128.2_Missense_Mutation_p.E680K|PNPLA8_ENST00000388728.5_Missense_Mutation_p.E680K|PNPLA8_ENST00000453144.1_Missense_Mutation_p.E642K|PNPLA8_ENST00000436062.1_Missense_Mutation_p.E742K	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	742					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						ATTTTTTGTTCATTTCTTTCT	0.299																																					p.E742K		.											.	PNPLA8-135	0			c.G2224A						.						42.0	44.0	43.0					7																	108112970		2202	4298	6500	SO:0001583	missense	50640	exon10			TTTGTTCATTTCT	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.2224G>A	7.37:g.108112970C>T	ENSP00000410804:p.Glu742Lys	Somatic	85	2		WXS	Illumina HiSeq	Phase_I	67	24	NM_001256008	0	0	7	15	8	A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Missense_Mutation	SNP	ENST00000422087.1	37	CCDS34733.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661045	0.88154	.	.	ENSG00000135241	ENST00000426128;ENST00000257694;ENST00000388728;ENST00000422087;ENST00000453144;ENST00000436062	T;T;T;T;T;T	0.76968	-1.06;-1.03;-1.03;-1.03;-1.03;-1.03	5.57	5.57	0.84162	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.263816	0.42964	D	0.000628	T	0.77698	0.4169	M	0.64997	1.995	0.37310	D	0.909096	P	0.45396	0.857	B	0.40982	0.345	T	0.81346	-0.0974	10	0.42905	T	0.14	.	19.5466	0.95300	0.0:1.0:0.0:0.0	.	742	Q9NP80	PLPL8_HUMAN	K	677;742;680;742;642;742	ENSP00000394988:E677K;ENSP00000257694:E742K;ENSP00000373380:E680K;ENSP00000410804:E742K;ENSP00000387789:E642K;ENSP00000406779:E742K	ENSP00000257694:E742K	E	-	1	0	PNPLA8	107900206	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.433000	0.80362	2.604000	0.88044	0.650000	0.86243	GAA	.		0.299	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723	
CTAGE15	441294	hgsc.bcm.edu	37	7	143270001	143270001	+	Missense_Mutation	SNP	C	C	T	rs201104924	byFrequency	TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr7:143270001C>T	ENST00000420911.2	+	1	1108	c.1091C>T	c.(1090-1092)gCa>gTa	p.A364V	RNU6-162P_ENST00000516228.1_RNA	NM_001008747.1	NP_001008747.1	A4D2H0	CTGEF_HUMAN	CTAGE family, member 15	364						integral component of membrane (GO:0016021)											ACTCAACAAGCATCTTTGCAA	0.299													.|||	1090	0.217652	0.171	0.3213	5008	,	,		25006	0.1002		0.3419	False		,,,				2504	0.2004				p.A364V		.											.	.	0			c.C1091T						.						2.0	2.0	2.0					7																	143270001		1060	2315	3375	SO:0001583	missense	441294	exon1			AACAAGCATCTTT		CCDS64788.1	7q35	2013-02-25	2013-02-25	2013-02-25	ENSG00000176227	ENSG00000271079			37295	protein-coding gene	gene with protein product			"""CTAGE family, member 15, pseudogene"""	CTAGE15P			Standard	NM_001008747		Approved		uc011kth.3	A4D2H0	OTTHUMG00000153233	ENST00000420911.2:c.1091C>T	7.37:g.143270001C>T	ENSP00000474204:p.Ala364Val	Somatic	46	1		WXS	Illumina HiSeq	Phase_I	58	9	NM_001008747	0	0	0	3	3	A6H8Z8	Missense_Mutation	SNP	ENST00000420911.2	37																																																																																				C|0.500;A|0.500		0.299	CTAGE15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330280.2	NM_001008747	
UNC5D	137970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	35541184	35541184	+	Silent	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr8:35541184C>T	ENST00000404895.2	+	5	1018	c.690C>T	c.(688-690)acC>acT	p.T230T	UNC5D_ENST00000287272.2_Silent_p.T230T|UNC5D_ENST00000453357.2_Silent_p.T225T|UNC5D_ENST00000420357.1_Silent_p.T230T|UNC5D_ENST00000416672.1_Silent_p.T230T	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	230	Ig-like C2-type.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T225T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAAATTACACCTGCATGGCAG	0.537																																					p.T230T		.											.	UNC5D-96	1	Substitution - coding silent(1)	lung(1)	c.C690T						.						86.0	72.0	77.0					8																	35541184		2203	4300	6503	SO:0001819	synonymous_variant	137970	exon5			TTACACCTGCATG	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.690C>T	8.37:g.35541184C>T		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	58	22	NM_080872	0	0	0	0	0	Q8WYP7	Silent	SNP	ENST00000404895.2	37	CCDS6093.2																																																																																			.		0.537	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
NOV	4856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	120429171	120429171	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr8:120429171G>C	ENST00000259526.3	+	2	499	c.272G>C	c.(271-273)cGc>cCc	p.R91P	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	0	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			TACTGTGATCGCAGCGCGGAC	0.612											OREG0018940	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R91P		.											.	NOV-228	0			c.G272C						.						48.0	44.0	46.0					8																	120429171		2203	4300	6503	SO:0001583	missense	4856	exon2			GTGATCGCAGCGC	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.272G>C	8.37:g.120429171G>C	ENSP00000259526:p.Arg91Pro	Somatic	44	0	1503	WXS	Illumina HiSeq	Phase_I	49	23	NM_002514	0	0	1	3	2		Missense_Mutation	SNP	ENST00000259526.3	37	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.796255	0.70567	.	.	ENSG00000136999	ENST00000259526	T	0.61274	0.12	4.93	4.05	0.47172	Insulin-like growth factor-binding protein, IGFBP (2);	0.205916	0.45126	D	0.000394	T	0.50497	0.1619	N	0.11313	0.125	0.37745	D	0.925773	D	0.71674	0.998	P	0.61132	0.884	T	0.56932	-0.7897	10	0.45353	T	0.12	-42.0353	8.4948	0.33121	0.0773:0.0:0.7703:0.1525	.	91	P48745	NOV_HUMAN	P	91	ENSP00000259526:R91P	ENSP00000259526:R91P	R	+	2	0	NOV	120498352	0.151000	0.22747	1.000000	0.80357	0.990000	0.78478	0.194000	0.17135	1.436000	0.47453	0.561000	0.74099	CGC	.		0.612	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514	
FAM135B	51059	broad.mit.edu	37	8	139151264	139151264	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr8:139151264C>T	ENST00000395297.1	-	18	4036	c.3866G>A	c.(3865-3867)cGc>cAc	p.R1289H		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1289										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GAAACATTTGCGCAAATCAGC	0.438										HNSCC(54;0.14)																											p.R1289H													.	FAM135B-31	0			c.G3866A						.						133.0	128.0	129.0					8																	139151264		1877	4117	5994	SO:0001583	missense	51059	exon18			CATTTGCGCAAAT	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3866G>A	8.37:g.139151264C>T	ENSP00000378710:p.Arg1289His	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	102	6	NM_015912	0	0	1	1	0	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	34	5.406433	0.96051	.	.	ENSG00000147724	ENST00000395297	T	0.42900	0.96	5.58	5.58	0.84498	Domain of unknown function DUF676, lipase-like (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73452	-0.3978	10	0.87932	D	0	-20.3154	18.5599	0.91096	0.0:1.0:0.0:0.0	.	1289	Q49AJ0	F135B_HUMAN	H	1289	ENSP00000378710:R1289H	ENSP00000378710:R1289H	R	-	2	0	FAM135B	139220446	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.644000	0.89710	0.655000	0.94253	CGC	.		0.438	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
MLLT3	4300	broad.mit.edu	37	9	20414346	20414346	+	Silent	SNP	G	G	A			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr9:20414346G>A	ENST00000380338.4	-	5	784	c.498C>T	c.(496-498)agC>agT	p.S166S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S163S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	166	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S166S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																p.S166S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	4	Substitution - coding silent(4)	urinary_tract(2)|lung(1)|prostate(1)	c.C498T						.						8.0	15.0	13.0					9																	20414346		1434	3114	4548	SO:0001819	synonymous_variant	4300	exon5			GCTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.498C>T	9.37:g.20414346G>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	73	4	NM_004529	0	0	9	9	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
RASEF	158158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	85597649	85597649	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr9:85597649A>C	ENST00000376447.3	-	17	2426	c.2166T>G	c.(2164-2166)aaT>aaG	p.N722K		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	722					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TCCCGGTTAGATTGGTAATGG	0.433																																					p.N722K		.											.	RASEF-280	0			c.T2166G						.						391.0	359.0	370.0					9																	85597649		2203	4300	6503	SO:0001583	missense	158158	exon17			GGTTAGATTGGTA	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.2166T>G	9.37:g.85597649A>C	ENSP00000365630:p.Asn722Lys	Somatic	252	0		WXS	Illumina HiSeq	Phase_I	273	87	NM_152573	0	0	7	11	4	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	A	8.015	0.758440	0.15846	.	.	ENSG00000165105	ENST00000376447	T	0.60797	0.16	5.05	-4.07	0.03975	.	0.378995	0.27640	N	0.018471	T	0.26774	0.0655	N	0.12746	0.255	0.20563	N	0.999889	B	0.09022	0.002	B	0.04013	0.001	T	0.36138	-0.9760	10	0.05721	T	0.95	.	9.4599	0.38778	0.2492:0.0:0.6328:0.118	.	722	Q8IZ41	RASEF_HUMAN	K	722	ENSP00000365630:N722K	ENSP00000365630:N722K	N	-	3	2	RASEF	84787469	0.953000	0.32496	0.062000	0.19696	0.834000	0.47266	0.266000	0.18534	-0.671000	0.05274	-0.353000	0.07706	AAT	.		0.433	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
PAPPA	5069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	118969850	118969850	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr9:118969850C>T	ENST00000328252.3	+	3	1963	c.1594C>T	c.(1594-1596)Cca>Tca	p.P532S	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	532	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						AGCAACTTGGCCATGGGACAA	0.433																																					p.P532S		.											.	PAPPA-77	0			c.C1594T						.						72.0	68.0	69.0					9																	118969850		2203	4300	6503	SO:0001583	missense	5069	exon3			ACTTGGCCATGGG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1594C>T	9.37:g.118969850C>T	ENSP00000330658:p.Pro532Ser	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	74	23	NM_002581	0	0	0	0	0	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	35	5.509017	0.96386	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.05258	3.47	6.07	6.07	0.98685	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.44030	0.1274	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61826	-0.6983	10	0.87932	D	0	-9.2416	20.6439	0.99570	0.0:1.0:0.0:0.0	.	74;532	E7EMD3;Q13219	.;PAPP1_HUMAN	S	532;74	ENSP00000330658:P532S	ENSP00000330658:P532S	P	+	1	0	PAPPA	118009671	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.786000	0.85741	2.884000	0.98904	0.655000	0.94253	CCA	.		0.433	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
ASTN2	23245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	119495750	119495750	+	Missense_Mutation	SNP	T	T	A	rs150944935	byFrequency	TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr9:119495750T>A	ENST00000313400.4	-	14	2549	c.2449A>T	c.(2449-2451)Atc>Ttc	p.I817F	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.I813F|ASTN2_ENST00000361209.2_Missense_Mutation_p.I766F			O75129	ASTN2_HUMAN	astrotactin 2	817					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GGCAGCGGGATCACCAACAGC	0.602																																					p.I766F		.											.	ASTN2-161	0			c.A2296T						.						73.0	78.0	76.0					9																	119495750		2203	4300	6503	SO:0001583	missense	23245	exon13			GCGGGATCACCAA	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.2449A>T	9.37:g.119495750T>A	ENSP00000314038:p.Ile817Phe	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	165	16	NM_014010	0	0	1	1	0	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	T	19.46	3.831645	0.71258	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.15372	2.75;2.74;2.43;2.77	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.21801	0.0525	N	0.14661	0.345	0.80722	D	1	D;D;D	0.71674	0.991;0.998;0.978	P;P;P	0.61874	0.791;0.895;0.877	T	0.08351	-1.0726	9	.	.	.	-20.5951	14.7786	0.69749	0.0:0.0:0.0:1.0	.	766;817;813	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	F	817;813;540;766	ENSP00000314038:I817F;ENSP00000363108:I813F;ENSP00000363098:I540F;ENSP00000354504:I766F	.	I	-	1	0	ASTN2	118535571	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.962000	0.87912	1.890000	0.54733	0.459000	0.35465	ATC	T|1.000;C|0.000		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
AMER1	139285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	63412033	63412033	+	Silent	SNP	A	A	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chrX:63412033A>G	ENST00000330258.3	-	2	1406	c.1134T>C	c.(1132-1134)gaT>gaC	p.D378D	AMER1_ENST00000374869.3_Silent_p.D378D|AMER1_ENST00000403336.1_Silent_p.D378D	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	378	Glu-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									cctcctcGTCATCATCATCTG	0.522																																					p.D378D		.											.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.T1134C						.						153.0	142.0	146.0					X																	63412033		2203	4300	6503	SO:0001819	synonymous_variant	139285	exon2			CTCGTCATCATCA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1134T>C	X.37:g.63412033A>G		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	85	7	NM_152424	0	0	1	1	0	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2																																																																																			.		0.522	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
TRMT112	51504	hgsc.bcm.edu;broad.mit.edu	37	11	64084953	64084953	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr11:64084953delC	ENST00000544844.1	-	1	603	c.46delG	c.(46-48)gtgfs	p.V16fs	TRMT112_ENST00000535750.1_5'UTR|PRDX5_ENST00000265462.4_5'Flank|PRDX5_ENST00000352435.4_5'Flank|TRMT112_ENST00000308774.2_Frame_Shift_Del_p.V16fs|PRDX5_ENST00000347941.4_5'Flank|TRMT112_ENST00000539854.1_Frame_Shift_Del_p.V16fs|TRMT112_ENST00000535126.1_Frame_Shift_Del_p.G4fs			Q9UI30	TR112_HUMAN	tRNA methyltransferase 11-2 homolog (S. cerevisiae)	16	TRM112.				peptidyl-glutamine methylation (GO:0018364)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protein methyltransferase activity (GO:0008276)			large_intestine(1)|upper_aerodigestive_tract(1)	2						CGGGACCCCACCCCCCGCACA	0.657																																					p.V16fs		.											.	TRMT112-90	0			c.46delG						.						22.0	22.0	22.0					11																	64084953		2200	4294	6494	SO:0001589	frameshift_variant	51504	exon1			.	AF110774	CCDS8068.1, CCDS66113.1, CCDS73312.1	11q13.1	2013-07-23			ENSG00000173113	ENSG00000173113			26940	protein-coding gene	gene with protein product						11042152	Standard	NM_001286082		Approved	HSPC152, HSPC170, TRM112, TRMT11-2	uc001nzt.3	Q9UI30	OTTHUMG00000167848	ENST00000544844.1:c.46delG	11.37:g.64084953delC	ENSP00000438349:p.Val16fs	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	34	11	NM_016404	0	0	0	0	0	B2R539|J3KNG5|Q3MHC7|Q8N2Z4	Frame_Shift_Del	DEL	ENST00000544844.1	37	CCDS8068.1																																																																																			.		0.657	TRMT112-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396598.2	NM_016404	
FOXO1	2308	broad.mit.edu	37	13	41134463	41134467	+	Frame_Shift_Del	DEL	CAGTT	CAGTT	-	rs199719831		TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	CAGTT	CAGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr13:41134463_41134467delCAGTT	ENST00000379561.5	-	2	1545_1549	c.1161_1165delAACTG	c.(1159-1167)ttaactgttfs	p.LTV387fs	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	387	Required for interaction with RUNX2. {ECO:0000250}.|Sufficient for interaction with NLK. {ECO:0000250}.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)		PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		TGGGTCGAAACAGTTAATGATGTTG	0.473																																					p.387_389del													.	FOXO1-1295	0			c.1161_1165del						.																																			SO:0001589	frameshift_variant	2308	exon2			TCGAAACAGTTAA		CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.1161_1165delAACTG	13.37:g.41134463_41134467delCAGTT	ENSP00000368880:p.Leu387fs	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	130	7	NM_002015	0	0	0	0	0	O43523|Q5VYC7|Q6NSK6	Frame_Shift_Del	DEL	ENST00000379561.5	37	CCDS9371.1																																																																																			.		0.473	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3	NM_002015	
FOXO1	2308	hgsc.bcm.edu	37	13	41134463	41134471	+	In_Frame_Del	DEL	CAGTTAATG	CAGTTAATG	-	rs199719831		TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	CAGTTAATG	CAGTTAATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr13:41134463_41134471delCAGTTAATG	ENST00000379561.5	-	2	1541_1549	c.1157_1165delCATTAACTG	c.(1156-1167)tcattaactgtt>ttt	p.386_389SLTV>F	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	386	Required for interaction with RUNX2. {ECO:0000250}.|Sufficient for interaction with NLK. {ECO:0000250}.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)		PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		TGGGTCGAAACAGTTAATGATGTTGGTGA	0.474																																					p.386_389del		.											.	FOXO1-1295	0			c.1157_1165del						.																																			SO:0001651	inframe_deletion	2308	exon2			.		CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.1157_1165delCATTAACTG	13.37:g.41134463_41134471delCAGTTAATG	ENSP00000368880:p.Ser386_Val389delinsPhe	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	142	35	NM_002015	0	0	0	0	0	O43523|Q5VYC7|Q6NSK6	In_Frame_Del	DEL	ENST00000379561.5	37	CCDS9371.1																																																																																			.		0.474	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3	NM_002015	
NID2	22795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	52474565	52474565	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr14:52474565delA	ENST00000216286.5	-	19	3842	c.3843delT	c.(3841-3843)tttfs	p.F1281fs	NID2_ENST00000541773.1_Frame_Shift_Del_p.F1180fs	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	1281					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					agaaagggtcaaaggttaagc	0.403																																					p.F1281fs		.											.	NID2-158	0			c.3843delT						.						126.0	116.0	120.0					14																	52474565		2203	4300	6503	SO:0001589	frameshift_variant	22795	exon19			.	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.3843delT	14.37:g.52474565delA	ENSP00000216286:p.Phe1281fs	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	61	21	NM_007361	0	0	0	0	0	A8K6I7|B4DU19|O43710	Frame_Shift_Del	DEL	ENST00000216286.5	37	CCDS9706.1																																																																																			.		0.403	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
RBL2	5934	broad.mit.edu	37	16	53468508	53468508	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr16:53468508delC	ENST00000262133.6	+	1	177	c.40delC	c.(40-42)cccfs	p.P16fs		NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	16	Poly-Pro.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCCCCCGCCTCCCCCTCCGGC	0.746																																					p.P14fs													.	RBL2-841	0			c.40delC						.																																			SO:0001589	frameshift_variant	5934	exon1			CCGCCTCCCCCTC	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.40delC	16.37:g.53468508delC	ENSP00000262133:p.Pro16fs	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	12	4	NM_005611	0	0	0	0	0	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Frame_Shift_Del	DEL	ENST00000262133.6	37	CCDS10748.1																																																																																			.		0.746	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
LRBA	987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	151827549	151827549	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr4:151827549delA	ENST00000357115.3	-	12	1745	c.1502delT	c.(1501-1503)ttgfs	p.L502fs	LRBA_ENST00000510413.1_Frame_Shift_Del_p.L502fs|LRBA_ENST00000535741.1_Frame_Shift_Del_p.L502fs|LRBA_ENST00000507224.1_Frame_Shift_Del_p.L502fs	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	502						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AAAGGCCAGCAAGGTTGAACT	0.333																																					p.L501fs		.											.	LRBA-157	0			c.1502delT						.						85.0	89.0	88.0					4																	151827549		2203	4300	6503	SO:0001589	frameshift_variant	987	exon12			.	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1502delT	4.37:g.151827549delA	ENSP00000349629:p.Leu502fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	120	36	NM_006726	0	0	0	0	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Frame_Shift_Del	DEL	ENST00000357115.3	37	CCDS3773.1																																																																																			.		0.333	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
HOXA5	3202	broad.mit.edu	37	7	27182960	27182966	+	Frame_Shift_Del	DEL	CGGCTGG	CGGCTGG	-			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	CGGCTGG	CGGCTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr7:27182960_27182966delCGGCTGG	ENST00000222726.3	-	1	321_327	c.261_267delCCAGCCG	c.(259-267)agccagccgfs	p.SQP87fs	HOXA-AS3_ENST00000518848.1_RNA|HOXA5_ENST00000520854.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000521197.1_RNA	NM_019102.3	NP_061975.2	P20719	HXA5_HUMAN	homeobox A5	87					anterior/posterior pattern specification (GO:0009952)|bronchiole development (GO:0060435)|cell migration (GO:0016477)|cell-cell signaling involved in mammary gland development (GO:0060764)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|intestinal epithelial cell maturation (GO:0060574)|lung alveolus development (GO:0048286)|lung goblet cell differentiation (GO:0060480)|lung-associated mesenchyme development (GO:0060484)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal-epithelial cell signaling (GO:0060638)|multicellular organism growth (GO:0035264)|negative regulation of angiogenesis (GO:0016525)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of apoptotic process (GO:0043065)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|respiratory system process (GO:0003016)|thyroid gland development (GO:0030878)|trachea cartilage morphogenesis (GO:0060535)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(12)|skin(1)	16						TGGACGTGGCCGGCTGGCTGTACCTGG	0.744																																					p.87_89del	Colon(119;75 2200 7557 42868)												.	HOXA5-514	0			c.261_267del						.																																			SO:0001589	frameshift_variant	3202	exon1			CGTGGCCGGCTGG		CCDS5406.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106004	ENSG00000106004		"""Homeoboxes / ANTP class : HOXL subclass"""	5106	protein-coding gene	gene with protein product		142952	"""homeo box A5"""	HOX1C, HOX1		1973146, 1358459	Standard	NM_019102		Approved		uc003syn.2	P20719	OTTHUMG00000023214	ENST00000222726.3:c.261_267delCCAGCCG	7.37:g.27182960_27182966delCGGCTGG	ENSP00000222726:p.Ser87fs	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	29	8	NM_019102	0	0	0	0	0	A4D179|O43367|Q96CY6	Frame_Shift_Del	DEL	ENST00000222726.3	37	CCDS5406.1																																																																																			.		0.744	HOXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358705.1		
CDH17	1015	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	95158391	95158391	+	Frame_Shift_Del	DEL	C	C	-	rs537643053	byFrequency	TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr8:95158391delC	ENST00000027335.3	-	15	2056	c.1932delG	c.(1930-1932)gggfs	p.G644fs	CDH17_ENST00000441892.2_Frame_Shift_Del_p.G430fs|CDH17_ENST00000450165.2_Frame_Shift_Del_p.G644fs	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TCAAGGAAGACCCCCCTAAGG	0.438																																					p.G644fs		.											.	CDH17-96	0			c.1932delG						.						80.0	74.0	76.0					8																	95158391		2203	4300	6503	SO:0001589	frameshift_variant	1015	exon15			.	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1932delG	8.37:g.95158391delC	ENSP00000027335:p.Gly644fs	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	76	24	NM_004063	0	0	0	0	0	Q15336|Q2M2E0	Frame_Shift_Del	DEL	ENST00000027335.3	37	CCDS6260.1																																																																																			.		0.438	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
GPRASP1	9737	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	101912417	101912418	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chrX:101912417_101912418delTC	ENST00000361600.5	+	5	4377_4378	c.3576_3577delTC	c.(3574-3579)attcgafs	p.IR1192fs	GPRASP1_ENST00000444152.1_Frame_Shift_Del_p.IR1192fs|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Frame_Shift_Del_p.IR1192fs|GPRASP1_ENST00000415986.1_Frame_Shift_Del_p.IR1192fs	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1192	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GAGATTTCATTCGAGATTCAGG	0.371																																					p.1192_1193del		.											.	GPRASP1-131	0			c.3576_3577del						.																																			SO:0001589	frameshift_variant	9737	exon3			.	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3576_3577delTC	X.37:g.101912417_101912418delTC	ENSP00000355146:p.Ile1192fs	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	69	52	NM_001099411	0	0	0	0	0	O43168|Q96LA1	Frame_Shift_Del	DEL	ENST00000361600.5	37	CCDS35352.1																																																																																			.		0.371	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
PPP1R9B	84687	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	48226606	48226607	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr17:48226606_48226607insG	ENST00000316878.6	-	3	1268_1269	c.1266_1267insC	c.(1264-1269)ccctacfs	p.Y423fs	PPP1R9B_ENST00000501501.2_5'UTR	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	423	Interacts with protein phosphatase 1. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						TCGGGCTCGTAGGGGGGCTCCC	0.678																																					.		.											.	PPP1R9B-90	0			.						.																																			SO:0001589	frameshift_variant	84687	.			.	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.1267dupC	17.37:g.48226612_48226612dupG	ENSP00000475417:p.Tyr423fs	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	58	16	.	0	0	0	0	0	Q8TCR9	Targeted_Region	INS	ENST00000316878.6	37																																																																																				.		0.678	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032595	
SETD2	29072	hgsc.bcm.edu;bcgsc.ca	37	3	47164376	47164377	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7058-01A-11D-1961-08	TCGA-BQ-7058-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	041f174c-a781-487c-9e56-c867fb4aecfc	bd3d0c3b-1fb5-4164-96a9-7764d25ea84d	g.chr3:47164376_47164377insT	ENST00000409792.3	-	3	1791_1792	c.1749_1750insA	c.(1747-1752)aaacagfs	p.Q584fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	584					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GAATGAGACTGTTTGATTTCTT	0.332			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.Q584fs		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.1750_1751insA						.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1750dupA	3.37:g.47164379_47164379dupT	ENSP00000386759:p.Gln584fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	95	44	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.332	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
