#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2160390	2160390	+	Missense_Mutation	SNP	C	C	G	rs28384811	byFrequency	TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:2160390C>G	ENST00000378536.4	+	1	257	c.185C>G	c.(184-186)gCg>gGg	p.A62G		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	62					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		gcggtgccggcgccggTGCCC	0.776													C|||	229	0.0457268	0.0234	0.0576	5008	,	,		4535	0.0079		0.0706	False		,,,				2504	0.0808				p.A62G	Ovarian(177;144 1678 13697 20086 27838 40755)	.											.	SKI-838	0			c.C185G						.						1.0	1.0	1.0					1																	2160390		788	1840	2628	SO:0001583	missense	6497	exon1			TGCCGGCGCCGGT	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.185C>G	1.37:g.2160390C>G	ENSP00000367797:p.Ala62Gly	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	7	3	NM_003036	0	0	0	0	0	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	102	0.046703296703296704	20	0.04065040650406504	28	0.07734806629834254	3	0.005244755244755245	51	0.06728232189973615	C	9.688	1.151208	0.21371	.	.	ENSG00000157933	ENST00000378536	D	0.95821	-3.82	2.3	2.3	0.28687	.	.	.	.	.	T	0.47857	0.1468	N	0.08118	0	0.45733	P	0.001363000000000003	D	0.57899	0.981	P	0.58520	0.84	T	0.76271	-0.3020	8	0.20519	T	0.43	-11.9718	7.7374	0.28823	0.0:1.0:0.0:0.0	rs28384811	62	P12755	SKI_HUMAN	G	62	ENSP00000367797:A62G	ENSP00000367797:A62G	A	+	2	0	SKI	2150250	0.994000	0.37717	0.998000	0.56505	0.971000	0.66376	0.878000	0.28126	1.104000	0.41587	0.185000	0.17295	GCG	C|0.953;G|0.047		0.776	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
CLSTN1	22883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	9795602	9795602	+	Missense_Mutation	SNP	C	C	T	rs190578331	byFrequency	TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:9795602C>T	ENST00000377298.4	-	13	2598	c.1806G>A	c.(1804-1806)atG>atA	p.M602I	CLSTN1_ENST00000477264.1_5'Flank|CLSTN1_ENST00000377288.3_Missense_Mutation_p.M583I|CLSTN1_ENST00000361311.4_Missense_Mutation_p.M592I	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	602					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		AGATGTGCTGCATGGCCTTAT	0.527													C|||	2	0.000399361	0.0	0.0	5008	,	,		17391	0.002		0.0	False		,,,				2504	0.0				p.M602I		.											.	CLSTN1-523	0			c.G1806A						.						169.0	159.0	163.0					1																	9795602		2203	4300	6503	SO:0001583	missense	22883	exon13			GTGCTGCATGGCC	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.1806G>A	1.37:g.9795602C>T	ENSP00000366513:p.Met602Ile	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	188	34	NM_001009566	0	0	296	456	160	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	ENST00000377298.4	37	CCDS30580.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	12.87	2.066247	0.36470	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.27890	1.64;1.64;1.64;1.64	5.91	5.0	0.66597	.	0.155624	0.64402	N	0.000001	T	0.30603	0.0770	L	0.56396	1.775	0.80722	D	1	B;B;B	0.32188	0.245;0.359;0.245	B;B;B	0.26202	0.03;0.067;0.03	T	0.06110	-1.0845	10	0.40728	T	0.16	-19.7085	15.1111	0.72359	0.0:0.9325:0.0:0.0675	.	583;592;602	B4E3Q1;O94985-2;O94985	.;.;CSTN1_HUMAN	I	602;592;403;583;583	ENSP00000366513:M602I;ENSP00000354997:M592I;ENSP00000401934:M403I;ENSP00000366502:M583I	ENSP00000354997:M592I	M	-	3	0	CLSTN1	9718189	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	4.824000	0.62701	1.505000	0.48720	-0.140000	0.14226	ATG	C|0.999;T|0.001		0.527	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
SRRM1	10250	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	24993373	24993373	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:24993373C>T	ENST00000323848.9	+	13	2011	c.1696C>T	c.(1696-1698)Cct>Tct	p.P566S	SRRM1_ENST00000374389.4_Missense_Mutation_p.P575S|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.P578S|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000537199.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	566	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TCCCGCCCCTCCTCCTCGACG	0.537																																					p.P566S	Ovarian(68;897 1494 3282 17478)												.	SRRM1-93	0			c.C1696T						.						53.0	45.0	48.0					1																	24993373		2203	4300	6503	SO:0001583	missense	10250	exon13			GCCCCTCCTCCTC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1696C>T	1.37:g.24993373C>T	ENSP00000326261:p.Pro566Ser	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	58	8	NM_005839	0	0	80	126	46	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712855	0.48517	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.55760	0.5;0.7;0.83	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.63920	0.2552	L	0.40543	1.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.54275	-0.8318	10	0.11794	T	0.64	-3.0627	19.3453	0.94361	0.0:1.0:0.0:0.0	.	578;566	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	S	566;578;575	ENSP00000326261:P566S;ENSP00000391430:P578S;ENSP00000363510:P575S	ENSP00000326261:P566S	P	+	1	0	SRRM1	24865960	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.310000	0.51911	2.654000	0.90174	0.650000	0.86243	CCT	.		0.537	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
BSDC1	55108	broad.mit.edu	37	1	32842099	32842099	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:32842099T>G	ENST00000455895.2	-	9	953	c.920A>C	c.(919-921)cAa>cCa	p.Q307P	BSDC1_ENST00000446293.2_Missense_Mutation_p.Q324P|BSDC1_ENST00000463967.1_5'Flank|BSDC1_ENST00000419121.2_Missense_Mutation_p.Q251P|BSDC1_ENST00000341071.7_Missense_Mutation_p.Q324P|BSDC1_ENST00000413080.1_Missense_Mutation_p.Q246P|BSDC1_ENST00000449308.1_Missense_Mutation_p.Q307P|BSDC1_ENST00000526031.1_Missense_Mutation_p.Q212P	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	307										breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TAGCAGCTTTTGGGACAGGTC	0.597																																					p.Q324P													.	BSDC1-92	0			c.A971C						.						106.0	98.0	100.0					1																	32842099		2203	4300	6503	SO:0001583	missense	55108	exon9			AGCTTTTGGGACA	BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.920A>C	1.37:g.32842099T>G	ENSP00000412173:p.Gln307Pro	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	184	3	NM_001143888	0	0	94	94	0	B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Missense_Mutation	SNP	ENST00000455895.2	37	CCDS363.2	.	.	.	.	.	.	.	.	.	.	T	13.73	2.325416	0.41197	.	.	ENSG00000160058	ENST00000455895;ENST00000413080;ENST00000341071;ENST00000526031;ENST00000419121;ENST00000446293;ENST00000449308	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	4.87	3.76	0.43208	.	0.225151	0.46442	D	0.000283	T	0.36386	0.0965	L	0.43152	1.355	0.44447	D	0.997376	B;B;B;B;B	0.13594	0.008;0.002;0.002;0.002;0.002	B;B;B;B;B	0.16289	0.015;0.009;0.009;0.002;0.004	T	0.15752	-1.0426	10	0.24483	T	0.36	-9.315	9.7393	0.40409	0.0:0.0834:0.0:0.9166	.	212;251;324;324;307	Q9NW68-9;Q9NW68-8;Q9NW68-7;Q9NW68-3;Q9NW68	.;.;.;.;BSDC1_HUMAN	P	307;246;324;212;251;324;307	ENSP00000412173:Q307P;ENSP00000409114:Q246P;ENSP00000344816:Q324P;ENSP00000432382:Q212P;ENSP00000405752:Q251P;ENSP00000397759:Q324P;ENSP00000391762:Q307P	ENSP00000344816:Q324P	Q	-	2	0	BSDC1	32614686	0.999000	0.42202	0.997000	0.53966	0.967000	0.64934	3.056000	0.49923	2.131000	0.65755	0.379000	0.24179	CAA	.		0.597	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020056.3	NM_018045	
POGZ	23126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151378756	151378756	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:151378756G>A	ENST00000271715.2	-	19	3069	c.2755C>T	c.(2755-2757)Cca>Tca	p.P919S	POGZ_ENST00000531094.1_Missense_Mutation_p.P857S|POGZ_ENST00000392723.1_Missense_Mutation_p.P866S|POGZ_ENST00000368863.2_Missense_Mutation_p.P824S|POGZ_ENST00000409503.1_Missense_Mutation_p.P910S|POGZ_ENST00000361398.3_Missense_Mutation_p.P866S|POGZ_ENST00000491586.1_Missense_Mutation_p.P875S|POGZ_ENST00000540984.1_Missense_Mutation_p.P281S	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	919	Pro-rich.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTGGGGGTTGGTGGTGGGGTT	0.592																																					p.P919S		.											.	POGZ-93	0			c.C2755T						.						73.0	73.0	73.0					1																	151378756		2203	4300	6503	SO:0001583	missense	23126	exon19			GGGTTGGTGGTGG	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2755C>T	1.37:g.151378756G>A	ENSP00000271715:p.Pro919Ser	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	140	32	NM_015100	0	0	18	31	13	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653454	0.29425	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.23552	5.88;5.91;5.88;5.84;5.89;5.88;1.9;5.37	5.87	3.95	0.45737	.	0.748779	0.12616	N	0.453449	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001;0.0	T	0.34527	-0.9825	10	0.45353	T	0.12	-1.4299	8.593	0.33699	0.0805:0.2988:0.6207:0.0	.	857;910;824;875;866;919	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	S	866;919;866;824;910;857;281;875	ENSP00000376484:P866S;ENSP00000271715:P919S;ENSP00000354467:P866S;ENSP00000357856:P824S;ENSP00000386836:P910S;ENSP00000431259:P857S;ENSP00000443547:P281S;ENSP00000418408:P875S	ENSP00000271715:P919S	P	-	1	0	POGZ	149645380	0.165000	0.22948	0.788000	0.31933	0.966000	0.64601	0.747000	0.26290	1.446000	0.47643	0.655000	0.94253	CCA	.		0.592	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
BTG2	7832	broad.mit.edu	37	1	203276560	203276560	+	Silent	SNP	C	C	T	rs377245155		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:203276560C>T	ENST00000290551.4	+	2	542	c.471C>T	c.(469-471)tcC>tcT	p.S157S	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	157					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			TGGCAGTCTCCAGCTAGGCCC	0.632																																					p.S157S													.	BTG2-651	0			c.C471T						.	C		0,4392		0,0,2196	24.0	25.0	25.0		471	4.8	1.0	1		25	1,8565		0,1,4282	no	coding-synonymous	BTG2	NM_006763.2		0,1,6478	TT,TC,CC		0.0117,0.0,0.0077		157/159	203276560	1,12957	2196	4283	6479	SO:0001819	synonymous_variant	7832	exon2			AGTCTCCAGCTAG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.471C>T	1.37:g.203276560C>T		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	60	4	NM_006763	0	0	70	84	14	A0A024R986|Q3KR25|Q5VUT0	Silent	SNP	ENST00000290551.4	37	CCDS1437.1																																																																																			.		0.632	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
MARC1	64757	broad.mit.edu	37	1	220964857	220964857	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:220964857G>A	ENST00000366910.5	+	2	486	c.300G>A	c.(298-300)gaG>gaA	p.E100E		NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	100					detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										TCAACCAGGAGGGAAACATGG	0.522																																					p.E100E													.	.	0			c.G300A						.						104.0	87.0	93.0					1																	220964857		2203	4300	6503	SO:0001819	synonymous_variant	64757	exon2			CCAGGAGGGAAAC	AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.300G>A	1.37:g.220964857G>A		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	70	4	NM_022746	0	0	1	1	0	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Silent	SNP	ENST00000366910.5	37	CCDS1526.1	.	.	.	.	.	.	.	.	.	.	G	8.167	0.790793	0.16258	.	.	ENSG00000186205	ENST00000407981	.	.	.	5.07	-5.6	0.02497	.	.	.	.	.	T	0.34745	0.0908	.	.	.	0.46416	D	0.999037	.	.	.	.	.	.	T	0.44298	-0.9337	4	.	.	.	-18.3348	0.5286	0.00624	0.2115:0.2571:0.2398:0.2915	.	.	.	.	R	9	.	.	G	+	1	0	MOSC1	219031480	0.003000	0.15002	0.021000	0.16686	0.909000	0.53808	-1.803000	0.01740	-0.429000	0.07329	0.650000	0.86243	GGG	.		0.522	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090904.1	NM_022746	
ACTA1	58	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	229568083	229568083	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:229568083C>T	ENST00000366684.3	-	4	652	c.550G>A	c.(550-552)Ggc>Agc	p.G184S	ACTA1_ENST00000366683.2_Intron	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	184			G -> D (in NEM3; mild). {ECO:0000269|PubMed:10508519, ECO:0000269|PubMed:15236405}.		cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				AGATCGCGGCCCGCCAGGTCC	0.677																																					p.G184S		.											.	ACTA1-90	0			c.G550A						.						38.0	37.0	38.0					1																	229568083		2203	4299	6502	SO:0001583	missense	58	exon4			CGCGGCCCGCCAG	J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.550G>A	1.37:g.229568083C>T	ENSP00000355645:p.Gly184Ser	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	76	13	NM_001100	0	0	1	1	0	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	ENST00000366684.3	37	CCDS1578.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399571	0.62177	.	.	ENSG00000143632	ENST00000366684;ENST00000366682	D	0.99586	-6.23	4.58	3.67	0.42095	.	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	H	0.99609	4.655	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.96775	0.9571	10	0.87932	D	0	.	12.6981	0.57016	0.0:0.9198:0.0:0.0802	.	184	P68133	ACTS_HUMAN	S	184;149	ENSP00000355645:G184S	ENSP00000355643:G149S	G	-	1	0	ACTA1	227634706	1.000000	0.71417	0.846000	0.33378	0.920000	0.55202	7.545000	0.82128	1.143000	0.42306	0.650000	0.86243	GGC	.		0.677	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092781.1	NM_001100	
DIP2C	22982	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	390986	390986	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr10:390986G>A	ENST00000280886.6	-	27	3383	c.3296C>T	c.(3295-3297)gCg>gTg	p.A1099V		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1099						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AGCCGCCGCCGCCTCCCTGGA	0.602																																					p.A1099V													.	DIP2C-156	0			c.C3296T						.						57.0	49.0	52.0					10																	390986		2203	4300	6503	SO:0001583	missense	22982	exon27			GCCGCCGCCTCCC	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3296C>T	10.37:g.390986G>A	ENSP00000280886:p.Ala1099Val	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	36	7	NM_014974	0	0	21	38	17	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	34	5.405888	0.96051	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.10288	2.89	5.59	5.59	0.84812	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.34424	0.0897	M	0.73372	2.23	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00857	-1.1538	10	0.34782	T	0.22	-28.982	19.59	0.95506	0.0:0.0:1.0:0.0	.	1099	Q9Y2E4	DIP2C_HUMAN	V	1099;24	ENSP00000280886:A1099V	ENSP00000280886:A1099V	A	-	2	0	DIP2C	380986	1.000000	0.71417	0.994000	0.49952	0.641000	0.38312	9.813000	0.99286	2.639000	0.89480	0.655000	0.94253	GCG	.		0.602	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
CAMK1D	57118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	12595265	12595265	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr10:12595265C>T	ENST00000378847.3	+	2	471	c.134C>T	c.(133-135)aCt>aTt	p.T45I	CAMK1D_ENST00000378845.1_Missense_Mutation_p.T45I|CAMK1D_ENST00000487696.1_Intron	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	45	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		GAGAAGGCAACTGGCAAGCTC	0.468																																					p.T45I		.											.	CAMK1D-334	0			c.C134T						.						162.0	150.0	154.0					10																	12595265		2203	4300	6503	SO:0001583	missense	57118	exon2			AGGCAACTGGCAA	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.134C>T	10.37:g.12595265C>T	ENSP00000368124:p.Thr45Ile	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	189	35	NM_153498	0	0	8	9	1	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	37	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.507699	0.44558	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.49139	0.79;0.79	5.14	4.23	0.50019	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055122	0.64402	D	0.000001	T	0.57888	0.2084	M	0.89785	3.06	0.45648	D	0.99857	B;B	0.19073	0.033;0.011	B;B	0.23716	0.048;0.047	T	0.62586	-0.6823	10	0.87932	D	0	-12.4567	13.7457	0.62874	0.0:0.6876:0.3124:0.0	.	45;45	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	I	45	ENSP00000368124:T45I;ENSP00000368122:T45I	ENSP00000368122:T45I	T	+	2	0	CAMK1D	12635271	1.000000	0.71417	0.981000	0.43875	0.946000	0.59487	3.132000	0.50523	1.127000	0.42034	0.561000	0.74099	ACT	.		0.468	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
ATRNL1	26033	hgsc.bcm.edu;broad.mit.edu	37	10	116889093	116889093	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr10:116889093A>C	ENST00000355044.3	+	5	751	c.625A>C	c.(625-627)Aat>Cat	p.N209H	ATRNL1_ENST00000527407.1_Missense_Mutation_p.N209H|ATRNL1_ENST00000529665.1_3'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	209	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.|EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TTACAGAATCAATTCTTGTCC	0.303																																					p.N209H		.											.	ATRNL1-96	0			c.A625C						.						86.0	84.0	84.0					10																	116889093		2203	4300	6503	SO:0001583	missense	26033	exon5			AGAATCAATTCTT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.625A>C	10.37:g.116889093A>C	ENSP00000347152:p.Asn209His	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	48	10	NM_207303	0	0	0	0	0	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.275216	0.80580	.	.	ENSG00000107518	ENST00000526946;ENST00000355044	T;T	0.51071	0.72;0.72	5.47	5.47	0.80525	CUB (3);Epidermal growth factor-like, type 3 (1);	0.040008	0.85682	D	0.000000	T	0.68815	0.3042	M	0.76002	2.32	0.80722	D	1	D;D;D	0.71674	0.977;0.998;0.986	P;D;P	0.78314	0.754;0.991;0.875	T	0.73222	-0.4051	10	0.87932	D	0	-20.838	15.5419	0.76057	1.0:0.0:0.0:0.0	.	142;209;209	E9PL90;Q5VV63;Q5VV63-2	.;ATRN1_HUMAN;.	H	142;209	ENSP00000431423:N142H;ENSP00000347152:N209H	ENSP00000347152:N209H	N	+	1	0	ATRNL1	116879083	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.307000	0.96226	2.085000	0.62840	0.383000	0.25322	AAT	.		0.303	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
SLC43A1	8501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57261478	57261478	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:57261478T>A	ENST00000278426.3	-	8	1214	c.859A>T	c.(859-861)Aac>Tac	p.N287Y	SLC43A1_ENST00000528450.1_Missense_Mutation_p.N287Y|SLC43A1_ENST00000533515.1_5'UTR	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TCAGGAAGGTTTTCTGAGGTG	0.567											OREG0020651	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N287Y		.											.	SLC43A1-90	0			c.A859T						.						74.0	65.0	68.0					11																	57261478		2201	4296	6497	SO:0001583	missense	8501	exon8			GAAGGTTTTCTGA	AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.859A>T	11.37:g.57261478T>A	ENSP00000278426:p.Asn287Tyr	Somatic	74	0	1021	WXS	Illumina HiSeq	Phase_I	62	13	NM_001198810	0	0	0	0	0		Missense_Mutation	SNP	ENST00000278426.3	37	CCDS7958.1	.	.	.	.	.	.	.	.	.	.	t	15.67	2.901506	0.52227	.	.	ENSG00000149150	ENST00000278426;ENST00000528450;ENST00000533066	T;T;T	0.58060	0.36;0.36;1.47	5.57	-2.09	0.07232	Major facilitator superfamily domain, general substrate transporter (1);	1.826000	0.01877	N	0.037616	T	0.36524	0.0970	N	0.14661	0.345	0.09310	N	1	P	0.48911	0.917	P	0.46419	0.516	T	0.21965	-1.0230	10	0.35671	T	0.21	0.3003	1.7106	0.02891	0.1305:0.2328:0.1338:0.5029	.	287	O75387	LAT3_HUMAN	Y	287;287;256	ENSP00000278426:N287Y;ENSP00000435673:N287Y;ENSP00000435647:N256Y	ENSP00000278426:N287Y	N	-	1	0	SLC43A1	57018054	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	0.234000	0.17930	-0.008000	0.14320	0.459000	0.35465	AAC	.		0.567	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627	
CAPN5	726	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	76825445	76825445	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:76825445C>T	ENST00000278559.3	+	5	853	c.664C>T	c.(664-666)Cac>Tac	p.H222Y	CAPN5_ENST00000456580.2_Missense_Mutation_p.H262Y|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Missense_Mutation_p.H222Y	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	222	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						GTTAAAGGTGCACAGCCGGGG	0.592											OREG0021255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H222Y		.											.	CAPN5-90	0			c.C664T						.						200.0	190.0	194.0					11																	76825445		2200	4292	6492	SO:0001583	missense	726	exon5			AAGGTGCACAGCC		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.664C>T	11.37:g.76825445C>T	ENSP00000278559:p.His222Tyr	Somatic	438	1	1171	WXS	Illumina HiSeq	Phase_I	330	21	NM_004055	0	0	58	68	10	O00263	Missense_Mutation	SNP	ENST00000278559.3	37	CCDS8248.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992258	0.54041	.	.	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	D;D;D	0.87179	-2.22;-2.22;-2.22	4.72	4.72	0.59763	Peptidase C2, calpain, catalytic domain (3);	0.049774	0.85682	D	0.000000	T	0.79569	0.4468	L	0.31926	0.97	0.80722	D	1	B;B;B;B	0.18461	0.028;0.022;0.01;0.028	B;B;B;B	0.22753	0.041;0.035;0.021;0.041	T	0.72821	-0.4177	10	0.02654	T	1	.	16.8563	0.86007	0.0:1.0:0.0:0.0	.	260;262;262;222	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	Y	222;262;222;262;262	ENSP00000278559:H222Y;ENSP00000432332:H222Y;ENSP00000409996:H262Y	ENSP00000278559:H222Y	H	+	1	0	CAPN5	76503093	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.902000	0.56310	2.438000	0.82558	0.655000	0.94253	CAC	.		0.592	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
USP35	57558	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	77921303	77921303	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:77921303C>T	ENST00000529308.1	+	10	2663	c.2402C>T	c.(2401-2403)cCg>cTg	p.P801L	USP35_ENST00000441408.2_Missense_Mutation_p.P387L|USP35_ENST00000530535.1_3'UTR|USP35_ENST00000530267.1_Missense_Mutation_p.P369L|USP35_ENST00000526425.1_Missense_Mutation_p.P532L	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	801	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			AGCCAAGGGCCGTGCTACCTC	0.622																																					p.P801L		.											.	USP35-637	0			c.C2402T						.						86.0	98.0	94.0					11																	77921303		2167	4250	6417	SO:0001583	missense	57558	exon10			AAGGGCCGTGCTA	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.2402C>T	11.37:g.77921303C>T	ENSP00000431876:p.Pro801Leu	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	112	8	NM_020798	0	0	7	8	1		Missense_Mutation	SNP	ENST00000529308.1	37	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572013	0.86542	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	4.35	4.35	0.52113	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000019	D	0.96457	0.8844	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98113	1.0421	10	0.87932	D	0	-41.8622	17.0748	0.86583	0.0:1.0:0.0:0.0	.	801;387	Q9P2H5;E7EWV7	UBP35_HUMAN;.	L	369;801;387;532	ENSP00000435468:P369L;ENSP00000431876:P801L;ENSP00000400825:P387L;ENSP00000434942:P532L	ENSP00000400825:P387L	P	+	2	0	USP35	77598951	1.000000	0.71417	0.993000	0.49108	0.817000	0.46193	7.600000	0.82769	2.257000	0.74773	0.436000	0.28706	CCG	.		0.622	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877713	82877713	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:82877713A>G	ENST00000298281.4	+	5	2226	c.1774A>G	c.(1774-1776)Aag>Gag	p.K592E		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	592					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GCAAAGTTCCAAGTCTGCCAA	0.368																																					p.K592E		.											.	PCF11-23	0			c.A1774G						.						71.0	71.0	71.0					11																	82877713		1781	3947	5728	SO:0001583	missense	51585	exon5			AGTTCCAAGTCTG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1774A>G	11.37:g.82877713A>G	ENSP00000298281:p.Lys592Glu	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	156	29	NM_015885	0	0	8	11	3	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.926781	0.52759	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.49720	1.75;0.79;0.77	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000007	T	0.58293	0.2112	L	0.32530	0.975	0.49687	D	0.999816	D;D	0.69078	0.997;0.993	D;D	0.75020	0.985;0.971	T	0.54801	-0.8239	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	592;592	E9PQ01;O94913	.;PCF11_HUMAN	E	592	ENSP00000298281:K592E;ENSP00000434540:K592E;ENSP00000431567:K592E	.	K	+	1	0	PCF11	82555361	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.414000	0.73318	2.326000	0.78906	0.533000	0.62120	AAG	.		0.368	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
ATF7	11016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53910964	53910964	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr12:53910964G>A	ENST00000548446.2	-	12	1554	c.1442C>T	c.(1441-1443)tCg>tTg	p.S481L	RP11-793H13.3_ENST00000548347.1_RNA|ATF7_ENST00000328463.7_Missense_Mutation_p.S481L|ATF7_ENST00000456903.4_Missense_Mutation_p.S470L|ATF7_ENST00000420353.2_Missense_Mutation_p.S470L|RP11-793H13.10_ENST00000591834.1_Intron|ATF7_ENST00000415113.1_Missense_Mutation_p.S449L|ATF7_ENST00000546661.1_5'UTR			P17544	ATF7_HUMAN	activating transcription factor 7	481	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	GATTACATGCGATTGTATCGG	0.587																																					p.S470L		.											.	ATF7-455	0			c.C1409T						.						112.0	109.0	110.0					12																	53910964		2075	4216	6291	SO:0001583	missense	11016	exon12			ACATGCGATTGTA	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1442C>T	12.37:g.53910964G>A	ENSP00000449938:p.Ser481Leu	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	184	36	NM_006856	0	0	33	50	17	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		.	.	.	.	.	.	.	.	.	.	G	24.4	4.522447	0.85600	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.56776	0.47;0.47;0.44;0.49;0.49	4.47	4.47	0.54385	.	0.132552	0.52532	D	0.000064	T	0.43233	0.1238	L	0.53249	1.67	0.54753	D	0.999981	P;P;B	0.46327	0.876;0.804;0.0	B;B;B	0.28553	0.091;0.042;0.001	T	0.58797	-0.7573	10	0.87932	D	0	-16.9898	16.5074	0.84276	0.0:0.0:1.0:0.0	.	449;470;481	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	L	481;481;294;449;470;470	ENSP00000449938:S481L;ENSP00000329212:S481L;ENSP00000404880:S449L;ENSP00000399465:S470L;ENSP00000387406:S470L	ENSP00000304187:S294L	S	-	2	0	ATF7	52197231	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.990000	0.76225	2.513000	0.84729	0.456000	0.33151	TCG	.		0.587	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
SMARCC2	6601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56558339	56558339	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr12:56558339T>C	ENST00000267064.4	-	27	3402	c.3316A>G	c.(3316-3318)Atc>Gtc	p.I1106V	SMARCC2_ENST00000347471.4_Intron|SMARCC2_ENST00000550164.1_Missense_Mutation_p.I1137V|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000394023.3_Intron	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1106	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TTAATACTGATGGAGTCAGCT	0.587																																					p.I1106V		.											.	SMARCC2-229	0			c.A3316G						.						103.0	89.0	94.0					12																	56558339		2203	4300	6503	SO:0001583	missense	6601	exon27			TACTGATGGAGTC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3316A>G	12.37:g.56558339T>C	ENSP00000267064:p.Ile1106Val	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	120	42	NM_003075	0	0	29	76	47	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.300338	0.23650	.	.	ENSG00000139613	ENST00000550164;ENST00000267064	T;T	0.44881	0.91;0.94	5.28	3.99	0.46301	.	0.593150	0.16689	N	0.203617	T	0.20577	0.0495	N	0.08118	0	0.25483	N	0.987717	B	0.02656	0.0	B	0.01281	0.0	T	0.19811	-1.0294	9	.	.	.	-5.712	7.8812	0.29623	0.0:0.1805:0.0:0.8195	.	1106	Q8TAQ2	SMRC2_HUMAN	V	1137;1106	ENSP00000449396:I1137V;ENSP00000267064:I1106V	.	I	-	1	0	SMARCC2	54844606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.211000	0.32382	0.832000	0.34804	0.460000	0.39030	ATC	.		0.587	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
VSIG10	54621	hgsc.bcm.edu	37	12	118506354	118506354	+	Silent	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr12:118506354T>C	ENST00000359236.5	-	8	1671	c.1395A>G	c.(1393-1395)gaA>gaG	p.E465E		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	465	Glu-rich.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						cctcctcctcttcctcttcTG	0.458																																					p.E465E		.											.	.	0			c.A1395G						.						97.0	90.0	93.0					12																	118506354		2037	4183	6220	SO:0001819	synonymous_variant	54621	exon8			CTCCTCTTCCTCT		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1395A>G	12.37:g.118506354T>C		Somatic	35	1		WXS	Illumina HiSeq	Phase_I	26	2	NM_019086	0	0	18	18	0	Q9NWQ7	Silent	SNP	ENST00000359236.5	37	CCDS44992.1																																																																																			.		0.458	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
GCH1	2643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	55310765	55310765	+	Silent	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr14:55310765C>T	ENST00000491895.2	-	6	911	c.723G>A	c.(721-723)cgG>cgA	p.R241R	GCH1_ENST00000254299.4_5'UTR|GCH1_ENST00000395514.1_Silent_p.R241R|GCH1_ENST00000543643.2_Intron|GCH1_ENST00000536224.2_Intron	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1	241			R -> W (in DYT5). {ECO:0000269|PubMed:9778264}.		7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						GGAACTCTTCCCGAGTCTTTG	0.493																																					p.R241R	Pancreas(198;1245 2204 4807 21567 38372)	.											.	GCH1-91	0			c.G723A						.						185.0	145.0	158.0					14																	55310765		2203	4300	6503	SO:0001819	synonymous_variant	2643	exon6			CTCTTCCCGAGTC	U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.723G>A	14.37:g.55310765C>T		Somatic	164	1		WXS	Illumina HiSeq	Phase_I	155	24	NM_000161	0	0	11	11	0	Q6FHY7|Q9Y4I8	Silent	SNP	ENST00000491895.2	37	CCDS9720.1																																																																																			.		0.493	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276895.3		
BTBD6	90135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105716270	105716270	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr14:105716270C>T	ENST00000392554.3	+	4	1016	c.719C>T	c.(718-720)gCc>gTc	p.A240V	BRF1_ENST00000546474.1_Intron|BRF1_ENST00000551787.1_5'Flank|BRF1_ENST00000440513.3_Intron|BRF1_ENST00000327359.3_Intron|BTBD6_ENST00000536364.1_Missense_Mutation_p.A240V|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BTBD6_ENST00000463376.2_Missense_Mutation_p.A165V|BTBD6_ENST00000327471.3_Missense_Mutation_p.A165V|BRF1_ENST00000446501.2_5'Flank|BRF1_ENST00000379932.4_5'Flank			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	240						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		ACTCGGGAGGCCCTCAACACC	0.617																																					p.A240V		.											.	BTBD6-90	0			c.C719T						.						30.0	27.0	28.0					14																	105716270		2201	4298	6499	SO:0001583	missense	90135	exon5			GGGAGGCCCTCAA	AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.719C>T	14.37:g.105716270C>T	ENSP00000376337:p.Ala240Val	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	44	7	NM_033271	0	0	47	71	24	Q8IVQ7|Q9BR94	Missense_Mutation	SNP	ENST00000392554.3	37	CCDS10002.2	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920172	0.52653	.	.	ENSG00000184887	ENST00000536364;ENST00000537513;ENST00000392554;ENST00000463376;ENST00000327471	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.07	5.07	0.68467	BTB/Kelch-associated (2);	0.118294	0.64402	D	0.000020	T	0.66218	0.2767	L	0.39898	1.24	0.48511	D	0.999668	B	0.29341	0.242	B	0.39935	0.314	T	0.69011	-0.5258	10	0.87932	D	0	-31.8506	15.9457	0.79792	0.0:1.0:0.0:0.0	.	240	Q96KE9	BTBD6_HUMAN	V	240;240;240;165;165	ENSP00000443091:A240V;ENSP00000446223:A240V;ENSP00000376337:A240V;ENSP00000418150:A165V;ENSP00000329361:A165V	ENSP00000329361:A165V	A	+	2	0	BTBD6	104787315	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	7.655000	0.83696	2.331000	0.79229	0.563000	0.77884	GCC	.		0.617	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074556.4		
MYO5C	55930	broad.mit.edu	37	15	52504078	52504078	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr15:52504078A>G	ENST00000261839.7	-	35	4306	c.4145T>C	c.(4144-4146)tTg>tCg	p.L1382S		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1382						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		ACGGGGCTTCAAGTCTGAAGC	0.537																																					p.L1382S													.	MYO5C-145	0			c.T4145C						.						55.0	57.0	57.0					15																	52504078		2055	4216	6271	SO:0001583	missense	55930	exon35			GGCTTCAAGTCTG	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4145T>C	15.37:g.52504078A>G	ENSP00000261839:p.Leu1382Ser	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	87	3	NM_018728	0	0	0	0	0	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.588593	0.86851	.	.	ENSG00000128833	ENST00000261839	T	0.25749	1.78	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000009	T	0.48095	0.1481	M	0.81802	2.56	0.80722	D	1	P	0.51449	0.945	P	0.55615	0.78	T	0.54616	-0.8267	10	0.87932	D	0	.	15.3487	0.74363	1.0:0.0:0.0:0.0	.	1382	Q9NQX4	MYO5C_HUMAN	S	1382	ENSP00000261839:L1382S	ENSP00000261839:L1382S	L	-	2	0	MYO5C	50291370	1.000000	0.71417	0.927000	0.36925	0.965000	0.64279	9.139000	0.94554	2.208000	0.71279	0.460000	0.39030	TTG	.		0.537	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
ACAN	176	hgsc.bcm.edu	37	15	89389052	89389052	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr15:89389052C>G	ENST00000561243.1	+	6	1368	c.1368C>G	c.(1366-1368)ttC>ttG	p.F456L	ACAN_ENST00000559004.1_Missense_Mutation_p.F456L|ACAN_ENST00000439576.2_Missense_Mutation_p.F456L|ACAN_ENST00000352105.7_Missense_Mutation_p.F456L|ACAN_ENST00000558207.1_Missense_Mutation_p.F456L			P16112	PGCA_HUMAN	aggrecan	456					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCACGGCATTCACCAGTGAGG	0.647																																					p.F456L		.											.	ACAN-25	0			c.C1368G						.						15.0	17.0	17.0					15																	89389052		2006	4159	6165	SO:0001583	missense	176	exon7			GGCATTCACCAGT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1368C>G	15.37:g.89389052C>G	ENSP00000453342:p.Phe456Leu	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	13	2	NM_001135	0	0	2	2	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531494	0.45073	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02158	4.65;4.42	5.37	4.46	0.54185	.	0.247838	0.21313	N	0.076607	T	0.03305	0.0096	M	0.66939	2.045	0.35117	D	0.766671	P;P;P	0.42908	0.793;0.793;0.731	B;B;B	0.38842	0.283;0.283;0.184	T	0.49560	-0.8927	10	0.14656	T	0.56	-15.7967	10.4531	0.44535	0.0:0.9094:0.0:0.0906	.	456;456;456	E7ENV9;E7EX88;Q6PID9	.;.;.	L	456	ENSP00000387356:F456L;ENSP00000341615:F456L	ENSP00000268134:F456L	F	+	3	2	ACAN	87190056	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	2.606000	0.46291	1.412000	0.46977	0.655000	0.94253	TTC	.		0.647	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
FAM86A	196483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	5140457	5140457	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr16:5140457T>A	ENST00000427587.4	-	5	520	c.452A>T	c.(451-453)gAg>gTg	p.E151V	FAM86A_ENST00000458008.4_Missense_Mutation_p.E117V|FAM86A_ENST00000587133.1_Missense_Mutation_p.E90V	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	151						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TGCCGGGTTCTCGATGGCCCA	0.642																																					p.E151V		.											.	FAM86A-90	0			c.A452T						.						86.0	84.0	85.0					16																	5140457		2197	4300	6497	SO:0001583	missense	196483	exon5			GGGTTCTCGATGG	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.452A>T	16.37:g.5140457T>A	ENSP00000398502:p.Glu151Val	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	159	16	NM_201400	0	0	18	21	3	D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	37	CCDS10529.1	.	.	.	.	.	.	.	.	.	.	t	17.73	3.461895	0.63513	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.20200	2.09;2.09	5.02	5.02	0.67125	.	0.188239	0.45867	D	0.000338	T	0.21761	0.0524	N	0.26042	0.785	0.44337	D	0.997227	P;P	0.40731	0.682;0.728	P;P	0.46850	0.522;0.529	T	0.02042	-1.1224	10	0.51188	T	0.08	.	12.2508	0.54597	0.0:0.0:0.0:1.0	.	117;151	Q96G04-2;Q96G04	.;FA86A_HUMAN	V	117;151	ENSP00000389710:E117V;ENSP00000398502:E151V	ENSP00000398502:E151V	E	-	2	0	FAM86A	5080458	0.999000	0.42202	0.910000	0.35882	0.241000	0.25554	6.872000	0.75536	2.117000	0.64856	0.370000	0.22315	GAG	.		0.642	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400	
TPPP3	51673	broad.mit.edu;bcgsc.ca	37	16	67424233	67424233	+	Silent	SNP	C	C	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr16:67424233C>G	ENST00000564104.1	-	3	1216	c.375G>C	c.(373-375)ctG>ctC	p.L125L	TPPP3_ENST00000393957.2_Silent_p.L125L|RNU1-123P_ENST00000458950.1_RNA|TPPP3_ENST00000290942.5_Silent_p.L125L|TPPP3_ENST00000562206.1_Silent_p.L125L			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	125					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		TGGTGTCCGTCAGCCGGTCTA	0.617																																					p.L125L													.	TPPP3-90	0			c.G375C						.						129.0	119.0	122.0					16																	67424233		2198	4300	6498	SO:0001819	synonymous_variant	51673	exon5			GTCCGTCAGCCGG	BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.375G>C	16.37:g.67424233C>G		Somatic	261	0		WXS	Illumina HiSeq	Phase_I	255	7	NM_016140	0	0	49	50	1	Q49AH9|Q9Y326|Q9Y6H0	Silent	SNP	ENST00000564104.1	37	CCDS10835.1																																																																																			.		0.617	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421787.2	NM_015964	
OR1D5	8386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	2966535	2966535	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:2966535A>T	ENST00000575751.1	-	1	366	c.367T>A	c.(367-369)Tat>Aat	p.Y123N		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	123					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						GTGGCCACATAGCGATCATAC	0.572																																					p.Y123N		.											.	.	0			c.T367A						.						72.0	79.0	77.0					17																	2966535		2188	4298	6486	SO:0001583	missense	8386	exon1			CCACATAGCGATC	AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.367T>A	17.37:g.2966535A>T	ENSP00000459028:p.Tyr123Asn	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	130	39	NM_014566	0	0	0	0	0	Q96RA6	Missense_Mutation	SNP	ENST00000575751.1	37	CCDS58499.1																																																																																			.		0.572	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438410.2	NM_014566	
MYH2	4620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10426831	10426831	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:10426831G>A	ENST00000245503.5	-	37	5838	c.5454C>T	c.(5452-5454)atC>atT	p.I1818I	MYH2_ENST00000397183.2_Silent_p.I1818I|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1818					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCAGTTTCTGGATCTGCTTCT	0.507																																					p.I1818I		.											.	MYH2-194	0			c.C5454T						.						97.0	103.0	101.0					17																	10426831		2203	4300	6503	SO:0001819	synonymous_variant	4620	exon37			TTTCTGGATCTGC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5454C>T	17.37:g.10426831G>A		Somatic	190	0		WXS	Illumina HiSeq	Phase_I	230	82	NM_017534	0	0	50	50	0	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	CCDS11156.1																																																																																			.		0.507	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	395	46		WXS	Illumina HiSeq		462	56	NM_145301	0	0	10	77	67	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
RHBDL3	162494	bcgsc.ca	37	17	30632400	30632400	+	Silent	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:30632400C>T	ENST00000269051.4	+	7	836	c.822C>T	c.(820-822)gtC>gtT	p.V274V	RHBDL3_ENST00000538145.1_Silent_p.V266V|RHBDL3_ENST00000536287.1_Silent_p.V176V	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	274						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				CCGCTCCAGTCGTGGGCTCTT	0.572																																					p.V274V													.	RHBDL3-91	0			c.C822T						.						174.0	140.0	151.0					17																	30632400		2203	4300	6503	SO:0001819	synonymous_variant	162494	exon7			TCCAGTCGTGGGC	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.822C>T	17.37:g.30632400C>T		Somatic	149	0		WXS	Illumina HiSeq	Phase_1	167	20	NM_138328	0	0	0	0	0	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Silent	SNP	ENST00000269051.4	37	CCDS32613.1																																																																																			.		0.572	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1	NM_138328	
RDM1	201299	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	34257138	34257138	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:34257138G>A	ENST00000293273.6	-	2	263	c.218C>T	c.(217-219)gCc>gTc	p.A73V	RDM1_ENST00000394527.1_Missense_Mutation_p.A50V|RDM1_ENST00000394528.3_Missense_Mutation_p.A73V|RDM1_ENST00000431884.2_Missense_Mutation_p.A73V|RDM1_ENST00000591402.1_Missense_Mutation_p.A50V|RDM1_ENST00000430160.2_Missense_Mutation_p.A50V|RDM1_ENST00000425909.3_Missense_Mutation_p.A73V|RDM1_ENST00000419453.2_Missense_Mutation_p.A50V|RDM1_ENST00000394529.3_Missense_Mutation_p.A50V	NM_145654.3	NP_663629.1	Q8NG50	RDM1_HUMAN	RAD52 motif containing 1	73	Necessary for nuclear localization and for nucleolar accumulation in response to heat shock.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(3)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)	9		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GGCTCTGTGGGCAGCCCTTGC	0.493								Other identified genes with known or suspected DNA repair function																													p.A73V		.											.	RDM1-228	0			c.C218T						.						115.0	125.0	122.0					17																	34257138		2203	4300	6503	SO:0001583	missense	201299	exon2			CTGTGGGCAGCCC	AB080728	CCDS11301.1, CCDS42299.1, CCDS54111.1, CCDS54108.1, CCDS54109.1, CCDS54110.1, CCDS59280.1, CCDS59281.1	17q11.2	2014-04-10	2014-04-10	2005-10-20	ENSG00000187456	ENSG00000278023		"""RNA binding motif (RRM) containing"""	19950	protein-coding gene	gene with protein product		612896	"""RAD52 homolog B (S. cerevisiae)"", ""RAD52 motif 1"""	RAD52B		15611051	Standard	NM_001163120		Approved	MGC33977	uc002hkh.3	Q8NG50	OTTHUMG00000188399	ENST00000293273.6:c.218C>T	17.37:g.34257138G>A	ENSP00000293273:p.Ala73Val	Somatic	271	0		WXS	Illumina HiSeq	Phase_I	361	23	NM_001034836	0	0	0	0	0	A0JP55|A8MV46|A8MY68|A8MZ92|A8RCS5|A8RCT0|A8RCT5|A8RCT8|A8RCU3|A8RCU8|A8RCW0|A8RCW5	Missense_Mutation	SNP	ENST00000293273.6	37	CCDS11301.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807688	0.50421	.	.	ENSG00000187456	ENST00000293273;ENST00000394529;ENST00000431884;ENST00000425909;ENST00000436836;ENST00000430160;ENST00000394528;ENST00000394527	T;T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58	3.78	3.78	0.43462	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.134512	0.49916	D	0.000140	T	0.52108	0.1714	M	0.79475	2.455	0.35240	D	0.777732	D;D;P;P;P;D;D;D;P	0.54397	0.957;0.957;0.946;0.859;0.946;0.957;0.957;0.966;0.946	P;P;B;B;P;P;P;P;P	0.61874	0.751;0.491;0.41;0.41;0.636;0.491;0.545;0.895;0.636	T	0.67090	-0.5758	10	0.54805	T	0.06	-6.8607	13.5182	0.61553	0.0:0.0:1.0:0.0	.	50;50;73;73;50;50;73;73;50	B4DZ74;Q8NG50-4;Q8NG50-5;Q8NG50-10;Q8NG50-2;Q8NG50-11;A8MY68;Q8NG50;Q8NG50-6	.;.;.;.;.;.;.;RDM1_HUMAN;.	V	73;50;73;73;73;50;73;50	ENSP00000293273:A73V;ENSP00000378037:A50V;ENSP00000391290:A73V;ENSP00000393620:A73V;ENSP00000397431:A73V;ENSP00000413421:A50V;ENSP00000378036:A73V;ENSP00000378035:A50V	ENSP00000293273:A73V	A	-	2	0	RDM1	31281251	1.000000	0.71417	0.014000	0.15608	0.101000	0.19017	4.843000	0.62838	2.141000	0.66446	0.655000	0.94253	GCC	.		0.493	RDM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256588.2	NM_145654	
MLX	6945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40720856	40720856	+	Splice_Site	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:40720856T>C	ENST00000246912.4	+	4	386	c.333T>C	c.(331-333)gaT>gaC	p.D111D	MLX_ENST00000435881.2_Splice_Site_p.D57D|MLX_ENST00000346833.4_Splice_Site_p.D27D	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	111					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		TGAGCGTAGATGATGAGGACA	0.607																																					p.D111D	GBM(121;657 1601 4665 24731 34640)	.											.	MLX-90	0			c.T333C						.						30.0	26.0	27.0					17																	40720856		2203	4300	6503	SO:0001630	splice_region_variant	6945	exon4			CGTAGATGATGAG	AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.332-1T>C	17.37:g.40720856T>C		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	23	6	NM_170607	0	0	0	0	0	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Silent	SNP	ENST00000246912.4	37	CCDS11430.1																																																																																			.		0.607	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450415.1	NM_170607	Silent
KMT2B	9757	ucsc.edu	37	19	36228069	36228069	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:36228069C>G	ENST00000222270.7	+	33	7455	c.7455C>G	c.(7453-7455)tgC>tgG	p.C2485W	IGFLR1_ENST00000587101.1_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.C2485W	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	2485	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CCCAGCGTTGCCAGCACTATA	0.627																																					p.C2485W													.	MLL4-697	0			c.C7455G						.						19.0	22.0	21.0					19																	36228069		2107	4231	6338	SO:0001583	missense	8085	exon33			GCGTTGCCAGCAC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7455C>G	19.37:g.36228069C>G	ENSP00000222270:p.Cys2485Trp	Somatic	28	0		WXS	Illumina HiSeq		12	2	NM_014727	0	0	18	26	8	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	9.266	1.044498	0.19748	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	T;T	0.58210	0.35;0.35	4.8	1.51	0.23008	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);	0.000000	0.47093	D	0.000255	T	0.69205	0.3085	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69113	-0.5231	10	0.87932	D	0	.	9.2199	0.37370	0.0:0.7553:0.0:0.2447	.	2485	Q9UMN6	MLL4_HUMAN	W	2485	ENSP00000222270:C2485W;ENSP00000398837:C2485W	ENSP00000222270:C2485W	C	+	3	2	AD000671.1	40919909	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	1.334000	0.33827	0.243000	0.21327	-0.253000	0.11424	TGC	.		0.627	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
ZNF568	374900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37441598	37441598	+	Missense_Mutation	SNP	T	T	C	rs201711551		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:37441598T>C	ENST00000333987.7	+	7	2049	c.1543T>C	c.(1543-1545)Tca>Cca	p.S515P	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.S451P	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAGTCAGAAATCAAACCTCAC	0.383													T|||	1	0.000199681	0.0	0.0	5008	,	,		19315	0.0		0.001	False		,,,				2504	0.0				p.S515P		.											.	ZNF568-136	0			c.T1543C						.	T	PRO/SER,PRO/SER,PRO/SER,,,PRO/SER	0,4270		0,0,2135	61.0	67.0	65.0		1540,1351,1351,,,1543	1.6	1.0	19		65	4,8558		0,4,4277	yes	missense,missense,missense,intron,intron,missense	ZNF568	NM_001204835.1,NM_001204836.1,NM_001204837.1,NM_001204838.1,NM_001204839.1,NM_198539.3	74,74,74,,,74	0,4,6412	CC,CT,TT		0.0467,0.0,0.0312	probably-damaging,probably-damaging,probably-damaging,,,probably-damaging	514/644,451/581,451/581,,,515/645	37441598	4,12828	2135	4281	6416	SO:0001583	missense	374900	exon7			CAGAAATCAAACC	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.1543T>C	19.37:g.37441598T>C	ENSP00000334685:p.Ser515Pro	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	101	15	NM_198539	0	0	2	2	0	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	CCDS42558.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	T	14.80	2.645026	0.47258	0.0	4.67E-4	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.07908	3.15;3.15	3.96	1.61	0.23674	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.28847	N	0.013944	T	0.27765	0.0683	M	0.84433	2.695	0.23865	N	0.996623	D	0.89917	1.0	D	0.91635	0.999	T	0.02333	-1.1175	10	0.87932	D	0	.	9.0886	0.36596	0.0:0.0:0.346:0.654	.	515	Q3ZCX4	ZN568_HUMAN	P	515;451	ENSP00000334685:S515P;ENSP00000394514:S451P	ENSP00000334685:S515P	S	+	1	0	ZNF568	42133438	0.000000	0.05858	0.961000	0.40146	0.992000	0.81027	-0.500000	0.06405	0.660000	0.30964	0.383000	0.25322	TCA	T|1.000;C|0.000		0.383	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
DHDH	27294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49447704	49447704	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:49447704T>G	ENST00000221403.2	+	6	875	c.835T>G	c.(835-837)Ttt>Gtt	p.F279V	DHDH_ENST00000522614.1_Intron|DHDH_ENST00000523250.1_Missense_Mutation_p.F140V	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	279					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GGACTGCAATTTTGACAACGG	0.622																																					p.F279V		.											.	DHDH-90	0			c.T835G						.						65.0	63.0	63.0					19																	49447704		2203	4300	6503	SO:0001583	missense	27294	exon6			TGCAATTTTGACA	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.835T>G	19.37:g.49447704T>G	ENSP00000221403:p.Phe279Val	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	110	24	NM_014475	0	0	13	32	19		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453658	0.63290	.	.	ENSG00000104808	ENST00000221403;ENST00000523250	T;T	0.21361	2.01;2.01	4.89	3.87	0.44632	.	0.210406	0.49916	D	0.000136	T	0.23330	0.0564	M	0.77616	2.38	0.80722	D	1	B	0.27117	0.168	B	0.28638	0.092	T	0.05903	-1.0857	10	0.33940	T	0.23	-6.6788	6.733	0.23393	0.0:0.1029:0.0:0.8971	.	279	Q9UQ10	DHDH_HUMAN	V	279;140	ENSP00000221403:F279V;ENSP00000428935:F140V	ENSP00000221403:F279V	F	+	1	0	DHDH	54139516	1.000000	0.71417	0.040000	0.18447	0.014000	0.08584	4.583000	0.60964	2.183000	0.69458	0.402000	0.26972	TTT	.		0.622	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
DHDH	27294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49447728	49447728	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:49447728T>A	ENST00000221403.2	+	6	899	c.859T>A	c.(859-861)Tat>Aat	p.Y287N	DHDH_ENST00000522614.1_Intron|DHDH_ENST00000523250.1_Missense_Mutation_p.Y148N	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	287					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		AGGCATGAGTTATGAGGCCAA	0.627																																					p.Y287N		.											.	DHDH-90	0			c.T859A						.						70.0	67.0	68.0					19																	49447728		2203	4300	6503	SO:0001583	missense	27294	exon6			ATGAGTTATGAGG	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.859T>A	19.37:g.49447728T>A	ENSP00000221403:p.Tyr287Asn	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	116	20	NM_014475	0	0	16	25	9		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	T	34	5.369860	0.95900	.	.	ENSG00000104808	ENST00000221403;ENST00000523250	T;T	0.24151	1.87;1.87	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.63301	-0.6668	10	0.59425	D	0.04	-13.1857	11.3361	0.49505	0.0:0.0:0.0:1.0	.	287	Q9UQ10	DHDH_HUMAN	N	287;148	ENSP00000221403:Y287N;ENSP00000428935:Y148N	ENSP00000221403:Y287N	Y	+	1	0	DHDH	54139540	0.999000	0.42202	0.059000	0.19551	0.914000	0.54420	6.248000	0.72418	2.252000	0.74401	0.402000	0.26972	TAT	.		0.627	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
ZSCAN18	65982	broad.mit.edu	37	19	58596700	58596700	+	Silent	SNP	G	G	A	rs200010643	byFrequency	TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:58596700G>A	ENST00000240727.6	-	7	1284	c.885C>T	c.(883-885)gcC>gcT	p.A295A	ZSCAN18_ENST00000600404.1_Silent_p.A351A|ZSCAN18_ENST00000421612.2_Silent_p.A159A|ZSCAN18_ENST00000601144.1_Silent_p.A295A	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	295					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCGCGGGGGCGGCCTCCTCGC	0.741													G|||	6	0.00119808	0.0038	0.0014	5008	,	,		12777	0.0		0.0	False		,,,				2504	0.0				p.A351A													.	ZSCAN18-90	0			c.C1053T						.						6.0	8.0	8.0					19																	58596700		1513	3173	4686	SO:0001819	synonymous_variant	65982	exon7			GGGGGCGGCCTCC	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.885C>T	19.37:g.58596700G>A		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	26	4	NM_001145542	0	0	42	62	20	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Silent	SNP	ENST00000240727.6	37	CCDS12971.1																																																																																			G|0.998;A|0.002		0.741	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	NM_023926	
PDIA6	10130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	10927529	10927529	+	Silent	SNP	A	A	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr2:10927529A>T	ENST00000272227.3	-	11	1182	c.1035T>A	c.(1033-1035)ctT>ctA	p.L345L	PDIA6_ENST00000381611.4_Silent_p.L350L|PDIA6_ENST00000404824.2_Silent_p.L393L|PDIA6_ENST00000540494.1_Silent_p.L342L|PDIA6_ENST00000404371.2_Silent_p.L397L	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	345					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		ACGCGGTCTCAAGTTCAGACT	0.488																																					p.L345L	GBM(73;509 1219 34219 41343 41551)	.											.	PDIA6-90	0			c.T1035A						.						81.0	83.0	82.0					2																	10927529		2203	4300	6503	SO:0001819	synonymous_variant	10130	exon11			GGTCTCAAGTTCA	BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.1035T>A	2.37:g.10927529A>T		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	80	10	NM_005742	0	0	675	771	96	B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Silent	SNP	ENST00000272227.3	37	CCDS1675.1																																																																																			.		0.488	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1	NM_005742	
STAT1	6772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	191859893	191859893	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr2:191859893A>T	ENST00000361099.3	-	10	1225	c.838T>A	c.(838-840)Ttg>Atg	p.L280M	STAT1_ENST00000392322.3_Missense_Mutation_p.L280M|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.L280M|STAT1_ENST00000392323.2_Missense_Mutation_p.L282M	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	280					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			AATTCCTCCAACTTTTTAAGC	0.448																																					p.L280M		.											.	STAT1-1335	0			c.T838A						.						158.0	136.0	143.0					2																	191859893		2203	4300	6503	SO:0001583	missense	6772	exon10			CCTCCAACTTTTT		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.838T>A	2.37:g.191859893A>T	ENSP00000354394:p.Leu280Met	Somatic	96	1		WXS	Illumina HiSeq	Phase_I	109	35	NM_007315	0	0	103	164	61	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464088	0.63513	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.66	3.89	0.44902	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.000000	0.85682	D	0.000000	T	0.79246	0.4413	M	0.86651	2.83	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79108	0.98;0.992	T	0.80185	-0.1487	10	0.72032	D	0.01	-20.1979	9.7711	0.40589	0.21:0.0:0.79:0.0	.	280;280	P42224-2;P42224	.;STAT1_HUMAN	M	280;280;280;282	ENSP00000354394:L280M;ENSP00000386244:L280M;ENSP00000376136:L280M;ENSP00000376137:L282M	ENSP00000354394:L280M	L	-	1	2	STAT1	191568138	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	5.579000	0.67457	0.757000	0.33036	-1.059000	0.02297	TTG	.		0.448	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
WNT10A	80326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219754883	219754883	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr2:219754883G>A	ENST00000258411.3	+	3	1187	c.554G>A	c.(553-555)gGt>gAt	p.G185D		NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	185					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGCAGCGTGGTAAGGGCCTG	0.672																																					p.G185D		.											.	WNT10A-523	0			c.G554A						.						48.0	43.0	45.0					2																	219754883		2203	4300	6503	SO:0001583	missense	80326	exon3			AGCGTGGTAAGGG	AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.554G>A	2.37:g.219754883G>A	ENSP00000258411:p.Gly185Asp	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	67	13	NM_025216	0	0	4	4	0	Q53S44|Q96TA7|Q9H7S8	Missense_Mutation	SNP	ENST00000258411.3	37	CCDS2426.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760111	0.89932	.	.	ENSG00000135925	ENST00000258411	T	0.75821	-0.97	4.46	4.46	0.54185	.	0.408178	0.26328	N	0.025007	D	0.84165	0.5412	M	0.71581	2.175	0.80722	D	1	D	0.63880	0.993	D	0.64144	0.922	D	0.86269	0.1660	10	0.72032	D	0.01	.	16.6424	0.85129	0.0:0.0:1.0:0.0	.	185	Q9GZT5	WN10A_HUMAN	D	185	ENSP00000258411:G185D	ENSP00000258411:G185D	G	+	2	0	WNT10A	219463127	1.000000	0.71417	0.795000	0.32087	0.929000	0.56500	9.117000	0.94347	2.478000	0.83669	0.655000	0.94253	GGT	.		0.672	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256730.2	NM_025216	
GPR55	9290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231775289	231775289	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr2:231775289C>T	ENST00000392040.1	-	2	581	c.389G>A	c.(388-390)aGc>aAc	p.S130N	GPR55_ENST00000392039.2_Missense_Mutation_p.S130N|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	130					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		CCGGAGGTGGCTCACCAGTAG	0.557																																					p.S130N		.											.	GPR55-91	0			c.G389A						.						51.0	46.0	48.0					2																	231775289		2203	4300	6503	SO:0001583	missense	9290	exon2			AGGTGGCTCACCA	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.389G>A	2.37:g.231775289C>T	ENSP00000375894:p.Ser130Asn	Somatic	76	1		WXS	Illumina HiSeq	Phase_I	78	8	NM_005683	0	0	0	0	0	Q8N580	Missense_Mutation	SNP	ENST00000392040.1	37	CCDS2480.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412948	0.25465	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.71698	-0.59;-0.59;-0.59	5.65	-1.33	0.09172	GPCR, rhodopsin-like superfamily (1);	0.431206	0.27464	N	0.019252	T	0.54806	0.1881	L	0.39397	1.21	0.21553	N	0.999648	B	0.02656	0.0	B	0.06405	0.002	T	0.41538	-0.9503	10	0.28530	T	0.3	-29.6367	9.6559	0.39925	0.0:0.4621:0.0:0.5379	.	130	Q9Y2T6	GPR55_HUMAN	N	130	ENSP00000375894:S130N;ENSP00000375893:S130N;ENSP00000412768:S130N	ENSP00000375893:S130N	S	-	2	0	GPR55	231483533	0.000000	0.05858	0.993000	0.49108	0.496000	0.33645	-0.132000	0.10467	-0.141000	0.11374	-0.940000	0.02684	AGC	.		0.557	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683	
TP53TG5	27296	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	44005872	44005872	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr20:44005872C>G	ENST00000372726.3	-	3	390	c.234G>C	c.(232-234)aaG>aaC	p.K78N	TP53TG5_ENST00000537995.1_Missense_Mutation_p.K62N|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000494455.1_5'UTR	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	78					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						TGCGGAGAATCTTTGGAACAC	0.512																																					p.K78N		.											.	TP53TG5-90	0			c.G234C						.						168.0	155.0	160.0					20																	44005872		2203	4300	6503	SO:0001583	missense	27296	exon3			GAGAATCTTTGGA	AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.234G>C	20.37:g.44005872C>G	ENSP00000361811:p.Lys78Asn	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	185	11	NM_014477	0	0	0	0	0		Missense_Mutation	SNP	ENST00000372726.3	37	CCDS13352.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593647	0.46214	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	T;T	0.18338	2.22;2.22	5.43	5.43	0.79202	.	1.020720	0.07785	N	0.953949	T	0.25195	0.0612	L	0.39898	1.24	0.09310	N	1	P	0.49090	0.919	P	0.48704	0.587	T	0.20438	-1.0275	10	0.66056	D	0.02	-0.733	12.8311	0.57746	0.0:0.8361:0.1639:0.0	.	78	Q9Y2B4	T53G5_HUMAN	N	78;62	ENSP00000361811:K78N;ENSP00000438374:K62N	ENSP00000361811:K78N	K	-	3	2	TP53TG5	43439286	0.039000	0.19947	0.020000	0.16555	0.437000	0.31866	2.319000	0.43788	2.720000	0.93068	0.591000	0.81541	AAG	.		0.512	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079460.1	NM_014477	
GRM2	2912	broad.mit.edu	37	3	51749233	51749233	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr3:51749233A>C	ENST00000395052.3	+	4	1678	c.1444A>C	c.(1444-1446)Acc>Ccc	p.T482P	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	482					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GACTCTGGACACCAGCCTCAT	0.627																																					p.T482P													.	GRM2-522	0			c.A1444C						.						61.0	51.0	54.0					3																	51749233		2203	4300	6503	SO:0001583	missense	2912	exon4			CTGGACACCAGCC	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.1444A>C	3.37:g.51749233A>C	ENSP00000378492:p.Thr482Pro	Somatic	43	6		WXS	Illumina HiSeq	Phase_I	39	7	NM_000839	0	0	0	0	0	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954193	0.34471	.	.	ENSG00000164082	ENST00000395052	D	0.88201	-2.35	4.95	0.946	0.19549	.	0.053035	0.85682	D	0.000000	T	0.76378	0.3979	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.62714	-0.6796	10	0.31617	T	0.26	.	6.0978	0.20031	0.716:0.1364:0.1476:0.0	.	482	Q14416	GRM2_HUMAN	P	482	ENSP00000378492:T482P	ENSP00000378492:T482P	T	+	1	0	GRM2	51724273	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	3.038000	0.49783	0.337000	0.23665	0.379000	0.24179	ACC	.		0.627	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E542K	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA-27752	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	c.G1624A						.						56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290	exon10			CTCTCTGAAATCA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	87	24	NM_006218	0	0	5	14	9	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	.		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PCDHB10	56126	broad.mit.edu	37	5	140573732	140573732	+	Missense_Mutation	SNP	G	G	A	rs17844579		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr5:140573732G>A	ENST00000239446.4	+	1	1791	c.1607G>A	c.(1606-1608)cGc>cAc	p.R536H		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	536	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCACAGACCGCGGCTCCCCC	0.682																																					p.R536H													.	PCDHB10-92	0			c.G1607A						.						52.0	70.0	64.0					5																	140573732		2203	4298	6501	SO:0001583	missense	56126	exon1			CAGACCGCGGCTC	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1607G>A	5.37:g.140573732G>A	ENSP00000239446:p.Arg536His	Somatic	286	0		WXS	Illumina HiSeq	Phase_I	217	5	NM_018930	0	0	3	3	0	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	g	9.720	1.159514	0.21454	.	.	ENSG00000120324	ENST00000239446	T	0.01745	4.66	3.53	2.55	0.30701	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01189	0.0039	N	0.11789	0.175	0.09310	N	1	B	0.29481	0.245	B	0.27715	0.082	T	0.49173	-0.8967	9	0.44086	T	0.13	.	3.8548	0.08971	0.2488:0.2797:0.4715:0.0	rs17844579	536	Q9UN67	PCDBA_HUMAN	H	536	ENSP00000239446:R536H	ENSP00000239446:R536H	R	+	2	0	PCDHB10	140553916	0.000000	0.05858	0.964000	0.40570	0.903000	0.53119	-0.301000	0.08232	0.821000	0.34540	0.549000	0.68633	CGC	G|1.000;T|0.000		0.682	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
GFPT2	9945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179751868	179751868	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr5:179751868G>A	ENST00000253778.8	-	8	793	c.624C>T	c.(622-624)gtC>gtT	p.V208V	GFPT2_ENST00000520165.1_5'Flank	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	208	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	ATTTGCTCCGGACTCCGATGA	0.542																																					p.V208V		.											.	GFPT2-92	0			c.C624T						.						96.0	104.0	101.0					5																	179751868		1961	4154	6115	SO:0001819	synonymous_variant	9945	exon8			GCTCCGGACTCCG	AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.624C>T	5.37:g.179751868G>A		Somatic	181	1		WXS	Illumina HiSeq	Phase_I	168	32	NM_005110	0	0	6	7	1	Q53XM2|Q9BWS4	Silent	SNP	ENST00000253778.8	37	CCDS43411.1																																																																																			.		0.542	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	
GRM4	2914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	34059742	34059742	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr6:34059742C>T	ENST00000538487.2	-	3	1097	c.654G>A	c.(652-654)tgG>tgA	p.W218*	GRM4_ENST00000544773.2_Nonsense_Mutation_p.W49*|GRM4_ENST00000374181.4_Nonsense_Mutation_p.W218*|GRM4_ENST00000455714.2_Nonsense_Mutation_p.W78*|GRM4_ENST00000609222.1_Nonsense_Mutation_p.W85*|GRM4_ENST00000535756.1_Nonsense_Mutation_p.W85*|GRM4_ENST00000374177.3_Nonsense_Mutation_p.W149*	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	218					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						ACACATAGTTCCACTTGAGGG	0.617																																					p.W218X		.											.	GRM4-525	0			c.G654A						.						101.0	71.0	81.0					6																	34059742		2203	4300	6503	SO:0001587	stop_gained	2914	exon3			ATAGTTCCACTTG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.654G>A	6.37:g.34059742C>T	ENSP00000440556:p.Trp218*	Somatic	69	1		WXS	Illumina HiSeq	Phase_I	68	16	NM_001256811	0	0	0	0	0	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Nonsense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	37	6.085596	0.97271	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	.	.	.	4.07	4.07	0.47477	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4078	0.83697	0.0:1.0:0.0:0.0	.	.	.	.	X	218;149;85;49;218;78	.	ENSP00000363292:W149X	W	-	3	0	GRM4	34167720	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.647000	0.83462	2.080000	0.62538	0.561000	0.74099	TGG	.		0.617	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
CRIP3	401262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43275462	43275462	+	Silent	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr6:43275462T>C	ENST00000274990.4	-	4	220	c.216A>G	c.(214-216)gtA>gtG	p.V72V	ZNF318_ENST00000607252.1_5'UTR|CRIP3_ENST00000372569.3_Silent_p.V72V			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	72					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AGTAGGAGCCTACACCACCAA	0.627																																					p.V72V		.											.	CRIP3-91	0			c.A216G						.						45.0	48.0	47.0					6																	43275462		2203	4300	6503	SO:0001819	synonymous_variant	401262	exon4			GGAGCCTACACCA	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.216A>G	6.37:g.43275462T>C		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	97	18	NM_206922	0	0	1	1	0	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Silent	SNP	ENST00000274990.4	37		.	.	.	.	.	.	.	.	.	.	T	7.040	0.562412	0.13498	.	.	ENSG00000146215	ENST00000416431	.	.	.	5.52	3.63	0.41609	.	.	.	.	.	T	0.33323	0.0859	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30592	-0.9973	4	.	.	.	-35.039	4.1803	0.10372	0.1604:0.5979:0.1554:0.0862	.	.	.	.	G	20	.	.	R	-	1	2	CRIP3	43383440	0.290000	0.24343	1.000000	0.80357	0.744000	0.42396	-0.819000	0.04462	1.470000	0.48102	-0.132000	0.14878	AGG	.		0.627	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
TRGV5	6978	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	38389256	38389256	+	RNA	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:38389256T>C	ENST00000390344.2	-	0	251									T cell receptor gamma variable 5																		AGTTGGAAGATTTCTGACTGG	0.428																																					.													.	.	0			.						.						66.0	59.0	61.0					7																	38389256		1848	4019	5867			0	.			GGAAGATTTCTGA	M36286		7p14	2012-02-07				ENSG00000211697		"""T cell receptors / TRG locus"""	12290	other	T cell receptor gene	"""T-cell receptor, gamma, variable region V5"""			TCRGV5		2902186, 2969332	Standard	NG_001336		Approved	V1S5			OTTHUMG00000155101		7.37:g.38389256T>C		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	117	31	.	0	0	2	2	0		RNA	SNP	ENST00000390344.2	37																																																																																				.		0.428	TRGV5-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000338407.4	NG_001336	
ZNF679	168417	broad.mit.edu	37	7	63720697	63720697	+	Silent	SNP	A	A	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:63720697A>G	ENST00000421025.1	+	3	407	c.138A>G	c.(136-138)ttA>ttG	p.L46L	ZNF679_ENST00000255746.4_Silent_p.L46L	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	46	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						ATGTGATGTTAGAGAACTACA	0.378																																					p.L46L													.	ZNF679-1	0			c.A138G						.						47.0	42.0	44.0					7																	63720697		692	1591	2283	SO:0001819	synonymous_variant	168417	exon3			GATGTTAGAGAAC	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.138A>G	7.37:g.63720697A>G		Somatic	214	0		WXS	Illumina HiSeq	Phase_I	184	4	NM_153363	0	0	6	36	30		Silent	SNP	ENST00000421025.1	37	CCDS47592.1																																																																																			.		0.378	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
FZD1	8321	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	90894779	90894779	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:90894779G>A	ENST00000287934.2	+	1	997	c.584G>A	c.(583-585)cGc>cAc	p.R195H		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	195	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GAGCGCGCGCGCCAGGGCTGC	0.672																																					p.R195H		.											.	FZD1-658	0			c.G584A						.						52.0	58.0	56.0					7																	90894779		2199	4299	6498	SO:0001583	missense	8321	exon1			GCGCGCGCCAGGG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.584G>A	7.37:g.90894779G>A	ENSP00000287934:p.Arg195His	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	169	33	NM_003505	0	0	56	76	20	A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	ENST00000287934.2	37	CCDS5620.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936514	0.92458	.	.	ENSG00000157240	ENST00000287934	T	0.76839	-1.05	4.69	4.69	0.59074	Frizzled domain (5);	0.000000	0.64402	D	0.000003	D	0.90407	0.6997	H	0.94542	3.55	0.80722	D	1	D	0.65815	0.995	P	0.61132	0.884	D	0.93351	0.6718	10	0.87932	D	0	.	17.7914	0.88553	0.0:0.0:1.0:0.0	.	195	Q9UP38	FZD1_HUMAN	H	195	ENSP00000287934:R195H	ENSP00000287934:R195H	R	+	2	0	FZD1	90732715	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.543000	0.73874	2.430000	0.82344	0.561000	0.74099	CGC	.		0.672	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
PTCD1	26024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99022814	99022814	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:99022814G>A	ENST00000292478.4	-	6	1591	c.1341C>T	c.(1339-1341)gcC>gcT	p.A447A	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.A496A|PTCD1_ENST00000555673.1_Silent_p.A496A	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	447					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TAGGGGGAACGGCCCCGGGGG	0.647																																					p.A496A		.											.	.	0			c.C1488T						.						58.0	61.0	60.0					7																	99022814		2203	4300	6503	SO:0001819	synonymous_variant	100526740	exon7			GGGAACGGCCCCG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1341C>T	7.37:g.99022814G>A		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	149	50	NM_001198879	0	0	7	20	13	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	37	CCDS34691.1																																																																																			.		0.647	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
ZCWPW1	55063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100016757	100016757	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:100016757T>C	ENST00000398027.2	-	5	585	c.338A>G	c.(337-339)cAg>cGg	p.Q113R	ZCWPW1_ENST00000360951.4_Missense_Mutation_p.Q113R|ZCWPW1_ENST00000490721.1_5'UTR|ZCWPW1_ENST00000324725.6_5'UTR	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	113							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AAGGGACTTCTGCAGAACAAT	0.438																																					p.Q113R		.											.	ZCWPW1-90	0			c.A338G						.						167.0	155.0	159.0					7																	100016757		1886	4103	5989	SO:0001583	missense	55063	exon5			GACTTCTGCAGAA	AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.338A>G	7.37:g.100016757T>C	ENSP00000381109:p.Gln113Arg	Somatic	235	2		WXS	Illumina HiSeq	Phase_I	246	96	NM_001258008	0	0	1	1	0	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	ENST00000398027.2	37	CCDS43623.1	.	.	.	.	.	.	.	.	.	.	T	12.12	1.841227	0.32513	.	.	ENSG00000078487	ENST00000398027;ENST00000360951;ENST00000379559	T;T	0.48522	0.82;0.81	5.59	-7.95	0.01148	.	0.871285	0.09674	N	0.770768	T	0.26195	0.0639	N	0.17474	0.49	0.80722	D	1	B;B;B;B	0.12630	0.006;0.002;0.001;0.005	B;B;B;B	0.16722	0.016;0.002;0.001;0.003	T	0.13575	-1.0504	9	.	.	.	0.2273	13.8447	0.63459	0.0:0.5835:0.0:0.4165	.	113;113;113;113	B4E3W9;B4DUQ2;C9J435;Q9H0M4	.;.;.;ZCPW1_HUMAN	R	113	ENSP00000381109:Q113R;ENSP00000354210:Q113R	.	Q	-	2	0	ZCWPW1	99854693	0.208000	0.23494	0.873000	0.34254	0.986000	0.74619	-1.340000	0.02650	-1.437000	0.01967	-0.376000	0.06991	CAG	.		0.438	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356083.1	NM_017984	
SERPINE1	5054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100780346	100780346	+	Silent	SNP	G	G	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:100780346G>C	ENST00000223095.4	+	8	1309	c.1152G>C	c.(1150-1152)gtG>gtC	p.V384V	SERPINE1_ENST00000445463.2_Silent_p.V369V	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	384					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TCCTCTTTGTGGTCCGGCACA	0.552																																					p.V384V		.											.	SERPINE1-652	0			c.G1152C						.						139.0	117.0	125.0					7																	100780346		2203	4300	6503	SO:0001819	synonymous_variant	5054	exon8			CTTTGTGGTCCGG	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.1152G>C	7.37:g.100780346G>C		Somatic	202	0		WXS	Illumina HiSeq	Phase_I	203	27	NM_000602	0	0	33	34	1	B7Z4S0|F8WD53	Silent	SNP	ENST00000223095.4	37	CCDS5711.1																																																																																			.		0.552	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602	
SLC26A5	375611	broad.mit.edu;bcgsc.ca	37	7	103017286	103017286	+	Silent	SNP	G	G	T	rs372287716		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:103017286G>T	ENST00000306312.3	-	19	2271	c.2010C>A	c.(2008-2010)gtC>gtA	p.V670V	SLC26A5_ENST00000432958.2_Silent_p.V638V|SLC26A5_ENST00000339444.6_Silent_p.V670V|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000393727.1_Silent_p.V672V|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000354356.4_Silent_p.V103V|SLC26A5_ENST00000393723.1_Silent_p.V640V|SLC26A5_ENST00000393730.1_Silent_p.V638V|SLC26A5_ENST00000393729.1_Silent_p.V633V	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	670	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						CATATATACCGACGTCTCCAT	0.308																																					p.V670V													.	SLC26A5-91	0			c.C2010A						.						110.0	113.0	112.0					7																	103017286		2203	4295	6498	SO:0001819	synonymous_variant	375611	exon19			TATACCGACGTCT	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.2010C>A	7.37:g.103017286G>T		Somatic	134	0		WXS	Illumina HiSeq	Phase_I	171	8	NM_206883	0	0	0	0	0	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Silent	SNP	ENST00000306312.3	37	CCDS5733.1																																																																																			.		0.308	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
HSDL2	84263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	115181173	115181173	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr9:115181173A>G	ENST00000398805.3	+	6	760	c.533A>G	c.(532-534)tAt>tGt	p.Y178C	HSDL2_ENST00000488101.1_3'UTR|HSDL2_ENST00000539114.1_Intron|HSDL2_ENST00000262542.7_Missense_Mutation_p.Y58C|HSDL2_ENST00000398803.1_Missense_Mutation_p.Y105C	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	178						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						ATGTCTATGTATGTGCTTGGA	0.274																																					p.Y178C		.											.	HSDL2-90	0			c.A533G						.						146.0	133.0	137.0					9																	115181173		1844	4082	5926	SO:0001583	missense	84263	exon6			CTATGTATGTGCT	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.533A>G	9.37:g.115181173A>G	ENSP00000381785:p.Tyr178Cys	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	83	6	NM_032303	0	0	83	101	18	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	37	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	A	4.417	0.077003	0.08485	.	.	ENSG00000119471	ENST00000398805;ENST00000398803;ENST00000262542	D;D;T	0.89810	-2.23;-2.57;2.17	5.54	4.61	0.57282	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.043003	0.85682	N	0.000000	T	0.66237	0.2769	N	0.00611	-1.325	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.67364	-0.5689	10	0.02654	T	1	.	14.288	0.66258	0.0732:0.0:0.9268:0.0	.	105;178	Q6YN16-2;Q6YN16	.;HSDL2_HUMAN	C	178;105;58	ENSP00000381785:Y178C;ENSP00000381783:Y105C;ENSP00000262542:Y58C	ENSP00000262542:Y58C	Y	+	2	0	HSDL2	114220994	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.348000	0.79366	1.462000	0.47948	-0.321000	0.08615	TAT	.		0.274	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
ALAD	210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	116151742	116151742	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr9:116151742G>A	ENST00000409155.3	-	10	973	c.777C>T	c.(775-777)gaC>gaT	p.D259D	ALAD_ENST00000277315.5_Silent_p.D242D|ALAD_ENST00000482001.1_5'Flank	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	259					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	CCCGCACGATGTCCAGGTAGG	0.567																																					p.D259D		.											.	ALAD-90	0			c.C777T						.						116.0	110.0	112.0					9																	116151742		2203	4300	6503	SO:0001819	synonymous_variant	210	exon10			CACGATGTCCAGG	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.777C>T	9.37:g.116151742G>A		Somatic	168	0		WXS	Illumina HiSeq	Phase_I	112	26	NM_000031	0	0	36	63	27	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Silent	SNP	ENST00000409155.3	37	CCDS6794.2																																																																																			.		0.567	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945	
CHST7	56548	hgsc.bcm.edu	37	X	46434588	46434588	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chrX:46434588A>C	ENST00000276055.3	+	1	1370	c.1222A>C	c.(1222-1224)Atg>Ctg	p.M408L		NM_019886.2	NP_063939.2	Q9NS84	CHST7_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7	408					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|N-acetylglucosamine metabolic process (GO:0006044)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			breast(3)|endometrium(2)|kidney(1)|lung(2)	8						CGCGCTCAACATGACTCGCGG	0.746																																					p.M408L		.											.	CHST7-133	0			c.A1222C						.						1.0	1.0	1.0					X																	46434588		1003	1936	2939	SO:0001583	missense	56548	exon1			CTCAACATGACTC	AB040711	CCDS14268.1	Xp11.3	2008-02-05			ENSG00000147119	ENSG00000147119		"""Sulfotransferases, membrane-bound"""	13817	protein-coding gene	gene with protein product		300375				10781596	Standard	NM_019886		Approved	C6ST-2, C6ST2	uc004dgt.3	Q9NS84	OTTHUMG00000021423	ENST00000276055.3:c.1222A>C	X.37:g.46434588A>C	ENSP00000276055:p.Met408Leu	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_019886	0	0	0	0	0	O75667	Missense_Mutation	SNP	ENST00000276055.3	37	CCDS14268.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.226851	0.79576	.	.	ENSG00000147119	ENST00000276055	D	0.81908	-1.55	4.63	3.44	0.39384	Sulfotransferase domain (1);	0.103863	0.64402	D	0.000007	D	0.84857	0.5565	L	0.49455	1.56	0.39368	D	0.966037	D	0.60575	0.988	D	0.77557	0.99	T	0.80362	-0.1414	10	0.10636	T	0.68	-25.0942	8.8051	0.34932	0.8291:0.0:0.0:0.1709	.	408	Q9NS84	CHST7_HUMAN	L	408	ENSP00000276055:M408L	ENSP00000276055:M408L	M	+	1	0	CHST7	46319532	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	7.010000	0.76353	0.602000	0.29896	0.350000	0.21858	ATG	.		0.746	CHST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056362.1	NM_019886	
SLAMF1	6504	broad.mit.edu	37	1	160589601	160589601	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:160589601delT	ENST00000302035.6	-	5	1178	c.829delA	c.(829-831)agcfs	p.S277fs	SLAMF1_ENST00000355199.3_Frame_Shift_Del_p.S277fs|SLAMF1_ENST00000538290.1_Intron|SLAMF1_ENST00000235739.5_Frame_Shift_Del_p.S247fs	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	277					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ATCGTAAGGCTTTTTTTTTCC	0.433																																					p.S277fs													.	SLAMF1-154	0			c.829delA						.						265.0	264.0	264.0					1																	160589601		2203	4300	6503	SO:0001589	frameshift_variant	6504	exon5			TAAGGCTTTTTTT	U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.829delA	1.37:g.160589601delT	ENSP00000306190:p.Ser277fs	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	231	8	NM_003037	0	0	0	0	0	Q5W172|Q9HBE8	Frame_Shift_Del	DEL	ENST00000302035.6	37	CCDS1207.1																																																																																			.		0.433	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060454.1		
AGAP4	119016	broad.mit.edu	37	10	46342668	46342688	+	In_Frame_Del	DEL	GCTCCTGCCATCCTGTCCCCA	GCTCCTGCCATCCTGTCCCCA	-	rs200468982	byFrequency	TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	GCTCCTGCCATCCTGTCCCCA	GCTCCTGCCATCCTGTCCCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr10:46342668_46342688delGCTCCTGCCATCCTGTCCCCA	ENST00000448048.2	-	1	233_253	c.108_128delTGGGGACAGGATGGCAGGAGC	c.(106-129)gctggggacaggatggcaggagcg>gcg	p.36_43AGDRMAGA>A	AGAP4_ENST00000430779.2_5'UTR	NM_133446.2	NP_597703.2	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 4	36					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.G37_A43delGDRMAGA(1)		central_nervous_system(1)|lung(1)|ovary(1)	3						AGCCATGGGCGCTCCTGCCATCCTGTCCCCAGCTCCTGCCT	0.588																																					p.36_43del													.	AGAP4-23	1	Deletion - In frame(1)	central_nervous_system(1)	c.108_128del						.			0,6		0,0,3						-2.8	0.0			1	28,40		13,2,19	no	coding	AGAP4	NM_133446.2		13,2,22	A1A1,A1R,RR		41.1765,0.0,37.8378				28,46				SO:0001651	inframe_deletion	119016	exon1			ATGGGCGCTCCTG	AF411132	CCDS7215.1	10q11.21	2014-06-19	2008-09-22	2008-09-22	ENSG00000188234	ENSG00000188234		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23459	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 1"", ""ArfGAP with GTPase domain, ankyrin repeat and PH domain 8"", ""centaurin, gamma-like family, member 5"""	CTGLF1, AGAP8, CTGLF5		12477932	Standard	XM_005271797		Approved	Em:AC012044.1, MRIP2	uc001jcx.4	Q96P64	OTTHUMG00000018088	ENST00000448048.2:c.108_128delTGGGGACAGGATGGCAGGAGC	10.37:g.46342668_46342688delGCTCCTGCCATCCTGTCCCCA	ENSP00000392513:p.Ala36_Gly42del	Somatic	196	0		WXS	Illumina HiSeq	Phase_I	171	3	NM_133446	0	0	0	0	0		In_Frame_Del	DEL	ENST00000448048.2	37	CCDS7215.1																																																																																			.		0.588	AGAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047799.1	NM_133446	
KCNN1	3780	broad.mit.edu	37	19	18109140	18109140	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:18109140delC	ENST00000222249.9	+	11	1876	c.1557delC	c.(1555-1557)ggcfs	p.G519fs	ARRDC2_ENST00000379656.3_5'Flank	NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	519				PLPPRPGPGPQDQAARSSPCRWTPVAPSDC -> RLPRQRA GLDH (in Ref. 3; BAD86831). {ECO:0000305}.	potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CCAGGCCCGGCCCCGGCCCCC	0.751																																					p.G519fs													.	KCNN1-22	0			c.1557delC						.						2.0	3.0	3.0					19																	18109140		1429	3432	4861	SO:0001589	frameshift_variant	3780	exon11			GCCCGGCCCCGGC	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1557delC	19.37:g.18109140delC	ENSP00000476519:p.Gly519fs	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_002248	0	0	0	0	0	Q5KR10|Q6DJU4	Frame_Shift_Del	DEL	ENST00000222249.9	37																																																																																				.		0.751	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
HTT	3064	broad.mit.edu	37	4	3076604	3076609	+	In_Frame_Del	DEL	CAGCAG	CAGCAG	-	rs71180116|rs374076986	byFrequency	TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	CAGCAG	CAGCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr4:3076604_3076609delCAGCAG	ENST00000355072.5	+	1	197_202	c.52_57delCAGCAG	c.(52-57)cagcagdel	p.QQ36del	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	36	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CAAGTCCTTCcagcagcagcagcagc	0.704														1892	0.377796	0.0741	0.3343	5008	,	,		6929	0.7421		0.327	False		,,,				2504	0.4959				p.18_19del													.	HTT-281	0			c.52_57del						.			33,28,149		16,0,1,14,0,74						2.6	1.0		dbSNP_119	4	239,82,669		114,3,8,38,3,329	no	codingComplex	HTT	NM_002111.6		130,3,9,52,3,403	A1A1,A1A2,A1R,A2A2,A2R,RR		32.4242,29.0476,31.8333				272,110,818				SO:0001651	inframe_deletion	3064	exon1			TCCTTCCAGCAGC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.52_57delCAGCAG	4.37:g.3076610_3076615delCAGCAG	ENSP00000347184:p.Gln36_Gln37del	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_002111	0	0	0	0	0	Q9UQB7	In_Frame_Del	DEL	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.704	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
NR2C2AP	126382	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	19313644	19313645	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:19313644_19313645insT	ENST00000331552.7	-	2	447_448	c.84_85insA	c.(82-87)aaacatfs	p.H29fs	NR2C2AP_ENST00000544883.1_Frame_Shift_Ins_p.H29fs|NR2C2AP_ENST00000420605.3_Frame_Shift_Ins_p.H29fs|NR2C2AP_ENST00000538165.2_Frame_Shift_Ins_p.H29fs	NM_176880.4	NP_795361.1	Q86WQ0	NR2CA_HUMAN	nuclear receptor 2C2-associated protein	29					cell adhesion (GO:0007155)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|kidney(2)|ovary(1)	5			Epithelial(12;0.00235)			TCGAAAAGATGTTTTTTTCCAA	0.54																																					p.H29fs		.											.	NR2C2AP-23	0			c.85_86insA						.																																			SO:0001589	frameshift_variant	126382	exon2			.	AY101377	CCDS32967.1, CCDS74316.1	19p13.11	2008-01-10				ENSG00000184162			30763	protein-coding gene	gene with protein product	"""TR4 orphan receptor associated protein TRA16"""	608719				12486131	Standard	XM_005259740		Approved	TRA16	uc002nlx.3	Q86WQ0		ENST00000331552.7:c.85dupA	19.37:g.19313651_19313651dupT	ENSP00000332823:p.His29fs	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	116	20	NM_176880	0	0	0	0	0	A6NGP7|B4DW92	Frame_Shift_Ins	INS	ENST00000331552.7	37	CCDS32967.1																																																																																			.		0.540	NR2C2AP-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402936.4	NM_176880	
C20orf141	128653	ucsc.edu;bcgsc.ca	37	20	2796280	2796281	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr20:2796280_2796281GC>TT	ENST00000380589.4	+	2	531_532	c.357_358GC>TT	c.(355-360)ctGCaa>ctTTaa	p.Q120*	TMEM239_ENST00000380593.4_Intron|C20orf141_ENST00000603872.1_Nonsense_Mutation_p.Q120*|TMEM239_ENST00000554164.1_Intron|TMEM239_ENST00000380585.1_5'Flank|TMEM239_ENST00000361033.1_5'Flank	NM_080739.2	NP_542777.1	Q9NUB4	CT141_HUMAN	chromosome 20 open reading frame 141	120	Leu-rich.					integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	10						CTCTACTCCTGCAAATGGGTAC	0.629																																					p.Q120*													.	C20orf141-90	0			c.C358T						.																																			SO:0001587	stop_gained	128653	exon2			CTCCTGCAAATGG		CCDS13034.1	20p13	2012-10-30			ENSG00000258713	ENSG00000258713			16134	protein-coding gene	gene with protein product							Standard	NM_001256538		Approved	dJ860F19.4	uc002wgw.3	Q9NUB4	OTTHUMG00000031707	Exception_encountered	20.37:g.2796280_2796281delinsTT	ENSP00000369963:p.Gln120*	Somatic	95	0		WXS	Illumina HiSeq		83	10	NM_080739	0	0	0	0	0		Nonsense_Mutation	DNP	ENST00000380589.4	37	CCDS13034.1																																																																																			.		0.629	C20orf141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077644.2	NM_080739	
NINL	22981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25469911	25469912	+	Nonsense_Mutation	DNP	GC	GC	TA			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr20:25469911_25469912GC>TA	ENST00000278886.6	-	13	1718_1719	c.1645_1646GC>TA	c.(1645-1647)GCa>TAa	p.A549*	NINL_ENST00000422516.1_Nonsense_Mutation_p.A549*	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	549					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CTTCAGGACTGCTGCGAACCGC	0.614																																					p.A549*		.											.	NINL	0			c.G1645T						.																																			SO:0001587	stop_gained	22981	exon13			GGACTGCTGCGAA		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1645_1646delinsTA	20.37:g.25469911_25469912delinsTA	ENSP00000278886:p.Ala549*	Somatic	204.0	1.0		WXS	Illumina HiSeq	Phase_I	165.0	24.0		0	0	0	0	0	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Nonsense_Mutation	DNP	ENST00000278886.6	37	CCDS33452.1																																																																																			.		0.614	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
