#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA2013	90231	hgsc.bcm.edu	37	1	11986231	11986231	+	Missense_Mutation	SNP	G	G	A	rs552116013	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:11986231G>A	ENST00000376572.3	-	1	249	c.64C>T	c.(64-66)Ctc>Ttc	p.L22F	KIAA2013_ENST00000376576.3_Missense_Mutation_p.L22F	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	22						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCAGAGGAGGCGGCGGGCC	0.771													G|||	26	0.00519169	0.0166	0.0043	5008	,	,		4617	0.0		0.001	False		,,,				2504	0.0				p.L22F		.											.	KIAA2013-91	0			c.C64T						.						1.0	1.0	1.0					1																	11986231		852	2025	2877	SO:0001583	missense	90231	exon1			AGAGGAGGCGGCG	AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.64C>T	1.37:g.11986231G>A	ENSP00000365756:p.Leu22Phe	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_138346	0	0	0	0	0	Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Missense_Mutation	SNP	ENST00000376572.3	37	CCDS141.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691701	0.68271	.	.	ENSG00000116685	ENST00000376572;ENST00000376576	.	.	.	2.55	1.47	0.22746	.	0.221922	0.29040	U	0.013323	T	0.31638	0.0803	N	0.14661	0.345	0.29766	N	0.835158	D;P	0.61080	0.989;0.954	P;P	0.59487	0.858;0.812	T	0.08659	-1.0711	9	0.46703	T	0.11	-19.9466	7.5843	0.27982	0.0:0.4455:0.5544:0.0	.	22;22	Q8IYS2-2;Q8IYS2	.;K2013_HUMAN	F	22	.	ENSP00000365756:L22F	L	-	1	0	KIAA2013	11908818	0.998000	0.40836	0.999000	0.59377	0.991000	0.79684	0.719000	0.25881	1.409000	0.46915	0.563000	0.77884	CTC	.		0.771	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006858.1	NM_138346	
UBXN11	91544	hgsc.bcm.edu	37	1	26608861	26608861	+	Missense_Mutation	SNP	C	C	T	rs200313935		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:26608861C>T	ENST00000374222.1	-	16	1956	c.1492G>A	c.(1492-1494)Ggt>Agt	p.G498S	UBXN11_ENST00000374217.2_Missense_Mutation_p.G465S|UBXN11_ENST00000314675.7_Missense_Mutation_p.G378S|UBXN11_ENST00000374221.3_Missense_Mutation_p.G498S|UBXN11_ENST00000374223.1_Missense_Mutation_p.G255S|UBXN11_ENST00000357089.4_Missense_Mutation_p.G465S			Q5T124	UBX11_HUMAN	UBX domain protein 11	498	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gggccgggaccgggaccggga	0.726																																					p.G498S		.											.	UBXN11-91	1	Deletion - In frame(1)	ovary(1)	c.G1492A						.						23.0	26.0	25.0					1																	26608861		1731	3974	5705	SO:0001583	missense	91544	exon16			CGGGACCGGGACC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1492G>A	1.37:g.26608861C>T	ENSP00000363339:p.Gly498Ser	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	32	18	NM_183008	0	0	0	0	0	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	26	0.011904761904761904	24	0.04878048780487805	2	0.0055248618784530384	0	0.0	0	0.0	C	10.29	1.310153	0.23821	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.17370	2.28;2.29;2.59;2.56;2.56;2.59	.	.	.	.	.	.	.	.	T	0.01061	0.0035	N	0.08118	0	0.20074	N	0.999939	D;D;D;D	0.65815	0.995;0.995;0.995;0.991	B;B;B;B	0.40901	0.343;0.343;0.343;0.185	T	0.29274	-1.0017	8	0.56958	D	0.05	.	5.9752	0.19375	0.0:1.0:0.0:0.0	.	465;460;378;498	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	S	378;255;465;498;498;465	ENSP00000324721:G378S;ENSP00000363340:G255S;ENSP00000349601:G465S;ENSP00000363338:G498S;ENSP00000363339:G498S;ENSP00000363334:G465S	ENSP00000324721:G378S	G	-	1	0	UBXN11	26481448	0.000000	0.05858	0.143000	0.22291	0.150000	0.21749	-1.043000	0.03535	-0.000000	0.14550	0.000000	0.15137	GGT	C|0.988;T|0.012		0.726	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
UBXN11	91544	hgsc.bcm.edu	37	1	26608865	26608865	+	Silent	SNP	A	A	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:26608865A>G	ENST00000374222.1	-	16	1952	c.1488T>C	c.(1486-1488)ggT>ggC	p.G496G	UBXN11_ENST00000374217.2_Silent_p.G463G|UBXN11_ENST00000314675.7_Silent_p.G376G|UBXN11_ENST00000374221.3_Silent_p.G496G|UBXN11_ENST00000374223.1_Silent_p.G253G|UBXN11_ENST00000357089.4_Silent_p.G463G			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						cgggaccgggaccgggactgg	0.721																																					p.G496G		.											.	UBXN11-91	1	Deletion - In frame(1)	ovary(1)	c.T1488C						.						25.0	29.0	28.0					1																	26608865		1768	4016	5784	SO:0001819	synonymous_variant	91544	exon16			ACCGGGACCGGGA	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1488T>C	1.37:g.26608865A>G		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	32	18	NM_183008	0	0	0	0	0	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Silent	SNP	ENST00000374222.1	37	CCDS41288.1																																																																																			.		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
LAPTM5	7805	broad.mit.edu	37	1	31208088	31208088	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:31208088G>A	ENST00000294507.3	-	7	705	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W		NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	211					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		CTGTAGCACCGCCACACGCAC	0.557																																					p.R211W													.	LAPTM5-226	0			c.C631T						.						253.0	221.0	232.0					1																	31208088		2203	4300	6503	SO:0001583	missense	7805	exon7			AGCACCGCCACAC	U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.631C>T	1.37:g.31208088G>A	ENSP00000294507:p.Arg211Trp	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	99	5	NM_006762	0	0	31	31	0	Q13240|Q14698|Q3KP54	Missense_Mutation	SNP	ENST00000294507.3	37	CCDS337.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368200	0.61513	.	.	ENSG00000162511	ENST00000294507;ENST00000424259	T	0.47528	0.84	5.81	0.658	0.17855	.	0.132879	0.51477	D	0.000082	T	0.62429	0.2427	M	0.67953	2.075	0.28772	N	0.900296	D	0.89917	1.0	D	0.68192	0.956	T	0.62506	-0.6840	10	0.72032	D	0.01	-10.4451	13.2343	0.59961	0.0:0.0:0.5902:0.4098	.	211	Q13571	LAPM5_HUMAN	W	211	ENSP00000294507:R211W	ENSP00000294507:R211W	R	-	1	2	LAPTM5	30980675	0.992000	0.36948	0.993000	0.49108	0.621000	0.37620	0.431000	0.21444	-0.131000	0.11578	-0.262000	0.10625	CGG	.		0.557	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010463.1	NM_006762	
ECHDC2	55268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	53362195	53362195	+	Silent	SNP	T	T	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:53362195T>C	ENST00000371522.4	-	10	969	c.876A>G	c.(874-876)aaA>aaG	p.K292K	ECHDC2_ENST00000536120.1_Silent_p.K246K|ECHDC2_ENST00000358358.5_Silent_p.K261K	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	292					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						ATGGGGGTCATTTGCCAACAA	0.488																																					p.K292K		.											.	ECHDC2-90	0			c.A876G						.						71.0	73.0	72.0					1																	53362195		2203	4300	6503	SO:0001819	synonymous_variant	55268	exon10			GGGTCATTTGCCA	AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.876A>G	1.37:g.53362195T>C		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	49	13	NM_001198961	0	0	17	32	15	D3DQ36|Q9NV38	Silent	SNP	ENST00000371522.4	37	CCDS55600.1																																																																																			.		0.488	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024712.3	NM_018281	
RNF2	6045	broad.mit.edu	37	1	185060812	185060812	+	Silent	SNP	T	T	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:185060812T>C	ENST00000367510.3	+	3	477	c.189T>C	c.(187-189)acT>acC	p.T63T	RNF2_ENST00000367509.4_Silent_p.T63T	NM_007212.3	NP_009143.1	Q99496	RING2_HUMAN	ring finger protein 2	63	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|large_intestine(4)|lung(3)|skin(2)	14		Breast(1374;0.000496)		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)		ACACCATGACTACAAAGGAGT	0.383																																					p.T63T													.	RNF2-658	0			c.T189C						.						203.0	182.0	189.0					1																	185060812		2203	4300	6503	SO:0001819	synonymous_variant	6045	exon3			CATGACTACAAAG	BC012583, Y10571	CCDS1365.1	1q25.3	2013-01-09			ENSG00000121481	ENSG00000121481		"""RING-type (C3HC4) zinc fingers"""	10061	protein-coding gene	gene with protein product		608985				11513855	Standard	XM_005245413		Approved	BAP-1, BAP1, DING, HIPI3, RING1B, RING2	uc001grc.1	Q99496	OTTHUMG00000035391	ENST00000367510.3:c.189T>C	1.37:g.185060812T>C		Somatic	163	0		WXS	Illumina HiSeq	Phase_I	151	3	NM_007212	0	0	1	1	0	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Silent	SNP	ENST00000367510.3	37	CCDS1365.1																																																																																			.		0.383	RNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085793.1	NM_007212	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	216262462	216262462	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:216262462G>T	ENST00000307340.3	-	23	5164	c.4778C>A	c.(4777-4779)aCt>aAt	p.T1593N	RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.T1593N|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1593	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTAGTTGTAGTTACTTCCAC	0.333										HNSCC(13;0.011)																											p.T1593N		.											.	USH2A-115	0			c.C4778A						.						184.0	168.0	173.0					1																	216262462		2203	4300	6503	SO:0001583	missense	7399	exon23			GTTGTAGTTACTT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4778C>A	1.37:g.216262462G>T	ENSP00000305941:p.Thr1593Asn	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	52	18	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336688	0.60963	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.80304	-1.36;-1.36	5.8	4.88	0.63580	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.45361	D	0.000370	D	0.87006	0.6070	M	0.73962	2.25	0.38859	D	0.95643	D	0.61080	0.989	P	0.58780	0.845	D	0.87966	0.2733	10	0.41790	T	0.15	.	15.1749	0.72903	0.0:0.2669:0.7331:0.0	.	1593	O75445	USH2A_HUMAN	N	1593	ENSP00000305941:T1593N;ENSP00000355910:T1593N	ENSP00000305941:T1593N	T	-	2	0	USH2A	214329085	1.000000	0.71417	0.699000	0.30290	0.787000	0.44495	5.826000	0.69293	1.417000	0.47077	0.655000	0.94253	ACT	.		0.333	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	237730023	237730023	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:237730023C>G	ENST00000366574.2	+	28	3688	c.3371C>G	c.(3370-3372)cCg>cGg	p.P1124R	RYR2_ENST00000360064.6_Missense_Mutation_p.P1122R|RYR2_ENST00000542537.1_Missense_Mutation_p.P1108R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1124	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGTTGTCAACCGGATCAGGAG	0.532																																					p.P1124R		.											.	RYR2-158	0			c.C3371G						.						218.0	216.0	217.0					1																	237730023		2066	4209	6275	SO:0001583	missense	6262	exon28			GTCAACCGGATCA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3371C>G	1.37:g.237730023C>G	ENSP00000355533:p.Pro1124Arg	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	185	48	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966699	0.74131	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.55588	0.51;0.51;0.51	5.29	5.29	0.74685	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000008	T	0.72558	0.3475	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.75814	-0.3185	10	0.87932	D	0	.	18.9442	0.92615	0.0:1.0:0.0:0.0	.	1124	Q92736	RYR2_HUMAN	R	1124;1122;1108	ENSP00000355533:P1124R;ENSP00000353174:P1122R;ENSP00000443798:P1108R	ENSP00000353174:P1122R	P	+	2	0	RYR2	235796646	1.000000	0.71417	0.114000	0.21550	0.563000	0.35712	7.814000	0.86154	2.465000	0.83290	0.655000	0.94253	CCG	.		0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
GAD2	2572	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	26506915	26506915	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr10:26506915C>T	ENST00000376261.3	+	3	784	c.281C>T	c.(280-282)gCa>gTa	p.A94V	GAD2_ENST00000376248.1_5'Flank|GAD2_ENST00000259271.3_Missense_Mutation_p.A94V	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	94					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTTCTCCATGCAACAGGTAAA	0.721																																					p.A94V		.											.	GAD2-515	0			c.C281T						.						27.0	36.0	33.0					10																	26506915		2200	4295	6495	SO:0001583	missense	2572	exon3			TCCATGCAACAGG	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.281C>T	10.37:g.26506915C>T	ENSP00000365437:p.Ala94Val	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	195	54	NM_000818	0	0	0	0	0	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996975	0.54147	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000428517	T;T;T	0.59638	0.25;0.25;0.25	5.84	4.88	0.63580	.	0.414814	0.27068	N	0.021100	T	0.51398	0.1672	L	0.54323	1.7	0.80722	D	1	P;B	0.39480	0.675;0.048	B;B	0.32864	0.154;0.016	T	0.59289	-0.7482	10	0.56958	D	0.05	-3.897	16.0867	0.81060	0.0:0.866:0.134:0.0	.	94;94	Q4G154;Q05329	.;DCE2_HUMAN	V	94	ENSP00000365437:A94V;ENSP00000259271:A94V;ENSP00000390434:A94V	ENSP00000259271:A94V	A	+	2	0	GAD2	26546921	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	4.858000	0.62947	2.768000	0.95171	0.561000	0.74099	GCA	.		0.721	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
KIF5B	3799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	32326205	32326205	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr10:32326205C>A	ENST00000302418.4	-	8	1145	c.688G>T	c.(688-690)Gtt>Ttt	p.V230F		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	230	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				GCTAAATCAACCAGATAAAGT	0.338			T	"""RET, ALK"""	NSCLC																																p.V230F		.		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	.	KIF5B-399	0			c.G688T						.						127.0	110.0	116.0					10																	32326205		2202	4298	6500	SO:0001583	missense	3799	exon8			AATCAACCAGATA	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.688G>T	10.37:g.32326205C>A	ENSP00000307078:p.Val230Phe	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	77	10	NM_004521	0	0	4	5	1	A0AVB2|Q5VZ85	Missense_Mutation	SNP	ENST00000302418.4	37	CCDS7171.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891963	0.91889	.	.	ENSG00000170759	ENST00000302418	D	0.83335	-1.71	5.0	5.0	0.66597	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.062994	0.64402	D	0.000007	D	0.95404	0.8508	H	0.99299	4.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97679	1.0171	10	0.87932	D	0	.	18.6607	0.91471	0.0:1.0:0.0:0.0	.	230	P33176	KINH_HUMAN	F	230	ENSP00000307078:V230F	ENSP00000307078:V230F	V	-	1	0	KIF5B	32366211	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.811000	0.86092	2.449000	0.82847	0.557000	0.71058	GTT	.		0.338	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	49983779	49983779	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr10:49983779C>T	ENST00000325239.5	+	14	2818	c.2791C>T	c.(2791-2793)Ccc>Tcc	p.P931S	WDFY4_ENST00000413659.2_Missense_Mutation_p.P931S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	931						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TCTTGGAATTCCCTCATCTCT	0.453																																					p.P931S		.											.	WDFY4-22	0			c.C2791T						.						185.0	156.0	165.0					10																	49983779		692	1591	2283	SO:0001583	missense	57705	exon15			GGAATTCCCTCAT	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2791C>T	10.37:g.49983779C>T	ENSP00000320563:p.Pro931Ser	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	92	30	NM_020945	0	0	0	0	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.81|14.81	2.645807|2.645807	0.47258|0.47258	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659|ENST00000312002	T;T|.	0.66815|.	-0.23;-0.23|.	4.51|4.51	-2.44|-2.44	0.06502|0.06502	.|.	.|.	.|.	.|.	.|.	T|T	0.52693|0.52693	0.1750|0.1750	M|M	0.70595|0.70595	2.14|2.14	0.09310|0.09310	N|N	1|1	B|.	0.20780|.	0.048|.	B|.	0.20577|.	0.03|.	T|T	0.54616|0.54616	-0.8267|-0.8267	8|5	.|.	.|.	.|.	.|.	11.8647|11.8647	0.52486|0.52486	0.0:0.2247:0.6889:0.0864|0.0:0.2247:0.6889:0.0864	.|.	931|.	Q6ZS81|.	WDFY4_HUMAN|.	S|F	940;931;931;931|21	ENSP00000320563:P931S;ENSP00000403789:P931S|.	.|.	P|S	+|+	1|2	0|0	WDFY4|WDFY4	49653785|49653785	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.855000|0.855000	0.48748|0.48748	-0.810000|-0.810000	0.04505|0.04505	-0.324000|-0.324000	0.08589|0.08589	-0.121000|-0.121000	0.15023|0.15023	CCC|TCC	.		0.453	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
MUC2	4583	bcgsc.ca	37	11	1093050	1093050	+	Silent	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:1093050C>A	ENST00000441003.2	+	30	4896	c.4869C>A	c.(4867-4869)ggC>ggA	p.G1623G	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cacccactggcacacagaccc	0.632																																					p.G1623G													.	MUC2-90	0			c.C4869A						.						129.0	166.0	153.0					11																	1093050		1883	3610	5493	SO:0001819	synonymous_variant	4583	exon30			CACTGGCACACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4869C>A	11.37:g.1093050C>A		Somatic	79	1		WXS	Illumina HiSeq	Phase_1	88	7	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093061	1093061	+	Missense_Mutation	SNP	C	C	T	rs111210454		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:1093061C>T	ENST00000441003.2	+	30	4907	c.4880C>T	c.(4879-4881)cCa>cTa	p.P1627L	MUC2_ENST00000359061.5_Missense_Mutation_p.P1594L|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acacagaccccaaccccaaca	0.632																																					p.P1627L													.	MUC2-90	0			c.C4880T						.						128.0	165.0	153.0					11																	1093061		1874	3606	5480	SO:0001583	missense	4583	exon30			AGACCCCAACCCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4880C>T	11.37:g.1093061C>T	ENSP00000415183:p.Pro1627Leu	Somatic	86	1		WXS	Illumina HiSeq	Phase_1	90	7	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	6.096	0.386050	0.11524	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13657	2.57;2.97	1.61	1.61	0.23674	.	13.230700	0.00633	U	0.000492	T	0.09774	0.0240	.	.	.	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.22906	-1.0203	9	0.27785	T	0.31	.	6.7045	0.23242	0.0:1.0:0.0:0.0	.	1627	E7EUV1	.	L	1627;1594	ENSP00000415183:P1627L;ENSP00000351956:P1594L	ENSP00000351956:P1594L	P	+	2	0	MUC2	1083061	0.000000	0.05858	0.009000	0.14445	0.048000	0.14542	0.279000	0.18771	0.910000	0.36722	0.121000	0.15741	CCA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	broad.mit.edu	37	11	1093204	1093204	+	Missense_Mutation	SNP	C	C	A	rs56299570		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:1093204C>A	ENST00000441003.2	+	30	5050	c.5023C>A	c.(5023-5025)Cca>Aca	p.P1675T	MUC2_ENST00000359061.5_Missense_Mutation_p.P1642T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1675T(1)|p.P1642T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gtccccaaccccaacagccat	0.627																																					p.P1675T													.	MUC2-90	2	Substitution - Missense(2)	kidney(2)	c.C5023A						.																																			SO:0001583	missense	4583	exon30			CCAACCCCAACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5023C>A	11.37:g.1093204C>A	ENSP00000415183:p.Pro1675Thr	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	55	5	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.954	-0.705464	0.03255	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.09073	3.02;3.53	1.75	-3.49	0.04724	.	0.575351	0.10542	U	0.662513	T	0.04092	0.0114	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45381	-0.9265	9	0.16896	T	0.51	.	6.9769	0.24681	0.6778:0.3222:0.0:0.0	rs56299570	1675	E7EUV1	.	T	1675;1642	ENSP00000415183:P1675T;ENSP00000351956:P1642T	ENSP00000351956:P1642T	P	+	1	0	MUC2	1083204	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.268000	0.00533	-1.450000	0.01936	0.184000	0.17185	CCA	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	96	6	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
STIM1	6786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4104179	4104179	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:4104179T>G	ENST00000300737.4	+	9	1774	c.1205T>G	c.(1204-1206)cTg>cGg	p.L402R	STIM1_ENST00000533977.1_Missense_Mutation_p.L229R|STIM1_ENST00000527651.1_Missense_Mutation_p.L402R	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	402	SOAR/CAD.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		AGCTCTTCCCTGGATGATGTA	0.448																																					p.L402R		.											.	STIM1-91	0			c.T1205G						.						104.0	93.0	97.0					11																	4104179		2201	4298	6499	SO:0001583	missense	6786	exon9			CTTCCCTGGATGA	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1205T>G	11.37:g.4104179T>G	ENSP00000300737:p.Leu402Arg	Somatic	365	0		WXS	Illumina HiSeq	Phase_I	324	102	NM_003156	0	0	1	1	0	E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	37	CCDS7749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.99|19.99	3.928765|3.928765	0.73327|0.73327	.|.	.|.	ENSG00000167323|ENSG00000167323	ENST00000300737;ENST00000527651;ENST00000533977|ENST00000526596	T;T;T|.	0.81330|.	-0.52;-1.48;-0.51|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73009|0.73009	0.3532|0.3532	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.69307|.	0.946;0.963|.	T|T	0.73528|0.73528	-0.3954|-0.3954	10|5	0.87932|.	D|.	0|.	-15.7324|-15.7324	14.4442|14.4442	0.67338|0.67338	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	402;402|.	E9PQJ4;Q13586|.	.;STIM1_HUMAN|.	R|G	402;402;229|133	ENSP00000300737:L402R;ENSP00000436208:L402R;ENSP00000434767:L229R|.	ENSP00000300737:L402R|.	L|W	+|+	2|1	0|0	STIM1|STIM1	4060755|4060755	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.687000|7.687000	0.84139|0.84139	2.007000|2.007000	0.58848|0.58848	0.374000|0.374000	0.22700|0.22700	CTG|TGG	.		0.448	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
PRPH	5630	hgsc.bcm.edu	37	12	49689404	49689404	+	Missense_Mutation	SNP	G	G	T	rs58599399	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr12:49689404G>T	ENST00000257860.4	+	1	1920	c.421G>T	c.(421-423)Gac>Tac	p.D141Y	RP11-161H23.9_ENST00000553259.1_RNA	NM_006262.3	NP_006253.2	P23942	PRPH2_HUMAN	peripherin	0					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(8)|skin(1)	12						GGCGCGCGCCGACCAGCTGTG	0.716													G|||	12	0.00239617	0.0	0.0029	5008	,	,		14065	0.0		0.0099	False		,,,				2504	0.0				p.D141Y		.											.	PRPH-90	0			c.G421T	GRCh37	CM044928	PRPH	M	rs58599399	.	G	TYR/ASP	2,3866		0,2,1932	3.0	4.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	421	4.7	1.0	12	dbSNP_129	3	42,7412		0,42,3685	yes	missense	PRPH	NM_006262.3	160	0,44,5617	TT,TG,GG		0.5635,0.0517,0.3886	possibly-damaging	141/471	49689404	44,11278	1934	3727	5661	SO:0001583	missense	5630	exon1			CGCGCCGACCAGC		CCDS8783.1	12q12-q13	2013-01-16						"""Intermediate filaments type III"""	9461	protein-coding gene	gene with protein product		170710		NEF4		1378416	Standard	XM_005269025		Approved	PRPH1	uc001rtu.3	P41219		ENST00000257860.4:c.421G>T	12.37:g.49689404G>T	ENSP00000257860:p.Asp141Tyr	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	99	56	NM_006262	0	0	0	0	0	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000257860.4	37	CCDS8783.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	21.9	4.223071	0.79464	5.17E-4	0.005635	ENSG00000135406	ENST00000257860	D	0.88509	-2.39	4.68	4.68	0.58851	Filament (1);	0.000000	0.42053	D	0.000774	D	0.83344	0.5234	N	0.20881	0.62	0.41388	D	0.987592	P	0.43392	0.805	P	0.54210	0.745	D	0.85943	0.1459	10	0.66056	D	0.02	.	10.2156	0.43166	0.0:0.0:0.802:0.198	rs58599399	141	P41219	PERI_HUMAN	Y	141	ENSP00000257860:D141Y	ENSP00000257860:D141Y	D	+	1	0	PRPH	47975671	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	7.738000	0.84966	2.443000	0.82685	0.462000	0.41574	GAC	G|0.999;T|0.001		0.716	PRPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393381.1	NM_006262	
GNS	2799	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	65152878	65152878	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr12:65152878A>T	ENST00000258145.3	-	1	349	c.179T>A	c.(178-180)gTg>gAg	p.V60E	RP11-629N8.3_ENST00000434563.3_RNA|GNS_ENST00000543646.1_Missense_Mutation_p.V60E|GNS_ENST00000542058.1_Missense_Mutation_p.V60E|snoU13_ENST00000458789.1_RNA	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	60					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		GCCGCCGAGCACTTCGTCCTG	0.652																																					p.V60E													.	GNS-514	0			c.T179A						.						32.0	32.0	32.0					12																	65152878		2195	4284	6479	SO:0001583	missense	2799	exon1			CCGAGCACTTCGT		CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.179T>A	12.37:g.65152878A>T	ENSP00000258145:p.Val60Glu	Somatic	159	1		WXS	Illumina HiSeq	Phase_I	229	52	NM_002076	0	0	0	0	0	B4DYH8|Q53F05	Missense_Mutation	SNP	ENST00000258145.3	37	CCDS8970.1	.	.	.	.	.	.	.	.	.	.	A	5.620	0.299140	0.10622	.	.	ENSG00000135677	ENST00000258145;ENST00000543646;ENST00000542058	D;D;D	0.98419	-4.92;-3.89;-3.89	4.48	3.3	0.37823	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.545721	0.18931	N	0.127212	D	0.92773	0.7702	N	0.10945	0.07	0.28091	N	0.931782	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.14023	0.01;0.004;0.002	D	0.85646	0.1279	9	.	.	.	-13.4349	8.0519	0.30583	0.8117:0.0:0.0:0.1883	.	60;60;60	B4DYH8;F6S8M0;P15586	.;.;GNS_HUMAN	E	60	ENSP00000258145:V60E;ENSP00000438497:V60E;ENSP00000444819:V60E	.	V	-	2	0	GNS	63439145	0.993000	0.37304	1.000000	0.80357	0.933000	0.57130	0.814000	0.27239	0.823000	0.34589	0.397000	0.26171	GTG	.		0.652	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401195.2		
TMTC2	160335	broad.mit.edu	37	12	83251082	83251082	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr12:83251082A>C	ENST00000321196.3	+	2	1084	c.377A>C	c.(376-378)cAc>cCc	p.H126P	TMTC2_ENST00000548305.1_Missense_Mutation_p.H126P|TMTC2_ENST00000549919.1_Missense_Mutation_p.H120P	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	126					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TTTGCTTCTCACCCCATTCAC	0.522																																					p.H126P													.	TMTC2-92	0			c.A377C						.						124.0	111.0	116.0					12																	83251082		2203	4300	6503	SO:0001583	missense	160335	exon2			CTTCTCACCCCAT	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.377A>C	12.37:g.83251082A>C	ENSP00000322300:p.His126Pro	Somatic	119	21		WXS	Illumina HiSeq	Phase_I	181	33	NM_152588	0	0	0	0	0	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.658613	0.67586	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	T;T;T	0.78246	-0.79;-1.16;-1.06	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.91945	0.7449	H	0.96662	3.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94358	0.7585	10	0.87932	D	0	-21.9399	14.6569	0.68838	1.0:0.0:0.0:0.0	.	126;126	Q8N394;F8VSH2	TMTC2_HUMAN;.	P	126;126;120	ENSP00000322300:H126P;ENSP00000448292:H126P;ENSP00000447609:H120P	ENSP00000322300:H126P	H	+	2	0	TMTC2	81775213	1.000000	0.71417	0.957000	0.39632	0.649000	0.38597	8.904000	0.92590	2.251000	0.74343	0.528000	0.53228	CAC	.		0.522	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
CEP290	80184	broad.mit.edu;bcgsc.ca	37	12	88471486	88471486	+	Silent	SNP	G	G	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr12:88471486G>T	ENST00000552810.1	-	40	5917	c.5574C>A	c.(5572-5574)acC>acA	p.T1858T	CEP290_ENST00000547691.2_Silent_p.T918T|CEP290_ENST00000309041.7_Silent_p.T1860T|CEP290_ENST00000397838.3_Silent_p.T918T	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1858					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GTAATCCACTGGTTAGTCTTT	0.269																																					p.T1858T													.	CEP290-96	0			c.C5574A						.						51.0	50.0	51.0					12																	88471486		1799	4036	5835	SO:0001819	synonymous_variant	80184	exon40			TCCACTGGTTAGT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.5574C>A	12.37:g.88471486G>T		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	19	4	NM_025114	0	0	0	0	0	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	ENST00000552810.1	37	CCDS55858.1																																																																																			.		0.269	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
RXFP2	122042	bcgsc.ca	37	13	32352703	32352703	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr13:32352703G>T	ENST00000298386.2	+	9	839	c.768G>T	c.(766-768)atG>atT	p.M256I	RXFP2_ENST00000380314.1_Missense_Mutation_p.M256I	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	256					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		GTGCCCAAATGCCTCAACTCA	0.328																																					p.M256I													.	RXFP2-90	0			c.G768T						.						128.0	136.0	133.0					13																	32352703		2203	4298	6501	SO:0001583	missense	122042	exon9			CCAAATGCCTCAA	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.768G>T	13.37:g.32352703G>T	ENSP00000298386:p.Met256Ile	Somatic	49	0		WXS	Illumina HiSeq	Phase_1	63	4	NM_001166058	0	0	0	0	0	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556594	0.45487	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.04502	4.29;3.61	5.49	5.49	0.81192	.	0.079417	0.85682	D	0.000000	T	0.07279	0.0184	L	0.53780	1.695	0.47698	D	0.999496	B;B	0.29590	0.25;0.25	B;B	0.29942	0.109;0.109	T	0.30851	-0.9964	10	0.27082	T	0.32	.	14.881	0.70534	0.0:0.0:1.0:0.0	.	256;256	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	I	256	ENSP00000369670:M256I;ENSP00000298386:M256I	ENSP00000298386:M256I	M	+	3	0	RXFP2	31250703	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.963000	0.63694	2.578000	0.87016	0.655000	0.94253	ATG	.		0.328	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
ZIC5	85416	hgsc.bcm.edu	37	13	100623585	100623585	+	Silent	SNP	C	C	T	rs370840169	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr13:100623585C>T	ENST00000267294.4	-	1	578	c.345G>A	c.(343-345)ccG>ccA	p.P115P		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	115	Pro-rich.				cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCGGAGCCTCCGGGTGTGCCG	0.781													c|||	6	0.00119808	0.0045	0.0	5008	,	,		6715	0.0		0.0	False		,,,				2504	0.0				p.P115P		.											.	ZIC5-90	0			c.G345A						.			21,3461		0,21,1720	3.0	3.0	3.0		345	0.0	0.2	13		3	0,6836		0,0,3418	no	coding-synonymous	ZIC5	NM_033132.3		0,21,5138	TT,TC,CC		0.0,0.6031,0.2035		115/664	100623585	21,10297	1741	3418	5159	SO:0001819	synonymous_variant	85416	exon1			AGCCTCCGGGTGT	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.345G>A	13.37:g.100623585C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	14	9	NM_033132	0	0	0	0	0	Q5VYB0	Silent	SNP	ENST00000267294.4	37	CCDS9494.2																																																																																			.		0.781	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	NM_033132	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L													.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	61	5	NM_080687	0	0	2	2	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31576342	31576342	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr14:31576342G>A	ENST00000399332.1	-	38	7224	c.6736C>T	c.(6736-6738)Cat>Tat	p.H2246Y	HECTD1_ENST00000553700.1_Missense_Mutation_p.H2246Y	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2246	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CCAAGGAAATGAAACAGTTTC	0.383																																					p.H2246Y		.											.	HECTD1-570	0			c.C6736T						.						113.0	108.0	110.0					14																	31576342		1901	4112	6013	SO:0001583	missense	25831	exon38			GGAAATGAAACAG	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6736C>T	14.37:g.31576342G>A	ENSP00000382269:p.His2246Tyr	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	161	36	NM_015382	0	0	2	4	2	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	G	3.742	-0.053467	0.07362	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332	T;T	0.56941	0.43;0.43	6.06	6.06	0.98353	HECT (4);	0.256570	0.26903	U	0.021909	T	0.31949	0.0813	N	0.11201	0.11	0.46298	D	0.99897	P	0.35208	0.49	B	0.32762	0.152	T	0.28138	-1.0053	10	0.02654	T	1	-11.499	18.8088	0.92050	0.0:0.0:1.0:0.0	.	2246	Q9ULT8	HECD1_HUMAN	Y	2246;2248;2246	ENSP00000450697:H2246Y;ENSP00000382269:H2246Y	ENSP00000261312:H2248Y	H	-	1	0	HECTD1	30646093	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.391000	0.73208	2.871000	0.98454	0.655000	0.94253	CAT	.		0.383	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
KIF7	374654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90174782	90174782	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr15:90174782T>G	ENST00000394412.3	-	15	3131	c.3055A>C	c.(3055-3057)Aag>Cag	p.K1019Q	KIF7_ENST00000558928.1_5'Flank	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1019					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			AGGCGCTGCTTGAGCAGCGAG	0.677																																					p.K1019Q		.											.	KIF7-523	0			c.A3055C						.						29.0	27.0	27.0					15																	90174782		2199	4292	6491	SO:0001583	missense	374654	exon15			GCTGCTTGAGCAG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3055A>C	15.37:g.90174782T>G	ENSP00000377934:p.Lys1019Gln	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	100	32	NM_198525	0	0	0	0	0	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	37	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.877591	0.91664	.	.	ENSG00000166813	ENST00000394412	T	0.48836	0.8	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.66577	0.2803	M	0.70275	2.135	0.54753	D	0.999983	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.67321	-0.5700	10	0.40728	T	0.16	.	14.4086	0.67101	0.0:0.0:0.0:1.0	.	505;1019	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	Q	1019	ENSP00000377934:K1019Q	ENSP00000377934:K1019Q	K	-	1	0	KIF7	87975786	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.570000	0.82390	1.802000	0.52723	0.379000	0.24179	AAG	.		0.677	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
UBALD1	124402	broad.mit.edu	37	16	4659850	4659850	+	Silent	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr16:4659850T>G	ENST00000283474.7	-	3	446	c.318A>C	c.(316-318)tcA>tcC	p.S106S	UBALD1_ENST00000587649.1_3'UTR|UBALD1_ENST00000591897.1_Silent_p.S46S|UBALD1_ENST00000590965.1_3'UTR|UBALD1_ENST00000590891.1_Silent_p.S141S|UBALD1_ENST00000587615.1_Silent_p.S81S|UBALD1_ENST00000591401.1_Silent_p.S85S	NM_145253.2	NP_660296.1	Q8TB05	UBAD1_HUMAN	UBA-like domain containing 1	106																	GTGGCGGGGGTGACGTGGCTG	0.716																																					p.S106S													.	.	0			c.A318C						.						6.0	7.0	7.0					16																	4659850		2008	3990	5998	SO:0001819	synonymous_variant	124402	exon3			CGGGGGTGACGTG	BC025327	CCDS10518.1	16p13.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000153443	ENSG00000153443			29576	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member A"""	FAM100A			Standard	NM_145253		Approved		uc002cwx.2	Q8TB05	OTTHUMG00000129472	ENST00000283474.7:c.318A>C	16.37:g.4659850T>G		Somatic	18	7		WXS	Illumina HiSeq	Phase_I	61	26	NM_145253	0	0	1	4	3	Q71MF6	Silent	SNP	ENST00000283474.7	37	CCDS10518.1																																																																																			.		0.716	UBALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251635.2	NM_145253	
PYDC1	260434	hgsc.bcm.edu	37	16	31226442	31226442	+	IGR	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr16:31226442G>A	ENST00000302964.3	-	0	813				TRIM72_ENST00000322122.3_Missense_Mutation_p.R128H|PYDC1_ENST00000568383.1_5'Flank	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1						innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GCCCACGCACGCCTCAAGGTG	0.687																																					p.R128H		.											.	TRIM72-44	0			c.G383A						.						9.0	9.0	9.0					16																	31226442		1778	3412	5190	SO:0001628	intergenic_variant	493829	exon2			ACGCACGCCTCAA		CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407		16.37:g.31226442G>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	31	19	NM_001008274	0	0	0	0	0	B2R8L4|Q8NFP8	Missense_Mutation	SNP	ENST00000302964.3	37	CCDS10710.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815564	0.70912	.	.	ENSG00000177238	ENST00000322122	T	0.57436	0.4	4.93	4.93	0.64822	.	0.080103	0.48767	D	0.000171	T	0.62441	0.2428	L	0.58101	1.795	0.34316	D	0.686018	D	0.89917	1.0	D	0.67725	0.953	T	0.65340	-0.6192	10	0.16420	T	0.52	.	10.896	0.47023	0.0887:0.0:0.9113:0.0	.	128	Q6ZMU5	TRI72_HUMAN	H	128	ENSP00000312675:R128H	ENSP00000312675:R128H	R	+	2	0	TRIM72	31133943	0.998000	0.40836	0.997000	0.53966	0.042000	0.13812	3.403000	0.52615	2.454000	0.82982	0.655000	0.94253	CGC	.		0.687	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255543.2	NM_152901	
ZDHHC7	55625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	85010785	85010785	+	Silent	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr16:85010785G>A	ENST00000313732.4	-	7	1018	c.666C>T	c.(664-666)ttC>ttT	p.F222F	ZDHHC7_ENST00000569488.1_5'UTR|ZDHHC7_ENST00000564466.1_Silent_p.F259F	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	222					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						CAAGGCACAGGAAGATCAACA	0.463																																					p.F259F		.											.	ZDHHC7-289	0			c.C777T						.						155.0	139.0	144.0					16																	85010785		2199	4300	6499	SO:0001819	synonymous_variant	55625	exon8			GCACAGGAAGATC	AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.666C>T	16.37:g.85010785G>A		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	209	45	NM_001145548	0	0	3	3	0	D3DUM1|Q8WV42|Q9NVD8	Silent	SNP	ENST00000313732.4	37	CCDS10950.1																																																																																			.		0.463	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269087.1	NM_017740	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	15	15	NM_001199417	0	0	0	0	0		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296599	39296599	+	Silent	SNP	T	T	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr17:39296599T>C	ENST00000345847.4	-	1	140	c.141A>G	c.(139-141)agA>agG	p.R47R		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	47	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						AGCACTGGGGTCTGCAGCAGC	0.682																																					p.R47R		.											.	.	0			c.A141G						.																																			SO:0001819	synonymous_variant	81871	exon1			CTGGGGTCTGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.141A>G	17.37:g.39296599T>C		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	129	11	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.		0.682	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
TIMP2	7077	broad.mit.edu	37	17	76888505	76888505	+	Intron	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr17:76888505T>G	ENST00000262768.7	-	2	429				TIMP2_ENST00000536189.2_Intron|DDC8_ENST00000322630.2_Silent_p.S27S	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			CCCCCGGGCCTGAGGAGCCAC	0.587																																					p.S27S													.	.	0			c.A81C						.																																			SO:0001627	intron_variant	0	exon3			CGGGCCTGAGGAG		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-18504A>C	17.37:g.76888505T>G		Somatic	264	8		WXS	Illumina HiSeq	Phase_I	345	28	NM_001243540	0	0	0	0	0	Q16121|Q93006|Q9UDF7	Silent	SNP	ENST00000262768.7	37	CCDS11758.1																																																																																			.		0.587	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
FSCN2	25794	hgsc.bcm.edu	37	17	79504052	79504052	+	Silent	SNP	C	C	A	rs398123553	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr17:79504052C>A	ENST00000417245.2	+	5	1561	c.1425C>A	c.(1423-1425)ggC>ggA	p.G475G	FSCN2_ENST00000334850.7_Silent_p.G499G	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	475					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GCGCCTCGGGCCTGCTGCGGG	0.726													C|||	26	0.00519169	0.0189	0.0014	5008	,	,		8785	0.0		0.0	False		,,,				2504	0.0				p.G499G		.											.	.	0			c.C1497A						.						2.0	2.0	2.0					17																	79504052		1250	2873	4123	SO:0001819	synonymous_variant	25794	exon5			CTCGGGCCTGCTG	AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.1425C>A	17.37:g.79504052C>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	8	5	NM_001077182	0	0	0	0	0	A0AVC4|A8MRA6	Silent	SNP	ENST00000417245.2	37	CCDS45811.1																																																																																			.		0.726	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394746.1	NM_012418	
ZNF567	163081	broad.mit.edu	37	19	37210687	37210687	+	Missense_Mutation	SNP	G	G	A	rs562512567		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr19:37210687G>A	ENST00000536254.2	+	6	1283	c.1061G>A	c.(1060-1062)cGt>cAt	p.R354H	ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000588311.1_Missense_Mutation_p.R323H|ZNF567_ENST00000360729.4_Missense_Mutation_p.R323H|ZNF567_ENST00000585696.1_Missense_Mutation_p.R323H|ZNF567_ENST00000392163.2_Missense_Mutation_p.R323H			Q8N184	ZN567_HUMAN	zinc finger protein 567	354					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CACCTCATTCGTCATCAGAGA	0.458																																					p.R323H													.	ZNF567-90	0			c.G968A						.						75.0	68.0	71.0					19																	37210687		2203	4300	6503	SO:0001583	missense	163081	exon4			TCATTCGTCATCA	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.1061G>A	19.37:g.37210687G>A	ENSP00000441838:p.Arg354His	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	111	5	NM_152603	0	0	0	0	0	B3KX49|Q6N044	Missense_Mutation	SNP	ENST00000536254.2	37		.	.	.	.	.	.	.	.	.	.	G	14.55	2.568648	0.45798	.	.	ENSG00000189042	ENST00000536254;ENST00000360729;ENST00000423498;ENST00000392163	T;T;T	0.07567	3.18;3.18;3.18	4.53	3.48	0.39840	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.190951	0.26654	N	0.023191	T	0.24890	0.0604	M	0.70842	2.15	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.73380	0.97;0.98	T	0.00998	-1.1486	10	0.45353	T	0.12	.	12.1099	0.53834	0.0:0.0:0.8276:0.1724	.	354;323	Q8N184;F8WEL6	ZN567_HUMAN;.	H	354;323;353;323	ENSP00000441838:R354H;ENSP00000353957:R323H;ENSP00000376003:R323H	ENSP00000353957:R323H	R	+	2	0	ZNF567	41902527	0.000000	0.05858	0.994000	0.49952	0.912000	0.54170	-0.782000	0.04643	1.231000	0.43661	0.462000	0.41574	CGT	.		0.458	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
OXER1	165140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	42990999	42990999	+	Silent	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr2:42990999C>A	ENST00000378661.2	-	1	402	c.321G>T	c.(319-321)ctG>ctT	p.L107L		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	107					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						TGTTCCCCACCAGGCCCAGGA	0.647																																					p.L107L		.											.	OXER1-500	0			c.G321T						.						43.0	47.0	45.0					2																	42990999		2203	4300	6503	SO:0001819	synonymous_variant	165140	exon1			CCCCACCAGGCCC	AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.321G>T	2.37:g.42990999C>A		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	100	34	NM_148962	0	0	5	5	0	Q86WP7|Q8NGW4	Silent	SNP	ENST00000378661.2	37	CCDS1810.1																																																																																			.		0.647	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250514.1	NM_148962	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P													.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	Somatic	30	4		WXS	Illumina HiSeq	Phase_I	122	32	NM_001145054	0	0	0	0	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
DNMT3B	1789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31389169	31389169	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:31389169G>C	ENST00000328111.2	+	19	2403	c.2082G>C	c.(2080-2082)tgG>tgC	p.W694C	DNMT3B_ENST00000456297.2_Missense_Mutation_p.W598C|DNMT3B_ENST00000443239.3_Missense_Mutation_p.W632C|DNMT3B_ENST00000344505.4_Missense_Mutation_p.W674C|DNMT3B_ENST00000353855.2_Missense_Mutation_p.W674C|DNMT3B_ENST00000348286.2_Missense_Mutation_p.W674C|DNMT3B_ENST00000201963.3_Missense_Mutation_p.W686C	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	694	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTTCTTCTGGATGTTTGAGA	0.532																																					p.W694C		.											.	DNMT3B-660	0			c.G2082C						.						105.0	95.0	98.0					20																	31389169		2203	4300	6503	SO:0001583	missense	1789	exon19			CTTCTGGATGTTT		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.2082G>C	20.37:g.31389169G>C	ENSP00000328547:p.Trp694Cys	Somatic	216	0		WXS	Illumina HiSeq	Phase_I	264	77	NM_006892	0	0	0	0	0	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875757	0.91664	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	D;D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.91858	0.7423	M	0.80508	2.5	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.992;0.998;0.999;0.999;0.987;0.999;0.999	D	0.92078	0.5670	10	0.87932	D	0	-23.2234	19.2924	0.94105	0.0:0.0:1.0:0.0	.	598;632;393;686;674;674;694	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	C	694;674;674;632;598;674;686	ENSP00000328547:W694C;ENSP00000313397:W674C;ENSP00000337764:W674C;ENSP00000403169:W632C;ENSP00000412305:W598C;ENSP00000345105:W674C;ENSP00000201963:W686C	ENSP00000201963:W686C	W	+	3	0	DNMT3B	30852830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.878000	0.98634	0.650000	0.86243	TGG	.		0.532	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
L3MBTL1	26013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	42162966	42162966	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:42162966G>A	ENST00000427442.2	+	15	1735	c.1576G>A	c.(1576-1578)Gtg>Atg	p.V526M	L3MBTL1_ENST00000373134.1_Missense_Mutation_p.V458M|L3MBTL1_ENST00000444063.1_Missense_Mutation_p.V458M|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.V458M|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.V526M			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	458					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GCTGGAGGCTGTGGACCGCAG	0.632																																					p.V526M		.											.	L3MBTL1-227	0			c.G1576A						.						45.0	47.0	46.0					20																	42162966		2203	4300	6503	SO:0001583	missense	26013	exon15			GAGGCTGTGGACC	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1576G>A	20.37:g.42162966G>A	ENSP00000402107:p.Val526Met	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	101	25	NM_032107	0	0	0	0	0	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	37	CCDS46602.2	.	.	.	.	.	.	.	.	.	.	G	31	5.080728	0.94050	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861;ENST00000373133	T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19	5.39	5.39	0.77823	.	0.115236	0.64402	D	0.000019	T	0.69324	0.3098	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.997;1.0;0.996	T	0.76170	-0.3057	10	0.87932	D	0	.	18.0965	0.89492	0.0:0.0:1.0:0.0	.	526;110;458;458	Q9Y468-5;Q9Y468-3;Q9Y468-2;Q9Y468-1	.;.;.;.	M	526;526;458;458;458;244;110	ENSP00000402107:V526M;ENSP00000398516:V526M;ENSP00000362227:V458M;ENSP00000403316:V458M;ENSP00000362226:V458M;ENSP00000410139:V244M	ENSP00000362225:V110M	V	+	1	0	L3MBTL1	41596380	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.598000	0.98277	2.804000	0.96469	0.655000	0.94253	GTG	.		0.632	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
SLC13A3	64849	broad.mit.edu	37	20	45194975	45194975	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:45194975G>A	ENST00000279027.4	-	11	1405	c.1387C>T	c.(1387-1389)Ccc>Tcc	p.P463S	SLC13A3_ENST00000396360.1_Missense_Mutation_p.P381S|SLC13A3_ENST00000435032.1_Missense_Mutation_p.P48S|SLC13A3_ENST00000290317.5_Missense_Mutation_p.P416S|SLC13A3_ENST00000413164.2_Missense_Mutation_p.P413S|SLC13A3_ENST00000495082.1_Missense_Mutation_p.P416S|SLC13A3_ENST00000472148.1_Missense_Mutation_p.P381S	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	463					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	AGGGCGGGGGGCACATTCTCC	0.607																																					p.P463S													.	SLC13A3-91	0			c.C1387T						.						95.0	98.0	97.0					20																	45194975		2203	4300	6503	SO:0001583	missense	64849	exon11			CGGGGGGCACATT	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1387C>T	20.37:g.45194975G>A	ENSP00000279027:p.Pro463Ser	Somatic	227	0		WXS	Illumina HiSeq	Phase_I	236	4	NM_022829	0	0	5	5	0	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125209	0.37533	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000435032;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082	T;T;T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93;3.93;3.93	5.25	3.3	0.37823	.	0.169329	0.53938	N	0.000051	T	0.06462	0.0166	L	0.48260	1.515	0.80722	D	1	P;P;P;B;B;P	0.40476	0.581;0.718;0.622;0.28;0.327;0.471	P;P;P;B;B;B	0.46585	0.521;0.451;0.465;0.253;0.37;0.3	T	0.25152	-1.0140	10	0.62326	D	0.03	-17.9448	8.7132	0.34395	0.2304:0.0:0.7696:0.0	.	413;48;381;416;365;463	B4DIR8;B4E181;Q8WWT9-3;F6WI18;B4DF27;Q8WWT9	.;.;.;.;.;S13A3_HUMAN	S	416;381;48;463;381;413;416	ENSP00000290317:P416S;ENSP00000379648:P381S;ENSP00000403394:P48S;ENSP00000279027:P463S;ENSP00000420177:P381S;ENSP00000415852:P413S;ENSP00000419621:P416S	ENSP00000279027:P463S	P	-	1	0	SLC13A3	44628382	1.000000	0.71417	0.307000	0.25127	0.310000	0.27922	4.143000	0.58051	0.601000	0.29879	0.561000	0.74099	CCC	.		0.607	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
PREX1	57580	broad.mit.edu	37	20	47258948	47258948	+	Silent	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:47258948G>A	ENST00000371941.3	-	28	3703	c.3681C>T	c.(3679-3681)aaC>aaT	p.N1227N	PREX1_ENST00000396220.1_Silent_p.N1227N|PREX1_ENST00000496915.1_5'UTR	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1227					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GTCCTACCTGGTTAAAGAGGT	0.607																																					p.N1227N													.	PREX1-231	0			c.C3681T						.						67.0	65.0	66.0					20																	47258948		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon28			TACCTGGTTAAAG	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3681C>T	20.37:g.47258948G>A		Somatic	142	1		WXS	Illumina HiSeq	Phase_I	140	4	NM_020820	0	0	0	0	0	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																			.		0.607	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
FAM65C	140876	broad.mit.edu	37	20	49208955	49208955	+	Missense_Mutation	SNP	C	C	G	rs77093450	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:49208955C>G	ENST00000327979.2	-	19	2902	c.2491G>C	c.(2491-2493)Ggc>Cgc	p.G831R	FAM65C_ENST00000462842.1_5'Flank|FAM65C_ENST00000535356.1_Missense_Mutation_p.G835R|FAM65C_ENST00000045083.2_Missense_Mutation_p.G831R			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	831										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTCGGAGTGCCGTCCAGCTGG	0.672																																					p.G831R													.	FAM65C-92	0			c.G2491C						.						32.0	36.0	34.0					20																	49208955		1970	4144	6114	SO:0001583	missense	140876	exon19			GAGTGCCGTCCAG	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.2491G>C	20.37:g.49208955C>G	ENSP00000332663:p.Gly831Arg	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	127	6	NM_080829	0	0	2	2	0	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948982	0.73787	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.77750	-1.12;-1.12;-1.12	4.81	4.81	0.61882	.	0.941590	0.08689	U	0.908334	D	0.83631	0.5296	L	0.54323	1.7	0.38977	D	0.958862	P;D	0.60575	0.767;0.988	P;P	0.54460	0.457;0.753	T	0.80120	-0.1515	10	0.39692	T	0.17	-29.6403	17.893	0.88878	0.0:1.0:0.0:0.0	.	835;831	F5H0X2;Q96MK2	.;FA65C_HUMAN	R	831;831;835	ENSP00000332663:G831R;ENSP00000045083:G831R;ENSP00000439802:G835R	ENSP00000045083:G831R	G	-	1	0	FAM65C	48642362	0.928000	0.31464	0.978000	0.43139	0.640000	0.38277	3.910000	0.56371	2.216000	0.71823	0.462000	0.41574	GGC	.		0.672	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
DOPEY2	9980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	37642372	37642372	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr21:37642372C>T	ENST00000399151.3	+	27	5634	c.5549C>T	c.(5548-5550)aCc>aTc	p.T1850I		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1850					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTGGAGCAAACCAGCTGGCTA	0.493																																					p.T1850I		.											.	DOPEY2-91	0			c.C5549T						.						104.0	109.0	108.0					21																	37642372		2203	4300	6503	SO:0001583	missense	9980	exon27			AGCAAACCAGCTG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.5549C>T	21.37:g.37642372C>T	ENSP00000382104:p.Thr1850Ile	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	82	25	NM_005128	0	0	4	6	2	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422737	0.83559	.	.	ENSG00000142197	ENST00000399151	T	0.14516	2.5	5.47	4.59	0.56863	.	0.049713	0.85682	N	0.000000	T	0.41119	0.1145	M	0.85542	2.76	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.41998	-0.9477	10	0.51188	T	0.08	-3.5123	13.7957	0.63168	0.0:0.9267:0.0:0.0733	.	1850;1850	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	I	1850	ENSP00000382104:T1850I	ENSP00000382104:T1850I	T	+	2	0	DOPEY2	36564242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.300000	0.78841	1.311000	0.45024	0.650000	0.86243	ACC	.		0.493	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
KCNJ4	3761	broad.mit.edu	37	22	38822920	38822920	+	Silent	SNP	A	A	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr22:38822920A>C	ENST00000303592.3	-	2	1476	c.1218T>G	c.(1216-1218)ggT>ggG	p.G406G	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	406					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					CCTCCTTGGAACCCGCCTCCA	0.672																																					p.G406G													.	KCNJ4-90	0			c.T1218G						.						45.0	55.0	52.0					22																	38822920		2200	4299	6499	SO:0001819	synonymous_variant	3761	exon2			CTTGGAACCCGCC	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.1218T>G	22.37:g.38822920A>C		Somatic	66	4		WXS	Illumina HiSeq	Phase_I	191	23	NM_004981	0	0	0	0	0	Q14D44	Silent	SNP	ENST00000303592.3	37	CCDS13971.1																																																																																			.		0.672	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
ZBED4	9889	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	50279802	50279802	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr22:50279802C>T	ENST00000216268.5	+	2	2969	c.2492C>T	c.(2491-2493)aCg>aTg	p.T831M		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	831						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		TTCAGCCATACGGTGAACCTG	0.642																																					p.T831M													.	ZBED4-92	0			c.C2492T						.						35.0	35.0	35.0					22																	50279802		2202	4300	6502	SO:0001583	missense	9889	exon2			GCCATACGGTGAA	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2492C>T	22.37:g.50279802C>T	ENSP00000216268:p.Thr831Met	Somatic	114	1		WXS	Illumina HiSeq	Phase_I	159	49	NM_014838	0	0	0	0	0	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	37	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451158	0.43531	.	.	ENSG00000100426	ENST00000216268	T	0.23348	1.91	5.57	3.46	0.39613	Ribonuclease H-like (1);	0.113857	0.64402	N	0.000019	T	0.47911	0.1471	M	0.77820	2.39	0.49483	D	0.999791	D	0.89917	1.0	D	0.71656	0.974	T	0.44757	-0.9307	10	0.54805	T	0.06	-22.2447	10.3753	0.44079	0.1354:0.7951:0.0:0.0695	.	831	O75132	ZBED4_HUMAN	M	831	ENSP00000216268:T831M	ENSP00000216268:T831M	T	+	2	0	ZBED4	48665806	0.999000	0.42202	0.659000	0.29680	0.301000	0.27625	4.300000	0.59079	0.688000	0.31529	0.655000	0.94253	ACG	.		0.642	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838	
OSBPL11	114885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	125298795	125298795	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr3:125298795A>T	ENST00000296220.5	-	3	612	c.323T>A	c.(322-324)cTt>cAt	p.L108H		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	108	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						AGCTCCTGCAAGCTGCAAAGT	0.403																																					p.L108H		.											.	OSBPL11-135	0			c.T323A						.						118.0	121.0	120.0					3																	125298795		2203	4300	6503	SO:0001583	missense	114885	exon3			CCTGCAAGCTGCA	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.323T>A	3.37:g.125298795A>T	ENSP00000296220:p.Leu108His	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	130	25	NM_022776	0	0	2	3	1	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.595561	0.86953	.	.	ENSG00000144909	ENST00000296220	D	0.84223	-1.82	5.07	5.07	0.68467	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.071226	0.56097	D	0.000021	D	0.94739	0.8302	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96314	0.9231	10	0.87932	D	0	0.5235	14.9917	0.71393	1.0:0.0:0.0:0.0	.	108	Q9BXB4	OSB11_HUMAN	H	108	ENSP00000296220:L108H	ENSP00000296220:L108H	L	-	2	0	OSBPL11	126781485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.073000	0.93992	2.124000	0.65301	0.533000	0.62120	CTT	.		0.403	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
NPHP3	27031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	132418235	132418235	+	Silent	SNP	A	A	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr3:132418235A>T	ENST00000337331.5	-	13	2033	c.1947T>A	c.(1945-1947)atT>atA	p.I649I	NPHP3_ENST00000326682.8_Silent_p.I649I	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	649					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCACAGAAACAATTACTCTTA	0.328																																					p.I649I		.											.	NPHP3-91	0			c.T1947A						.						122.0	107.0	112.0					3																	132418235		2203	4300	6503	SO:0001819	synonymous_variant	27031	exon13			AGAAACAATTACT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.1947T>A	3.37:g.132418235A>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	61	22	NM_153240	0	0	0	0	0	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Silent	SNP	ENST00000337331.5	37	CCDS3078.1																																																																																			.		0.328	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
MUC4	4585	broad.mit.edu	37	3	195511447	195511447	+	Missense_Mutation	SNP	G	G	A	rs577730605	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr3:195511447G>A	ENST00000463781.3	-	2	7463	c.7004C>T	c.(7003-7005)aCg>aTg	p.T2335M	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2335M|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2335M(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGCGTGGTGTCACC	0.597													.|||	23	0.00459265	0.0159	0.0	5008	,	,		17550	0.0		0.001	False		,,,				2504	0.001				p.T2335M													.	MUC4-90	1	Substitution - Missense(1)	endometrium(1)	c.C7004T						.						5.0	6.0	6.0					3																	195511447		581	1479	2060	SO:0001583	missense	4585	exon2			AGAGGCGTGGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7004C>T	3.37:g.195511447G>A	ENSP00000417498:p.Thr2335Met	Somatic	236	1		WXS	Illumina HiSeq	Phase_I	416	4	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	3.781	-0.045698	0.07452	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36699	1.24;1.28	.	.	.	.	1.329500	0.07018	U	0.826373	T	0.30978	0.0782	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.52909	0.713	T	0.26677	-1.0096	8	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	2335	E7ESK3	.	M	2335	ENSP00000417498:T2335M;ENSP00000420243:T2335M	.	T	-	2	0	MUC4	196995842	0.000000	0.05858	0.018000	0.16275	0.025000	0.11179	-0.545000	0.06069	0.064000	0.16427	0.064000	0.15345	ACG	.		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SDHA	6389	hgsc.bcm.edu	37	5	218487	218487	+	Missense_Mutation	SNP	G	G	A	rs187964306	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr5:218487G>A	ENST00000264932.6	+	1	132	c.17G>A	c.(16-18)gGc>gAc	p.G6D	CTD-2083E4.4_ENST00000565521.1_RNA|SDHA_ENST00000510361.1_Missense_Mutation_p.G6D|CCDC127_ENST00000296824.3_5'Flank|SDHA_ENST00000504309.1_Missense_Mutation_p.G6D	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	6					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GGGGTCCGGGGCCTGTCGCGG	0.781									Familial Paragangliomas				G|||	20	0.00399361	0.0151	0.0	5008	,	,		8006	0.0		0.0	False		,,,				2504	0.0				p.G6D		.											.	SDHA-226	0			c.G17A						.	G	ASP/GLY	55,3035		0,55,1490	5.0	7.0	6.0		17	-1.9	0.0	5		6	0,7136		0,0,3568	no	missense	SDHA	NM_004168.2	94	0,55,5058	AA,AG,GG		0.0,1.7799,0.5378	possibly-damaging	6/665	218487	55,10171	1545	3568	5113	SO:0001583	missense	6389	exon1	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	TCCGGGGCCTGTC	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.17G>A	5.37:g.218487G>A	ENSP00000264932:p.Gly6Asp	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	14	9	NM_004168	0	0	8	16	8	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	9	0.004120879120879121	8	0.016260162601626018	1	0.0027624309392265192	0	0.0	0	0.0	G	5.417	0.262064	0.10239	0.017799	0.0	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.71698	-0.59;0.26;-0.59	3.66	-1.91	0.07641	.	0.522646	0.15819	U	0.243080	T	0.25005	0.0607	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.19583	0.004;0.037;0.004;0.004;0.004	B;B;B;B;B	0.20955	0.004;0.032;0.004;0.004;0.019	T	0.12477	-1.0546	10	0.21540	T	0.41	.	4.3656	0.11223	0.0:0.2691:0.2152:0.5156	.	6;6;6;6;12	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	D	6	ENSP00000264932:G6D;ENSP00000426514:G6D;ENSP00000427703:G6D	ENSP00000264932:G6D	G	+	2	0	SDHA	271487	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.926000	0.03988	-0.485000	0.06754	0.471000	0.43371	GGC	G|0.996;A|0.004		0.781	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
NSUN2	54888	hgsc.bcm.edu	37	5	6633071	6633071	+	Missense_Mutation	SNP	G	G	A	rs181415619	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr5:6633071G>A	ENST00000264670.6	-	1	333	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W	NSUN2_ENST00000539938.1_5'UTR|SRD5A1_ENST00000537411.1_5'Flank|NSUN2_ENST00000506139.1_Missense_Mutation_p.R8W|SRD5A1_ENST00000538824.1_5'Flank|SRD5A1_ENST00000274192.5_5'Flank	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	8					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						TGGAGCCGCCGACCCCGCGAC	0.756													G|||	125	0.0249601	0.0893	0.0101	5008	,	,		10402	0.0		0.0	False		,,,				2504	0.0				p.R8W		.											.	NSUN2-91	0			c.C22T						.	G	TRP/ARG,TRP/ARG	120,1992		0,120,936	1.0	2.0	2.0		22,22	2.6	0.9	5		2	3,4631		0,3,2314	no	missense,missense	NSUN2	NM_001193455.1,NM_017755.5	101,101	0,123,3250	AA,AG,GG		0.0647,5.6818,1.8233	probably-damaging,probably-damaging	8/733,8/768	6633071	123,6623	1056	2317	3373	SO:0001583	missense	54888	exon1			GCCGCCGACCCCG	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.22C>T	5.37:g.6633071G>A	ENSP00000264670:p.Arg8Trp	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	7	7	NM_017755	0	0	0	0	0	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	57	0.0260989010989011	45	0.09146341463414634	2	0.0055248618784530384	0	0.0	10	0.013192612137203167	G	17.62	3.434487	0.62955	0.056818	6.47E-4	ENSG00000037474	ENST00000264670;ENST00000506139	T;T	0.38722	1.12;1.12	4.5	2.59	0.31030	.	0.397846	0.23951	N	0.042944	T	0.03477	0.0100	L	0.51422	1.61	0.09310	P	0.99999999735625	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.42085	-0.9472	9	0.72032	D	0.01	-12.5115	9.6603	0.39952	0.0:0.0:0.6264:0.3736	.	8;8	B4DQW2;Q08J23	.;NSUN2_HUMAN	W	8	ENSP00000264670:R8W;ENSP00000420957:R8W	ENSP00000264670:R8W	R	-	1	2	NSUN2	6686071	0.066000	0.20996	0.881000	0.34555	0.921000	0.55340	0.367000	0.20382	0.860000	0.35481	0.557000	0.71058	CGG	G|0.974;A|0.026		0.756	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
ISL1	3670	broad.mit.edu	37	5	50687165	50687165	+	Missense_Mutation	SNP	G	G	T	rs371918442		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr5:50687165G>T	ENST00000230658.7	+	5	1408	c.823G>T	c.(823-825)Ggt>Tgt	p.G275C	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Intron	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	275	Gln-rich.|LIM-binding domain (LID). {ECO:0000250}.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GAGACACGACGGTGGCTTACA	0.517																																					p.G275C													.	ISL1-515	0			c.G823T						.						62.0	65.0	64.0					5																	50687165		1934	4139	6073	SO:0001583	missense	3670	exon5			CACGACGGTGGCT	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.823G>T	5.37:g.50687165G>T	ENSP00000230658:p.Gly275Cys	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	142	5	NM_002202	0	0	0	0	0	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647492	0.87958	.	.	ENSG00000016082	ENST00000230658	D	0.85484	-1.99	5.93	5.93	0.95920	.	0.053759	0.85682	D	0.000000	D	0.88840	0.6546	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	P	0.62184	0.899	D	0.88870	0.3332	10	0.62326	D	0.03	.	20.3311	0.98718	0.0:0.0:1.0:0.0	.	275	P61371	ISL1_HUMAN	C	275	ENSP00000230658:G275C	ENSP00000230658:G275C	G	+	1	0	ISL1	50722922	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	6.671000	0.74472	2.797000	0.96272	0.655000	0.94253	GGT	.		0.517	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
REV3L	5980	ucsc.edu;bcgsc.ca	37	6	111701285	111701285	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr6:111701285C>A	ENST00000358835.3	-	12	1808	c.1354G>T	c.(1354-1356)Gaa>Taa	p.E452*	REV3L_ENST00000368802.3_Nonsense_Mutation_p.E452*|REV3L_ENST00000435970.1_Nonsense_Mutation_p.E374*|REV3L_ENST00000368805.1_Nonsense_Mutation_p.E452*			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	452					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TCATTTTCTTCATCATCACTA	0.398								DNA polymerases (catalytic subunits)																													p.E452X													.	REV3L-294	0			c.G1354T						.						279.0	252.0	261.0					6																	111701285		2203	4300	6503	SO:0001587	stop_gained	5980	exon11			TTTCTTCATCATC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.1354G>T	6.37:g.111701285C>A	ENSP00000351697:p.Glu452*	Somatic	121	2		WXS	Illumina HiSeq		109	35	NM_002912	0	0	0	0	0	O43214|Q5TC33	Nonsense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	46	12.327003	0.99657	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	.	.	.	5.71	5.71	0.89125	.	0.058399	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-8.3219	19.8632	0.96793	0.0:1.0:0.0:0.0	.	.	.	.	X	452;452;452;374	.	ENSP00000351697:E452X	E	-	1	0	REV3L	111807978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.350000	0.79385	2.699000	0.92147	0.655000	0.94253	GAA	.		0.398	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
SLC22A3	6581	hgsc.bcm.edu	37	6	160769796	160769796	+	Silent	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr6:160769796C>T	ENST00000275300.2	+	1	497	c.345C>T	c.(343-345)gcC>gcT	p.A115A	SLC22A3_ENST00000392145.1_Silent_p.A115A	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	115					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	ACCCACTCGCCGCCTTCCCCA	0.756																																					p.A115A		.											.	SLC22A3-517	0			c.C345T						.						3.0	3.0	3.0					6																	160769796		1659	3388	5047	SO:0001819	synonymous_variant	6581	exon1			ACTCGCCGCCTTC	AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.345C>T	6.37:g.160769796C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	23	11	NM_021977	0	0	0	0	0	Q5SYN6|Q9UP02	Silent	SNP	ENST00000275300.2	37	CCDS5277.1																																																																																			.		0.756	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042953.1	NM_021977	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	75	10	NM_003194	0	0	2	2	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TAF6	6878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99707631	99707631	+	Silent	SNP	G	G	A	rs148894017		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr7:99707631G>A	ENST00000344095.4	-	12	1749	c.1224C>T	c.(1222-1224)gaC>gaT	p.D408D	TAF6_ENST00000452041.1_Silent_p.D408D|AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000437822.2_Silent_p.D445D|TAF6_ENST00000472509.1_Silent_p.D465D|TAF6_ENST00000453269.2_Silent_p.D408D|TAF6_ENST00000418432.2_Silent_p.D332D	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	408					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCACAGGGCCGTCCAGCACAC	0.587																																					p.D445D		.											.	TAF6-91	0			c.C1335T						.	G	,,	0,4406		0,0,2203	110.0	97.0	101.0		1335,1224,1224	-6.5	0.9	7	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TAF6	NM_001190415.1,NM_005641.3,NM_139315.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	445/715,408/678,408/678	99707631	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6878	exon12			AGGGCCGTCCAGC		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1224C>T	7.37:g.99707631G>A		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	155	37	NM_001190415	1	0	23	35	11	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	37	CCDS5686.1																																																																																			G|1.000;A|0.000		0.587	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
SSPO	23145	hgsc.bcm.edu	37	7	149487608	149487608	+	RNA	SNP	T	T	G	rs1635798	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr7:149487608T>G	ENST00000378016.2	+	0	4921							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GACGCCTGCGTTGAGGCTCCC	0.776													G|||	1320	0.263578	0.6959	0.1095	5008	,	,		8211	0.1171		0.0885	False		,,,				2504	0.1196				.		.											.	.	0			c.4921+1T>G						.						1.0	1.0	1.0					7																	149487608		434	1167	1601			23145	exon32			CCTGCGTTGAGGC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149487608T>G		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_198455	0	0	0	0	0	Q76B61	Splice_Site	SNP	ENST00000378016.2	37																																																																																				T|0.784;G|0.216		0.776	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
GIMAP8	155038	broad.mit.edu	37	7	150174500	150174500	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr7:150174500G>T	ENST00000307271.3	+	5	2204	c.1630G>T	c.(1630-1632)Gct>Tct	p.A544S		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	544	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GGACAAAACAGCTGTGGCGAA	0.502																																					p.A544S													.	GIMAP8-95	0			c.G1630T						.						80.0	77.0	78.0					7																	150174500		2203	4300	6503	SO:0001583	missense	155038	exon5			AAAACAGCTGTGG	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1630G>T	7.37:g.150174500G>T	ENSP00000305107:p.Ala544Ser	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	194	8	NM_175571	0	0	1	1	0		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633250	0.47049	.	.	ENSG00000171115	ENST00000307271	T	0.34859	1.34	4.44	1.39	0.22231	AIG1 (1);	3.096750	0.01386	N	0.013095	T	0.33673	0.0871	L	0.41236	1.265	0.09310	N	1	P	0.35793	0.521	B	0.38378	0.272	T	0.23833	-1.0177	10	0.45353	T	0.12	.	5.6382	0.17548	0.3651:0.0:0.6349:0.0	.	544	Q8ND71	GIMA8_HUMAN	S	544	ENSP00000305107:A544S	ENSP00000305107:A544S	A	+	1	0	GIMAP8	149805433	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.442000	0.21628	0.518000	0.28383	-0.150000	0.13652	GCT	.		0.502	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
HR	55806	hgsc.bcm.edu	37	8	21974513	21974513	+	Missense_Mutation	SNP	G	G	C	rs143782421	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr8:21974513G>C	ENST00000381418.4	-	17	4733	c.3253C>G	c.(3253-3255)Cca>Gca	p.P1085A	HR_ENST00000312841.8_Intron	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	1085	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CAGCTGCCTGGGGCGCCAGGC	0.716													G|||	40	0.00798722	0.028	0.0043	5008	,	,		13773	0.0		0.0	False		,,,				2504	0.0				p.P1085A		.											.	HR-154	0			c.C3253G						.	G	ALA/PRO,	28,3236		0,28,1604	2.0	3.0	3.0		3253,	4.4	0.0	8	dbSNP_134	3	0,6902		0,0,3451	no	missense,intron	HR	NM_005144.4,NM_018411.4	27,	0,28,5055	CC,CG,GG		0.0,0.8578,0.2754	probably-damaging,	1085/1190,	21974513	28,10138	1632	3451	5083	SO:0001583	missense	55806	exon17			TGCCTGGGGCGCC	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.3253C>G	8.37:g.21974513G>C	ENSP00000370826:p.Pro1085Ala	Somatic	6	0		WXS	Illumina HiSeq	Phase_I	17	8	NM_005144	0	0	0	0	0	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	13	0.005952380952380952	12	0.024390243902439025	1	0.0027624309392265192	0	0.0	0	0.0	G	16.79	3.221593	0.58560	0.008578	0.0	ENSG00000168453	ENST00000381418	T	0.70282	-0.47	5.32	4.44	0.53790	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.123995	0.37715	N	0.001968	T	0.49167	0.1541	L	0.36672	1.1	0.33054	D	0.533176	P	0.43750	0.816	P	0.46362	0.514	T	0.70890	-0.4749	10	0.59425	D	0.04	-10.3405	9.9179	0.41446	0.0936:0.0:0.9064:0.0	.	1085	O43593	HAIR_HUMAN	A	1085	ENSP00000370826:P1085A	ENSP00000370826:P1085A	P	-	1	0	HR	22030458	0.909000	0.30893	0.029000	0.17559	0.847000	0.48162	3.053000	0.49901	1.367000	0.46095	0.655000	0.94253	CCA	G|0.994;C|0.006		0.716	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
HR	55806	hgsc.bcm.edu	37	8	21974550	21974550	+	Silent	SNP	C	C	T	rs146855847	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr8:21974550C>T	ENST00000381418.4	-	17	4696	c.3216G>A	c.(3214-3216)gtG>gtA	p.V1072V	HR_ENST00000312841.8_Intron	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	1072	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CGGCCGGGCACACCTCAAAGA	0.687													C|||	40	0.00798722	0.028	0.0043	5008	,	,		14630	0.0		0.0	False		,,,				2504	0.0				p.V1072V		.											.	HR-154	0			c.G3216A						.	C	,	44,3144		0,44,1550	3.0	3.0	3.0		3216,	3.5	1.0	8	dbSNP_134	3	1,6735		0,1,3367	no	coding-synonymous,intron	HR	NM_005144.4,NM_018411.4	,	0,45,4917	TT,TC,CC		0.0148,1.3802,0.4534	,	1072/1190,	21974550	45,9879	1594	3368	4962	SO:0001819	synonymous_variant	55806	exon17			CGGGCACACCTCA	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.3216G>A	8.37:g.21974550C>T		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	15	5	NM_005144	0	0	0	0	0	Q6GS30|Q96H33|Q9NPE1	Silent	SNP	ENST00000381418.4	37	CCDS6022.1																																																																																			C|0.994;T|0.006		0.687	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
STMN4	81551	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27099960	27099960	+	Silent	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr8:27099960G>A	ENST00000265770.7	-	3	199	c.63C>T	c.(61-63)tcC>tcT	p.S21S	STMN4_ENST00000519997.1_Silent_p.S12S|STMN4_ENST00000350889.4_Silent_p.S21S|STMN4_ENST00000523048.1_Silent_p.S21S|STMN4_ENST00000519614.1_Silent_p.S21S|STMN4_ENST00000522908.1_Silent_p.S21S			Q9H169	STMN4_HUMAN	stathmin-like 4	21					regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	CCAGGAAGCAGGAGCAGAACA	0.577																																					p.S21S													.	STMN4-154	0			c.C63T						.						104.0	97.0	100.0					8																	27099960		2203	4300	6503	SO:0001819	synonymous_variant	81551	exon3			GAAGCAGGAGCAG		CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.63C>T	8.37:g.27099960G>A		Somatic	113	1		WXS	Illumina HiSeq	Phase_I	138	43	NM_030795	0	0	0	0	0	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Silent	SNP	ENST00000265770.7	37																																																																																				.		0.577	STMN4-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000375941.1	NM_030795	
C9orf156	51531	broad.mit.edu	37	9	100672508	100672508	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr9:100672508G>T	ENST00000375119.3	-	4	876	c.800C>A	c.(799-801)gCa>gAa	p.A267E	C9orf156_ENST00000478126.1_5'UTR	NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156	267					viral process (GO:0016032)		hydrolase activity (GO:0016787)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				TTGTTCTTCTGCCACGCTGGA	0.468																																					p.A267E													.	C9orf156-90	0			c.C800A						.						168.0	163.0	165.0					9																	100672508		2203	4300	6503	SO:0001583	missense	51531	exon4			TCTTCTGCCACGC	AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.800C>A	9.37:g.100672508G>T	ENSP00000364260:p.Ala267Glu	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	207	6	NM_016481	0	0	6	6	0	Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Missense_Mutation	SNP	ENST00000375119.3	37	CCDS6730.1	.	.	.	.	.	.	.	.	.	.	G	2.642	-0.283955	0.05642	.	.	ENSG00000136932	ENST00000375119;ENST00000375118;ENST00000325350	T;T	0.32272	1.88;1.46	5.03	3.07	0.35406	Uncharacterised domain UPF0066, YaeB-like domain (1);	1.008340	0.07952	N	0.981024	T	0.28466	0.0704	L	0.29908	0.895	0.09310	N	1	B;D;P	0.53462	0.082;0.96;0.483	B;P;B	0.47891	0.069;0.56;0.058	T	0.13282	-1.0515	10	0.48119	T	0.1	-1.4593	6.9791	0.24694	0.0908:0.0:0.6546:0.2546	.	164;121;267	Q6Y2L2;Q5T114;Q9BU70	.;.;NAP1_HUMAN	E	267;121;164	ENSP00000364260:A267E;ENSP00000364259:A121E	ENSP00000324426:A164E	A	-	2	0	C9orf156	99712329	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	0.188000	0.17018	1.253000	0.44018	0.563000	0.77884	GCA	.		0.468	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055401.1	NM_016481	
AKNA	80709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117143567	117143567	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr9:117143567C>A	ENST00000307564.4	-	2	208	c.47G>T	c.(46-48)gGg>gTg	p.G16V	AKNA_ENST00000374088.3_Missense_Mutation_p.G16V|AKNA_ENST00000312033.3_Missense_Mutation_p.G16V	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	16					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGGGCCCTTCCCCAGGCCAGG	0.622																																					p.G16V		.											.	AKNA-94	0			c.G47T						.						35.0	28.0	31.0					9																	117143567		2201	4299	6500	SO:0001583	missense	80709	exon2			CCCTTCCCCAGGC	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.47G>T	9.37:g.117143567C>A	ENSP00000303769:p.Gly16Val	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	83	25	NM_030767	0	0	2	2	0	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167000	0.38217	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000312033;ENST00000394574	T;T;T	0.58940	1.58;1.58;0.3	3.83	3.83	0.44106	.	0.000000	0.43919	D	0.000520	T	0.64023	0.2561	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66614	-0.5879	10	0.87932	D	0	-30.4003	11.5452	0.50690	0.0:1.0:0.0:0.0	.	16;16	Q7Z591-6;Q7Z591	.;AKNA_HUMAN	V	16	ENSP00000303769:G16V;ENSP00000363201:G16V;ENSP00000309222:G16V	ENSP00000303769:G16V	G	-	2	0	AKNA	116183388	0.873000	0.30073	0.977000	0.42913	0.053000	0.15095	1.457000	0.35212	2.460000	0.83146	0.561000	0.74099	GGG	.		0.622	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
UBXN11	91544	hgsc.bcm.edu	37	1	26608848	26608853	+	In_Frame_Del	DEL	CTGGGG	CTGGGG	-	rs61775089|rs199707978		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	CTGGGG	CTGGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:26608848_26608853delCTGGGG	ENST00000374222.1	-	16	1964_1969	c.1500_1505delCCCCAG	c.(1498-1506)ggccccagt>ggt	p.PS501del	UBXN11_ENST00000374217.2_In_Frame_Del_p.PS468del|UBXN11_ENST00000314675.7_In_Frame_Del_p.PS381del|UBXN11_ENST00000374221.3_In_Frame_Del_p.PS501del|UBXN11_ENST00000374223.1_In_Frame_Del_p.PS258del|UBXN11_ENST00000357089.4_In_Frame_Del_p.PS468del			Q5T124	UBX11_HUMAN	UBX domain protein 11	501	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.|P -> S (in dbSNP:rs17838088).			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gggaccgggactggggccgggaccgg	0.728																																					p.500_502del		.											.	UBXN11-91	1	Deletion - In frame(1)	ovary(1)	c.1500_1505del						.																																			SO:0001651	inframe_deletion	91544	exon16			.	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1500_1505delCCCCAG	1.37:g.26608848_26608853delCTGGGG	ENSP00000363339:p.Pro501_Ser502del	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	25	13	NM_183008	0	0	0	0	0	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	In_Frame_Del	DEL	ENST00000374222.1	37	CCDS41288.1																																																																																			.		0.728	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
F12	2161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176833055	176833058	+	Frame_Shift_Del	DEL	AGTG	AGTG	-	rs149368999	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	AGTG	AGTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr5:176833055_176833058delAGTG	ENST00000253496.3	-	3	168_171	c.120_123delCACT	c.(118-123)ctcactfs	p.LT40fs	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	40					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CCCCGGTGACAGTGAGAACTGCAG	0.588									Hereditary Angioedema																												p.40_41del		.											.	F12-90	0			c.120_123del						.																																			SO:0001589	frameshift_variant	2161	exon3	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	.	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.120_123delCACT	5.37:g.176833055_176833058delAGTG	ENSP00000253496:p.Leu40fs	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	71	23	NM_000505	0	0	0	0	0	P78339	Frame_Shift_Del	DEL	ENST00000253496.3	37	CCDS34302.1																																																																																			.		0.588	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
OBSCN	84033	broad.mit.edu	37	1	228444409	228444410	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:228444409_228444410insG	ENST00000422127.1	+	15	4411_4412	c.4367_4368insG	c.(4366-4371)gcggggfs	p.AG1456fs	OBSCN_ENST00000570156.2_Frame_Shift_Ins_p.AG1548fs|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Frame_Shift_Ins_p.AG1456fs|OBSCN_ENST00000359599.6_Frame_Shift_Ins_p.AG20fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1456	Ig-like 15.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGCCCAGGCGGGGGCCAGCA	0.619																																					p.A1548fs													.	OBSCN-403	0			c.4643_4644insG						.																																			SO:0001589	frameshift_variant	84033	exon16			CCCAGGCGGGGGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4372dupG	1.37:g.228444414_228444414dupG	ENSP00000409493:p.Ala1456fs	Somatic	224	0		WXS	Illumina HiSeq	Phase_I	388	8	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Ins	INS	ENST00000422127.1	37	CCDS58065.1																																																																																			.		0.619	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PTGDR2	11251	hgsc.bcm.edu	37	11	60620166	60620167	+	In_Frame_Ins	INS	-	-	GCG	rs55642873	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:60620166_60620167insGCG	ENST00000332539.4	-	2	1140_1141	c.1029_1030insCGC	c.(1027-1032)cgcacc>cgcCGCacc	p.343_344insR	RP11-804A23.4_ENST00000538705.1_RNA	NM_004778.2	NP_004769.2	Q9Y5Y4	PD2R2_HUMAN	prostaglandin D2 receptor 2	343					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|calcium-mediated signaling (GO:0019722)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|prostaglandin D receptor activity (GO:0004956)|prostaglandin F receptor activity (GO:0004958)|prostaglandin J receptor activity (GO:0001785)									Indomethacin(DB00328)|Sulindac(DB00605)	GTGGAGGAGGTGCGGCGGCGGC	0.748														93	0.0185703	0.0514	0.0086	5008	,	,		8844	0.0		0.0119	False		,,,				2504	0.0072				p.T344delinsRT		.											.	.	0			c.1030_1031insCGC						.																																			SO:0001652	inframe_insertion	11251	exon2			.	AF118265	CCDS7994.1	11q12-q13.3	2012-08-08	2011-11-11	2011-11-11		ENSG00000183134		"""CD molecules"", ""GPCR / Class A : Prostanoid receptors"""	4502	protein-coding gene	gene with protein product	"""chemoattractant receptor homologous molecule expressed on T helper type 2 cells"""	604837	"""G protein-coupled receptor 44"""	GPR44		10036181	Standard	NM_004778		Approved	CRTH2, CD294, DP2	uc001nqc.2	Q9Y5Y4		ENST00000332539.4:c.1027_1029dupCGC	11.37:g.60620173_60620175dupGCG	ENSP00000332812:p.Arg343_Arg343dup	Somatic	1	0		WXS	Illumina HiSeq	Phase_I	48	12	NM_004778	0	0	0	0	0	O94765|Q4QRI6	In_Frame_Ins	INS	ENST00000332539.4	37	CCDS7994.1																																																																																			.		0.748	PTGDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396328.1	NM_004778	
USP31	57478	hgsc.bcm.edu	37	16	23160421	23160422	+	In_Frame_Ins	INS	-	-	GAGGAGGGC	rs555380492	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr16:23160421_23160422insGAGGAGGGC	ENST00000219689.7	-	1	169_170	c.170_171insGCCCTCCTC	c.(169-171)tct>tcGCCCTCCTCt	p.57_57S>SPSS		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CCGAGCGTGCAGAGGAGGGCGA	0.762														35	0.00698882	0.025	0.0014	5008	,	,		3570	0.001		0.0	False		,,,				2504	0.0				p.S57delinsSPSS		.											.	USP31-663	0			c.171_172insGCCCTCCTC						.																																			SO:0001652	inframe_insertion	57478	exon1			.	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.162_170dupGCCCTCCTC	16.37:g.23160422_23160430dupGAGGAGGGC	ENSP00000219689:p.ProSerSer57dup	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	58	12	NM_020718	0	0	0	0	0	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	In_Frame_Ins	INS	ENST00000219689.7	37	CCDS10607.1																																																																																			.		0.762	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
PRDM13	59336	hgsc.bcm.edu	37	6	100061624	100061625	+	In_Frame_Ins	INS	-	-	CCG	rs370363311|rs577768379|rs112674667	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr6:100061624_100061625insCCG	ENST00000369215.4	+	4	1418_1419	c.1113_1114insCCG	c.(1114-1116)ccg>CCGccg	p.372_372P>PP		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	372	Poly-Pro.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		TCGCTGGGGACccgccgccgcc	0.757														1281	0.255791	0.3979	0.2017	5008	,	,		7609	0.1062		0.2734	False		,,,				2504	0.2382				p.D371delinsDP		.											.	PRDM13-135	0			c.1113_1114insCCG						.																																			SO:0001652	inframe_insertion	59336	exon4			.	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.1129_1131dupCCG	6.37:g.100061631_100061633dupCCG	ENSP00000358217:p.Pro378dup	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	13	11	NM_021620	0	0	0	0	0	Q5TGC1|Q5TGC2	In_Frame_Ins	INS	ENST00000369215.4	37	CCDS43487.1																																																																																			.		0.757	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
